Sample records for common large deletion

  1. Deletion mapping of 22q11 in CATCH22 syndrome: Identification of a second critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurahashi, Hiroki; Nakayama, Takahiro; Nishisho, Isamu

    1996-06-01

    The deletion at 22q11.2 implicates a variety of congenital anomaly syndromes, for which the acronym CATCH22 has been proposed . Most patients with these syndromes share the common large deletion spanning 1-2 Mb, while the phenotypic variability of the patients does not seem to correlate with the extent of the deletions. On the basis of the deletions of rare cases with unbalanced translocation, the shortest region of overlap (SRO) had been identified in the most-centromeric region of the common large deletion. One patient (ADU) has been reported to carry a balanced translocation with the breakpoint located in the SRO. Recently,more » three transcripts were identified at or very close to the ADU breakpoint (ADUBP), making them strong candidates for CATCH22 syndrome. Here, we describe one patient with a unique deletion at 22q11.2 revealed by quantitative hybridization and/or FISH with six DNA markers in the common large deletion. The patient was dizygous at loci within the SRO and hemizygous only at the most-telomeric locus in the common large deletion. This finding suggests that there must be another critical region in the common large deletion besides the breakpoint of the ADU and that haploinsufficiency of genes in this deletion may also play a major role in CATCH22 pathogenesis. 15 refs., 3 figs.« less

  2. Identification of novel deletions of 15q11q13 in Angelman syndrome by array-CGH: molecular characterization and genotype-phenotype correlations.

    PubMed

    Sahoo, Trilochan; Bacino, Carlos A; German, Jennifer R; Shaw, Chad A; Bird, Lynne M; Kimonis, Virginia; Anselm, Irinia; Waisbren, Susan; Beaudet, Arthur L; Peters, Sarika U

    2007-09-01

    Angelman syndrome (AS) is a neurodevelopmental disorder characterized by mental retardation, absent speech, ataxia, and a happy disposition. Deletions of the 15q11q13 region are found in approximately 70% of AS patients. The deletions are sub-classified into class I and class II based on their sizes of approximately 6.8 and approximately 6.0, respectively, with two different proximal breakpoints and a common distal breakpoint. Utilizing a chromosome 15-specific comparative genomic hybridization genomic microarray (array-CGH), we have identified, determined the deletion sizes, and mapped the breakpoints in a cohort of 44 cases, to relate those breakpoints to the genomic architecture and derive more precise genotype-phenotype correlations. Interestingly four patients of the 44 studied (9.1%) had novel and unusually large deletions, and are reported here. This is the first report of very large deletions of 15q11q13 resulting in AS; the largest deletion being >10.6 Mb. These novel deletions involve three different distal breakpoints, two of which have been earlier shown to be involved in the generation of isodicentric 15q chromosomes (idic15). Additionally, precise determination of the deletion breakpoints reveals the presence of directly oriented low-copy repeats (LCRs) flanking the recurrent and novel breakpoints. The LCRs are adequate in size, orientation, and homology to enable abnormal recombination events leading to deletions and duplications. This genomic organization provides evidence for a common mechanism for the generation of both common and rare deletion types. Larger deletions result in a loss of several genes outside the common Angelman syndrome-Prader-Willi syndrome (AS-PWS) critical interval, and a more severe phenotype.

  3. A Tunisian patient with Pearson syndrome harboring the 4.977kb common deletion associated to two novel large-scale mitochondrial deletions.

    PubMed

    Ayed, Imen Ben; Chamkha, Imen; Mkaouar-Rebai, Emna; Kammoun, Thouraya; Mezghani, Najla; Chabchoub, Imen; Aloulou, Hajer; Hachicha, Mongia; Fakhfakh, Faiza

    2011-07-29

    Pearson syndrome (PS) is a multisystem disease including refractory anemia, vacuolization of marrow precursors and pancreatic fibrosis. The disease starts during infancy and affects various tissues and organs, and most affected children die before the age of 3years. Pearson syndrome is caused by de novo large-scale deletions or, more rarely, duplications in the mitochondrial genome. In the present report, we described a Pearson syndrome patient harboring multiple mitochondrial deletions which is, in our knowledge, the first case described and studied in Tunisia. In fact, we reported the common 4.977kb deletion and two novel heteroplasmic deletions (5.030 and 5.234kb) of the mtDNA. These deletions affect several protein-coding and tRNAs genes and could strongly lead to defects in mitochondrial polypeptides synthesis, and impair oxidative phosphorylation and energy metabolism in the respiratory chain in the studied patient. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

    PubMed

    Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

    2015-01-01

    Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

  5. Clinical utility of an array comparative genomic hybridization analysis for Williams syndrome.

    PubMed

    Yagihashi, Tatsuhiko; Torii, Chiharu; Takahashi, Reiko; Omori, Mikimasa; Kosaki, Rika; Yoshihashi, Hiroshi; Ihara, Masahiro; Minagawa-Kawai, Yasuyo; Yamamoto, Junichi; Takahashi, Takao; Kosaki, Kenjiro

    2014-11-01

    To reveal the relation between intellectual disability and the deleted intervals in Williams syndrome, we performed an array comparative genomic hybridization analysis and standardized developmental testing for 11 patients diagnosed as having Williams syndrome based on fluorescent in situ hybridization testing. One patient had a large 4.2-Mb deletion spanning distally beyond the common 1.5-Mb intervals observed in 10/11 patients. We formulated a linear equation describing the developmental age of the 10 patients with the common deletion; the developmental age of the patient with the 4.2-Mb deletion was significantly below the expectation (developmental age = 0.51 × chronological age). The large deletion may account for the severe intellectual disability; therefore, the use of array comparative genomic hybridization may provide practical information regarding individuals with Williams syndrome. © 2014 Japanese Teratology Society.

  6. Large Deletions of TSPAN12 Cause Familial Exudative Vitreoretinopathy (FEVR).

    PubMed

    Seo, Soo Hyun; Kim, Man Jin; Park, Sung Wook; Kim, Jeong Hun; Yu, Young Suk; Song, Ji Yun; Cho, Sung Im; Ahn, Joo Hyun; Oh, Yeon Hee; Lee, Jee-Soo; Lee, Seungjun; Seong, Moon-Woo; Park, Sung Sup; Kim, Ji Yeon

    2016-12-01

    Familial exudative vitreoretinopathy (FEVR) is a rare, hereditary visual disorder. The gene TSPAN12 is associated with autosomal dominant inheritance of FEVR. The prevalence and impact of large deletions/duplications of TSPAN12 on FEVR patients is unknown. To glean better insight of TSPAN12 on FEVR pathology, herein, we describe three FEVR patients with TSPAN12 deletions. Thirty-three Korean FEVR patients, who previously screened negative for TSPAN12 mutations, mutations in other FEVR-associated genes such as NDP, FZD4, LRP5, and large deletions and duplications of NDP, FZD4, and LRP5, were selected for TSPAN12 large deletion and duplication analyses. Semiquantitative multiplex PCR for TSPAN12 gene dosage analyses were performed, followed by droplet digital PCR (ddPCR) for validation. Among the 33 patients, three patients were confirmed to carry large TSPAN12 deletions. Two of them had whole-gene deletions of TSPAN12, and the other patient possessed a deletion of TSPAN12 in exon 4. FEVR severity detected in these patients was not more severe than in a patient with TSPAN12 point mutation. Regarding previously reported proportions of FEVR-associated genes contributing to the disorder's autosomal dominant inheritance pattern in Korea, we determined that patients with TSPAN12 large deletions were more common than patients with single nucleotide variants in TSPAN12. Evaluating TSPAN12 large deletions and duplications should be considered in FEVR screening and diagnosis as well as in routine genetic workups for FEVR patients.

  7. Developmental delay and connective tissue disorder in four patients sharing a common microdeletion at 6q13-14.

    PubMed

    Van Esch, Hilde; Rosser, Elisabeth M; Janssens, Sandra; Van Ingelghem, Ingrid; Loeys, Bart; Menten, Bjorn

    2010-10-01

    Interstitial deletions of the long arm of chromosome 6 are rare, and most reported cases represent large, cytogenetically detectable deletions. The implementation of array comparative genome hybridisation in the diagnostic work-up of patients presenting with congenital disorders, including developmental delay, has enabled identification of many patients with smaller chromosomal imbalances. In this report, the cases are presented of four patients with a de novo interstitial deletion of chromosome 6q13-14, resulting in a common microdeletion of 3.7 Mb. All presented with developmental delay, mild dysmorphism and signs of lax connective tissue. Interestingly, the common deleted region harbours 16 genes, of which COL12A1 is a good candidate for the connective tissue pathology.

  8. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    PubMed

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  9. The use of field-inversion gel electrophoresis for deletion detection in Duchenne muscular dystrophy.

    PubMed Central

    Chen, J D; Denton, M J; Morgan, G; Pearn, J H; Mackinlay, A G

    1988-01-01

    Deletion is a common cause of Duchenne muscular dystrophy (DMD). Field-inversion gel electrophoresis, in conjunction with Southern blot hybridization, was used to detect large SfiI DNA fragments in the DMD locus. Two unrelated boys with DMD were found to have abnormal sized DNA fragments resulting from deletions. Some of the female relatives of these patients were also shown by this method to have deletions in the DMD locus. Images Figure 1 PMID:3358426

  10. Molecular analysis of velo-cardio-facial syndrome patients with psychiatric disorders.

    PubMed Central

    Carlson, C; Papolos, D; Pandita, R K; Faedda, G L; Veit, S; Goldberg, R; Shprintzen, R; Kucherlapati, R; Morrow, B

    1997-01-01

    Velo-cardio-facial syndrome (VCFS) is characterized by conotruncal cardiac defects, cleft palate, learning disabilities, and characteristic facial appearance and is associated with hemizygous deletions within 22q11. A newly recognized clinical feature is the presence of psychiatric illness in children and adults with VCFS. To ascertain the relationship between psychiatric illness, VCFS, and chromosome 22 deletions, we evaluated 26 VCFS patients by clinical and molecular biological methods. The VCFS children and adolescents were found to share a set of psychiatric disorders, including bipolar spectrum disorders and attention-deficit disorder with hyperactivity. The adult patients, >18 years of age, were affected with bipolar spectrum disorders. Four of six adult patients had psychotic symptoms manifested as paranoid and grandiose delusions. Loss-of-heterozygosity analysis of all 26 patients revealed that all but 3 had a large 3-Mb common deletion. One patient had a nested distal deletion and two did not have a detectable deletion. Somatic cell hybrids were developed from the two patients who did not have a detectable deletion within 22q11 and were analyzed with a large number of sequence tagged sites. A deletion was not detected among the two patients at a resolution of 21 kb. There was no correlation between the phenotype and the presence of the deletion within 22q11. The remarkably high prevalence of bipolar spectrum disorders, in association with the congenital anomalies of VCFS and its occurrence among nondeleted VCFS patients, suggest a common genetic etiology. Images Figure 4 PMID:9106531

  11. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    PubMed Central

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  12. Update of the GJB2/DFNB1 mutation spectrum in Russia: a founder Ingush mutation del(GJB2-D13S175) is the most frequent among other large deletions

    PubMed Central

    Bliznetz, Elena A; Lalayants, Maria R; Markova, Tatiana G; Balanovsky, Oleg P; Balanovska, Elena V; Skhalyakho, Roza A; Pocheshkhova, Elvira A; Nikitina, Natalya V; Voronin, Sergey V; Kudryashova, Elena K; Glotov, Oleg S; Polyakov, Alexander V

    2017-01-01

    Although mutations in the GJB2 gene sequence make up the majority of variants causing autosomal-recessive non-syndromic hearing loss, few large deletions have been shown to contribute to DFNB1 deafness. Currently, genetic testing for DFNB1 hearing loss includes GJB2 sequencing and DFNB1 deletion analysis for two common large deletions, del(GJB6-D13S1830) and del(GJB6-D13S1854). Here, we report frequency in Russia, clinical significance and evolutionary origins of a 101 kb deletion, del(GJB2-D13S175), recently identified by us. In multiethnic cohort of 1104 unrelated hearing loss patients with biallelic mutations at the DFNB1 locus, the del(GJB2-D13S175) allele frequency of up to 0.5% (11/2208) was determined and this allele was shown to be predominantly associated with profound sensorineural hearing loss. Additionally, eight previously unpublished GJB2 mutations were described in this study. All patients carrying del(GJB2-D13S175) were of the Ingush ancestry. Among normal hearing individuals, del(GJB2-D13S175) was observed in Russian Republic of Ingushetia with a carrier rate of ~1% (2/241). Analysis of haplotypes associated with the deletion revealed a common founder in the Ingushes, with age of the deletion being ~3000 years old. Since del(GJB2-D13S175) was missed by standard methods of GJB2 analysis, del(GJB2-D13S175) detection has been added to our routine testing strategy for DFNB1 hearing loss. PMID:28405014

  13. DMD mutation spectrum analysis in 613 Chinese patients with dystrophinopathy.

    PubMed

    Guo, Ruolan; Zhu, Guosheng; Zhu, Huimin; Ma, Ruiyu; Peng, Ying; Liang, Desheng; Wu, Lingqian

    2015-08-01

    Dystrophinopathy is a group of inherited diseases caused by mutations in the DMD gene. Within the dystrophinopathy spectrum, Duchenne and Becker muscular dystrophies are common X-linked recessive disorders that mainly feature striated muscle necrosis. We combined multiplex ligation-dependent probe amplification with Sanger sequencing to detect large deletions/duplications and point mutations in the DMD gene in 613 Chinese patients. A total of 571 (93.1%) patients were diagnosed, including 428 (69.8%) with large deletions/duplications and 143 (23.3%) with point mutations. Deletion/duplication breakpoints gathered mostly in introns 44-55. Reading frame rules could explain 88.6% of deletion mutations. We identified seventy novel point mutations that had not been previously reported. Spectrum expansion and genotype-phenotype analysis of DMD mutations on such a large sample size in Han Chinese population would provide new insights into the pathogenic mechanism underlying dystrophinopathies.

  14. MDS/AML del(11)(q14) Share Common Morphological Features Despite Different Chromosomal Breakpoints.

    PubMed

    Dambruoso, Irene; Invernizzi, Rosangela; Boni, Marina; Zappatore, Rita; Giardini, Ilaria; Cavigliano, Maria Paola; Rocca, Barbara; Calvello, Celeste; Bastia, Raffaella; Caresana, Marilena; Pasi, Francesca; Nano, Rosanna; Bernasconi, Paolo

    2017-02-01

    In myelodysplatic syndromes and acute myeloid leukemia (MDS/AML) deletion of the 11q14 region is a rare chromosomal defect (incidence: 0.6-1.0%), included within the intermediate risk criteria by the International Prognostic Scoring System. No fluorescence in situ hybridization (FISH) study has yet been performed to identify a common breakpoint region (CBR). In our study through FISH with bacterial artificial chromosomes and commercial probes, we analyzed seven patients with MDS/AML harboring 11q14 deletion on conventional cytogenetic analysis. FISH revealed deletions in five patients and amplifications in two. Three patients with deletion carried a CBR, two had a deletion involving a more centromeric breakpoint. These five patients exhibited multilineage dysplasia, blast cells with large round nuclei, loose chromatin, small and abundant nucleoli, and vacuolated cytoplasm with very thin Auer bodies. In conclusion, the morphological features which occur independently of the extent of the deletion are of multilineage dysplasia in MDS and leukemic blasts strongly reactive to peroxidase in AML; despite the variable size of the deleted area, some patients harbor a CBR. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  15. Deletion of ribosomal protein genes is a common vulnerability in human cancer, especially in concert with TP53 mutations.

    PubMed

    Ajore, Ram; Raiser, David; McConkey, Marie; Jöud, Magnus; Boidol, Bernd; Mar, Brenton; Saksena, Gordon; Weinstock, David M; Armstrong, Scott; Ellis, Steven R; Ebert, Benjamin L; Nilsson, Björn

    2017-04-01

    Heterozygous inactivating mutations in ribosomal protein genes (RPGs) are associated with hematopoietic and developmental abnormalities, activation of p53, and altered risk of cancer in humans and model organisms. Here we performed a large-scale analysis of cancer genome data to examine the frequency and selective pressure of RPG lesions across human cancers. We found that hemizygous RPG deletions are common, occurring in about 43% of 10,744 cancer specimens and cell lines. Consistent with p53-dependent negative selection, such lesions are underrepresented in TP53 -intact tumors ( P  ≪ 10 -10 ), and shRNA-mediated knockdown of RPGs activated p53 in TP53 -wild-type cells. In contrast, we did not see negative selection of RPG deletions in TP53 -mutant tumors. RPGs are conserved with respect to homozygous deletions, and shRNA screening data from 174 cell lines demonstrate that further suppression of hemizygously deleted RPGs inhibits cell growth. Our results establish RPG haploinsufficiency as a strikingly common vulnerability of human cancers that associates with TP53 mutations and could be targetable therapeutically. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  16. Testicular expressed genes are missing in familial X-Linked Kallmann syndrome due to two large different deletions in daughter's X chromosomes.

    PubMed

    Hershkovitz, Eli; Loewenthal, Neta; Peretz, Asaf; Parvari, Ruti

    2008-01-01

    X-linked Kallmann syndrome (KS) is caused mainly by point mutations, in the KAL1 gene. Large deletions >1 Mb are rare events in the human population and commonly result in contiguous gene syndromes. A search for the mutation causing KS carried out on two pairs of first-degree cousins of 2 sisters. Two different apparently independent deletions were found. The deleted sequences encompass the KAL1 gene and four known additional genes exclusively expressed in testis. Two of these genes belong to the FAM9 gene family, which shares some homology with the SCYP3 gene, previously implicated in azoospermia. One of the events causing the deletion may have been mediated by an L1 transposition, the other by a non-homologous end joining. Such non-homologous recombinations have not yet been reported in the KAL genomic region and thus this area may be more prone to deletions than previously expected. This is the first report on genetic characterization of KS with a deletion of solely testis-expressed genes. The absence of these genes may have unfavorable implications for the patients regarding future fertility. (c) 2008 S. Karger AG, Basel

  17. Novel large-range mitochondrial DNA deletions and fatal multisystemic disorder with prominent hepatopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Expanded array of mtDNA deletions. Black-Right-Pointing-Pointer Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. Black-Right-Pointing-Pointer Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. Black-Right-Pointing-Pointer Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount ofmore » mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.« less

  18. A large germline deletion in the Chek2 kinase gene is associated with an increased risk of prostate cancer

    PubMed Central

    Cybulski, C; Wokołorczyk, D; Huzarski, T; Byrski, T; Gronwald, J; Górski, B; Dębniak, T; Masojć, B; Jakubowska, A; Gliniewicz, B; Sikorski, A; Stawicka, M; Godlewski, D; Kwias, Z; Antczak, A; Krajka, K; Lauer, W; Sosnowski, M; Sikorska‐Radek, P; Bar, K; Klijer, R; Zdrojowy, R; Małkiewicz, B; Borkowski, A; Borkowski, T; Szwiec, M; Narod, S A; Lubiński, J

    2006-01-01

    Background Germline mutations in the Chek2 kinase gene (CHEK2) have been associated with a range of cancer types. Recently, a large deletion of exons 9 and 10 of CHEK2 was identified in several unrelated patients with breast cancer of Czech or Slovak origin. The geographical and ethnic extent of this founder allele has not yet been determined. Participants and methods We assayed for the presence of this deletion, and of three other CHEK2 founder mutations, in 1864 patients with prostate cancer and 5496 controls from Poland. Results The deletion was detected in 24 of 5496 (0.4%) controls from the general population, and is the most common CHEK2 truncating founder allele in Polish patients. The deletion was identified in 15 of 1864 (0.8%) men with unselected prostate cancer (OR 1.9; 95% CI 0.97 to 3.5; p = 0.09) and in 4 of 249 men with familial prostate cancer (OR 3.7; 95% CI 1.3 to 10.8; p = 0.03). These ORs were similar to those associated with the other truncating mutations (IVS2+1G→A, 1100delC). Conclusion A large deletion of exons 9 and 10 of CHEK2 confers an increased risk of prostate cancer in Polish men. The del5395 founder deletion might be present in other Slavic populations, including Ukraine, Belarus, Russia, Baltic and Balkan countries. It will be of interest to see to what extent this deletion is responsible for the burden of prostate cancer in other populations. PMID:17085682

  19. Clinical comparison of overlapping deletions of 19p13.3.

    PubMed

    Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

    2013-05-01

    We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

  20. A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

    PubMed

    Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

    2000-01-01

    Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

  1. Deletion 22q13.3 syndrome.

    PubMed

    Phelan, Mary C

    2008-05-27

    The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH) or array comparative genomic hybridization (CGH) is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy). Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements. Individuals with deletion 22q13 should have routine examinations by the primary care physician as well as genetic evaluations with referral to specialists if neurological, gastrointestinal, renal, or other systemic problems are suspected. Affected individuals benefit from early intervention programs, intense occupational and communication therapies, adaptive exercise and sport programs, and other therapies to strengthen their muscles and increase their communication skills. No apparent life-threatening organic abnormalities accompany the diagnosis of deletion 22q13.

  2. Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?

    PubMed

    Ceroni, José Rm; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R

    2018-01-01

    CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5' untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought.

  3. Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?

    PubMed Central

    Ceroni, José RM; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R

    2018-01-01

    Abstract CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5’ untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought. PMID:29473937

  4. Characterization of large rearrangements in autosomal dominant polycystic kidney disease and the PKD1/TSC2 contiguous gene syndrome

    PubMed Central

    Consugar, Mark B.; Wong, Wai C.; Lundquist, Patrick A.; Rossetti, Sandro; Kubly, Vickie J.; Walker, Denise L.; Rangel, Laureano J.; Aspinwall, Richard; Niaudet, W. Patrick; Özen, Seza; David, Albert; Velinov, Milen; Bergstralh, Eric J.; Bae, Kyongtae T.; Chapman, Arlene B.; Guay-Woodford, Lisa M.; Grantham, Jared J.; Torres, Vicente E.; Sampson, Julian R.; Dawson, Brian D.; Harris, Peter C.

    2009-01-01

    Large DNA rearrangements account for about 8% of disease mutations and are more common in duplicated genomic regions, where they are difficult to detect. Autosomal dominant polycystic kidney disease (ADPKD) is caused by mutations in either PKD1 or PKD2. PKD1 is located in an intrachromosomally duplicated region. A tuberous sclerosis gene, TSC2, lies immediately adjacent to PKD1 and large deletions can result in the PKD1/TSC2 contiguous gene deletion syndrome. To rapidly identify large rearrangements, a multiplex ligation-dependent probe amplification assay was developed employing base-pair differences between PKD1 and the six pseudogenes to generate PKD1-specific probes. All changes in a set of 25 previously defined deletions in PKD1, PKD2 and PKD1/TSC2 were detected by this assay and we also found 14 new mutations at these loci. About 4% of the ADPKD patients in the CRISP study were found to have gross rearrangements, and these accounted for about a third of base-pair mutation negative families. Sensitivity of the assay showed that about 40% of PKD1/TSC contiguous gene deletion syndrome families contained mosaic cases. Characterization of a family found to be mosaic for a PKD1 deletion is discussed here to illustrate family risk and donor selection considerations. Our assay improves detection levels and the reliability of molecular testing of patients with ADPKD. PMID:18818683

  5. The Evolution and Functional Impact of Human Deletion Variants Shared with Archaic Hominin Genomes

    PubMed Central

    Lin, Yen-Lung; Pavlidis, Pavlos; Karakoc, Emre; Ajay, Jerry; Gokcumen, Omer

    2015-01-01

    Allele sharing between modern and archaic hominin genomes has been variously interpreted to have originated from ancestral genetic structure or through non-African introgression from archaic hominins. However, evolution of polymorphic human deletions that are shared with archaic hominin genomes has yet to be studied. We identified 427 polymorphic human deletions that are shared with archaic hominin genomes, approximately 87% of which originated before the Human–Neandertal divergence (ancient) and only approximately 9% of which have been introgressed from Neandertals (introgressed). Recurrence, incomplete lineage sorting between human and chimp lineages, and hominid-specific insertions constitute the remaining approximately 4% of allele sharing between humans and archaic hominins. We observed that ancient deletions correspond to more than 13% of all common (>5% allele frequency) deletion variation among modern humans. Our analyses indicate that the genomic landscapes of both ancient and introgressed deletion variants were primarily shaped by purifying selection, eliminating large and exonic variants. We found 17 exonic deletions that are shared with archaic hominin genomes, including those leading to three fusion transcripts. The affected genes are involved in metabolism of external and internal compounds, growth and sperm formation, as well as susceptibility to psoriasis and Crohn’s disease. Our analyses suggest that these “exonic” deletion variants have evolved through different adaptive forces, including balancing and population-specific positive selection. Our findings reveal that genomic structural variants that are shared between humans and archaic hominin genomes are common among modern humans and can influence biomedically and evolutionarily important phenotypes. PMID:25556237

  6. Duchenne Muscular Dystrophy and Becker Muscular Dystrophy Confirmed by Multiplex Ligation-Dependent Probe Amplification: Genotype-Phenotype Correlation in a Large Cohort.

    PubMed

    Vengalil, Seena; Preethish-Kumar, Veeramani; Polavarapu, Kiran; Mahadevappa, Manjunath; Sekar, Deepha; Purushottam, Meera; Thomas, Priya Treesa; Nashi, Saraswathi; Nalini, Atchayaram

    2017-01-01

    Studies of cases of Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) confirmed by multiplex ligation-dependent probe amplification (MLPA) have determined the clinical characteristics, genotype, and relations between the reading frame and phenotype for different countries. This is the first such study from India. A retrospective genotype-phenotype analysis of 317 MLPA-confirmed patients with DMD or BMD who visited the neuromuscular clinic of a quaternary referral center in southern India. The 317 patients comprised 279 cases of DMD (88%), 32 of BMD (10.1%), and 6 of intermediate phenotype (1.9%). Deletions accounted for 91.8% of cases, with duplications causing the remaining 8.2%. There were 254 cases of DMD (91%) with deletions and 25 (9%) due to duplications, and 31 cases (96.8%) of BMD with deletions and 1 (3.2%) due to duplication. All six cases of intermediate type were due to deletions. The most-common mutation was a single-exon deletion. Deletions of six or fewer exons constituted 68.8% of cases. The deletion of exon 50 was the most common. The reading-frame rule held in 90% of DMD and 94% of BMD cases. A tendency toward a lower IQ and earlier wheelchair dependence was observed with distal exon deletions, though a significant correlation was not found. The reading-frame rule held in 90% to 94% of children, which is consistent with reports from other parts of the world. However, testing by MLPA is a limitation, and advanced sequencing methods including analysis of the structure of mutant dystrophin is needed for more-accurate assessments of the genotype-phenotype correlation.

  7. A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

    PubMed Central

    Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

    2000-01-01

    Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

  8. Alu elements mediate large SPG11 gene rearrangements: further spatacsin mutations.

    PubMed

    Conceição Pereira, Maria; Loureiro, José Leal; Pinto-Basto, Jorge; Brandão, Eva; Margarida Lopes, Ana; Neves, Georgina; Dias, Pureza; Geraldes, Ruth; Martins, Isabel Pavão; Cruz, Vitor Tedim; Kamsteeg, Erik-Jan; Brunner, Han G; Coutinho, Paula; Sequeiros, Jorge; Alonso, Isabel

    2012-01-01

    Hereditary spastic paraplegias compose a group of neurodegenerative disorders with a large clinical and genetic heterogeneity. Among the autosomal recessive forms, spastic paraplegia type 11 is the most common. To better understand the spastic paraplegia type 11 mutation spectrum, we studied a group of 54 patients with hereditary spastic paraplegia. Mutation screening was performed by PCR amplification of SPG11 coding regions and intron boundaries, followed by sequencing. For the detection of large gene rearrangements, we performed multiplex ligation-dependent probe amplification. We report 13 families with spastic paraplegia type 11 carrying either novel or previously identified mutations. We describe a complex entire SPG11 rearrangement and show that large gene rearrangements are frequent among patients with spastic paraplegia type 11. Moreover, we mapped the deletion breakpoints of three different large SPG11 deletions and provide evidence for Alu microhomology-mediated exon deletion. Our analysis shows that the high number of repeated elements in SPG11 together with the presence of recombination hotspots and the high intrinsic instability of the 15q locus all contribute toward making this genomic region more prone to large gene rearrangements. These findings enlarge the amount of data relating repeated elements with neurodegenerative disorders and highlight their importance in human disease and genome evolution.

  9. Molecular analysis of mucopolysaccharidosis IVA: Common mutations and racial difference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomatsu, S.; Hori, T.; Nakashima, Y.

    1994-09-01

    Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine -6-sulfate sulfatase (GALNS). Studies on the molecular basis of MPS IVA have been facilitated following cloning of the full-length cDNA and genomic DNA. In this study we detected mutations from 20 Caucasian and 19 Japanese MPS IVA patients using SSCP system and compared mutations of Caucasian origin with those of Japanese origin. The results showed the presence of 16 various mutations (3 small, deletions, 2 nonsense and 11 missense mutations) for Caucasian patients and 15 (1 deletion, 1 large alteration and 13 missense mutations) formore » Japanese. Moreover, two common mutations existed; one is double gene deletion characteristic for Japanese (6 alleles; 15%) and the other is a point mutation (1113F A{yields}T transition) characteristic for Caucasian (9 alleles; 22.5%). And the clear genotype/phenotype relationship among 1342delCA, IVS1(-2), P151S, Q148X, R386C, I113F, Q473X, W220G, P151L, A291T, R90W, and P77R, for a severe type, G96B N204K and V138A for a milder type, was observed. Only R386 mutation was seen in both of the populations. Further, the precise DNA analysis for double gene deletion of a common double gene deletion has been performed by defining the breakpoints and the results showed that one deletion was caused by homologous recombination due to Alu repetitive sequences and the other was due to nonhomologous recombination of short direct repeat. Haplotype analysis for six alleles with double deletion were different, indicating the different origin of this mutation or the frequent recombination events before a mutational event. Thus the mutations in GALNS gene are very heterogeneous and the racial difference is characteristic.« less

  10. A large deletion of PROP1 gene in patients with combined pituitary hormone deficiency from two unrelated Chinese pedigrees.

    PubMed

    Zhang, Huiwen; Wang, Yi; Han, Lianshu; Gu, Xuefan; Shi, Dingping

    2010-01-01

    Familial combined pituitary hormone deficiency (CPHD) appears to have a genetic cause, PROP1 gene mutations being the most common one. We investigated whether PROP1 plays a role in two Chinese familial cases of CPHD. PROP1 gene and adjacent sequences from genomic samples from two unrelated families were amplified to investigate molecular variations and define the extension of a potential deletion. A quantitative real-time polymerase chain reaction was conducted to analyze the copy number of PROP1 gene in the probands' mothers. The relationship of the two distantly located families was further analyzed using microsatellite markers. A segment of about 53.2 kilobases (kb) comprehending PROP1 and another gene encoding a hypothetical protein Q6ZTH3 was deleted in both pedigrees. The mother of one of the probands was hemizygous for this large deletion, which confirmed the assumption that the affected children inherited the deletion allele from their consanguineous parents. The difference of three microsatellites surrounding the absent segment indicated that the two pedigrees were genetically unrelated. We report the largest genomic deletion including PROP1 gene associated with CPHD. Q6ZTH3 is unlikely to exert an indispensable function during embryogenesis or organogenesis. The 7.7-kb segment upstream of the transcription of PROP1 probably harbors a fragile site that favors the occurrence of breakpoints. Copyright (c) 2010 S. Karger AG, Basel.

  11. Recurrent Deletions and Reciprocal Duplications of 10q11.21q11.23 Including CHAT and SLC18A3 are Likely Mediated by Complex Low-Copy Repeats

    PubMed Central

    Stankiewicz, Paweł; Kulkarni, Shashikant; Dharmadhikari, Avinash V.; Sampath, Srirangan; Bhatt, Samarth S.; Shaikh, Tamim H.; Xia, Zhilian; Pursley, Amber N.; Cooper, M. Lance; Shinawi, Marwan; Paciorkowski, Alex R.; Grange, Dorothy K.; Noetzel, Michael J.; Saunders, Scott; Simons, Paul; Summar, Marshall; Lee, Brendan; Scaglia, Fernando; Fellmann, Florence; Martinet, Danielle; Beckmann, Jacques S.; Asamoah, Alexander; Platky, Kathryn; Sparks, Susan; Martin, Ann S.; Madan-Khetarpal, Suneeta; Hoover, Jacqueline; Medne, Livija; Bonnemann, Carsten G.; Moeschler, John B.; Vallee, Stephanie E.; Parikh, Sumit; Irwin, Polly; Dalzell, Victoria P.; Smith, Wendy E.; Banks, Valerie C.; Flannery, David B.; Lovell, Carolyn M.; Bellus, Gary A.; Golden-Grant, Kathryn; Gorski, Jerome L.; Kussmann, Jennifer L.; McGregor, Tracy L.; Hamid, Rizwan; Pfotenhauer, Jean; Ballif, Blake C.; Shaw, Chad A.; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Rosenfeld, Jill A.; Cheung, Sau Wai; Shaffer, Lisa G.

    2013-01-01

    We report 24 unrelated individuals with deletions and 17 additional cases with duplications at 10q11.21q21.1 identified by chromosomal microarray analysis. The rearrangements range in size from 0.3 to 12 Mb. Nineteen of the deletions and eight duplications are flanked by large, directly oriented segmental duplications of >98% sequence identity, suggesting that nonallelic homologous recombination (NAHR) caused these genomic rearrangements. Nine individuals with deletions and five with duplications have additional copy number changes. Detailed clinical evaluation of 20 patients with deletions revealed variable clinical features, with developmental delay (DD) and/or intellectual disability (ID) as the only features common to a majority of individuals. We suggest that some of the other features present in more than one patient with deletion, including hypotonia, sleep apnea, chronic constipation, gastroesophageal and vesicoureteral refluxes, epilepsy, ataxia, dysphagia, nystagmus, and ptosis may result from deletion of the CHAT gene, encoding choline acetyltransferase, and the SLC18A3 gene, mapping in the first intron of CHAT and encoding vesicular acetylcholine transporter. The phenotypic diversity and presence of the deletion in apparently normal carrier parents suggest that subjects carrying 10q11.21q11.23 deletions may exhibit variable phenotypic expressivity and incomplete penetrance influenced by additional genetic and nongenetic modifiers. PMID:21948486

  12. Copy number variation detection in cattle reveals potential breed specific differences

    USDA-ARS?s Scientific Manuscript database

    Copy Number Variations (CNVs) are large, common deletions or duplications of genome sequence among individuals of a species that have been linked to diseases and phenotypic traits. For example, a CNV-generating, translocation mechanism encompassing the KIT gene is responsible for color sidedness in ...

  13. Molecular and clinical characterization of a patient with a chromosome 4p deletion, Wolf-Hirschhorn syndrome, and congenital glaucoma.

    PubMed

    Finzi, S; Pinto, C F; Wiggs, J L

    2001-03-01

    Wolf-Hirschhorn syndrome is a developmental disorder associated with hemizygous deletion of the distal short arm of chromosome 4. We have identified a patient affected with Wolf-Hirschhorn syndrome and early onset glaucoma. Five other patients with Wolf-Hirschhorn syndrome and early onset glaucoma or ocular anomalies associated with early onset glaucoma have been previously described, suggesting that the association with Wolf-Hirschhorn syndrome is not coincidental. The infrequent association of early onset glaucoma suggests that the chromosomal region commonly deleted in Wolf-Hirschhorn patients does not contain genes responsible for early onset glaucoma. In this study, we performed a molecular characterization of the deleted chromosome 4 to determine the extent of the deletion in an attempt to begin to identify the chromosomal region responsible for the associated glaucoma. Using microsatellite repeat markers located on 4p, we determined that the deletion spanned a 60-cM region including the minimal Wolf-Hirschhorn region. The proximal breakpoint occurred between markers D4S3045 and D4S2974. These results support the hypothesis that patients with Wolf-Hirschhorn syndrome and early onset glaucoma may have large deletions of 4p that include a gene(s) that may be responsible for a dominant form of congenital glaucoma.

  14. Mutational analysis of Greek patients with suspected hereditary neuropathy with liability to pressure palsies (HNPP): a 15-year experience.

    PubMed

    Karadima, Georgia; Koutsis, Georgios; Raftopoulou, Maria; Karletidi, Karolina-Maria; Zambelis, Thomas; Karandreas, Nikolaos; Panas, Marios

    2015-06-01

    There has been limited information from population studies regarding the overall frequency of the common 1.5-Mb 17p11.2 deletion and even scarcer data regarding the overall frequency of PMP22 micromutations in patients with a clinical suspicion of hereditary neuropathy with liability to pressure palsies (HNPP). We have analysed 100 consecutive Greek patients referred for HNPP genetic testing over a 15-year period to our Neurogenetics Unit in Athens, a reference centre for all regions of Greece. All patients were screened for the 1.5-Mb deletion and a selected subgroup of deletion-negative patients for PMP22 micromutations. Mutation-positive and mutation-negative patients were compared for various clinical parameters. In total, 54 mutation-positive patients were identified. In index cases, the deletion frequency was 47.8%, and the PMP22 micromutation frequency was 2.2%. Within mutation-positive patients, the common deletion represented 95.7% and PMP22 micromutations 4.3% of cases. Two previously reported PMP22 micromutations (c.364_365delCC and c.79-2A>G) were detected. HNPP index cases had a 2.8-1 male-to-female ratio, similar to mutation-negative patients. A typical phenotype (recurrent or isolated palsies) was present in 82.4% of symptomatic HNPP cases, significantly higher than mutation-negative patients. Sensitivity of proposed electrophysiological diagnostic criteria for HNPP was calculated at 95.7% and specificity at 80.5%. In conclusion, the common HNPP deletion accounts for ∼50% and PMP22 micromutations for ∼2% of cases in a large consecutive cohort of patients with suspected HNPP. The mutational and phenotypic spectrum of HNPP is similar in the Greek population compared with other populations. Proposed electrophysiological diagnostic criteria perform satisfactorily in everyday clinical practice. © 2015 Peripheral Nerve Society.

  15. A Comparison of Missing-Data Procedures for Arima Time-Series Analysis

    ERIC Educational Resources Information Center

    Velicer, Wayne F.; Colby, Suzanne M.

    2005-01-01

    Missing data are a common practical problem for longitudinal designs. Time-series analysis is a longitudinal method that involves a large number of observations on a single unit. Four different missing-data methods (deletion, mean substitution, mean of adjacent observations, and maximum likelihood estimation) were evaluated. Computer-generated…

  16. Selfish Little Circles: Transmission Bias and Evolution of Large Deletion-Bearing Mitochondrial DNA in Caenorhabditis briggsae Nematodes

    PubMed Central

    Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.

    2012-01-01

    Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984

  17. Smad4 loss promotes lung cancer formation but increases sensitivity to DNA topoisomerase inhibitors

    PubMed Central

    Kalra, Sean; Cleaver, Timothy G.; Merrick, Daniel; Wang, Xiao-Jing; Malkoski, Stephen P.

    2015-01-01

    Non-small cell lung cancer (NSCLC) is a common malignancy with a poor prognosis. Despite progress targeting oncogenic drivers, there are no therapies targeting tumor suppressor loss. Smad4 is an established tumor suppressor in pancreatic and colon cancer, however, the consequences of Smad4 loss in lung cancer are largely unknown. We evaluated Smad4 expression in human NSCLC samples and examined Smad4 alterations in large NSCLC datasets and found that reduced Smad4 expression is common in human NSCLC and occurs through a variety of mechanisms including mutation, homozygous deletion, and heterozygous loss. We modeled Smad4 loss in lung cancer by deleting Smad4 in airway epithelial cells and found that Smad4 deletion both initiates and promotes lung tumor development. Interestingly, both Smad4−/− mouse tumors and human NSCLC samples with reduced Smad4 expression demonstrated increased DNA damage while Smad4 knockdown in lung cancer cells reduced DNA repair and increased apoptosis after DNA damage. In addition, Smad4 deficient NSCLC cells demonstrated increased sensitivity to both chemotherapeutics that inhibit DNA topoisomerase and drugs that block double strand DNA break repair by non-homologous end joining. In sum, these studies establish Smad4 as a lung tumor suppressor and suggest that the defective DNA repair phenotype of Smad4 deficient tumors can be exploited by specific therapeutic strategies. PMID:25893305

  18. Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility

    PubMed Central

    Machev, N; Saut, N; Longepied, G; Terriou, P; Navarro, A; Levy, N; Guichaoua, M; Metzler-Guillemai..., C; Collignon, P; Frances, A; Belougne, J; Clemente, E; Chiaroni, J; Chevillard, C; Durand, C; Ducourneau, A; Pech, N; McElreavey, K; Mattei, M; Mitchell, M

    2004-01-01

    Background: Complete deletion of the complete AZFc interval of the Y chromosome is the most common known genetic cause of human male infertility. Two partial AZFc deletions (gr/gr and b1/b3) that remove some copies of all AZFc genes have recently been identified in infertile and fertile populations, and an association study indicates that the resulting gene dose reduction represents a risk factor for spermatogenic failure. Methods: To determine the incidence of various partial AZFc deletions and their effect on fertility, we combined quantitative and qualitative analyses of the AZFc interval at the DAZ and CDY1 loci in 300 infertile men and 399 control men. Results: We detected 34 partial AZFc deletions (32 gr/gr deletions), arising from at least 19 independent deletion events, and found gr/gr deletion in 6% of infertile and 3.5% of control men (p>0.05). Our data provide evidence for two large AZFc inversion polymorphisms, and for relative hot and cold spots of unequal crossing over within the blocks of homology that mediate gr/gr deletion. Using SFVs (sequence family variants), we discriminate DAZ1/2, DAZ3/4, CDY1a (proximal), and CDY1b (distal) and define four types of DAZ-CDY1 gr/gr deletion. Conclusions: The only deletion type to show an association with infertility was DAZ3/4-CDY1a (p = 0.042), suggesting that most gr/gr deletions are neutral variants. We see a stronger association, however, between loss of the CDY1a SFV and infertility (p = 0.002). Thus, loss of this SFV through deletion or gene conversion could be a major risk factor for male infertility. PMID:15520406

  19. Large transcription units unify copy number variants and common fragile sites arising under replication stress.

    PubMed

    Wilson, Thomas E; Arlt, Martin F; Park, So Hae; Rajendran, Sountharia; Paulsen, Michelle; Ljungman, Mats; Glover, Thomas W

    2015-02-01

    Copy number variants (CNVs) resulting from genomic deletions and duplications and common fragile sites (CFSs) seen as breaks on metaphase chromosomes are distinct forms of structural chromosome instability precipitated by replication inhibition. Although they share a common induction mechanism, it is not known how CNVs and CFSs are related or why some genomic loci are much more prone to their occurrence. Here we compare large sets of de novo CNVs and CFSs in several experimental cell systems to each other and to overlapping genomic features. We first show that CNV hotpots and CFSs occurred at the same human loci within a given cultured cell line. Bru-seq nascent RNA sequencing further demonstrated that although genomic regions with low CNV frequencies were enriched in transcribed genes, the CNV hotpots that matched CFSs specifically corresponded to the largest active transcription units in both human and mouse cells. Consistently, active transcription units >1 Mb were robust cell-type-specific predictors of induced CNV hotspots and CFS loci. Unlike most transcribed genes, these very large transcription units replicated late and organized deletion and duplication CNVs into their transcribed and flanking regions, respectively, supporting a role for transcription in replication-dependent lesion formation. These results indicate that active large transcription units drive extreme locus- and cell-type-specific genomic instability under replication stress, resulting in both CNVs and CFSs as different manifestations of perturbed replication dynamics. © 2015 Wilson et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Large transcription units unify copy number variants and common fragile sites arising under replication stress

    PubMed Central

    Park, So Hae; Rajendran, Sountharia; Paulsen, Michelle; Ljungman, Mats; Glover, Thomas W.

    2015-01-01

    Copy number variants (CNVs) resulting from genomic deletions and duplications and common fragile sites (CFSs) seen as breaks on metaphase chromosomes are distinct forms of structural chromosome instability precipitated by replication inhibition. Although they share a common induction mechanism, it is not known how CNVs and CFSs are related or why some genomic loci are much more prone to their occurrence. Here we compare large sets of de novo CNVs and CFSs in several experimental cell systems to each other and to overlapping genomic features. We first show that CNV hotpots and CFSs occurred at the same human loci within a given cultured cell line. Bru-seq nascent RNA sequencing further demonstrated that although genomic regions with low CNV frequencies were enriched in transcribed genes, the CNV hotpots that matched CFSs specifically corresponded to the largest active transcription units in both human and mouse cells. Consistently, active transcription units >1 Mb were robust cell-type-specific predictors of induced CNV hotspots and CFS loci. Unlike most transcribed genes, these very large transcription units replicated late and organized deletion and duplication CNVs into their transcribed and flanking regions, respectively, supporting a role for transcription in replication-dependent lesion formation. These results indicate that active large transcription units drive extreme locus- and cell-type-specific genomic instability under replication stress, resulting in both CNVs and CFSs as different manifestations of perturbed replication dynamics. PMID:25373142

  1. ACE Gene in Egyptian Ischemic Stroke Patients.

    PubMed

    Mostafa, Magdy A; El-Nabiel, Lobna M; Fahmy, Nagia Aly; Aref, Hany; Shreef, Edrees; Abd El-Tawab, Fathy; Abdulghany, Osama M

    2016-09-01

    Angiotensin-1-converting enzyme (ACE) is a crucial player in vascular homeostasis and in the pathogenesis of atherosclerosis and hypertension. The present study was conducted to determine whether there is an association between the ACE insertion/deletion (I/D) polymorphism and ischemic stroke in Egyptian population. Also, we analyzed the ACE gene I/D polymorphism as a risk factor for small-vessel (SV) versus large-vessel (LV) disease. Sixty patients with ischemic stroke were included: 30 with SV disease and 30 with LV disease. In addition, a control group of 30 apparent healthy subjects were studied. Clinical assessment, computed tomography, magnetic resonance imaging brain, and genetic study using the polymerase chain reaction of ACE gene were done for all subjects. We found that the distribution of ACE gene polymorphism frequency was significantly different between the 3 groups. The DD genotype was far more common in stroke patients compared to controls. It was also significantly more common in each of the patient groups compared to controls but rather similar in the 2 patient groups with SV and LV diseases. We found that the ACE gene deletion/deletion genotype is common in Egyptian patients with non-cardioembolic ischemic stroke but does not appear to be specific neither to SV nor to LV disease. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  2. Construction of the physical map of the gpa7 locus reveals that a large segment was deleted during rice domestication.

    PubMed

    Li, Xianran; Tian, Feng; Huang, Haiyan; Tan, Lubin; Zhu, Zuofeng; Hu, Songnian; Sun, Chuanqing

    2008-06-01

    To facilitate cloning gene(s) underlying gpa7, a deep-coverage BAC library was constructed for an isolate of common wild rice (Oryza rufipogon Griff.) collected from Dongxiang, Jiangxi Province, China (DXCWR). gpa7, a quantitative trait locus corresponding to grain number per panicle, is positioned in the short arm of chromosome 7. The BAC library containing 96,768 clones represents approximate 18 haploid genome equivalents. The contig spanning DXCWR gpa7 was constructed with a series of ordered markers. The putative physical map near the gpa7 locus of another accession of O. rufipogon (Accession: IRGC 105491) was also isolated in silico. Analysis of the physical maps of gpa7 indicated that a segment of about 150 kb was deleted during domestication of common wild rice.

  3. Parameters affecting the resilience of scale-free networks to random failures.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Link, Hamilton E.; LaViolette, Randall A.; Lane, Terran

    2005-09-01

    It is commonly believed that scale-free networks are robust to massive numbers of random node deletions. For example, Cohen et al. in (1) study scale-free networks including some which approximate the measured degree distribution of the Internet. Their results suggest that if each node in this network failed independently with probability 0.99, most of the remaining nodes would still be connected in a giant component. In this paper, we show that a large and important subclass of scale-free networks are not robust to massive numbers of random node deletions. In particular, we study scale-free networks which have minimum node degreemore » of 1 and a power-law degree distribution beginning with nodes of degree 1 (power-law networks). We show that, in a power-law network approximating the Internet's reported distribution, when the probability of deletion of each node is 0.5 only about 25% of the surviving nodes in the network remain connected in a giant component, and the giant component does not persist beyond a critical failure rate of 0.9. The new result is partially due to improved analytical accommodation of the large number of degree-0 nodes that result after node deletions. Our results apply to power-law networks with a wide range of power-law exponents, including Internet-like networks. We give both analytical and empirical evidence that such networks are not generally robust to massive random node deletions.« less

  4. Detection of α-thalassemia-1 Southeast Asian and Thai Type Deletions and β-thalassemia 3.5-kb Deletion by Single-tube Multiplex Real-time PCR with SYBR Green1 and High-resolution Melting Analysis

    PubMed Central

    Wiengkum, Thanatcha; Srithep, Sarinee; Chainoi, Isarapong; Singboottra, Panthong; Wongwiwatthananukit, Sanchai

    2011-01-01

    Background Prevention and control of thalassemia requires simple, rapid, and accurate screening tests for carrier couples who are at risk of conceiving fetuses with severe thalassemia. Methods Single-tube multiplex real-time PCR with SYBR Green1 and high-resolution melting (HRM) analysis were used for the identification of α-thalassemia-1 Southeast Asian (SEA) and Thai type deletions and β-thalassemia 3.5-kb gene deletion. The results were compared with those obtained using conventional gap-PCR. DNA samples were derived from 28 normal individuals, 11 individuals with α-thalassemia-1 SEA type deletion, 2 with α-thalassemia-1 Thai type deletion, and 2 with heterozygous β-thalassemia 3.5-kb gene deletion. Results HRM analysis indicated that the amplified fragments from α-thalassemia-1 SEA type deletion, α-thalassemia-1 Thai type deletion, β-thalassemia 3.5-kb gene deletion, and the wild-type β-globin gene had specific peak heights at mean melting temperature (Tm) values of 86.89℃, 85.66℃, 77.24℃, and 74.92℃, respectively. The results obtained using single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis showed 100% consistency with those obtained using conventional gap-PCR. Conclusions Single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis is a potential alternative for routine clinical screening of the common types of α- and β-thalassemia large gene deletions, since it is simple, cost-effective, and highly accurate. PMID:21779184

  5. Deletion of chromosome 21 in a girl with congenital hypothyroidism and mild mental retardation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahlbom, B.E.; Anneren, G.; Sidenvall, R.

    1996-08-23

    We report on a girl with a large interstitial deletion of the long arm of chromosome 21 and with mild mental retardation, congenital hypothyroidism, and hyperopia. The deletion [del(21)(q11.1-q22.1)] extends molecularly from marker D21S215 to D21S213. The distal breakpoint is not clearly defined but is situated between markers D21S213 and IFNAR. This patient has the largest deletion of chromosome 21 known without having severe mental retardation or malformations. The deletion does not involve the {open_quotes}Down syndrome chromosome{close_quotes} region, the region of chromosome 21 which in trisomy causes most of the manifestations of Down syndrome. Apparently, the proximal part of themore » long arm of chromosome 21 does not include genes that are responsible for severe clinical effects in the event of either deletion or duplication, since several reported patients with either trisomy or deletion of this region have mild phenotypic abnormalities. Congenital hypothyroidism is much more common in Down syndrome than in the average population. Thus, the congenital hypothyroidism of the present patient might indicate that there is one or several genes on the proximal part of chromosome 21, which might be of importance for the thyroid function. 24 refs., 4 figs., 2 tabs.« less

  6. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

    1994-09-01

    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

  7. Common regions of deletion in chromosome regions 3p12 and 3p14.2 in primary clear cell renal carcinomas.

    PubMed

    Lubinski, J; Hadaczek, P; Podolski, J; Toloczko, A; Sikorski, A; McCue, P; Druck, T; Huebner, K

    1994-07-15

    Nearly all clear cell renal cell carcinomas (RCCs) exhibit loss of alleles on the short arm of chromosome 3. Loss and mutation at the von Hippel-Lindau (VHL) gene at 3p25 probably occurs in most RCCs and, since the VHL gene was recently cloned, data on VHL involvement in RCCs is accumulating. However, the region 3p14-p12, a region that contains the familial RCC-associated t(3;8)(p14.2;q24) chromosome translocation and the small cell lung carcinoma-associated homozygous deletion at 3p13-12, has also been reported to exhibit allele loss in a large fraction of RCCs. In order to focus future studies on potential suppressor genes in the 3p14-p12 region, we have studied allele loss in 30 RCCs with 9 polymorphic simple sequence repeat markers spanning 3p21.1-p12. Partial losses in the 3p21-p12 region were observed, allowing determination of common regions of loss of heterozygosity overlap in 15 RCCs. Results suggested that most RCCs exhibit loss in a region which brackets the t(3;8) familial chromosome translocation at 3p14.2, and some show additional deletions within the U2020 small cell lung carcinoma deletion at 3p12.

  8. Analysis of chromosome 22q11 copy number variations by multiplex ligation-dependent probe amplification for prenatal diagnosis of congenital heart defect.

    PubMed

    Zhang, Jingjing; Ma, Dingyuan; Wang, Yan; Cao, Li; Wu, Yun; Qiao, Fengchang; Liu, An; Li, Li; Lin, Ying; Liu, Gang; Liu, Cuiyun; Hu, Ping; Xu, Zhengfeng

    2015-01-01

    Congenital heart defects (CHD) represent one of the most common birth defects. This study aimed to evaluate the value of multiplex ligation-dependent probe amplification (MLPA) as a tool to detect the copy number variations (CNVs) of 22q11 in fetuses with CHD. A large cohort of 225 fetuses with CHD was screened by fetal echocardiography. Once common chromosome abnormalities in 30 fetuses were screened out by conventional G-banding analysis, the CNVs of chromosome 22q11 in the remaining 195 fetuses were determined by MLPA for prenatal genetic counseling. In 195 CHD fetuses with normal karyotype, 11 cases had pathological CNVs, including 22q11.2 deletion (seven cases), the deletion of 22q11 cat eye syndrome (CES) region (one case), 22q11.2 duplication (one case), 22q13.3 deletion (one case) and 17p13.3 deletion (one case). In total, our findings from MLPA screening represented 4.9 % in our cohort. Among these, three cases were inherited CNVs, and eight cases were de novo. These CNVs were further verified by single nucleotide polymorphism (SNP)-array analysis, and their chromosomal location was refined. This study indicated that MLPA could serve as an effective test for routine prenatal diagnosis of 22q11 in fetuses with CHD.

  9. Mucopolysaccharidosis type IVA: Common double deletion in the N-Acetylgalactosamine-6-sulfatase gene (GALNS)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hori, Toshinori; Tomatsu, Shunji; Fukuda, Seiji

    1995-04-10

    Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine-6-sulfatase (GALNS). We found two separate deletions of nearly 8.0 and 6.0 kb in the GALNS gene, including some exons. There are Alu repetitive elements near the breakpoints of the 8.0-kb deletion, and this deletion resulted from an Alu-Alu recombination. The other 6.0-kb deletion involved illegitimate recombinational events between incomplete short direct repeats of 8 bp at deletion breakpoints. The same rearrangement has been observed in a heteroallelic state in four unrelated patients. This is the first documentation of a common double deletion a gene thatmore » is not a member of a gene cluster. 39 refs., 5 figs.« less

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Merriwether, D.A.; Huston, S.L.; Bunker, C.A.

    An intergenic region V Mitochondrial DNA (mtDNA) 9 bp deletion located between the genes for tRNA{sup LYS} and cytochrome oxidase II was discovered in a small percentage of Nigerian and Ivory Coast natives. Previously this deletion has been described as Asian-specific and has been reported throughout the New World, Asia, S.E. Asia, and the Pacific Islands at frequencies ranging from 0% to 100%. In the New World and the Pacific Islands, the deletion is almost always accompanied by an Hae III restriction site gain at nt 16517. All 9 occurrences of the deletion observed in Africa (from four different populations)more » co-occur with the Hae III 16517 site gain, indicating that the African deletion probably shares a common origin with the deletion described as {open_quotes}Asian-specific{close_quotes}. The deletion was found in Benin and Sokoto, Nigeria in 2/54 Edo Bini, 1/2 Edo Ishan, 3/99 Hausa, 0/18 Fulani, and 0/16 other Nigerians. The deletion was also detected in 3/115 Ivory Coast natives from Abidjan. A 9 bp insertion (triplication) was observed in 1/115 Ivory Coast natives. The triplicated individual also possessed the Hae III 16517 site gain. The fragment containing the African deletion was sequenced and found to be identical in sequence to the Asian deletion region. D-loop sequence of nts 15975 to 00048 revealed that 2 of the 3 Ivory Coast deleted individuals and 1 of the 6 Nigerians deleted (Hausa) had a T-C transition at nt position 16189 which is common in New World-deleted individuals. These results raise the possibility that the occurrence of this deletion predates the separation of Asian and African populations from a common ancestral populations, or that the deletion has occurred more than once in human evolution. Either explanation requires that caution be exercised when using the 9 bp deletion as a population marker.« less

  11. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  12. Weak D caused by a founder deletion in the RHD gene.

    PubMed

    Fichou, Yann; Chen, Jian-Min; Le Maréchal, Cédric; Jamet, Déborah; Dupont, Isabelle; Chuteau, Claude; Durousseau, Cécile; Loirat, Marie-Jeanne; Bailly, Pascal; Férec, Claude

    2012-11-01

    The RhD blood group system exemplifies a genotype-phenotype correlation by virtue of its highly polymorphic and immunogenic nature. Weak D phenotypes are generally thought to result from missense mutations leading to quantitative change of the D antigen in the red blood cell membrane or intracellularly. Different sets of polymerase chain reaction primers were designed to map and clone a deletion involving RHD Exon 10, which was found in approximately 3% of approximately 2000 RHD hemizygous subjects with D phenotype ambiguity. D antigen density was measured by flow cytometry. Transcript analysis was carried out by 3'-rapid amplification of complementary DNA ends. Haplotype analysis was performed by microsatellite genotyping. A 5405-bp deletion that removed nearly two-thirds of Intron 9 and almost all of Exon 10 of the RHD gene was characterized. It is predicted to result in the replacement of the last eight amino acids of the wild-type RhD protein by another four amino acids. The mean RhD antigen density from two deletion carriers was determined to be only 30. A consensus haplotype could be deduced from the deletion carriers based on the microsatellite genotyping data. The currently reported deletion was derived from a common founder. This deletion appears to represent not only the first large deletion associated with weak D but also the weakest of weak D alleles so far reported. This highly unusual genotype-phenotype relationship may be attributable to the additive effect of three distinct mechanisms that affect mRNA formation, mRNA stability, and RhD/ankyrin-R interaction, respectively. © 2012 American Association of Blood Banks.

  13. Genes commonly deleted in childhood B-cell precursor acute lymphoblastic leukemia: association with cytogenetics and clinical features

    PubMed Central

    Schwab, Claire J.; Chilton, Lucy; Morrison, Heather; Jones, Lisa; Al-Shehhi, Halima; Erhorn, Amy; Russell, Lisa J.; Moorman, Anthony V.; Harrison, Christine J.

    2013-01-01

    In childhood B-cell precursor acute lymphoblastic leukemia, cytogenetics is important in diagnosis and as an indicator of response to therapy, thus playing a key role in risk stratification of patients for treatment. Little is known of the relationship between different cytogenetic subtypes in B-cell precursor acute lymphoblastic leukemia and the recently reported copy number abnormalities affecting significant leukemia associated genes. In a consecutive series of 1427 childhood B-cell precursor acute lymphoblastic leukemia patients, we have determined the incidence and type of copy number abnormalities using multiplex ligation-dependent probe amplification. We have shown strong links between certain deletions and cytogenetic subtypes, including the novel association between RB1 deletions and intrachromosomal amplification of chromosome 21. In this study, we characterized the different copy number abnormalities and show heterogeneity of PAX5 and IKZF1 deletions and the recurrent nature of RB1 deletions. Whole gene losses are often indicative of larger deletions, visible by conventional cytogenetics. An increased number of copy number abnormalities is associated with NCI high risk, specifically deletions of IKZF1 and CDKN2A/B, which occur more frequently among these patients. IKZF1 deletions and rearrangements of CRLF2 among patients with undefined karyotypes may point to the poor risk BCR-ABL1-like group. In conclusion, this study has demonstrated in a large representative cohort of children with B-cell precursor acute lymphoblastic leukemia that the pattern of copy number abnormalities is highly variable according to the primary genetic abnormality. PMID:23508010

  14. Prenatal diagnosis of two fetuses with deletions of 8p23.1, critical region for congenital diaphragmatic hernia and heart defects.

    PubMed

    Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba

    2013-07-01

    Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.

  15. Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

    PubMed Central

    Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

    2010-01-01

    Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

  16. 4p16.3 microdeletions and microduplications detected by chromosomal microarray analysis: New insights into mechanisms and critical regions.

    PubMed

    Bi, Weimin; Cheung, Sau-Wai; Breman, Amy M; Bacino, Carlos A

    2016-10-01

    Deletions in the 4p16.3 region cause Wolf-Hirschhorn syndrome, a well known contiguous microdeletion syndrome with the critical region for common phenotype mapped in WHSCR2. Recently, duplications in 4p16.3 were reported in three patients with developmental delay and dysmorphic features. Through chromosomal microarray analysis, we identified 156 patients with a deletion (n = 109) or duplication (n = 47) in 4p16.3 out of approximately 60,000 patients analyzed by Baylor Miraca Genetics Laboratories. Seventy-five of the postnatally detected deletions encompassed the entire critical region, 32 (43%) of which were associated with other chromosome rearrangements, including six patients (8%) that had a duplication adjacent to the terminal deletion. Our data indicate that Wolf-Hirschhorn syndrome deletions with an adjacent duplication occur at a higher frequency than previously appreciated. Pure deletions (n = 14) or duplications (n = 15) without other copy number changes distal to or inside the WHSCR2 were identified for mapping of critical regions. Our data suggest that deletion of the segment from 0.6 to 0.9 Mb from the terminus of 4p causes a seizure phenotype and duplications of a region distal to the previously defined smallest region of overlap for 4p16.3 microduplication syndrome are associated with neurodevelopmental problems. We detected seven Wolf-Hirschhorn syndrome deletions and one 4p16.3 duplication prenatally; all of the seven are either >8 Mb in size and/or associated with large duplications. In conclusion, our study provides deeper insight into the molecular mechanisms, the critical regions and effective prenatal diagnosis for 4p16.3 deletions/ duplications. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. UGT2B17 gene deletion associated with an increase in bone mineral density similar to the effect of hormone replacement in postmenopausal women.

    PubMed

    Giroux, S; Bussières, J; Bureau, A; Rousseau, F

    2012-03-01

    UGT2B17 is one of the most important enzymes for androgen metabolism. In addition, the UGT2B17 gene is one of the most commonly deleted regions of the human genome. The deletion was previously found associated with higher femoral bone density in men and women, and we replicated this association in a sample of postmenopausal who never used hormone therapy. Deletion of the UGT2B17 gene was previously shown to be associated with a higher hip bone mineral density (BMD). Using a PCR assay, we tried to replicate the association among a large group of 2,379 women. We examined the effect of the deletion on femoral neck BMD and lumbar spine BMD according to the menopausal status and hormone replacement therapy (HRT). We used a high-throughput PCR assay to identify the gene and the deletion in a population of well-characterized women. Two additional polymorphisms, UGT2B28 deletion and UGT2B15 rs1902023 G > T were also investigated. Only UGT2B17 deletion was associated with LS and FN BMD. Furthermore, the association was seen only among postmenopausal women who had never used hormone replacement as in the first reported association. We confirmed the association between UGT2B17 deletion and a higher LS and FN BMD. In addition, we show that the association is observed among postmenopausal women who never used HRT consistent with the enzymatic function of UGT2B17. The analysis shows that those having one or two UGT2B17 alleles benefit from HRT, which is not the case for null carriers.

  18. Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements

    PubMed Central

    Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.

    2008-01-01

    Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679

  19. Small terminal deletions of the long arm of chromosome 2: Two new cases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fisher, A.M.; Ellis, K.H.; Browne, C.E.

    1994-12-01

    We report on 2 girls with small de novo terminal deletions of the long arm of chromosome 2 and breakpoints within q37. Four cases with similar or more extensive deletions have been previously reported in full. Hypotonia and psychomotor retardation were the only manifestations common to all 6 cases. The phenotype associated with small terminal 2q deletions is variable and clearly not always as mild as indicated in previous reports. The abnormality may also be more common than has been assumed. 12 refs., 3 figs., 1 tab.

  20. Identification of a novel AluSx-mediated deletion of exon 3 in the SBDS gene in a patient with Shwachman-Diamond syndrome.

    PubMed

    Costa, Elísio; Duque, Frederico; Oliveira, Jorge; Garcia, Paula; Gonçalves, Isabel; Diogo, Luísa; Santos, Rosário

    2007-01-01

    Shwachman-Diamond syndrome (SDS) is caused by mutations in the SBDS gene, most of which are the result of gene conversion events involving its highly homologous pseudogene SBDSP. Here we describe the molecular characterization of the first documented gross deletion in the SBDS gene, in a 4-year-old Portuguese girl with SDS. The clinical diagnosis was based on the presence of hematological symptoms (severe anemia and cyclic neutropenia), pancreatic exocrine insufficiency and skeletal abnormalities. Routine molecular screening revealed heterozygosity for the common splicing mutation c.258+2T>C, and a further step-wise approach led to the detection of a large deletion encompassing exon 3, the endpoints of which were subsequently delineated at the gDNA level. This novel mutation (c.258+374_459+250del), predictably giving rise to an internally deleted polypeptide (p.Ile87_Gln153del), appears to have arisen from an excision event mediated by AluSx elements which are present in introns 2 and 3. Our case illustrates the importance of including gross deletion screening in the SDS diagnostic setting, especially in cases where only one deleterious mutation is detected by routine screening methods. In particular, deletional rearrangements involving exon 3 should be considered, since Alu sequences are known to be an important cause of recurrent mutations.

  1. Age-related clinical and biological features of PTEN abnormalities in T-cell acute lymphoblastic leukaemia.

    PubMed

    Tesio, M; Trinquand, A; Ballerini, P; Hypolite, G; Lhermitte, L; Petit, A; Ifrah, N; Baruchel, A; Dombret, H; Macintyre, E; Asnafi, V

    2017-12-01

    The tumour suppressor gene PTEN is commonly altered in T-cell acute lymphoblastic leukaemia but its prognostic impact is still debated. We screened a cohort of 573 fully characterised adult and paediatric T-cell acute lymphoblastic leukaemia (T-ALL) patients for genomic PTEN abnormalities. PTEN-inactivating mutations and/or deletions were identified in 91 cases (16%), including 18% of paediatric (49/277) and 14% of adult cases (42/296). Thirty-four patients harboured only mutations, 12 cases demonstrated only large deletions and 9 only microdeletions. About 36 patients had combined alterations. Different mechanisms of PTEN inactivation predicted differences in the clinical outcome for both adult and paediatric patients treated according to the GRAALL03/05 and FRALLE2000 protocols. Whereas large deletions predicted lower 5-year overall survival (P=0.0053 in adults, P=0.001 in children) and disease-free survival (P=0.0009 in adults, P=0.0002 in children), mutations were not associated with a worse prognosis. The prognostic impact of PTEN loss is therefore linked to the underlying type of genomic abnormality, both in adult and paediatric T-ALLs, demonstrating that detailed analysis of the type of abnormality type would be useful to refine risk stratification.

  2. Molecular characterization of a polymorphic 3-Mb deletion at chromosome Yp11.2 containing the AMELY locus in Singapore and Malaysia populations.

    PubMed

    Yong, Rita Y Y; Gan, Linda S H; Chang, Yuet Meng; Yap, Eric P H

    2007-11-01

    Amelogenin paralogs on Chromosome X (AMELX) and Y (AMELY) are commonly used sexing markers. Interstitial deletion of Yp involving the AMELY locus has previously been reported. The combined frequency of the AMELY null allele in Singapore and Malaysia populations is 2.7%, 0.6% in Indian and Malay ethnic groups respectively. It is absent among 541 Chinese screened. The null allele in this study belongs to 3 Y haplogroups; J2e1 (85.7%), F* (9.5%) and D* (4.8%). Low and high-resolution STS mapping, followed by sequence analysis of breakpoint junction confirmed a large deletion of 3 to 3.7-Mb located at the Yp11.2 region. Both breakpoints were located in TSPY repeat arrays, suggesting a non-allelic homologous recombination (NAHR) mechanism of deletion. All regional null samples shared identical breakpoint sequences according to their haplogroup affiliation, providing molecular evidence of a common ancestry origin for each haplogroup, and at least 3 independent deletion events recurred in history. The estimated ages based on Y-SNP and STR analysis were approximately 13.5 +/- 3.1 kyears and approximately 0.9 +/- 0.9 kyears for the J2e1 and F* mutations, respectively. A novel polymorphism G > A at Y-GATA-H4 locus in complete linkage disequilibrium with J2e1 null mutations is a more recent event. This work re-emphasizes the need to include other sexing markers for gender determination in certain regional populations. The frequency difference among global populations suggests it constitutes another structural variation locus of human chromosome Y. The breakpoint sequences provide further information to a better understanding of the NAHR mechanism and DNA rearrangements due to higher order genomic architecture.

  3. Genotype and cardiovascular phenotype correlations with TBX1 in 1,022 velo-cardio- facial/DiGeorge/22q11.2 deletion syndrome patients

    PubMed Central

    Guo, Tingwei; McGinn, Donna McDonald; Blonska, Anna; Shanske, Alan; Bassett, Anne; Chow, Eva; Bowser, Mark; Sheridan, Molly; Beemer, Frits; Devriendt, Koen; Swillen, Ann; Breckpot, Jeroen; Digilio, M. Cristina; Marino, Bruno; Dallapiccola, Bruno; Carpenter, Courtney; Zheng, Xin; Johnson, Jacob; Chung, Jonathan; Higgins, Anne Marie; Philip, Nicole; Simon, Tony J.; Coleman, Karlene; Heine-Suner, Damian; Rosell, Jordi; Kates, Wendy; Devoto, Marcella; Goldmuntz, Elizabeth; Zackai, Elaine; Wang, Tao; Shprintzen, Robert; Emanuel, Beverly; Morrow, Bernice

    2011-01-01

    Haploinsufficiency of TBX1, encoding a T-box transcription factor, is largely responsible for the physical malformations in velo-cardio-facial/DiGeorge/22q11.2 deletion syndrome (22q11DS) patients. Cardiovascular malformations in these patients are highly variable, raising the question as to whether DNA variations in the TBX1 locus on the remaining allele of 22q11.2, could be responsible. To test this, a large sample size is needed. The TBX1 gene was sequenced in 360 consecutive 22q11DS patients. Rare and common variations were identified. We did not detect enrichment in rare SNP number in those with or without a congenital heart defect. One exception was that there was increased number of very rare SNPs between those with normal heart anatomy compared to those with right-sided aortic arch or persistent truncus arteriosus, suggesting potentially protective roles in the SNPs for these phenotype enrichment groups. Nine common SNPs (MAF >0.05) were chosen and used to genotype the entire cohort of 1,022 22q11DS subjects. We did not find a correlation between common SNPs or haplotypes and cardiovascular phenotype. This work demonstrates that common DNA variations in TBX1 do not explain variable cardiovascular expression in 22q11DS patients, implicating existence of modifiers in other genes on 22q11.2 or elsewhere in the genome. PMID:21796729

  4. State of the art and new developments in molecular diagnostics for hemoglobinopathies in multiethnic societies.

    PubMed

    Harteveld, C L

    2014-02-01

    For detecting carriers of thalassemia traits, the basic part of diagnostics consists of measurement of the hematological indices followed by mostly automatic separation and measurement of the Hb fractions, while direct Hb separation either on high pressure liquid chromatography or capillary electrophoresis is sufficient to putatively identify carriers of the common Hb variants like HbS, C, E, D, and O-Arab. A putative positive result is reported together with an advice for parents, partner, or family analysis. For couples, presumed at-risk confirmation at the DNA level is essential. In general, this part of diagnostics is done in specialized centers provided with sufficient experience and the technical tools needed to combine hematological and biochemical interpretation with identification of the mutations at the molecular level. State-of-the-art tools are usually available in centers that also provide prenatal diagnosis and should consist of gap-PCR for the common deletions, direct DNA sequencing for all kind of point-mutations and the capacity to uncover novel or rare mutations or disease mechanisms. New developments are MLPA for large and eventually unknown deletion defects and microarray technology for fine mapping and primer design for breakpoint analysis. Gap-PCR primers designed in the region flanking the deletion breakpoints can subsequently be used to facilitate carrier detection of uncommon deletions in family members or isolated populations in laboratories where no microarray technology or MLPA is available. © 2013 John Wiley & Sons Ltd.

  5. [An updated review of 1p36 deletion (monosomy) syndrome].

    PubMed

    Bello, Sabina; Rodríguez-Moreno, Antonio

    The Monosomy 1p36 deletion syndrome is part of the group of diseases known as Rare Diseases. The objective of the present work is to review the characteristics of Monosomy 1p36 deletion syndrome. The monosomy 1p36 deletion syndrome phenotype includes: dysmorphic craniofacial features; large anterior fontanelle, unibrow, deep-set eyes, epicanthus, wide nasal root/bridge, mandible hypoplasia, abnormal location of the pinna, philtrum and pointed chin; neurological alterations: seizures and hydrocephalus (in some cases). Cerebral malformations: ventricular hypertrophy, increased subarachnoid space, morphological alterations of corpus callosum, cortical atrophy, delays in myelinisation, periventricular leukomalacia and periventricular heterotopia. These alterations produce intellectual disability and delays in motor growth, communication skills, language, social and adaptive behaviour. It is Hearing and vision impairments are also observed in subjects with this syndrome, as well as alterations of cardiac, endocrine and urinary systems and alterations at skin and skeletal level. Approximately 100 cases have been documented since 1981. This rare disease is the most common subtelomeric-micro-deletion syndrome. In situ hybridization with fluorescence (FISH) and array-comparative genomic hybridization (CGH-array) are at present the two best diagnostic techniques. There is currently no effective medical treatment for this disease. Copyright © 2016 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

  6. Molecular characterization of deletion breakpoints in adults with 22q11 deletion syndrome

    PubMed Central

    Stachon, Andrea C.; Squire, Jeremy A.; Moldovan, Laura; Bayani, Jane; Meyn, Stephen; Chow, Eva; Bassett, Anne S.

    2011-01-01

    22q11 Deletion syndrome (22q11DS) is a common microdeletion syndrome with variable expression, including congenital and later onset conditions such as schizophrenia. Most studies indicate that expression does not appear to be related to length of the deletion but there is limited information on the endpoints of even the common deletion breakpoint regions in adults. We used a real-time quantitative PCR (qPCR) approach to fine map 22q11.2 deletions in 44 adults with 22q11DS, 22 with schizophrenia (SZ; 12 M, 10 F; mean age 35.7 SD 8.0 years) and 22 with no history of psychosis (NP; 8 M, 14 F; mean age 27.1 SD 8.6 years). QPCR data were consistent with clinical FISH results using the TUPLE1 or N25 probes. Two subjects (one SZ, one NP) negative for clinical FISH had atypical 22q11.2 deletions confirmed by FISH using the RP11-138C22 probe. Most (n = 34; 18 SZ, 16 NP) subjects shared a common 3 Mb hemizygous 22q11.2 deletion. However, eight subjects showed breakpoint variability: a more telomeric proximal breakpoint (n = 2), or more centromeric (n = 3) or more telomeric distal breakpoint (n = 3). One NP subject had a proximal nested 1.4 Mb deletion. COMT and TBX1 were deleted in all 44 subjects, and PRODH in 40 subjects (19 SZ, 21 NP). The results delineate proximal and distal breakpoint variants in 22q11DS. Neither deletion extent nor PRODH haploinsufficiency appeared to explain the clinical expression of schizophrenia in the present study. Further studies are needed to elucidate the molecular basis of schizophrenia and clinical heterogeneity in 22q11DS. PMID:17028864

  7. Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

    PubMed

    Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

    1996-11-01

    Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and efficient means for determining frequency and progression of oncogenetic events in prostate cancer.

  8. Microdeletion syndromes, balanced translocations, and gene mapping.

    PubMed Central

    Schinzel, A

    1988-01-01

    High resolution prometaphase chromosome banding has allowed the detection of discrete chromosome aberrations which escaped earlier metaphase examinations. Consistent tiny deletions have been detected in some well established malformation syndromes: an interstitial deletion in 15q11/12 in the majority of patients with the Prader-Willi syndrome and in a minority of patients with the Angelman (happy puppet) syndrome; a terminal deletion of 17p13.3 in most patients examined with the Miller-Dieker syndrome; an interstitial deletion of 8q23.3/24.1 in a large majority of patients with the Giedion-Langer syndrome; an interstitial deletion of 11p13 in virtually all patients with the WAGR (Wilms' tumour-aniridia-gonadoblastoma-retardation) syndrome; and an interstitial deletion in 22q11 in about one third of patients with the DiGeorge sequence. In addition, a combination of chromosome prometaphase banding and DNA marker studies has allowed the localisation of the genes for retinoblastoma and for Wilms' tumour and the clarification of both the autosomal recessive nature of the mutation and the possible somatic mutations by which the normal allele can be lost in retina and kidney cells. After a number of X linked genes had been mapped, discrete deletions in the X chromosome were detected by prometaphase banding with specific attention paid to the sites of the gene(s) in males who had from one to up to four different X linked disorders plus mental retardation. Furthermore, the detection of balanced translocations in probands with disorders caused by autosomal dominant or X linked genes has allowed a better insight into the localisation of these genes. In some females with X linked disorders, balanced X; autosomal translocations have allowed the localisation of X linked genes at the breakpoint on the X chromosome. Balanced autosome; autosome translocations segregating with autosomal dominant conditions have provided some clues to the gene location of these conditions. In two conditions, Greig cephalopolysyndactyly and dominant aniridia, two translocation families with one common breakpoint have allowed quite a confident location of the genes at the common breakpoint at 7p13 and 11p13, respectively. PMID:3050093

  9. SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

    PubMed

    Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

    2007-11-01

    Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

  10. PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

    PubMed Central

    Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

    2015-01-01

    The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

  11. Lynch syndrome-associated extracolonic tumors are rare in two extended families with the same EPCAM deletion.

    PubMed

    Lynch, Henry T; Riegert-Johnson, Douglas L; Snyder, Carrie; Lynch, Jane F; Hagenkord, Jill; Boland, C Richard; Rhees, Jennifer; Thibodeau, Stephen N; Boardman, Lisa A; Davies, Janine; Kuiper, Roland P; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J L

    2011-10-01

    The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3' end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution's standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. Both families were found to harbor the same deletion at the 3' end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC.

  12. DeF-GPU: Efficient and effective deletions finding in hepatitis B viral genomic DNA using a GPU architecture.

    PubMed

    Cheng, Chun-Pei; Lan, Kuo-Lun; Liu, Wen-Chun; Chang, Ting-Tsung; Tseng, Vincent S

    2016-12-01

    Hepatitis B viral (HBV) infection is strongly associated with an increased risk of liver diseases like cirrhosis or hepatocellular carcinoma (HCC). Many lines of evidence suggest that deletions occurring in HBV genomic DNA are highly associated with the activity of HBV via the interplay between aberrant viral proteins release and human immune system. Deletions finding on the HBV whole genome sequences is thus a very important issue though there exist underlying the challenges in mining such big and complex biological data. Although some next generation sequencing (NGS) tools are recently designed for identifying structural variations such as insertions or deletions, their validity is generally committed to human sequences study. This design may not be suitable for viruses due to different species. We propose a graphics processing unit (GPU)-based data mining method called DeF-GPU to efficiently and precisely identify HBV deletions from large NGS data, which generally contain millions of reads. To fit the single instruction multiple data instructions, sequencing reads are referred to as multiple data and the deletion finding procedure is referred to as a single instruction. We use Compute Unified Device Architecture (CUDA) to parallelize the procedures, and further validate DeF-GPU on 5 synthetic and 1 real datasets. Our results suggest that DeF-GPU outperforms the existing commonly-used method Pindel and is able to exactly identify the deletions of our ground truth in few seconds. The source code and other related materials are available at https://sourceforge.net/projects/defgpu/. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Small fibre neuropathy in mitochondrial diseases explored with sudoscan.

    PubMed

    Luigetti, Marco; Primiano, Guido; Cuccagna, Cristina; Bernardo, Daniela; Sauchelli, Donato; Vollono, Catello; Servidei, Serenella

    2018-06-01

    Polyneuropathy in mitochondrial diseases (MDs) is relatively common and widely investigated, but few data are instead reported about small fibres involvement. In order to investigate the involvement of small fibres in MDs we performed extensive neurophysiological test (nerve conduction studies; sympathetic skin response; sudoscan) in 27 patients with genetic diagnosis of MD (7 m.3243A > G; 4 m.8344A > G; 9 single mtDNA deletion; 7 multiple mtDNA deletions). NCS showed a polyneuropathy in 11/27 cases (41%). The incidence was very high in POLG1 (100%), m.8344A > G (75%) and m.3243A > G (43%), while only 11% of patients with single deletion had evidence of large fibres involvement. Sympathetic skin response was abnormal only in three patients (one progressive external ophthalmoplegia with single mtDNA deletion; one patient with m.3243A > G mutation; one patient with POLG1 mutation). Sudoscan revealed the presence of an autonomic small fibres dysfunction in 9/27 cases (33%), most of them (7/9) carrying a single mtDNA deletion. Sudoscan data were also confirmed in a sub-group of patients by laser evoked potentials study. Considering only patients with single mtDNA deletion 7/9 (78%) showed abnormal results at sudoscan. Small fibre neuropathy is another feature to investigate in mitochondrial diseases and seems specifically associated with the presence of single mtDNA deletion. The correct identification through specific neurophysiological tests of small fibres involvement in MDs represents another tile in this challenging diagnosis. Copyright © 2018 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

  14. Retrospective assessment of the most common mitochondrial DNA mutations in a large Hungarian cohort of suspect mitochondrial cases.

    PubMed

    Remenyi, Viktoria; Inczedy-Farkas, Gabriella; Komlosi, Katalin; Horvath, Rita; Maasz, Anita; Janicsek, Ingrid; Pentelenyi, Klara; Gal, Aniko; Karcagi, Veronika; Melegh, Bela; Molnar, Maria Judit

    2015-08-01

    Prevalence estimations for mitochondrial disorders still vary widely and only few epidemiologic studies have been carried out so far. With the present work we aim to give a comprehensive overview about frequencies of the most common mitochondrial mutations in Hungarian patients. A total of 1328 patients were tested between 1999 and 2012. Among them, 882 were screened for the m.3243A > G, m.8344A > G, m.8993T > C/G mutations and deletions, 446 for LHON primary mutations. The mutation frequency in our cohort was 2.61% for the m.3243A > G, 1.47% for the m.8344A > G, 17.94% for Leber's Hereditary Optic Neuropathy (m.3460G > A, m.11778G > A, m.14484T > C) and 0.45% for the m.8993T > C/G substitutions. Single mtDNA deletions were detected in 14.97%, while multiple deletions in 6.01% of the cases. The mutation frequency in Hungarian patients suggestive of mitochondrial disease was similar to other Caucasian populations. Further retrospective studies of different populations are needed in order to accurately assess the importance of mitochondrial diseases and manage these patients.

  15. Mitochondrial pathology in inclusion body myositis.

    PubMed

    Lindgren, Ulrika; Roos, Sara; Hedberg Oldfors, Carola; Moslemi, Ali-Reza; Lindberg, Christopher; Oldfors, Anders

    2015-04-01

    Inclusion body myositis (IBM) is usually associated with a large number of cytochrome c oxidase (COX)-deficient muscle fibers and acquired mitochondrial DNA (mtDNA) deletions. We studied the number of COX-deficient fibers and the amount of mtDNA deletions, and if variants in nuclear genes involved in mtDNA maintenance may contribute to the occurrence of mtDNA deletions in IBM muscle. Twenty-six IBM patients were included. COX-deficient fibers were assayed by morphometry and mtDNA deletions by qPCR. POLG was analyzed in all patients by Sanger sequencing and C10orf2 (Twinkle), DNA2, MGME1, OPA1, POLG2, RRM2B, SLC25A4 and TYMP in six patients by next generation sequencing. Patients with many COX-deficient muscle fibers had a significantly higher proportion of mtDNA deletions than patients with few COX-deficient fibers. We found previously unreported variants in POLG and C10orf2 and IBM patients had a significantly higher frequency of an RRM2B variant than controls. POLG variants appeared more common in IBM patients with many COX-deficient fibers, but the difference was not statistically significant. We conclude that COX-deficient fibers in inclusion body myositis are associated with multiple mtDNA deletions. In IBM patients we found novel and also previously reported variants in genes of importance for mtDNA maintenance that warrants further studies. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

    PubMed

    He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

    2014-01-01

    Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

  17. APC promoter 1B deletion in seven American families with familial adenomatous polyposis.

    PubMed

    Snow, A K; Tuohy, T M F; Sargent, N R; Smith, L J; Burt, R W; Neklason, D W

    2015-10-01

    Familial adenomatous polyposis (FAP) is a colorectal cancer predisposition syndrome caused by mutations in the adenomatous polyposis coli (APC) gene. Clinical genetic testing fails to identify disease causing mutations in up to 20% of clinically apparent FAP cases. Following the inclusion of multiplex ligation-dependent probe amplification (MLPA) probes specific for APC promoter 1B, seven probands were identified with a deletion of promoter 1B. Using haplotype analysis spanning the APC locus, the seven families appear to be identical by descent from a common founder. The clinical phenotype of 19 mutation carriers is classical FAP with colectomy at an average age of 24. The majority of cases had a large number of duodenal and gastric polyps. Measurements of allele-specific expression of APC mRNA using TaqMan assay confirmed that relative expression in the allele containing the promoter 1B deletion was reduced 42-98%, depending on tissue type. This study confirms the importance of APC promoter deletions as a cause of FAP and identifies a founder mutation in FAP patients from the United States. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

    PubMed

    Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

    2013-02-01

    To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

  19. Mitochondrial DNA deletion percentage in sun exposed and non sun exposed skin.

    PubMed

    Powers, Julia M; Murphy, Gillian; Ralph, Nikki; O'Gorman, Susan M; Murphy, James E J

    2016-12-01

    The percentages of mitochondrial genomes carrying the mtDNA 3895 and the mtDNA 4977 (common) deletion were quantified in sun exposed and non sun exposed skin biopsies, for five cohorts of patients varying either in sun exposure profile, age or skin cancer status. Non-melanoma skin cancer diagnoses are rising in Ireland and worldwide [12] but most risk prediction is based on subjective visual estimations of sun exposure history. A quantitative objective test for pre-neoplastic markers may result in better adherence to sun protective behaviours. Mitochondrial DNA (mtDNA) is known to be subject to the loss of a significant proportion of specific sections of genetic code due to exposure to ultraviolet light in sunlight. Although one such deletion has been deemed more sensitive, another, called the mtDNA 4977 or common deletion, has proved to be a more useful indicator of possible risk in this study. Quantitative molecular analysis was carried out to determine the percentage of genomes carrying the deletion using non sun exposed and sun exposed skin biopsies in cohorts of patients with high or low sun exposure profiles and two high exposure groups undergoing treatment for NMSC. Results indicate that mtDNA deletions correlate to sun exposure; in groups with high sun exposure habits a significant increase in deletion number in exposed over non sun exposed skin occurred. An increase in deletion percentage was also seen in older cohorts compared to the younger group. The mtDNA 3895 deletion was detected in small amounts in exposed skin of many patients, the mtDNA 4977 common deletion, although present to some extent in non sun exposed skin, is suggested to be the more reliable and easily detected marker. In all cohorts except the younger group with relatively lower sun exposure, the mtDNA 4977 deletion was more frequent in sun exposed skin samples compared to non-sun exposed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. High-molecular-weight glutenin subunit-deficient mutants induced by ion beam and the effects of Glu-1 loci deletion on wheat quality properties.

    PubMed

    Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen

    2016-03-15

    High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.

  1. A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease

    PubMed Central

    Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

    2018-01-01

    Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT, and DLD genes. Among the wide range of disease-causing mutations in BCKDHB, only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient’s unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD. PMID:29740478

  2. A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease.

    PubMed

    Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

    2018-01-01

    Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT , and DLD genes. Among the wide range of disease-causing mutations in BCKDHB , only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient's unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD.

  3. Tumor suppressors BTG1 and IKZF1 cooperate during mouse leukemia development and increase relapse risk in B-cell precursor acute lymphoblastic leukemia patients.

    PubMed

    Scheijen, Blanca; Boer, Judith M; Marke, René; Tijchon, Esther; van Ingen Schenau, Dorette; Waanders, Esmé; van Emst, Liesbeth; van der Meer, Laurens T; Pieters, Rob; Escherich, Gabriele; Horstmann, Martin A; Sonneveld, Edwin; Venn, Nicola; Sutton, Rosemary; Dalla-Pozza, Luciano; Kuiper, Roland P; Hoogerbrugge, Peter M; den Boer, Monique L; van Leeuwen, Frank N

    2017-03-01

    Deletions and mutations affecting lymphoid transcription factor IKZF1 (IKAROS) are associated with an increased relapse risk and poor outcome in B-cell precursor acute lymphoblastic leukemia. However, additional genetic events may either enhance or negate the effects of IKZF1 deletions on prognosis. In a large discovery cohort of 533 childhood B-cell precursor acute lymphoblastic leukemia patients, we observed that single-copy losses of BTG1 were significantly enriched in IKZF1 -deleted B-cell precursor acute lymphoblastic leukemia ( P =0.007). While BTG1 deletions alone had no impact on prognosis, the combined presence of BTG1 and IKZF1 deletions was associated with a significantly lower 5-year event-free survival ( P =0.0003) and a higher 5-year cumulative incidence of relapse ( P =0.005), when compared with IKZF1 -deleted cases without BTG1 aberrations. In contrast, other copy number losses commonly observed in B-cell precursor acute lymphoblastic leukemia, such as CDKN2A/B, PAX5, EBF1 or RB1 , did not affect the outcome of IKZF1 -deleted acute lymphoblastic leukemia patients. To establish whether the combined loss of IKZF1 and BTG1 function cooperate in leukemogenesis, Btg1 -deficient mice were crossed onto an Ikzf1 heterozygous background. We observed that loss of Btg1 increased the tumor incidence of Ikzf1 +/- mice in a dose-dependent manner. Moreover, murine B cells deficient for Btg1 and Ikzf1 +/- displayed increased resistance to glucocorticoids, but not to other chemotherapeutic drugs. Together, our results identify BTG1 as a tumor suppressor in leukemia that, when deleted, strongly enhances the risk of relapse in IKZF1 -deleted B-cell precursor acute lymphoblastic leukemia, and augments the glucocorticoid resistance phenotype mediated by the loss of IKZF1 function. Copyright© Ferrata Storti Foundation.

  4. Novel interstitial deletion of 10q24.3-25.1 associated with multiple congenital anomalies including lobar holoprosencephaly, cleft lip and palate, and hypoplastic kidneys.

    PubMed

    Peltekova, Iskra T; Hurteau-Millar, Julie; Armour, Christine M

    2014-12-01

    Chromosome 10q deletions are rare and phenotypically diverse. Such deletions differ in length and occur in numerous regions on the long arm of chromosome 10, accounting for the wide clinical variability. Commonly reported findings include dysmorphic facial features, microcephaly, developmental delay, and genitourinary abnormalities. Here, we report on a female patient with a novel interstitial 5.54 Mb deletion at 10q24.31-q25.1. This patient had findings in common with a previously reported patient with an overlapping deletion, including renal anomalies and an orofacial cleft, but also demonstrated lobar holoprosencephaly and a Dandy-Walker malformation, features which have not been previously reported with 10q deletions. An analysis of the region deleted in our patient showed numerous genes, such as KAZALD1, PAX2, SEMA4G, ACTRA1, INA, and FGF8, whose putative functions may have played a role in the phenotype seen in our patient. © 2014 Wiley Periodicals, Inc.

  5. Severe laryngeal stenosis in newly born twins with 22q11.2 deletion syndrome: A case report.

    PubMed

    Clive, B; Corsten, G; Penney, L S; Van den Hof, M; El-Naggar, W

    2016-05-18

    Chromosome 22q11.2 deletion syndrome is common and presents with a range of clinical features from cardiac malformations to hypocalcemia. Laryngeal anomalies are not a common feature of this syndrome. We describe newly born twins who presented with unexpected severe birth depression secondary to severe type IV glottic webs requiring extensive resuscitation and emergency tracheostomy. They were diagnosed postnatally to have deletion of 22q11.2. The successful resuscitation of these infants at birth was only possible because they were born in a tertiary care hospital. This report shows the critical nature of prenatal diagnosis of 22q11.2 deletion syndrome.

  6. Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

    PubMed

    Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

    2000-03-01

    Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

  7. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    PubMed

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  8. Lynch Syndrome-Associated Extracolonic Tumors Are Rare in Two Extended Families With the Same EPCAM Deletion

    PubMed Central

    Lynch, Henry T.; Riegert-Johnson, Douglas L.; Snyder, Carrie; Lynch, Jane F.; Hagenkord, Jill; Boland, C. Richard; Rhees, Jennifer; Thibodeau, Stephen N.; Boardman, Lisa A.; Davies, Janine; Kuiper, Roland P.; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J.L.

    2013-01-01

    OBJECTIVES The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3′ end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. METHODS Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution’s standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. RESULTS Both families were found to harbor the same deletion at the 3′ end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. CONCLUSIONS Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC. PMID:21769135

  9. Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

    PubMed

    Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

    2015-01-20

    In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Reviewing Large LAMA2 Deletions and Duplications in Congenital Muscular Dystrophy Patients.

    PubMed

    Oliveira, Jorge; Gonçalves, Ana; Oliveira, Márcia E; Fineza, Isabel; Pavanello, Rita C M; Vainzof, Mariz; Bronze-da-Rocha, Elsa; Santos, Rosário; Sousa, Mário

    2014-01-01

    Congenital muscular dystrophy (CMD) type 1A (MDC1A) is caused by recessive mutations in laminin-α2 (LAMA2) gene. Laminin-211, a heterotrimeric glycoprotein that contains the α2 chain, is crucial for muscle stability establishing a bond between the sarcolemma and the extracellular matrix. More than 215 mutations are listed in the locus specific database (LSDB) for LAMA2 gene (May 2014). A limited number of large deletions/duplications have been reported in LAMA2. Our main objective was the identification of additional large rearrangements in LAMA2 found in CMD patients and a systematic review of cases in the literature and LSDB. In four of the fifty-two patients studied over the last 10 years, only one heterozygous mutation was identified, after sequencing and screening for a frequent LAMA2 deletion. Initial screening of large mutations was performed by multiplex ligation-dependent probe application (MLPA). Further characterization implied several techniques: long-range PCR, cDNA and Southern-blot analysis. Three novel large deletions in LAMA2 and the first pathogenic large duplication were successfully identified, allowing a definitive molecular diagnosis, carrier screening and prenatal diagnosis. A total of fifteen deletions and two duplications previously reported were also reviewed. Two possible mutational "hotspots" for deletions may exist, the first encompassing exons 3 and 4 and second in the 3' region (exons 56 to 65) of LAMA2. Our findings show that this type of mutation is fairly frequent (18.4% of mutated alleles) and is underestimated in the literature. It is important to include the screening of large deletions/duplications as part of the genetic diagnosis strategy.

  11. Accumulation of Mitochondrial DNA Common Deletion Since The Preataxic Stage of Machado-Joseph Disease.

    PubMed

    Raposo, Mafalda; Ramos, Amanda; Santos, Cristina; Kazachkova, Nadiya; Teixeira, Balbina; Bettencourt, Conceição; Lima, Manuela

    2018-04-21

    Molecular alterations reflecting pathophysiologic changes thought to occur many years before the clinical onset of Machado-Joseph disease (MJD)/spinocerebellar ataxia type 3 (SCA3), a late-onset polyglutamine disorder, remain unidentified. The absence of molecular biomarkers hampers clinical trials, which lack sensitive measures of disease progression, preventing the identification of events occurring prior to clinical onset. Our aim was to analyse the mtDNA content and the amount of the common deletion (m.8482_13460del4977) in a cohort of 16 preataxic MJD mutation carriers, 85 MJD patients and 101 apparently healthy age-matched controls. Relative expression levels of RPPH1, MT-ND1 and MT-ND4 genes were assessed by quantitative real-time PCR. The mtDNA content was calculated as the difference between the expression levels of a mitochondrial gene (MT-ND1) and a nuclear gene (RPPH1); the amount of mtDNA common deletion was calculated as the difference between expression levels of a deleted (MT-ND4) and an undeleted (MT-ND1) mitochondrial genes. mtDNA content in MJD carriers was similar to that of healthy age-matched controls, whereas the percentage of the common deletion was significantly increased in MJD subjects, and more pronounced in the preclinical stage (p < 0.05). The BCL2/BAX ratio was decreased in preataxic carriers compared to controls, suggesting that the mitochondrial-mediated apoptotic pathway is altered in MJD. Our findings demonstrate for the first time that accumulation of common deletion starts in the preclinical stage. Such early alterations provide support to the current understanding that any therapeutic intervention in MJD should start before the overt clinical phenotype.

  12. Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

    PubMed

    Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

    2009-09-01

    We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

  13. Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

    PubMed

    Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

    2014-01-01

    Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

  14. Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.

    PubMed

    Cox-Paulson, Elisabeth A; Grana, Theresa M; Harris, Michelle A; Batzli, Janet M

    2012-01-01

    Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms.

  15. Studying Human Disease Genes in Caenorhabditis elegans: A Molecular Genetics Laboratory Project

    PubMed Central

    Cox-Paulson, Elisabeth A.; Grana, Theresa M.; Harris, Michelle A.; Batzli, Janet M.

    2012-01-01

    Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms. PMID:22665589

  16. Large mitochondrial DNA deletion in an infant with addison disease.

    PubMed

    Duran, Gloria P; Martinez-Aguayo, A; Poggi, H; Lagos, M; Gutierrez, D; Harris, P R

    2012-01-01

    Mitochondrial diseases are a group of disorders caused by mutations in nuclear DNA or mitochondrial DNA, usually involving multiple organ systems. Primary adrenal insufficiency due to mitochondrial disease is extremely infrequent and has been reported in association with mitochondrial DNA deletion syndromes such as Kearns-Sayre syndrome. To report a 3-year-old boy with Addison disease, congenital glaucoma, chronic pancreatitis, and mitochondrial myopathy due to large mitochondrial DNA deletion. Molecular analysis of mitochondrial DNA samples obtained from peripheral blood, oral mucosa, and muscle tissue. A novel large mitochondrial DNA deletion of 7,372bp was identified involving almost all genes on the big arch of mtDNA. This case reaffirms the association of adrenal insufficiency and mitochondrial DNA deletions and presents new evidence that glaucoma is another manifestation of mitochondrial diseases. Due to the genetic and clinical heterogeneity of mitochondrial disorders, molecular analysis is crucial to confirm diagnosis and to allow accurate genetic counseling.

  17. Molecular Analysis of Pediatric Oligodendrogliomas Highlights Genetic Differences with Adult Counterparts and Other Pediatric Gliomas.

    PubMed

    Nauen, David; Haley, Lisa; Lin, Ming-Tseh; Perry, Arie; Giannini, Caterina; Burger, Peter C; Rodriguez, Fausto J

    2016-03-01

    Oligodendroglioma represents a distinctive neoplasm in adults but similar neoplasms occur rarely in children. We studied 20 cases of pediatric oligodendroglioma by SNP array (median age 9 years, range 1-19; 15 grade II and 5 grade III). Cytogenetic abnormalities were present in 8 (53%) grade II and all five anaplastic oligodendrogliomas. Most changes were in the form of deletion and copy neutral loss of heterozygosity (LOH). The most common abnormality was 1p deletion (n = 5). Whole arm 1p19q co-deletion was present in three cases from adolescent patients and 9p loss in 3, including one low-grade oligodendroglioma with CDKN2A homozygous deletion. Common losses were largely limited to the anaplastic subset (n = 5) and included 3q29 (n = 3), 11p (n = 3), 17q (n = 3), 4q (n = 2), 6p (n = 2), 13q (n = 2), 14q (n = 2), 17p (n = 2) and whole Ch 18 loss (n = 2). Gains were non-recurrent except for whole Ch 7 (n = 2) and gain on 12q (n = 2) including the MDM2 locus. Possible germ line LOH (or uniparental disomy) was present in seven cases (35%), with one focal abnormality (22q13.1-13.2) in two. BRAF-KIAA1549 fusions and BRAF p.V600E mutations were absent (n = 13 and 8). In summary, cytogenetic alterations in pediatric oligodendrogliomas are characterized mostly by genomic losses, particularly in anaplastic tumors. © 2015 International Society of Neuropathology.

  18. Identification of a Recurrent Microdeletion at 17q23.1q23.2 Flanked by Segmental Duplications Associated with Heart Defects and Limb Abnormalities

    PubMed Central

    Ballif, Blake C.; Theisen, Aaron; Rosenfeld, Jill A.; Traylor, Ryan N.; Gastier-Foster, Julie; Thrush, Devon Lamb; Astbury, Caroline; Bartholomew, Dennis; McBride, Kim L.; Pyatt, Robert E.; Shane, Kate; Smith, Wendy E.; Banks, Valerie; Gallentine, William B.; Brock, Pamela; Rudd, M. Katharine; Adam, Margaret P.; Keene, Julia A.; Phillips, John A.; Pfotenhauer, Jean P.; Gowans, Gordon C.; Stankiewicz, Pawel; Bejjani, Bassem A.; Shaffer, Lisa G.

    2010-01-01

    Segmental duplications, which comprise ∼5%–10% of the human genome, are known to mediate medically relevant deletions, duplications, and inversions through nonallelic homologous recombination (NAHR) and have been suggested to be hot spots in chromosome evolution and human genomic instability. We report seven individuals with microdeletions at 17q23.1q23.2, identified by microarray-based comparative genomic hybridization (aCGH). Six of the seven deletions are ∼2.2 Mb in size and flanked by large segmental duplications of >98% sequence identity and in the same orientation. One of the deletions is ∼2.8 Mb in size and is flanked on the distal side by a segmental duplication, whereas the proximal breakpoint falls between segmental duplications. These characteristics suggest that NAHR mediated six out of seven of these rearrangements. These individuals have common features, including mild to moderate developmental delay (particularly speech delay), microcephaly, postnatal growth retardation, heart defects, and hand, foot, and limb abnormalities. Although all individuals had at least mild dysmorphic facial features, there was no characteristic constellation of features that would elicit clinical suspicion of a specific disorder. The identification of common clinical features suggests that microdeletions at 17q23.1q23.2 constitute a novel syndrome. Furthermore, the inclusion in the minimal deletion region of TBX2 and TBX4, transcription factors belonging to a family of genes implicated in a variety of developmental pathways including those of heart and limb, suggests that these genes may play an important role in the phenotype of this emerging syndrome. PMID:20206336

  19. Analysis of the Functions of Recombination-Related Genes in the Generation of Large Chromosomal Deletions by Loop-Out Recombination in Aspergillus oryzae

    PubMed Central

    Ogawa, Masahiro; Koyama, Yasuji

    2012-01-01

    Loop-out-type recombination is a type of intrachromosomal recombination followed by the excision of a chromosomal region. The detailed mechanism underlying this recombination and the genes involved in loop-out recombination remain unknown. In the present study, we investigated the functions of ku70, ligD, rad52, rad54, and rdh54 in the construction of large chromosomal deletions via loop-out recombination and the effect of the position of the targeted chromosomal region on the efficiency of loop-out recombination in Aspergillus oryzae. The efficiency of generation of large chromosomal deletions in the near-telomeric region of chromosome 3, including the aflatoxin gene cluster, was compared with that in the near-centromeric region of chromosome 8, including the tannase gene. In the Δku70 and Δku70-rdh54 strains, only precise loop-out recombination occurred in the near-telomeric region. In contrast, in the ΔligD, Δku70-rad52, and Δku70-rad54 strains, unintended chromosomal deletions by illegitimate loop-out recombination occurred in the near-telomeric region. In addition, large chromosomal deletions via loop-out recombination were efficiently achieved in the near-telomeric region, but barely achieved in the near-centromeric region, in the Δku70 strain. Induction of DNA double-strand breaks by I-SceI endonuclease facilitated large chromosomal deletions in the near-centromeric region. These results indicate that ligD, rad52, and rad54 play a role in the generation of large chromosomal deletions via precise loop-out-type recombination in the near-telomeric region and that loop-out recombination between distant sites is restricted in the near-centromeric region by chromosomal structure. PMID:22286092

  20. Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

    PubMed

    Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

    2015-11-12

    Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

  1. Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

    PubMed

    Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

    2004-01-01

    Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

  2. Rapid detection of α-thalassaemia variants using droplet digital PCR.

    PubMed

    Lee, T-Y; Lai, M-I; Ramachandran, V; Tan, J A M A; Teh, L-K; Othman, R; Hussein, N H; George, E

    2016-08-01

    Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately. The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR). This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously. In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia. © 2016 John Wiley & Sons Ltd.

  3. Early onset intellectual disability in chromosome 22q11.2 deletion syndrome.

    PubMed

    Cascella, Marco; Muzio, Maria Rosaria

    2015-01-01

    Chromosome 22q11.2 deletion syndrome, or DiGeorge syndrome, or velocardiofacial syndrome, is one of the most common multiple anomaly syndromes in humans. This syndrome is commonly caused by a microdelection from chromosome 22 at band q11.2. Although this genetic disorder may reflect several clinical abnormalities and different degrees of organ commitment, the clinical features that have driven the greatest amount of attention are behavioral and developmental features, because individuals with 22q11.2 deletion syndrome have a 30-fold risk of developing schizophrenia. There are differing opinions about the cognitive development, and commonly a cognitive decline rather than an early onset intellectual disability has been observed. We report a case of 22q11.2 deletion syndrome with both early assessment of mild intellectual disabilities and tetralogy of Fallot as the only physic manifestation. Copyright © 2015 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  5. A large deletion in the succinate dehydrogenase B gene (SDHB) in a Japanese patient with abdominal paraganglioma and concomitant metastasis.

    PubMed

    Kodama, Hitomi; Iihara, Masatoshi; Nissato, Sumiko; Isobe, Kazumasa; Kawakami, Yasushi; Okamoto, Takahiro; Takekoshi, Kazuhiro

    2010-01-01

    Recently, mutations in nuclear genes encoding two mitochondrial complex II subunit proteins, Succinate dehydrogenase D (SDHD) and SDHB, have been found to be associated with the development of familial pheochromocytomas and paragangliomas (hereditary pheochromocytoma/paraganglioma syndrome: HPPS). Growing evidence suggests that the mutation of SDHB is highly associated with abdominal paraganglioma and the following distant metastasis (malignant paraganglioma). In the present study, we used multiplex ligation dependent probe amplification (MLPA) analysis to identify a large heterozygous SDHB gene deletion encompassing sequences corresponding to the promoter region, in addition to exon 1 and exon 2 malignant paraganglioma patient in whom previously characterized SDHB mutations were undetectable. This is the first Japanese case report of malignant paraganglioma, with a large SDHB deletions. Our present findings strongly support the notion that large deletions in the SDHB gene should be considered in patients lacking characterized SDHB mutations.

  6. Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9

    PubMed Central

    Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu

    2015-01-01

    ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037

  7. Recurrent Distal 7q11.23 Deletion Including HIP1 and YWHAG Identified in Patients with Intellectual Disabilities, Epilepsy, and Neurobehavioral Problems

    PubMed Central

    Ramocki, Melissa B.; Bartnik, Magdalena; Szafranski, Przemyslaw; Kołodziejska, Katarzyna E.; Xia, Zhilian; Bravo, Jaclyn; Miller, G. Steve; Rodriguez, Diana L.; Williams, Charles A.; Bader, Patricia I.; Szczepanik, Elżbieta; Mazurczak, Tomasz; Antczak-Marach, Dorota; Coldwell, James G.; Akman, Cigdem I.; McAlmon, Karen; Cohen, Melinda P.; McGrath, James; Roeder, Elizabeth; Mueller, Jennifer; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Bocian, Ewa; Shaw, Chad A.; Cheung, Sau Wai; Mazurczak, Tadeusz; Stankiewicz, Paweł

    2010-01-01

    We report 26 individuals from ten unrelated families who exhibit variable expression and/or incomplete penetrance of epilepsy, learning difficulties, intellectual disabilities, and/or neurobehavioral abnormalities as a result of a heterozygous microdeletion distally adjacent to the Williams-Beuren syndrome region on chromosome 7q11.23. In six families with a common recurrent ∼1.2 Mb deletion that includes the Huntingtin-interacting protein 1 (HIP1) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (YWHAG) genes and that is flanked by large complex low-copy repeats, we identified sites for nonallelic homologous recombination in two patients. There were no cases of this ∼1.2 Mb distal 7q11.23 deletion copy number variant identified in over 20,000 control samples surveyed. Three individuals with smaller, nonrecurrent deletions (∼180–500 kb) that include HIP1 but not YWHAG suggest that deletion of HIP1 is sufficient to cause neurological disease. Mice with targeted mutation in the Hip1 gene (Hip1−/−) develop a neurological phenotype characterized by failure to thrive, tremor, and gait ataxia. Overall, our data characterize a neurodevelopmental and epilepsy syndrome that is likely caused by recurrent and nonrecurrent deletions, including HIP1. These data do not exclude the possibility that YWHAG loss of function is also sufficient to cause neurological phenotypes. Based on the current knowledge of Hip1 protein function and its proposed role in AMPA and NMDA ionotropic glutamate receptor trafficking, we believe that HIP1 haploinsufficiency in humans will be amenable to rational drug design for improved seizure control and cognitive and behavioral function. PMID:21109226

  8. Recurrent distal 7q11.23 deletion including HIP1 and YWHAG identified in patients with intellectual disabilities, epilepsy, and neurobehavioral problems.

    PubMed

    Ramocki, Melissa B; Bartnik, Magdalena; Szafranski, Przemyslaw; Kołodziejska, Katarzyna E; Xia, Zhilian; Bravo, Jaclyn; Miller, G Steve; Rodriguez, Diana L; Williams, Charles A; Bader, Patricia I; Szczepanik, Elżbieta; Mazurczak, Tomasz; Antczak-Marach, Dorota; Coldwell, James G; Akman, Cigdem I; McAlmon, Karen; Cohen, Melinda P; McGrath, James; Roeder, Elizabeth; Mueller, Jennifer; Kang, Sung-Hae L; Bacino, Carlos A; Patel, Ankita; Bocian, Ewa; Shaw, Chad A; Cheung, Sau Wai; Mazurczak, Tadeusz; Stankiewicz, Paweł

    2010-12-10

    We report 26 individuals from ten unrelated families who exhibit variable expression and/or incomplete penetrance of epilepsy, learning difficulties, intellectual disabilities, and/or neurobehavioral abnormalities as a result of a heterozygous microdeletion distally adjacent to the Williams-Beuren syndrome region on chromosome 7q11.23. In six families with a common recurrent ∼1.2 Mb deletion that includes the Huntingtin-interacting protein 1 (HIP1) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (YWHAG) genes and that is flanked by large complex low-copy repeats, we identified sites for nonallelic homologous recombination in two patients. There were no cases of this ∼1.2 Mb distal 7q11.23 deletion copy number variant identified in over 20,000 control samples surveyed. Three individuals with smaller, nonrecurrent deletions (∼180-500 kb) that include HIP1 but not YWHAG suggest that deletion of HIP1 is sufficient to cause neurological disease. Mice with targeted mutation in the Hip1 gene (Hip1⁻(/)⁻) develop a neurological phenotype characterized by failure to thrive, tremor, and gait ataxia. Overall, our data characterize a neurodevelopmental and epilepsy syndrome that is likely caused by recurrent and nonrecurrent deletions, including HIP1. These data do not exclude the possibility that YWHAG loss of function is also sufficient to cause neurological phenotypes. Based on the current knowledge of Hip1 protein function and its proposed role in AMPA and NMDA ionotropic glutamate receptor trafficking, we believe that HIP1 haploinsufficiency in humans will be amenable to rational drug design for improved seizure control and cognitive and behavioral function. Copyright © 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. [Grave's disease in children with 22q11 deletion. Report of three cases].

    PubMed

    Gosselin, J; Lebon-Labich, B; Lucron, H; Marçon, F; Leheup, B

    2004-12-01

    Hypothyroidism is a well recognized complication of 22q11.2 deletion syndrome. Auto-immune hyperthyroidism is less common. We report three patients with a 22q11.2 deletion and Graves' disease diagnosed at age 17, 14 and 11 years, respectively. The clinical and biological presentation was typical for auto-immune hyperthyroidism. Graves' disease should be periodically sought during the follow-up program of patients with 22q11.2 deletion syndrome.

  10. Cell-autonomous correction of ring chromosomes in human induced pluripotent stem cells

    NASA Astrophysics Data System (ADS)

    Bershteyn, Marina; Hayashi, Yohei; Desachy, Guillaume; Hsiao, Edward C.; Sami, Salma; Tsang, Kathryn M.; Weiss, Lauren A.; Kriegstein, Arnold R.; Yamanaka, Shinya; Wynshaw-Boris, Anthony

    2014-03-01

    Ring chromosomes are structural aberrations commonly associated with birth defects, mental disabilities and growth retardation. Rings form after fusion of the long and short arms of a chromosome, and are sometimes associated with large terminal deletions. Owing to the severity of these large aberrations that can affect multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have been proposed. During cell division, ring chromosomes can exhibit unstable behaviour leading to continuous production of aneuploid progeny with low viability and high cellular death rate. The overall consequences of this chromosomal instability have been largely unexplored in experimental model systems. Here we generated human induced pluripotent stem cells (iPSCs) from patient fibroblasts containing ring chromosomes with large deletions and found that reprogrammed cells lost the abnormal chromosome and duplicated the wild-type homologue through the compensatory uniparental disomy (UPD) mechanism. The karyotypically normal iPSCs with isodisomy for the corrected chromosome outgrew co-existing aneuploid populations, enabling rapid and efficient isolation of patient-derived iPSCs devoid of the original chromosomal aberration. Our results suggest a fundamentally different function for cellular reprogramming as a means of `chromosome therapy' to reverse combined loss-of-function across many genes in cells with large-scale aberrations involving ring structures. In addition, our work provides an experimentally tractable human cellular system for studying mechanisms of chromosomal number control, which is of critical relevance to human development and disease.

  11. Large copy-number variations in patients with statin-associated myopathy affecting statin myopathy-related loci.

    PubMed

    Stránecký, V; Neřoldová, M; Hodaňová, K; Hartmannová, H; Piherová, L; Zemánková, P; Přistoupilová, A; Vrablík, M; Adámková, V; Kmoch, S; Jirsa, M

    2016-12-13

    Some patients are susceptible to statin-associated myopathy (SAM) either because of genetic variations affecting statin uptake and metabolism, or because they predispose their carriers to muscular diseases. Among the frequent variants examined using the genome-wide association study approach, SLCO1B1 c.521T>C represents the only validated predictor of SAM in patients treated with high-dose simvastatin. Our aim was to ascertain the overall contribution of large copy-number variations (CNVs) to SAM diagnosed in 86 patients. CNVs were detected by whole genome genotyping using Illumina HumanOmni2.5 Exome BeadChips. Exome sequence data were used for validation of CNVs in SAM-related loci. In addition, we performed a specific search for CNVs in the SLCO1B region detected recently in Rotor syndrome subjects. Rare deletions possibly contributing to genetic predisposition to SAM were found in two patients: one removed EYS associated previously with SAM, the other was present in LARGE associated with congenital muscular dystrophy. Another two patients carried deletions in CYP2C19, which may predispose to clopidogrel-statin interactions. We found no common large CNVs potentially associated with SAM and no CNVs in the SLCO1B locus. Our findings suggest that large CNVs do not play a substantial role in the etiology of SAM.

  12. Novel deletion of the E3A ubiquitin protein ligase gene detected by multiplex ligation-dependent probe amplification in a patient with Angelman syndrome

    PubMed Central

    Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio

    2010-01-01

    Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004

  13. SANDO syndrome in a cohort of 107 patients with CPEO and mitochondrial DNA deletions.

    PubMed

    Hanisch, Frank; Kornhuber, Malte; Alston, Charlotte L; Taylor, Robert W; Deschauer, Marcus; Zierz, Stephan

    2015-06-01

    The sensory ataxic neuropathy with dysarthria and ophthalmoparesis (SANDO) syndrome is a subgroup of mitochondrial chronic progressive external ophthalmoplegia (CPEO)-plus disorders associated with multiple mitochondrial DNA (mtDNA) deletions. There is no systematic survey on SANDO in patients with CPEO with either single or multiple large-scale mtDNA deletions. In this retrospective analysis, we characterised the frequency, the genetic and clinical phenotype of 107 index patients with mitochondrial CPEO (n=66 patients with single and n=41 patients with multiple mtDNA deletions) and assessed these for clinical evidence of a SANDO phenotype. Patients with multiple mtDNA deletions were additionally screened for mutations in the nuclear-encoded POLG, SLC25A4, PEO1 and RRM2B genes. The clinical, histological and genetic data of 11 patients with SANDO were further analysed. None of the 66 patients with single, large-scale mtDNA deletions fulfilled the clinical criteria of SANDO syndrome. In contrast, 9 of 41 patients (22%) with multiple mtDNA deletions and two additional family members fulfilled the clinical criteria for SANDO. Within this subgroup, multiple mtDNA deletions were associated with the following nuclear mutations: POLG (n=6), PEO1 (n=2), unidentified (n=2). The combination of sensory ataxic neuropathy with ophthalmoparesis (SANO) was observed in 70% of patients with multiple mtDNA deletions but only in 4% with single deletions. The combination of CPEO and sensory ataxic neuropathy (SANO, incomplete SANDO) was found in 43% of patients with multiple mtDNA deletions but not in patients with single deletions. The SANDO syndrome seems to indicate a cluster of symptoms within the wide range of multisystemic symptoms associated with mitochondrial CPEO. SANO seems to be the most frequent phenotype associated with multiple mtDNA deletions in our cohort but not or is rarely associated with single, large-scale mtDNA deletions. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Difference of clinical phenotypes and immunological features of 22q11.2 deletion syndrome in north-eastern Thai children compare to western countries.

    PubMed

    Wichajam, Khunton; Kampan, Jureeporn

    2014-10-01

    22q11.2 deletion syndrome is a common microdeletion syndrome that affected various systems. To determine clinical phenotypes and immunologicalfeatures of 22q11.2 deletion syndrome in north-eastern Thai children compare to western countries. The authors described the clinical and immunological features in 20 north-eastern Thai children with 22q11.2 deletion syndrome that were followed-up at Srinagarind Hospital. Clinical phenotypes were facial dysmorphism (100%), congenital heart disease (80%) and cleft palate (30%). Prevalence of tetralogy of Fallot (TOF) in this syndrome was higher than in western. Serious infections were found including pneumonia, septicemia and brain abscess. Only a patient had panhypogammaglobulinemia and subsequently died. Selective IgA deficiency was not found. There was a twin patient conceivedfrom intracytoplasmic sperm injection (ICSI). TOF is more common in Asian patients than in western which different to selective IgA deficiency. The 22q11.2 deletion syndrome could be consequence from ICSI.

  15. Construction of a psb C deletion strain in Synechocystis 6803.

    PubMed

    Goldfarb, N; Knoepfle, N; Putnam-Evans, C

    1997-01-01

    Synechocystis 6803 is a cyanobacterium that carries out-oxygenic photosynthesis. We are interested in the introduction of mutations in the large extrinsic loop region of the CP43 protein of Photosystem II (PSII). CP43 appears to be required for the stable assembly of the PSII complex and also appears to play a role in photosynthetic oxygen evolution. Deletion of short segments of the large extrinsic loop results in mutants incapable of evolving oxygen. Alterations in psbC, the gene encoding CP43, are introduced into Synechocystis 6803 by transformation and homologous recombination. Specifically, plasmid constructs bearing the site-directed mutations are introduced into a deletion strain where the portion of the gene encoding the area of mutation has been deleted and replaced by a gene conferring antibiotic resistance. We have constructed a deletion strain of Synechocystis appropriate for the introduction of mutations in the large extrinsic loop of CP43 and have used it successfully to produce site-directed mutants.

  16. A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

    PubMed

    Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

    2015-11-01

    Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

  17. Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

    PubMed Central

    Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

    1995-01-01

    Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

  18. Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morrow, B.; Carlson, C.; Gupta, R.D.

    Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

  19. Genetics Home Reference: 17q12 deletion syndrome

    MedlinePlus

    ... spectrum disorder (which affects social interaction and communication), schizophrenia , anxiety, and bipolar disorder . Less commonly, 17q12 deletion ... Encyclopedia: Autism Spectrum Disorder Encyclopedia: Bipolar Disorder Encyclopedia: ... Topic: Developmental Disabilities Health Topic: Diabetes Health ...

  20. Detailed clinical and molecular study of 20 females with Xq deletions with special reference to menstruation and fertility.

    PubMed

    Mercer, Catherine L; Lachlan, Katherine; Karcanias, Alexandra; Affara, Nabeel; Huang, Shuwen; Jacobs, Patricia A; Thomas, N Simon

    2013-01-01

    Integrity of the long arm of the X chromosome is important for maintaining female fertility and several critical regions for normal ovarian function have been proposed. In order to understand further the importance of specific areas of the X chromosome, we describe a series of 20 previously unreported patients missing part of Xq in whom detailed phenotypic information has been gathered as well as precise chromosome mapping using array Comparative Genomic Hybridization. Features often associated with Turner syndrome were not common in our study and excluding puberty, menarche and menstruation, the phenotypes observed were present in only a minority of women and were not specific to the X chromosome. The most frequently occurring phenotypic features in our patients were abnormalities of menstruation and fertility. Larger terminal deletions were associated with a higher incidence of primary ovarian failure, occurring at a younger age; however patients with similar or even identical deletions had discordant menstrual phenotypes, making accurate genetic counselling difficult. Nevertheless, large deletions are likely to be associated with complete skewing of X inactivation so that the resulting phenotypes are relatively benign given the amount of genetic material missing, even in cases with unbalanced X;autosome translocations. Some degree of ovarian dysfunction is highly likely, especially for terminal deletions extending proximal to Xq27. In conjunction with patient data from the literature, our study suggests that loss of Xq26-Xq28 has the most significant effect on ovarian function. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  1. A Deletion Variant of the α2b-Adrenoceptor Modulates the Stress-Induced Shift from "Cognitive" to "Habit" Memory.

    PubMed

    Wirz, Lisa; Wacker, Jan; Felten, Andrea; Reuter, Martin; Schwabe, Lars

    2017-02-22

    Stress induces a shift from hippocampus-based "cognitive" toward dorsal striatum-based "habitual" learning and memory. This shift is thought to have important implications for stress-related psychopathologies, including post-traumatic stress disorder (PTSD). However, there is large individual variability in the stress-induced bias toward habit memory, and the factors underlying this variability are completely unknown. Here we hypothesized that a functional deletion variant of the gene encoding the α2b-adrenoceptor ( ADRA2B ), which has been linked to emotional memory processes and increased PTSD risk, modulates the stress-induced shift from cognitive toward habit memory. In two independent experimental studies, healthy humans were genotyped for the ADRA2B deletion variant. After a stress or control manipulation, participants completed a dual-solution learning task while electroencephalographic (Study I) or fMRI measurements (Study II) were taken. Carriers compared with noncarriers of the ADRA2B deletion variant exhibited a significantly reduced bias toward habit memory after stress. fMRI results indicated that, whereas noncarriers of the ADRA2B deletion variant showed increased functional connectivity between amygdala and putamen after stress, this increase in connectivity was absent in carriers of the deletion variant, who instead showed overall enhanced connectivity between amygdala and entorhinal cortex. Our results indicate that a common genetic variation of the noradrenergic system modulates the impact of stress on the balance between cognitive and habitual memory systems, most likely via altered amygdala orchestration of these systems. SIGNIFICANCE STATEMENT Stressful events have a powerful effect on human learning and memory. Specifically, accumulating evidence suggests that stress favors more rigid dorsal striatum-dependent habit memory, at the expense of flexible hippocampus-dependent cognitive memory. Although this shift may have important implications for understanding mental disorders, such as post-traumatic stress disorder, little is known about the source of individual differences in the sensitivity for the stress-induced bias toward habit memory. We report here that a common genetic variation of the noradrenergic system, a known risk factor for post-traumatic stress disorder, modulates the stress-induced shift from cognitive to habit memory, most likely through altered crosstalk between the hippocampus and dorsal striatum with the amygdala, a key structure in emotional memory. Copyright © 2017 the authors 0270-6474/17/372149-12$15.00/0.

  2. Microdeletion of 19p13.3 in a girl with Peutz-Jeghers syndrome, intellectual disability, hypotonia, and distinctive features.

    PubMed

    Kuroda, Yukiko; Saito, Toshiyuki; Nagai, Jun-Ichi; Ida, Kazumi; Naruto, Takuya; Masuno, Mitsuo; Kurosawa, Kenji

    2015-02-01

    Peutz-Jeghers syndrome (PJS) is a rare autosomal dominant disease characterized by gastrointestinal polyposis and mucocutaneous pigmentation. Germline point mutations in the serine/threonine kinase 11 (STK11) have been identified in about 70% of patients with PJS. Only a few large genomic deletions have been identified. We report on a girl with PJS and multiple congenital anomalies. She had intellectual disability, umbilical hernia, bilateral inguinal hernias, scoliosis, and distinct facial appearance including prominent mandible, smooth philtrum, and malformed ears. She developed lip pigmentation at the age of 12 years but had no gastrointestinal polyps. Array comparative genomic hybridization revealed an approximately 610 kb deletion at 19p13.3, encompassing STK11. Together with previous reports, the identification of common clinical features suggests that microdeletion at 19p13.3 encompassing STK11 constitutes a distinctive phenotype. © 2014 Wiley Periodicals, Inc.

  3. Genome-wide mapping of large deletions and their population-genetic properties in dairy cattle

    PubMed Central

    Mesbah-Uddin, Md; Guldbrandtsen, Bernt; Iso-Touru, Terhi; Vilkki, Johanna; De Koning, Dirk-Jan; Boichard, Didier; Lund, Mogens Sandø; Sahana, Goutam

    2018-01-01

    Abstract Large genomic deletions are potential candidate for loss-of-function, which could be lethal as homozygote. Analysing whole genome data of 175 cattle, we report 8,480 large deletions (199 bp–773 KB) with an overall false discovery rate of 8.8%; 82% of which are novel compared with deletions in the dbVar database. Breakpoint sequence analyses revealed that majority (24 of 29 tested) of the deletions contain microhomology/homology at breakpoint, and therefore, most likely generated by microhomology-mediated end joining. We observed higher differentiation among breeds for deletions in some genic-regions, such as ABCA12, TTC1, VWA3B, TSHR, DST/BPAG1, and CD1D. The genes overlapping deletions are on average evolutionarily less conserved compared with known mouse lethal genes (P-value = 2.3 × 10−6). We report 167 natural gene knockouts in cattle that are apparently nonessential as live homozygote individuals are observed. These genes are functionally enriched for immunoglobulin domains, olfactory receptors, and MHC classes (FDR = 2.06 × 10−22, 2.06 × 10−22, 7.01 × 10−6, respectively). We also demonstrate that deletions are enriched for health and fertility related quantitative trait loci (2-and 1.5-fold enrichment, Fisher’s P-value = 8.91 × 10−10 and 7.4 × 10−11, respectively). Finally, we identified and confirmed the breakpoint of a ∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8), causing stillbirth in Nordic Red Cattle. PMID:28985340

  4. A Case With Short Stature, Growth Hormone Deficiency and 46, XX, Xq27-qter Deletion.

    PubMed

    Yıldırım, Şule; Topaloğlu, Naci; Tekin, Mustafa; Sılan, Fatma

    2017-10-01

    We report a case of 11-year-old girl with growth retardation and 46, XX, Xq27-qter deletion. The endocrinologic evaluation revealed growth hormone deficiency. In karyotype analysis  46, XX, Xq27-qter deletion was determined. The deletion of terminal region of chromosome 27 is most commonly being detected during the evaluation of infertility, premature ovarian insufficiency or in screening for fragile X carrier status. To our knowledge, this is the first reported case with 46, XX, Xq27-qter deletion and growth hormone deficiency. Furthermore, this case might facilitate future search for candidate genes involved in growth hormone deficiency.

  5. Velo-cardio-facial syndrome: Frequency and textent of 22q11 deletions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindsay, E.A.; Goldberg, R.; Jurecic, V.

    Velo-cardio-facial (VCFS) or Shprintzen syndrome is associated with deletions in a region of chromosome 22q11.2 also deleted in DiGeorge anomaly and some forms of congenital heart disease. Due to the variability of phenotype, the evaluation of the incidence of deletions has been hampered by uncertainty of diagnosis. In this study, 54 patients were diagnosed with VCFS by a single group of clinicians using homogeneous clinical criteria independent of the deletion status. Cell lines of these patients were established and the deletion status evaluated for three loci within the commonly deleted region at 22q11.2 using fluorescence in situ hybridization (FISH). Inmore » 81% of the patients all three loci were hemizygous. In one patient we observed a smaller interstitial deletion than that defined by the three loci. The phenotype of this patient was not different from that observed in patients with larger deletions. 22 refs., 2 figs., 1 tab.« less

  6. A method for rapid, targeted CNV genotyping identifies rare variants associated with neurocognitive disease.

    PubMed

    Mefford, Heather C; Cooper, Gregory M; Zerr, Troy; Smith, Joshua D; Baker, Carl; Shafer, Neil; Thorland, Erik C; Skinner, Cindy; Schwartz, Charles E; Nickerson, Deborah A; Eichler, Evan E

    2009-09-01

    Copy-number variants (CNVs) are substantial contributors to human disease. A central challenge in CNV-disease association studies is to characterize the pathogenicity of rare and possibly incompletely penetrant events, which requires the accurate detection of rare CNVs in large numbers of individuals. Cost and throughput issues limit our ability to perform these studies. We have adapted the Illumina BeadXpress SNP genotyping assay and developed an algorithm, SNP-Conditional OUTlier detection (SCOUT), to rapidly and accurately detect both rare and common CNVs in large cohorts. This approach is customizable, cost effective, highly parallelized, and largely automated. We applied this method to screen 69 loci in 1105 children with unexplained intellectual disability, identifying pathogenic variants in 3.1% of these individuals and potentially pathogenic variants in an additional 2.3%. We identified seven individuals (0.7%) with a deletion of 16p11.2, which has been previously associated with autism. Our results widen the phenotypic spectrum of these deletions to include intellectual disability without autism. We also detected 1.65-3.4 Mbp duplications at 16p13.11 in 1.1% of affected individuals and 350 kbp deletions at 15q11.2, near the Prader-Willi/Angelman syndrome critical region, in 0.8% of affected individuals. Compared to published CNVs in controls they are significantly (P = 4.7 x 10(-5) and 0.003, respectively) enriched in these children, supporting previously published hypotheses that they are neurocognitive disease risk factors. More generally, this approach offers a previously unavailable balance between customization, cost, and throughput for analysis of CNVs and should prove valuable for targeted CNV detection in both research and diagnostic settings.

  7. Large-scale mapping of cortical alterations in 22q11.2 deletion syndrome: Convergence with idiopathic psychosis and effects of deletion size.

    PubMed

    Sun, Daqiang; Ching, Christopher R K; Lin, Amy; Forsyth, Jennifer K; Kushan, Leila; Vajdi, Ariana; Jalbrzikowski, Maria; Hansen, Laura; Villalon-Reina, Julio E; Qu, Xiaoping; Jonas, Rachel K; van Amelsvoort, Therese; Bakker, Geor; Kates, Wendy R; Antshel, Kevin M; Fremont, Wanda; Campbell, Linda E; McCabe, Kathryn L; Daly, Eileen; Gudbrandsen, Maria; Murphy, Clodagh M; Murphy, Declan; Craig, Michael; Vorstman, Jacob; Fiksinski, Ania; Koops, Sanne; Ruparel, Kosha; Roalf, David R; Gur, Raquel E; Schmitt, J Eric; Simon, Tony J; Goodrich-Hunsaker, Naomi J; Durdle, Courtney A; Bassett, Anne S; Chow, Eva W C; Butcher, Nancy J; Vila-Rodriguez, Fidel; Doherty, Joanne; Cunningham, Adam; van den Bree, Marianne B M; Linden, David E J; Moss, Hayley; Owen, Michael J; Murphy, Kieran C; McDonald-McGinn, Donna M; Emanuel, Beverly; van Erp, Theo G M; Turner, Jessica A; Thompson, Paul M; Bearden, Carrie E

    2018-06-13

    The 22q11.2 deletion (22q11DS) is a common chromosomal microdeletion and a potent risk factor for psychotic illness. Prior studies reported widespread cortical changes in 22q11DS, but were generally underpowered to characterize neuroanatomic abnormalities associated with psychosis in 22q11DS, and/or neuroanatomic effects of variability in deletion size. To address these issues, we developed the ENIGMA (Enhancing Neuro Imaging Genetics Through Meta-Analysis) 22q11.2 Working Group, representing the largest analysis of brain structural alterations in 22q11DS to date. The imaging data were collected from 10 centers worldwide, including 474 subjects with 22q11DS (age = 18.2 ± 8.6; 46.9% female) and 315 typically developing, matched controls (age = 18.0 ± 9.2; 45.9% female). Compared to controls, 22q11DS individuals showed thicker cortical gray matter overall (left/right hemispheres: Cohen's d = 0.61/0.65), but focal thickness reduction in temporal and cingulate cortex. Cortical surface area (SA), however, showed pervasive reductions in 22q11DS (left/right hemispheres: d = -1.01/-1.02). 22q11DS cases vs. controls were classified with 93.8% accuracy based on these neuroanatomic patterns. Comparison of 22q11DS-psychosis to idiopathic schizophrenia (ENIGMA-Schizophrenia Working Group) revealed significant convergence of affected brain regions, particularly in fronto-temporal cortex. Finally, cortical SA was significantly greater in 22q11DS cases with smaller 1.5 Mb deletions, relative to those with typical 3 Mb deletions. We found a robust neuroanatomic signature of 22q11DS, and the first evidence that deletion size impacts brain structure. Psychotic illness in this highly penetrant deletion was associated with similar neuroanatomic abnormalities to idiopathic schizophrenia. These consistent cross-site findings highlight the homogeneity of this single genetic etiology, and support the suitability of 22q11DS as a biological model of schizophrenia.

  8. ReacKnock: Identifying Reaction Deletion Strategies for Microbial Strain Optimization Based on Genome-Scale Metabolic Network

    PubMed Central

    Xu, Zixiang; Zheng, Ping; Sun, Jibin; Ma, Yanhe

    2013-01-01

    Gene knockout has been used as a common strategy to improve microbial strains for producing chemicals. Several algorithms are available to predict the target reactions to be deleted. Most of them apply mixed integer bi-level linear programming (MIBLP) based on metabolic networks, and use duality theory to transform bi-level optimization problem of large-scale MIBLP to single-level programming. However, the validity of the transformation was not proved. Solution of MIBLP depends on the structure of inner problem. If the inner problem is continuous, Karush-Kuhn-Tucker (KKT) method can be used to reformulate the MIBLP to a single-level one. We adopt KKT technique in our algorithm ReacKnock to attack the intractable problem of the solution of MIBLP, demonstrated with the genome-scale metabolic network model of E. coli for producing various chemicals such as succinate, ethanol, threonine and etc. Compared to the previous methods, our algorithm is fast, stable and reliable to find the optimal solutions for all the chemical products tested, and able to provide all the alternative deletion strategies which lead to the same industrial objective. PMID:24348984

  9. A large homozygous deletion in the SAMHD1 gene causes atypical Aicardi–Goutiéres syndrome associated with mtDNA deletions

    PubMed Central

    Leshinsky-Silver, Esther; Malinger, Gustavo; Ben-Sira, Liat; Kidron, Dvora; Cohen, Sarit; Inbar, Shani; Bezaleli, Tali; Levine, Arie; Vinkler, Chana; Lev, Dorit; Lerman-Sagie, Tally

    2011-01-01

    Aicardi–Goutiéres syndrome (AGS) is a genetic neurodegenerative disorder with clinical symptoms mimicking a congenital viral infection. Five causative genes have been described: three prime repair exonuclease1 (TREX1), ribonucleases H2A, B and C, and most recently SAM domain and HD domain 1 (SAMHD1). We performed a detailed clinical and molecular characterization of a family with autosomal recessive neurodegenerative disorder showing white matter destruction and calcifications, presenting in utero and associated with multiple mtDNA deletions. A muscle biopsy was normal and did not show any evidence of respiratory chain dysfunction. Southern blot analysis of tissue from a living child and affected fetuses demonstrated multiple mtDNA deletions. Molecular analysis of genes involved in mtDNA synthesis and maintenance (POLGα, POLGβ, Twinkle, ANT1, TK2, SUCLA1 and DGOUK) revealed normal sequences. Sequencing of TREX1 and ribonucleases H2A, B and C failed to reveal any mutations. Whole-genome homozygosity mapping revealed a candidate region containing the SAMHD1 gene. Sequencing of the gene in the affected child and two affected fetuses revealed a large deletion (9 kb), spanning the promoter, exon1 and intron 1. The parents were found to be heterozygous for this deletion. The identification of a homozygous large deletion in the SAMHD1 gene causing atypical AGS with multiple mtDNA deletions may add information regarding the involvement of mitochondria in self-activation of innate immunity by cell intrinsic components. PMID:21102625

  10. The detection of large deletions or duplications in genomic DNA.

    PubMed

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  11. Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant

    PubMed Central

    Hannes, F D; Sharp, A J; Mefford, H C; de Ravel, T; Ruivenkamp, C A; Breuning, M H; Fryns, J-P; Devriendt, K; Van Buggenhout, G; Vogels, A; Stewart, H; Hennekam, R C; Cooper, G M; Regan, R; Knight, S J L; Eichler, E E; Vermeesch, J R

    2009-01-01

    Background: Genomic disorders are often caused by non-allelic homologous recombination between segmental duplications. Chromosome 16 is especially rich in a chromosome-specific low copy repeat, termed LCR16. Methods and Results: A bacterial artificial chromosome (BAC) array comparative genome hybridisation (CGH) screen of 1027 patients with mental retardation and/or multiple congenital anomalies (MR/MCA) was performed. The BAC array CGH screen identified five patients with deletions and five with apparently reciprocal duplications of 16p13 covering 1.65 Mb, including 15 RefSeq genes. In addition, three atypical rearrangements overlapping or flanking this region were found. Fine mapping by high-resolution oligonucleotide arrays suggests that these deletions and duplications result from non-allelic homologous recombination (NAHR) between distinct LCR16 subunits with >99% sequence identity. Deletions and duplications were either de novo or inherited from unaffected parents. To determine whether these imbalances are associated with the MR/MCA phenotype or whether they might be benign variants, a population of 2014 normal controls was screened. The absence of deletions in the control population showed that 16p13.11 deletions are significantly associated with MR/MCA (p = 0.0048). Despite phenotypic variability, common features were identified: three patients with deletions presented with MR, microcephaly and epilepsy (two of these had also short stature), and two other deletion carriers ascertained prenatally presented with cleft lip and midline defects. In contrast to its previous association with autism, the duplication seems to be a common variant in the population (5/1682, 0.29%). Conclusion: These findings indicate that deletions inherited from clinically normal parents are likely to be causal for the patients’ phenotype whereas the role of duplications (de novo or inherited) in the phenotype remains uncertain. This difference in knowledge regarding the clinical relevance of the deletion and the duplication causes a paradigm shift in (cyto)genetic counselling. PMID:18550696

  12. Subtelomeric Deletion of Chromosome 10p15.3: Clinical Findings and Molecular Cytogenetic Characterization

    PubMed Central

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H.; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia AL; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B.A.; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-01-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11,), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM# 608668) and DIP2C (OMIM# 611380) (UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. PMID:22847950

  13. Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

    PubMed

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-09-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

  14. Chronic lymphocytic leukemia cells with allelic deletions at 13q14 commonly have one intact RB1 gene: Evidence for a role of an adjacent locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leu, Y.; Grander, D.; Linder, S.

    The authors have previously shown that 30% of patients with B-cell chronic lymphocytic leukemia (B-CLL) have hemizygous deletions of the retinoblastoma (RB1) gene at 13q14. RB1 gene deletions may thus participate in malignant transformation of B-CLL, but is it also possible that a neighboring gene on 13q is the relevant one. To answer this question the remaining RB1 allele of eight clones with hemizygous deletions was studied by reverse transcription-polymerase chain reaction (RT-PCR), single-strand conformation polymorphism (SSCP) analysis, and immunofluorescense techniques. Cells from 10 patients without RB1 gene deletions were also studied by these methods. Lack of RB1 mRNA andmore » RB protein expression was seen in leukemia cells from one of the patients. All other cases were found to be normal with regard to immunofluorescense, RT-PCR, and SSCP analysis, indicating at least one functional RB1 allele and supporting the importance of another gene in the 13q14 deletions. The authors then performed extended Southern blot analysis of the 13q region, using probes for 10 different loci. In 14 of 31 CLL clones (45%), deletions of a region telomeric to the RB1 gene (D13S25) were observed. In 4 of the cases the deletions were homozygous. Hemizygous deletions of the RB1 gene were observed in 11 of these patients and in one of the patients without D13S25 deletions. These data thus indicate that a gene(s) telomeric to RB1 is involved in the malignant transformation of CLL clones and that deletions of this region are a common event in this disease. 20 refs., 3 figs., 3 tabs.« less

  15. Augmented Currents of an HCN2 Variant in Patients with Febrile Seizure Syndromes

    PubMed Central

    Dibbens, Leanne M.; Reid, Christopher A.; Hodgson, Bree; Thomas, Evan A.; Phillips, Alison M.; Gazina, Elena; Cromer, Brett A.; Clarke, Alison L.; Baram, Tallie Z.; Scheffer, Ingrid E.; Berkovic, Samuel F.; Petrou, Steven

    2012-01-01

    The genetic architecture of common epilepsies is largely unknown. HCNs are excellent epilepsy candidate genes because of their fundamental neurophysiological roles. Screening in subjects with febrile seizures and genetic epilepsy with febrile seizures plus revealed that 2.4% carried a common triple proline deletion (delPPP) in HCN2 that was seen in only 0.2% of blood bank controls. Currents generated by mutant HCN2 channels were ~35% larger than those of controls; an effect revealed using automated electrophysiology and an appropriately powered sample size. This is the first association of HCN2 and familial epilepsy, demonstrating gain of function of HCN2 current as a potential contributor to polygenic epilepsy. PMID:20437590

  16. Molecular mapping within the mouse albino-deletion complex.

    PubMed Central

    Johnson, D K; Hand, R E; Rinchik, E M

    1989-01-01

    Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

  17. Chromosomal DNA Deletions Explain Phenotypic Characteristics of Two Antigenic Variants, Phase II and RSA 514 (Crazy), of the Coxiella burnetii Nine Mile Strain†

    PubMed Central

    Hoover, T. A.; Culp, D. W.; Vodkin, M. H.; Williams, J. C.; Thompson, H. A.

    2002-01-01

    After repeated passages through embyronated eggs, the Nine Mile strain of Coxiella burnetii exhibits antigenic variation, a loss of virulence characteristics, and transition to a truncated lipopolysaccharide (LPS) structure. In two independently derived strains, Nine Mile phase II and RSA 514, these phenotypic changes were accompanied by a large chromosomal deletion (M. H. Vodkin and J. C. Williams, J. Gen. Microbiol. 132:2587-2594, 1986). In the work reported here, additional screening of a cosmid bank prepared from the wild-type strain was used to map the deletion termini of both mutant strains and to accumulate all the segments of DNA that comprise the two deletions. The corresponding DNAs were then sequenced and annotated. The Nine Mile phase II deletion was completely nested within the deletion of the RSA 514 strain. Basic alignment and homology studies indicated that a large group of LPS biosynthetic genes, arranged in an apparent O-antigen cluster, was deleted in both variants. Database homologies identified, in particular, mannose pathway genes and genes encoding sugar methylases and nucleotide sugar epimerase-dehydratase proteins. Candidate genes for addition of sugar units to the core oligosaccharide for synthesis of the rare sugar 6-deoxy-3-C-methylgulose (virenose) were identified in the deleted region. Repeats, redundancies, paralogous genes, and two regions with reduced G+C contents were found within the deletions. PMID:12438347

  18. Zoom‐in comparative genomic hybridisation arrays for the characterisation of variable breakpoint contiguous gene syndromes

    PubMed Central

    Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G

    2007-01-01

    Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889

  19. A Tool for Multiple Targeted Genome Deletions that Is Precise, Scar-Free, and Suitable for Automation.

    PubMed

    Aubrey, Wayne; Riley, Michael C; Young, Michael; King, Ross D; Oliver, Stephen G; Clare, Amanda

    2015-01-01

    Many advances in synthetic biology require the removal of a large number of genomic elements from a genome. Most existing deletion methods leave behind markers, and as there are a limited number of markers, such methods can only be applied a fixed number of times. Deletion methods that recycle markers generally are either imprecise (remove untargeted sequences), or leave scar sequences which can cause genome instability and rearrangements. No existing marker recycling method is automation-friendly. We have developed a novel openly available deletion tool that consists of: 1) a method for deleting genomic elements that can be repeatedly used without limit, is precise, scar-free, and suitable for automation; and 2) software to design the method's primers. Our tool is sequence agnostic and could be used to delete large numbers of coding sequences, promoter regions, transcription factor binding sites, terminators, etc in a single genome. We have validated our tool on the deletion of non-essential open reading frames (ORFs) from S. cerevisiae. The tool is applicable to arbitrary genomes, and we provide primer sequences for the deletion of: 90% of the ORFs from the S. cerevisiae genome, 88% of the ORFs from S. pombe genome, and 85% of the ORFs from the L. lactis genome.

  20. A Tool for Multiple Targeted Genome Deletions that Is Precise, Scar-Free, and Suitable for Automation

    PubMed Central

    Aubrey, Wayne; Riley, Michael C.; Young, Michael; King, Ross D.; Oliver, Stephen G.; Clare, Amanda

    2015-01-01

    Many advances in synthetic biology require the removal of a large number of genomic elements from a genome. Most existing deletion methods leave behind markers, and as there are a limited number of markers, such methods can only be applied a fixed number of times. Deletion methods that recycle markers generally are either imprecise (remove untargeted sequences), or leave scar sequences which can cause genome instability and rearrangements. No existing marker recycling method is automation-friendly. We have developed a novel openly available deletion tool that consists of: 1) a method for deleting genomic elements that can be repeatedly used without limit, is precise, scar-free, and suitable for automation; and 2) software to design the method’s primers. Our tool is sequence agnostic and could be used to delete large numbers of coding sequences, promoter regions, transcription factor binding sites, terminators, etc in a single genome. We have validated our tool on the deletion of non-essential open reading frames (ORFs) from S. cerevisiae. The tool is applicable to arbitrary genomes, and we provide primer sequences for the deletion of: 90% of the ORFs from the S. cerevisiae genome, 88% of the ORFs from S. pombe genome, and 85% of the ORFs from the L. lactis genome. PMID:26630677

  1. Genomic alterations in Warthin tumors of the parotid gland.

    PubMed

    Wemmert, Silke; Willnecker, Vivienne; Sauter, Birgit; Schuh, Sebastian; Brunner, Christian; Bohle, Rainer Maria; Urbschat, Steffi; Schick, Bernhard

    2014-04-01

    Despite the fact that Warthin tumors are the second most common type of benign salivary gland tumors, information regarding genetic alterations is extremely limited, and the tumorigenesis of these tumors has not been elucidated. The present results of the largest series of 30 tumors analyzed by comparative genomic hybridization (CGH) to date confirmed previous genetic findings and identified significant new candidate regions. The most commonly observed alterations were deletions of the short arm of chromosome 8, followed by deletions on 9p. Further representative changes were deletions on 16p and 22q with the minimal overlapping region at 16p12p13.1 and 22q12.1q12.3. Moreover, we indicated two different patterns of chromosomal aberrations. One group harbors deletions on 8p partly apparent with deletions on 9q, 11q 15q, 16p and 22. The second group shows gains on 22, partly apparent with gains on 1p and 20q and deletions on 9p. This leads to the assumption that Warthin tumors, in particular those with a high number of alterations, can be divided into two different genetic groups based on the pattern of numerical chromosomal aberrations. Further studies should address whether these subgroups also reflect a different clinical presentation.

  2. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  3. Neurological presentation of three patients with 22q11 deletion (CATCH 22 syndrome).

    PubMed

    Roubertie, A; Semprino, M; Chaze, A M; Rivier, F; Humbertclaude, V; Cheminal, R; Lefort, G; Echenne, B

    2001-12-01

    Chromosome 22q11 deletion (CATCH 22 syndrome or velocardiofacial syndrome) is one of the most frequent chromosomal syndromes. Neurological features other than cognitive disorders are probably the least-described part of the expanding phenotype of the 22q11 deletion. We report the neurological features of three unrelated children with a de novo deletion: one patient with an autistic disorder, a second patient with hypocalcaemic neonatal seizures and unusual persistent epileptic focus at electroencephalographic follow-up, and a third patient with atypical absence epilepsy. These observations enlarge the clinical and neurological spectrum of the 22q11 deletion. Awareness of such cases is necessary, and a diagnosis of the 22q11 deletion should be suspected in children with common neurological features associated with severe or mild dysmorphism. Diagnosis of the 22q11 deletion should be confirmed by fluorescence in situ hybridization analysis associated with standard chromosomal analysis.

  4. Molecular definition of 22q11 deletions in 151 velo-cardio-facial syndrome patients.

    PubMed Central

    Carlson, C; Sirotkin, H; Pandita, R; Goldberg, R; McKie, J; Wadey, R; Patanjali, S R; Weissman, S M; Anyane-Yeboa, K; Warburton, D; Scambler, P; Shprintzen, R; Kucherlapati, R; Morrow, B E

    1997-01-01

    Velo-cardio-facial syndrome (VCFS) is a relatively common developmental disorder characterized by craniofacial anomalies and conotruncal heart defects. Many VCFS patients have hemizygous deletions for a part of 22q11, suggesting that haploinsufficiency in this region is responsible for its etiology. Because most cases of VCFS are sporadic, portions of 22q11 may be prone to rearrangement. To understand the molecular basis for chromosomal deletions, we defined the extent of the deletion, by genotyping 151 VCFS patients and performing haplotype analysis on 105, using 15 consecutive polymorphic markers in 22q11. We found that 83% had a deletion and >90% of these had a similar approximately 3 Mb deletion, suggesting that sequences flanking the common breakpoints are susceptible to rearrangement. We found no correlation between the presence or size of the deletion and the phenotype. To further define the chromosomal breakpoints among the VCFS patients, we developed somatic hybrid cell lines from a set of VCFS patients. An 11-kb resolution physical map of a 1,080-kb region that includes deletion breakpoints was constructed, incorporating genes and expressed sequence tags (ESTs) isolated by the hybridization selection method. The ordered markers were used to examine the two separated copies of chromosome 22 in the somatic hybrid cell lines. In some cases, we were able to map the chromosome breakpoints within a single cosmid. A 480-kb critical region for VCFS has been delineated, including the genes for GSCL, CTP, CLTD, HIRA, and TMVCF, as well as a number of novel ordered ESTs. PMID:9326327

  5. Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

    PubMed

    Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

    2011-11-01

    Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

  6. Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

    PubMed

    Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

    2018-06-04

    Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Microdeletion/microduplication of proximal 15q11.2 between BP1 and BP2: a susceptibility region for neurological dysfunction including developmental and language delay.

    PubMed

    Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G

    2011-10-01

    The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.

  8. Genotype-phenotype analysis of recombinant chromosome 4 syndrome: an array-CGH study and literature review

    PubMed Central

    2013-01-01

    Background Recombinant chromosome 4, a rare constitutional rearrangement arising from pericentric inversion, comprises a duplicated segment of 4p13~p15→4pter and a deleted segment of 4q35→4qter. To date, 10 cases of recombinant chromosome 4 have been reported. Result We describe the second case in which array-CGH was used to characterize recombinant chromosome 4 syndrome. The patient was a one-year old boy with consistent clinical features. Conventional cytogenetics and FISH documented a recombinant chromosome 4, derived from a paternal pericentric inversion, leading to partial trisomy 4p and partial monosomy of 4q. Array-CGH, performed to further characterize the rearranged chromosome 4 and delineate the breakpoints, documented a small (4.36 Mb) 4q35.1 terminal deletion and a large (23.81 Mb) 4p15.1 terminal duplication. Genotype-phenotype analysis of 10 previously reported cases and the present case indicated relatively consistent clinical features and breakpoints. This consistency was more evident in our case and another characterized by array-CGH, where both showed the common breakpoints of p15.1 and q35.1. A genotype-phenotype correlation study between rec(4), dup(4p), and del(4q) syndromes revealed that urogenital and cardiac defects are probably due to the deletion of 4q whereas the other clinical features are likely due to 4p duplication. Conclusion Our findings support that the clinical features of patients with rec(4) are relatively consistent and specific to the regions of duplication or deletion. Recombinant chromosome 4 syndrome thus appears to be a discrete entity that can be suspected on the basis of clinical features or specific deleted and duplicated chromosomal regions. PMID:23639048

  9. Genotype-phenotype analysis of recombinant chromosome 4 syndrome: an array-CGH study and literature review.

    PubMed

    Hemmat, Morteza; Hemmat, Omid; Anguiano, Arturo; Boyar, Fatih Z; El Naggar, Mohammed; Wang, Jia-Chi; Wang, Borris T; Sahoo, Trilochan; Owen, Renius; Haddadin, Mary

    2013-05-02

    Recombinant chromosome 4, a rare constitutional rearrangement arising from pericentric inversion, comprises a duplicated segment of 4p13~p15→4pter and a deleted segment of 4q35→4qter. To date, 10 cases of recombinant chromosome 4 have been reported. We describe the second case in which array-CGH was used to characterize recombinant chromosome 4 syndrome. The patient was a one-year old boy with consistent clinical features. Conventional cytogenetics and FISH documented a recombinant chromosome 4, derived from a paternal pericentric inversion, leading to partial trisomy 4p and partial monosomy of 4q. Array-CGH, performed to further characterize the rearranged chromosome 4 and delineate the breakpoints, documented a small (4.36 Mb) 4q35.1 terminal deletion and a large (23.81 Mb) 4p15.1 terminal duplication. Genotype-phenotype analysis of 10 previously reported cases and the present case indicated relatively consistent clinical features and breakpoints. This consistency was more evident in our case and another characterized by array-CGH, where both showed the common breakpoints of p15.1 and q35.1. A genotype-phenotype correlation study between rec(4), dup(4p), and del(4q) syndromes revealed that urogenital and cardiac defects are probably due to the deletion of 4q whereas the other clinical features are likely due to 4p duplication. Our findings support that the clinical features of patients with rec(4) are relatively consistent and specific to the regions of duplication or deletion. Recombinant chromosome 4 syndrome thus appears to be a discrete entity that can be suspected on the basis of clinical features or specific deleted and duplicated chromosomal regions.

  10. Noonan like appearance and familial deletion of the 22q11 Shprintzen-DiGeorge critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Piussan, C.; Mathieu, M.; Boudailliez, B.

    1994-09-01

    Shprintzen velocardiofacial syndrome (VCFS) and reported cases of autosomal dominant DiGeorge sequence (DGS) both belong to a heterogeneous developmental field defect due to the familial segregation of a 22q11 deletion. Two sisters present with mental retardation, dysmorphia and multiple congenital anomalies. The eldest has a Noonan-like appearance; short stature, short webbed neck, low posterior hairline, widely spaced nipples, hemivertebrae, speech disability and mild hypoparathyroidism. Her younger sister has prominent eyes, floppy ears, pulmonary valvular stenosis, hypoplastic right kidney, left multicystic kidney, hypoparathyroidism and renal failure causing death at age 3. Their retarded mother has a typical Shprintzen phenotype and nomore » hypoparathyroidism. A deletion of the critical DiGeorge-Shprintzen conotruncal malformation region was found by FISH in the mother and her Noonan-like daughter. In the mother`s family exist 3 cleft palates, an imperforate anus, a stillbirth and one infant died at age 3 months because of heart malformation. To our knowledge, another case of Noonan-like appearance in a DG patient affected with monosomy 22q11 has been reported in 1992 by Wilson et al. Whether resulting from the hemizygosity of a gene or from the deletion of contiguous genes, the wide DGS-VCFS spectrum encompasses quite variable phenotypes, discordant for palatal and conotruncal defects as well as for hypoparathyroidism, dysmorphic features and multiple congenital anomalies. Physical mapping of both the large 22q11 region commonly lost and the smallest deletion sufficient to produce DGS has been done and may account for the broadening spectrum, the variable expression and the frequently delayed diagnosis of this syndrome.« less

  11. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

    PubMed Central

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

    2016-01-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

  12. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

    PubMed

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

    2016-08-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

  13. Mutation analysis of the MYO7A and CDH23 genes in Japanese patients with Usher syndrome type 1.

    PubMed

    Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Takizawa, Yoshinori; Hosono, Katsuhiro; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

    2010-12-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 1 (USH1), the second common type of USH, is frequently caused by MYO7A and CDH23 mutations, accounting for 70-80% of the cases among various ethnicities, including Caucasians, Africans and Asians. However, there have been no reports of mutation analysis for any responsible genes for USH1 in Japanese patients. This study describes the first mutation analysis of MYO7A and CDH23 in Japanese USH1 patients. Five mutations (three in MYO7A and two in CDH23) were identified in four of five unrelated patients. Of these mutations, two were novel. One of them, p.Tyr1942SerfsX23 in CDH23, was a large deletion causing the loss of 3 exons. This is the first large deletion to be found in CDH23. The incidence of the MYO7A and CDH23 mutations in the study population was 80%, which is consistent with previous findings. Therefore, mutation screening for these genes is expected to be a highly sensitive method for diagnosing USH1 among the Japanese.

  14. Large-scale identification of target proteins of a glycosyltransferase isozyme by Lectin-IGOT-LC/MS, an LC/MS-based glycoproteomic approach

    PubMed Central

    Sugahara, Daisuke; Kaji, Hiroyuki; Sugihara, Kazushi; Asano, Masahide; Narimatsu, Hisashi

    2012-01-01

    Model organisms containing deletion or mutation in a glycosyltransferase-gene exhibit various physiological abnormalities, suggesting that specific glycan motifs on certain proteins play important roles in vivo. Identification of the target proteins of glycosyltransferase isozymes is the key to understand the roles of glycans. Here, we demonstrated the proteome-scale identification of the target proteins specific for a glycosyltransferase isozyme, β1,4-galactosyltransferase-I (β4GalT-I). Although β4GalT-I is the most characterized glycosyltransferase, its distinctive contribution to β1,4-galactosylation has been hardly described so far. We identified a large number of candidates for the target proteins specific to β4GalT-I by comparative analysis of β4GalT-I-deleted and wild-type mice using the LC/MS-based technique with the isotope-coded glycosylation site-specific tagging (IGOT) of lectin-captured N-glycopeptides. Our approach to identify the target proteins in a proteome-scale offers common features and trends in the target proteins, which facilitate understanding of the mechanism that controls assembly of a particular glycan motif on specific proteins. PMID:23002422

  15. First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

    PubMed

    Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F

    2014-01-01

    Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

  16. First Report of a Deletion Encompassing an Entire Exon in the Homogentisate 1,2-Dioxygenase Gene Causing Alkaptonuria

    PubMed Central

    Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.

    2014-01-01

    Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259

  17. [Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

    PubMed

    Cheng, L H; Liu, Y; Niu, T

    2017-05-14

    Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

  18. Large deletions play a minor but essential role in congenital coagulation factor VII and X deficiencies.

    PubMed

    Rath, M; Najm, J; Sirb, H; Kentouche, K; Dufke, A; Pauli, S; Hackmann, K; Liehr, T; Hübner, C A; Felbor, U

    2015-01-01

    Congenital factor VII (FVII) and factor X (FX) deficiencies belong to the group of rare bleeding disorders which may occur in separate or combined forms since both the F7 and F10 genes are located in close proximity on the distal long arm of chromosome 13 (13q34). We here present data of 192 consecutive index cases with FVII and/or FX deficiency. 10 novel and 53 recurrent sequence alterations were identified in the F7 gene and 5 novel as well as 11 recurrent in the F10 gene including one homozygous 4.35 kb deletion within F7 (c.64+430_131-6delinsTCGTAA) and three large heterozygous deletions involving both the F7 and F10 genes. One of the latter proved to be cytogenetically visible as a chromosome 13q34 deletion and associated with agenesis of the corpus callosum and psychomotor retardation. Large deletions play a minor but essential role in the mutational spectrum of the F7 and F10 genes. Copy number analyses (e. g. MLPA) should be considered if sequencing cannot clarify the underlying reason of an observed coagulopathy. Of note, in cases of combined FVII/FX deficiency, a deletion of the two contiguous genes might be part of a larger chromosomal rearrangement.

  19. Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

    PubMed

    Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

    2007-01-05

    High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

  20. Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population.

    PubMed

    Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki

    2004-12-01

    Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.

  1. New chromosome aberration: duplication of a large part of chromosome 4q and partial deletion of chromosome 1q.

    PubMed

    Merlob, P; Kohn, G; Litwin, A; Nissenkorn, I; Katznelson, M B; Reisner, S H

    1989-01-01

    We describe a preterm female infant with multiple anomalies who has a duplication of a large part of 4q and partial deletion of chromosome 1q. Her karyotype was interpreted to be 46,XX,-1,+der(1),t(1;4) (q44;q23 or 24)mat. She is the first patient with an unbalanced translocation involving chromosomes 4 and 1. There is a substantial amount of concordance between the phenotypic features of this patient and those described in the context of partial deletion 1q. The extensive duplication of 4q has no dominant clinical effects in the present infant. These facts support the general concept of much more deleterious effects of deletions versus duplications in human species.

  2. Identification of a novel large intragenic deletion in a family with Fanconi anemia: first molecular report from India and review of literature.

    PubMed

    Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2013-04-15

    We report here an Indian case with Fanconi anemia (FA) presented with fever, pallor, short stature, hyperpigmentation and upper limb anomaly. Chromosome breakage analysis together with FANCD2 Western blot monoubiquitination assay confirmed the diagnosis as FA. Multiplex ligation-dependent probe amplification (MLPA) revealed a novel homozygous large intragenic deletion (exons 8-27 del) in the FANCA gene in the proband. His sib and parents were also analyzed and found to be heterozygous for the same mutation. We also reviewed the literature of FANCA large intragenic deletions found in FA patients from different countries and the mechanism involved in the formation of these deletions. To the best of our knowledge, this is the first molecular report from India on FA. The finding expands the mutation spectrum of the FANCA gene. Identification of the mutation confirms the diagnosis of FA at DNA level and helps in providing proper genetic counseling to the family. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Genetic studies of Prader-Willi patients provide evidence for conservation of genomic architecture in proximal chromosome 15q.

    PubMed

    Hou, Aihua; Lin, Shuan-Pei; Ho, Shi Yun; Chen, Chi-Fung Jennifer; Lin, Hsiang-Yu; Chen, Yen-Juin; Huang, Chi-Yu; Chiu, Huei-Ching; Chuang, Chih-Kuang; Chen, Ken-Shiung

    2011-03-01

    Prader-Willi syndrome (PWS) is a neurogenetic disorder associated with recurrent genomic recombination involving low copy repeats (LCRs) located in the human chromosome 15q11-q13. Previous studies of PWS patients from Asia suggested that there is a higher incidence of deletion and lower incidence of maternal uniparental disomy (mUPD) compared to that of Western populations. In this report, we present genetic etiology of 28 PWS patients from Taiwan. Consistent with the genetic etiology findings from Western populations, the type II deletion appears to be the most common deletion subtype. Furthermore, the ratio of the two most common deletion subtypes and the ratio of the maternal heterodisomy to isodisomy cases observed from this study are in agreement with previous findings from Western populations. In addition, we identified and further mapped the deletion breakpoints in two patients with atypical deletions using array CGH (comparative genomic hybridization). Despite the relatively small numbers of patients in each subgroup, our findings suggest that the genomic architecture responsible for the recurrent recombination in PWS is conserved in Taiwanese of the Han Chinese heritage and Western populations, thereby predisposing chromosome 15q11-q13 to a similar risk of rearrangements. © 2010 The Authors Annals of Human Genetics © 2010 Blackwell Publishing Ltd/University College London.

  4. Childhood-onset schizophrenia case with 2.2 Mb deletion at chromosome 3p12.2-p12.1 and two large chromosomal abnormalities at 16q22.3-q24.3 and Xq23-q28.

    PubMed

    Rudd, Danielle; Axelsen, Michael; Epping, Eric A; Andreasen, Nancy; Wassink, Thomas

    2015-04-01

    Childhood-onset schizophrenia is rare, comprising 1% of known schizophrenia cases. Here, we report a patient with childhood-onset schizophrenia who has three large chromosomal abnormalities: an inherited 2.2 Mb deletion of chromosome 3p12.2-p12.1, a de novo 16.7 Mb duplication of 16q22.3-24.3, and a de novo 43 Mb deletion of Xq23-q28.

  5. Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

    PubMed

    Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

    2014-10-01

    Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Increased CNV-Region deletions in mild cognitive impairment (MCI) and Alzheimer's disease (AD) subjects in the ADNI sample

    PubMed Central

    Guffanti, Guia; Torri, Federica; Rasmussen, Jerod; Clark, Andrew P.; Lakatos, Anita; Turner, Jessica A.; Fallon, James H.; Saykin, Andrew J.; Weiner, Michael; Vawter, Marquis P.; Knowles, James A.; Potkin, Steven G.; Macciardi, Fabio

    2014-01-01

    We investigated the genome-wide distribution of CNVs in the Alzheimer's disease (AD) Neuroimaging Initiative (ADNI) sample (146 with AD, 313 with Mild Cognitive Impairment (MCI), and 181 controls). Comparison of single CNVs between cases (MCI and AD) and controls shows overrepresentation of large heterozygous deletions in cases (p-value < 0.0001). The analysis of CNV-Regions identifies 44 copy number variable loci of heterozygous deletions, with more CNV-Regions among affected than controls (p = 0.005). Seven of the 44 CNV-Regions are nominally significant for association with cognitive impairment. We validated and confirmed our main findings with genome re-sequencing of selected patients and controls. The functional pathway analysis of the genes putatively affected by deletions of CNV-Regions reveals enrichment of genes implicated in axonal guidance, cell–cell adhesion, neuronal morphogenesis and differentiation. Our findings support the role of CNVs in AD, and suggest an association between large deletions and the development of cognitive impairment PMID:23583670

  7. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shomrat, R.; Gluck, E.; Legum, C.

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and themore » remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.« less

  8. Integrated Genomic and Epigenomic Analysis of Breast Cancer Brain Metastasis

    PubMed Central

    Salhia, Bodour; Kiefer, Jeff; Ross, Julianna T. D.; Metapally, Raghu; Martinez, Rae Anne; Johnson, Kyle N.; DiPerna, Danielle M.; Paquette, Kimberly M.; Jung, Sungwon; Nasser, Sara; Wallstrom, Garrick; Tembe, Waibhav; Baker, Angela; Carpten, John; Resau, Jim; Ryken, Timothy; Sibenaller, Zita; Petricoin, Emanuel F.; Liotta, Lance A.; Ramanathan, Ramesh K.; Berens, Michael E.; Tran, Nhan L.

    2014-01-01

    The brain is a common site of metastatic disease in patients with breast cancer, which has few therapeutic options and dismal outcomes. The purpose of our study was to identify common and rare events that underlie breast cancer brain metastasis. We performed deep genomic profiling, which integrated gene copy number, gene expression and DNA methylation datasets on a collection of breast brain metastases. We identified frequent large chromosomal gains in 1q, 5p, 8q, 11q, and 20q and frequent broad-level deletions involving 8p, 17p, 21p and Xq. Frequently amplified and overexpressed genes included ATAD2, BRAF, DERL1, DNMTRB and NEK2A. The ATM, CRYAB and HSPB2 genes were commonly deleted and underexpressed. Knowledge mining revealed enrichment in cell cycle and G2/M transition pathways, which contained AURKA, AURKB and FOXM1. Using the PAM50 breast cancer intrinsic classifier, Luminal B, Her2+/ER negative, and basal-like tumors were identified as the most commonly represented breast cancer subtypes in our brain metastasis cohort. While overall methylation levels were increased in breast cancer brain metastasis, basal-like brain metastases were associated with significantly lower levels of methylation. Integrating DNA methylation data with gene expression revealed defects in cell migration and adhesion due to hypermethylation and downregulation of PENK, EDN3, and ITGAM. Hypomethylation and upregulation of KRT8 likely affects adhesion and permeability. Genomic and epigenomic profiling of breast brain metastasis has provided insight into the somatic events underlying this disease, which have potential in forming the basis of future therapeutic strategies. PMID:24489661

  9. Identification and characterization of large DNA deletions affecting oil quality traits in soybean seeds through transcriptome sequencing analysis.

    PubMed

    Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles

    2016-08-01

    Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.

  10. Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

    PubMed

    Long, Ju

    2016-05-01

    In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Submicroscopic deletions at 22q11.2: Variability of the clinical picture and delineation of a commonly deleted region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindsay, E.A.; Shaffer, L.G.; Greenberg, F.

    DiGeorge anomaly (DGA) and velo-cardio-facial syndrome (VCFS) are frequently associated with monosomy of chromosome region 22q11. Most patients have a submicroscopic deletion, recently estimated to be at least 1-2 Mb. It is not clear whether individuals who present with only some of the features of these conditions have the deletion, and if so, whether the size of the deletion varies from those with more classic phenotypes. We have used fluorescence in situ hybridization (FISH) to assess the deletion status of 85 individuals referred to us for molecular analysis, with a wide range of DGA-like or VCFS-like clinical features. The testmore » probe used was the cosmid sc11.1, which detects two loci about 2 Mb apart in 22q11.2. Twenty-four patients carried the deletion. Of the deleted patients, most had classic DGA or VCFS phenotypes, but 6 deleted patients had mild phenotypes, including 2 with minor facial anomalies and velopharyngeal incompetence as the only presenting signs. Despite the great phenotypic variability among the deleted patients, none had a deletion smaller than the 2-Mb region defined by sc11.1. Smaller deletions were not detected in patients with particularly suggestive phenotypes who were not deleted for sc11.1, even when tested with two other probes from the DGA/VCFS region. 24 refs., 2 figs., 2 tabs.« less

  12. Germline APOBEC3B deletion is associated with breast cancer risk in an Asian multi-ethnic cohort and with immune cell presentation.

    PubMed

    Wen, Wei Xiong; Soo, Jaslyn Sian-Siu; Kwan, Pui Yoke; Hong, Elaine; Khang, Tsung Fei; Mariapun, Shivaani; Lee, Christine Shu-Mei; Hasan, Siti Norhidayu; Rajadurai, Pathmanathan; Yip, Cheng Har; Mohd Taib, Nur Aishah; Teo, Soo Hwang

    2016-05-27

    APOBEC3B is a cytosine deaminase implicated in immune response to viral infection, cancer predisposition and carcinogenesis. Germline APOBEC3B deletion is more common in East Asian women and confers a modest risk to breast cancer in both East Asian and Caucasian women. Analysis of tumour samples from women of European descent has shown that germline APOBEC3B deletion is associated with an increased propensity to develop somatic mutations and with an enrichment for immune response-related gene sets. However, this has not been examined in Asian tumour samples, where population differences in genetic and dietary factors may have an impact on the immune system. In this study, we determined the prevalence of germline APOBEC3B deletion and its association with breast cancer risk in a cross-sectional hospital-based Asian multi-ethnic cohort of 1451 cases and 1442 controls from Malaysia. We compared gene expression profiles of breast cancers arising from APOBEC3B deletion carriers and non-carriers using microarray analyses. Finally, we characterised the overall abundance of tumour-infiltrating immune cells in breast cancers from TCGA and METABRIC using ESTIMATE and relative frequency of 22 immune cell subsets in breast cancers from METABRIC using CIBERSORT. The minor allelic frequency of APOBEC3B deletion was estimated to be 0.35, 0.42 and 0.16 in female populations of Chinese, Malay and Indian descent, respectively, and that germline APOBEC3B deletion was associated with breast cancer risk with odds ratios of 1.23 (95 % CI: [1.05, 1.44]) for one-copy deletion and 1.38 (95 % CI: [1.10, 1.74]) for two-copy deletion compared to women with no deletion. Germline APOBEC3B deletion was not associated with any clinicopathologic features or the expression of any APOBEC family members but was associated with immune response-related gene sets (FDR q values < 0.05). Analysis of breast cancers from METABRIC revealed breast cancers from APOBEC3B deletion carriers to have significantly higher abundance of tumour-infiltrating immune cells (P < 0.001). Taken together, our data suggests that tumour-infiltrating immune cells may be an important feature of breast cancers arising in women with APOBEC3B germline deletion, and that this may be of particular interest in Asian women where the germline deletion is more common.

  13. Impact of molecular mechanisms, including deletion size, on Prader-Willi syndrome phenotype: study of 75 patients.

    PubMed

    Varela, M C; Kok, F; Setian, N; Kim, C A; Koiffmann, C P

    2005-01-01

    Prader-Willi syndrome (PWS) can result from a 15q11-q13 paternal deletion, maternal uniparental disomy (UPD), or imprinting mutations. We describe here the phenotypic variability detected in 51 patients with different types of deletions and 24 patients with UPD. Although no statistically significant differences could be demonstrated between the two main types of PWS deletion patients, it was observed that type I (BP1-BP3) patients acquired speech later than type II (BP2-BP3) patients. Comparing the clinical pictures of our patients with UPD with those with deletions, we found that UPD children presented with lower birth length and started walking earlier and deletion patients presented with a much higher incidence of seizures than UPD patients. In addition, the mean maternal age in the UPD group was higher than in the deletion group. No statistically significant differences could be demonstrated between the deletion and the UPD group with respect to any of the major features of PWS. In conclusion, our study did not detect significant phenotypic differences among type I and type II PWS deletion patients, but it did demonstrate that seizures were six times more common in patients with a deletion than in those with UPD.

  14. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    PubMed

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  15. Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

    PubMed

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

    2013-09-01

    Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

  16. Deletion of a target gene in Indica rice via CRISPR/Cas9.

    PubMed

    Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

    2017-08-01

    Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

  17. Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis.

    PubMed

    Nicoletti, Annalisa; Ziccardi, Lucia; Maltese, Paolo Enrico; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

    2017-02-01

    X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by "home-made" MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene.

  18. Identification of a novel large deletion in a patient with severe factor V deficiency using an in-house F5 MLPA assay.

    PubMed

    Nuzzo, F; Paraboschi, E M; Straniero, L; Pavlova, A; Duga, S; Castoldi, E

    2015-01-01

    Factor V (FV) deficiency is a rare autosomal recessive bleeding disorder caused by mutations in the F5 gene. FV-deficient patients in whom no mutation or only one mutation is found may harbour large gene rearrangements, which are not detected by conventional mutation screening strategies. The aim of this study was to develop and validate a multiplex ligation-dependent probe amplification (MLPA) assay for the detection of large deletions and duplications in the F5 gene. Twenty-two MLPA probes targeting 19 of the 25 exons and the upstream and downstream regions of the F5 gene were designed and tested in 10 normal controls, a patient with a known heterozygous deletion of F5 exons 1-7 (positive control) and 14 genetically unexplained FV-deficient patients. MLPA results were confirmed by digital PCR on a QuantStudio(™) 3D Digital PCR System. The F5-specific probes yielded a reproducible peak profile in normal controls, correctly detected the known deletion in the positive control and suggested the presence of a novel deletion of exons 9-10 in a patient with undetectable FV levels and only one identified mutation. Follow-up by chip-based digital PCR, long-range PCR and direct sequencing confirmed that this patient carried a heterozygous F5 deletion of 1823 bp extending from intron 8 to intron 10. Bioinformatics sequence analysis pinpointed repetitive elements that might have originated the deletion. In conclusion, we have developed and validated an MLPA assay for the detection of gross F5 gene rearrangements. This assay may represent a valuable tool for the molecular diagnosis of FV deficiency. © 2014 John Wiley & Sons Ltd.

  19. Poor phenotype-genotype association in a large series of patients with Type III Bartter syndrome.

    PubMed

    García Castaño, Alejandro; Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Álvaro; Chocrón, Sara; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; García Nieto, Víctor; Barajas de Frutos, David; Loza, Reyner; Pintos, Guillem; Castaño, Luis; Ariceta, Gema

    2017-01-01

    Type III Bartter syndrome (BS) is an autosomal recessive renal tubule disorder caused by loss-of-function mutations in the CLCNKB gene, which encodes the chloride channel protein ClC-Kb. In this study, we carried out a complete clinical and genetic characterization in a cohort of 30 patients, one of the largest series described. By comparing with other published populations, and considering that 80% of our patients presented the p.Ala204Thr Spanish founder mutation presumably associated with a common phenotype, we aimed to test the hypothesis that allelic differences could explain the wide phenotypic variability observed in patients with type III BS. Clinical data were retrieved from the referral centers. The exon regions and flanking intronic sequences of the CLCNKB gene were screened for mutations by polymerase chain reaction (PCR) followed by direct Sanger sequencing. Presence of gross deletions or duplications in the region was checked for by MLPA and QMPSF analyses. Polyuria, polydipsia and dehydration were the main common symptoms. Metabolic alkalosis and hypokalemia of renal origin were detected in all patients at diagnosis. Calciuria levels were variable: hypercalciuria was detected in 31% of patients, while 23% had hypocalciuria. Nephrocalcinosis was diagnosed in 20% of the cohort. Two novel CLCNKB mutations were identified: a small homozygous deletion (c.753delG) in one patient and a small deletion (c.1026delC) in another. The latter was present in compound heterozygosis with the already previously described p.Glu442Gly mutation. No phenotypic association was obtained regarding the genotype. A poor correlation was found between a specific type of mutation in the CLCNKB gene and type III BS phenotype. Importantly, two CLCNKB mutations not previously described were found in our cohort.

  20. Poor phenotype-genotype association in a large series of patients with Type III Bartter syndrome

    PubMed Central

    Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Álvaro; Chocrón, Sara; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; García Nieto, Víctor; Barajas de Frutos, David; Loza, Reyner; Pintos, Guillem; Castaño, Luis; Ariceta, Gema

    2017-01-01

    Introduction Type III Bartter syndrome (BS) is an autosomal recessive renal tubule disorder caused by loss-of-function mutations in the CLCNKB gene, which encodes the chloride channel protein ClC-Kb. In this study, we carried out a complete clinical and genetic characterization in a cohort of 30 patients, one of the largest series described. By comparing with other published populations, and considering that 80% of our patients presented the p.Ala204Thr Spanish founder mutation presumably associated with a common phenotype, we aimed to test the hypothesis that allelic differences could explain the wide phenotypic variability observed in patients with type III BS. Methods Clinical data were retrieved from the referral centers. The exon regions and flanking intronic sequences of the CLCNKB gene were screened for mutations by polymerase chain reaction (PCR) followed by direct Sanger sequencing. Presence of gross deletions or duplications in the region was checked for by MLPA and QMPSF analyses. Results Polyuria, polydipsia and dehydration were the main common symptoms. Metabolic alkalosis and hypokalemia of renal origin were detected in all patients at diagnosis. Calciuria levels were variable: hypercalciuria was detected in 31% of patients, while 23% had hypocalciuria. Nephrocalcinosis was diagnosed in 20% of the cohort. Two novel CLCNKB mutations were identified: a small homozygous deletion (c.753delG) in one patient and a small deletion (c.1026delC) in another. The latter was present in compound heterozygosis with the already previously described p.Glu442Gly mutation. No phenotypic association was obtained regarding the genotype. Conclusion A poor correlation was found between a specific type of mutation in the CLCNKB gene and type III BS phenotype. Importantly, two CLCNKB mutations not previously described were found in our cohort. PMID:28288174

  1. Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

    PubMed

    Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

    2016-04-01

    The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Phenotypic and Molecular Convergence of 2q23.1 Deletion Syndrome with Other Neurodevelopmental Syndromes Associated with Autism Spectrum Disorder

    PubMed Central

    Mullegama, Sureni V.; Alaimo, Joseph T.; Chen, Li; Elsea, Sarah H.

    2015-01-01

    Roughly 20% of autism spectrum disorders (ASD) are syndromic with a well-established genetic cause. Studying the genes involved can provide insight into the molecular and cellular mechanisms of ASD. 2q23.1 deletion syndrome (causative gene, MBD5) is a recently identified genetic neurodevelopmental disorder associated with ASD. Mutations in MBD5 have been found in ASD cohorts. In this study, we provide a phenotypic update on the prevalent features of 2q23.1 deletion syndrome, which include severe intellectual disability, seizures, significant speech impairment, sleep disturbance, and autistic-like behavioral problems. Next, we examined the phenotypic, molecular, and network/pathway relationships between nine neurodevelopmental disorders associated with ASD: 2q23.1 deletion Rett, Angelman, Pitt-Hopkins, 2q23.1 duplication, 5q14.3 deletion, Kleefstra, Kabuki make-up, and Smith-Magenis syndromes. We show phenotypic overlaps consisting of intellectual disability, speech delay, seizures, sleep disturbance, hypotonia, and autistic-like behaviors. Molecularly, MBD5 possibly regulates the expression of UBE3A, TCF4, MEF2C, EHMT1 and RAI1. Network analysis reveals that there could be indirect protein interactions, further implicating function for these genes in common pathways. Further, we show that when MBD5 and RAI1 are haploinsufficient, they perturb several common pathways that are linked to neuronal and behavioral development. These findings support further investigations into the molecular and pathway relationships among genes linked to neurodevelopmental disorders and ASD, which will hopefully lead to common points of regulation that may be targeted toward therapeutic intervention. PMID:25853262

  3. Childhood-onset schizophrenia case with 2.2 Mb deletion at chromosome 3p12.2–p12.1 and two large chromosomal abnormalities at 16q22.3–q24.3 and Xq23–q28

    PubMed Central

    Rudd, Danielle; Axelsen, Michael; Epping, Eric A; Andreasen, Nancy; Wassink, Thomas

    2015-01-01

    Key Clinical Message Childhood-onset schizophrenia is rare, comprising 1% of known schizophrenia cases. Here, we report a patient with childhood-onset schizophrenia who has three large chromosomal abnormalities: an inherited 2.2 Mb deletion of chromosome 3p12.2–p12.1, a de novo 16.7 Mb duplication of 16q22.3–24.3, and a de novo 43 Mb deletion of Xq23–q28. PMID:25914809

  4. Further delineation of the 15q13 microdeletion and duplication syndromes: a clinical spectrum varying from non-pathogenic to a severe outcome.

    PubMed

    van Bon, B W M; Mefford, H C; Menten, B; Koolen, D A; Sharp, A J; Nillesen, W M; Innis, J W; de Ravel, T J L; Mercer, C L; Fichera, M; Stewart, H; Connell, L E; Ounap, K; Lachlan, K; Castle, B; Van der Aa, N; van Ravenswaaij, C; Nobrega, M A; Serra-Juhé, C; Simonic, I; de Leeuw, N; Pfundt, R; Bongers, E M; Baker, C; Finnemore, P; Huang, S; Maloney, V K; Crolla, J A; van Kalmthout, M; Elia, M; Vandeweyer, G; Fryns, J P; Janssens, S; Foulds, N; Reitano, S; Smith, K; Parkel, S; Loeys, B; Woods, C G; Oostra, A; Speleman, F; Pereira, A C; Kurg, A; Willatt, L; Knight, S J L; Vermeesch, J R; Romano, C; Barber, J C; Mortier, G; Pérez-Jurado, L A; Kooy, F; Brunner, H G; Eichler, E E; Kleefstra, T; de Vries, B B A

    2009-08-01

    Recurrent 15q13.3 microdeletions were recently identified with identical proximal (BP4) and distal (BP5) breakpoints and associated with mild to moderate mental retardation and epilepsy. To assess further the clinical implications of this novel 15q13.3 microdeletion syndrome, 18 new probands with a deletion were molecularly and clinically characterised. In addition, we evaluated the characteristics of a family with a more proximal deletion between BP3 and BP4. Finally, four patients with a duplication in the BP3-BP4-BP5 region were included in this study to ascertain the clinical significance of duplications in this region. The 15q13.3 microdeletion in our series was associated with a highly variable intra- and inter-familial phenotype. At least 11 of the 18 deletions identified were inherited. Moreover, 7 of 10 siblings from four different families also had this deletion: one had a mild developmental delay, four had only learning problems during childhood, but functioned well in daily life as adults, whereas the other two had no learning problems at all. In contrast to previous findings, seizures were not a common feature in our series (only 2 of 17 living probands). Three patients with deletions had cardiac defects and deletion of the KLF13 gene, located in the critical region, may contribute to these abnormalities. The limited data from the single family with the more proximal BP3-BP4 deletion suggest this deletion may have little clinical significance. Patients with duplications of the BP3-BP4-BP5 region did not share a recognisable phenotype, but psychiatric disease was noted in 2 of 4 patients. Overall, our findings broaden the phenotypic spectrum associated with 15q13.3 deletions and suggest that, in some individuals, deletion of 15q13.3 is not sufficient to cause disease. The existence of microdeletion syndromes, associated with an unpredictable and variable phenotypic outcome, will pose the clinician with diagnostic difficulties and challenge the commonly used paradigm in the diagnostic setting that aberrations inherited from a phenotypically normal parent are usually without clinical consequences.

  5. Clinical spectrum and molecular diagnosis of Angelman and Prader-Willi syndrome patients with an imprinting mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saitoh, S.; Cassidy, S.B.; Conroy, J.M.

    Recent studies have identified a new class of Prader-Willi syndrome (PWS) and Angelman syndrome (AS) patients who have biparental inheritance, but neither the typical deletion nor uniparental disomy (UPD) or translocation. However, these patients have uniparental DNA methylation throughout 15q11-q13, and thus appear to have a mutation in the imprinting process for this region. Here we describe detailed clinical findings of five AS imprinting mutation patients (three families) and two PWS imprinting mutation patients (one new family). All these patients have essentially the classical clinical phenotype for the respective syndrome, except that the incidence of microcephaly is lower in imprintingmore » mutation AS patients than in deletion AS patients. Furthermore, imprinting mutation AS and PWS patients do not typically have hypopigmentation, which is commonly found in patients with the usual large deletion. Molecular diagnosis of these cases is initially achieved by DNA methylation analyses of the DN34/ZNF127, PW71 (D15S63), and SNRPN loci. The latter two probes have clear advantages in the simple molecular diagnostic analysis of PWS and AS patients with an imprinting mutation, as has been found for typical deletion or UPD PWS and AS cases. With the recent finding of inherited microdeletions in PWS and AS imprinting mutation families, our studies define a new class of these two syndromes. The clinical and molecular identification of these PWS and AS patients has important genetic counseling consequences. 49 refs., 4 figs., 3 tabs.« less

  6. Evidence and age-related distribution of mtDNA D-loop point mutations in skeletal muscle from healthy subjects and mitochondrial patients.

    PubMed

    Del Bo, Roberto; Bordoni, Andreina; Martinelli Boneschi, Filippo; Crimi, Marco; Sciacco, Monica; Bresolin, Nereo; Scarlato, Guglielmo; Comi, Giacomo Pietri

    2002-10-15

    The progressive accumulation of mitochondrial DNA (mtDNA) alterations, ranging from single mutations to large-scale deletions, in both the normal ageing process and pathological conditions is a relevant phenomenon in terms of frequency and heteroplasmic degree. Recently, two point mutations (A189G and T408A) within the Displacement loop (D-loop) region, the control region for mtDNA replication, were shown to occur in skeletal muscles from aged individuals. We evaluated the presence and the heteroplasmy levels of these two mutations in muscle biopsies from 91 unrelated individuals of different ages (21 healthy subjects and 70 patients affected by mitochondrial encephalomyopathies). Overall, both mutations significantly accumulate with age. However, a different relationship was discovered among the different subgroups of patients: a higher number of A189G positive subjects younger than 53 years was detected in the subgroup of multiple-deleted patients; furthermore, a trend towards an increased risk for the mutations was evidenced among patients carrying multiple deletions when compared to healthy controls. These findings support the idea that a common biological mechanism determines the accumulation of somatic point mutations in the D-loop region, both in healthy subjects and in mitochondrial myopathy patients. At the same time, it appears that disorders caused by mutations of nuclear genes controlling mtDNA replication (the "mtDNA multiple deletions" syndromes) present a temporal advantage to mutate in the D-loop region. This observation may be relevant to the definition of the molecular pathogenesis of these latter syndromes. Copyright 2002 Elsevier Science B.V.

  7. A Pyrosequencing-Based Assay for the Rapid Detection of the 22q11.2 Deletion in DNA from Buccal and Dried Blood Spot Samples

    PubMed Central

    Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

    2015-01-01

    The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH–confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. PMID:24973633

  8. A rare large mutation involving two exons of the SP-B gene in an infant with severe respiratory distress.

    PubMed

    Takcı, Şahin; Anuk-İnce, Deniz; Louha, Malek; Couderc, Remy; Çakar, Nursen; Köseoğlu, Reşit Doğan; Ateş, Ömer

    2017-01-01

    Takcı Ş, Anuk-İnce D, Louha M, Couderc R, Çakar N, Köseoğlu RD, Ateş Ö. A rare large mutation involving two exons of the SP-B gene in an infant with severe respiratory distress. Turk J Pediatr 2017; 59: 483-486. Hereditary surfactant protein-B (SP-B) deficiency is a rare autosomal recessive disease of newborn infants causing severe respiratory failure and death within the first year of life. The most common cause of SP-B deficiency is a frameshift mutation in exon 4 (121ins2) in the gene encoding SP-B. We report a term infant with unremitting respiratory distress who was unresponsive to all treatment modalities. The parents were consanguineous and a term sibling of the infant had died due to respiratory failure without a certain diagnosis. In the first step of the diagnostic work-up, common genetic mutations for SP-B, surfactant protein C and ATP-binding cassette s3 were absent, however sequencing of SP-B gene revealed a large homozygous genomic deletion covering exon 8 and 9. In this case report, we aimed to emphasize further genetic evaluation in all cases suggestive of surfactant dysfunction, even if common mutations are absent.

  9. An interstitial 15q11-q14 deletion: expanded Prader-Willi syndrome phenotype.

    PubMed

    Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Cooley, Linda D; Yu, Shihui

    2010-02-01

    We present an infant girl with a de novo interstitial deletion of the chromosome 15q11-q14 region, larger than the typical deletion seen in Prader-Willi syndrome (PWS). She presented with features seen in PWS including hypotonia, a poor suck, feeding problems, and mild micrognathia. She also presented with features not typically seen in PWS such as preauricular ear tags, a high-arched palate, edematous feet, coarctation of the aorta, a PDA, and a bicuspid aortic valve. G-banded chromosome analysis showed a large de novo deletion of the proximal long arm of chromosome 15 confirmed using FISH probes (D15511 and GABRB3). Methylation testing was abnormal and consistent with the diagnosis of PWS. Because of the large appearing deletion by karyotype analysis, an array comparative genomic hybridization (aCGH) was performed. A 12.3 Mb deletion was found which involved the 15q11-q14 region containing approximately 60 protein coding genes. This rare deletion was approximately twice the size of the typical deletion seen in PWS and involved the proximal breakpoint BP1 and the distal breakpoint was located in the 15q14 band between previously recognized breakpoints BP5 and BP6. The deletion extended slightly distal to the AVEN gene including the neighboring CHRM5 gene. There is no evidence that the genes in the 15q14 band are imprinted; therefore, their potential contribution in this patient's expanded PWS phenotype must be a consequence of dosage sensitivity of the genes or due to altered expression of intact neighboring genes from a position effect. Copyright 2010 Wiley-Liss, Inc.

  10. Genetic modifiers of Velo- cardio- facial syndrome/DiGeorge syndrome

    PubMed Central

    Aggarwal, Vimla S.; Morrow, Bernice E.

    2009-01-01

    Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that Tbx1, a T- box containing transcription factor present on the deleted region, is likely responsible for the etiology of the syndrome. Furthermore, mutations in TBX1 have been found in rare non-deleted patients. Despite having the same sized deletion, most VCFS/DGS patients exhibit significant clinical variability. Stochastic, environmental and genetic factors likely modify the phenotype of patients with the disorder. Here, we review mouse genetics studies which may help identify genetic modifiers for VCFS/DGS. PMID:18636633

  11. Distribution of Alpha Thalassaemia Gene Variants in Diverse Ethnic Populations in Malaysia: Data from the Institute for Medical Research

    PubMed Central

    Ahmad, Rahimah; Saleem, Mohamed; Aloysious, Nisha Sabrina; Yelumalai, Punithawathy; Mohamed, Nurul; Hassan, Syahzuwan

    2013-01-01

    Alpha thalassaemia is highly prevalent in the plural society of Malaysia and is a public health problem. Haematological and molecular data from 5016 unrelated patients referred from various hospitals to the Institute for Medical Research for α thalassaemia screening from 2007 to 2010 were retrieved. The aims of this retrospective analysis were to describe the distribution of various alpha thalassaemia alleles in different ethnic groups, along with their genotypic interactions, and to illustrate the haematological changes associated with each phenotype. Amongst the patients, 51.2% (n = 2567) were diagnosed with α thalassaemia. Of the 13 α thalassaemia determinants screened, eight different deletions and mutations were demonstrated: three double gene deletions, – – SEA, – – THAI, ––FIL; two single-gene deletions, α–3.7 and – α4.2; and three non-deletion mutations, Cd59G > A (haemoglobin [Hb] Adana), Cd125T > C (Hb Quong Sze) and Cd142 (Hb Constant Spring). A high incidence of α–3.7 deletion was observed in Malays, Indians, Sabahans, Sarawakians and Orang Asli people. However, the – – SEA deletion was the most common cause of alpha thalassaemia in Chinese, followed by the α–3.7 deletion. As many as 27 genotypic interactions showed 1023 α thalassaemia silent carriers, 196 homozygous α+ thalassaemia traits, 973 heterozygous α0 thalassaemia carriers and 375 patients with Hb H disease. Statistical analysis showed a significant difference in the distribution of α thalassaemia determinants amongst the various ethnic groups. Hence, the heterogeneous distribution of common determinants indicated that the introduction of an ethnicity-targeted hierarchical α thalassaemia screening approach in this multi-ethnic Malaysian population would be effective. PMID:24025420

  12. Detection of large scale 3′ deletions in the PMS2 gene amongst Colon-CFR participants – have we been missing anything?

    PubMed Central

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N.; Lindor, Noralane; Potter, John D.; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L.; Jenkins, Mark A.; Rosty, Christophe; Young, Joanne P.; Buchanan, Daniel D.

    2013-01-01

    Current screening practices have been able to identify PMS2 mutations in 78% of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3′ end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22% (n = 16) of CRC-affected probands for mutations in the 3′ end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3′ deletions in PMS2 are not a frequent occurrence in such families. PMID:23288611

  13. Detection of large deletion in human BRCA1 gene in human breast carcinoma MCF-7 cells by using DNA-Silver Nanoclusters

    NASA Astrophysics Data System (ADS)

    Borghei, Yasaman-Sadat; Hosseini, Morteza; Ganjali, Mohammad Reza

    2018-01-01

    Here we describe a label-free detection strategy for large deletion mutation in breast cancer (BC) related gene BRCA1 based on a DNA-silver nanocluster (NC) fluorescence upon recognition-induced hybridization. The specific hybridization of DNA templated silver NCs fluorescent probe to target DNAs can act as effective templates for enhancement of AgNCs fluorescence, which can be used to distinguish the deletion of BRCA1 due to different fluorescence intensities. Under the optimal conditions, the fluorescence intensity of the DNA-AgNCs at emission peaks around 440 nm (upon excitation at 350 nm) increased with the increasing deletion type within a dynamic range from 1.0 × 10-10 to 2.4 × 10-6 M with a detection limit (LOD) of 6.4 × 10-11 M. In this sensing system, the normal type shows no significant fluorescence; on the other hand, the deletion type emits higher fluorescence than normal type. Using this nanobiosensor, we successfully determined mutation using the non-amplified genomic DNAs that were isolated from the BC cell line.

  14. Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.

    PubMed

    Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih

    2017-01-01

    Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.

  15. Deletion of 8.5 Mb, including the FMR1 gene, in a male with the fragile X syndrome phenotype and overgrowth.

    PubMed

    Parvari, R; Mumm, S; Galil, A; Manor, E; Bar-David, Y; Carmi, R

    1999-04-02

    A four-year-old boy with severe psychomotor retardation, facial appearance consistent with the fragile X syndrome, hypotonia, and overgrowth was found to have a deletion including the fragile X gene (FMR1). The breakpoints of the deletion were established between CDR1 and sWXD2905 (approximately 200 kb apart) at Xq27.1 (centromeric) and between DXS8318 (612-1078L) and DXS7847 (576-291L) (approximately 250 kb apart) at Xq28, about 500 kb telomeric to the FMR1 gene. The total length of the deletion is approximately 8.5 Mb. The propositus's mother, who was found to be a carrier of the deletion, showed very mild mental impairment. Except for mental retardation, which is a common finding in all cases reported with similar deletions of chromosome Xq, this patient had generalized overgrowth, exceeding the 97th centile for height and weight. Obesity and increased growth parameters have been reported in other patients with deletions either overlapping or within a distance of 0.5 Mb from the deletion in the present patient. Thus, it is suggested that a deletion of the 8-Mb fragment centromeric to the FMR1 gene might have an effect on growth.

  16. Using natural language processing to analyze physician modifications to data entry templates.

    PubMed Central

    Wilcox, Adam B.; Narus, Scott P.; Bowes, Watson A.

    2002-01-01

    Efficient data entry by clinicians remains a significant challenge for electronic medical records. Current approaches have largely focused on either structured data entry, which can be limiting in expressive power, or free-text entry, which restricts the use of the data for automated decision support. Text-based templates are a semi-structured data entry method that has been used to assist physicians in manually entering clinical notes, by allowing them to edit predefined example notes. We analyzed changes made to 18,726 sentences from text templates, using a natural language processor. The most common changes were addition or deletion of normal observations, or changes in certainty. We identified common modifications that could be captured in structured form by a graphical user interface. PMID:12463955

  17. Techniques for Large-Scale Bacterial Genome Manipulation and Characterization of the Mutants with Respect to In Silico Metabolic Reconstructions.

    PubMed

    diCenzo, George C; Finan, Turlough M

    2018-01-01

    The rate at which all genes within a bacterial genome can be identified far exceeds the ability to characterize these genes. To assist in associating genes with cellular functions, a large-scale bacterial genome deletion approach can be employed to rapidly screen tens to thousands of genes for desired phenotypes. Here, we provide a detailed protocol for the generation of deletions of large segments of bacterial genomes that relies on the activity of a site-specific recombinase. In this procedure, two recombinase recognition target sequences are introduced into known positions of a bacterial genome through single cross-over plasmid integration. Subsequent expression of the site-specific recombinase mediates recombination between the two target sequences, resulting in the excision of the intervening region and its loss from the genome. We further illustrate how this deletion system can be readily adapted to function as a large-scale in vivo cloning procedure, in which the region excised from the genome is captured as a replicative plasmid. We next provide a procedure for the metabolic analysis of bacterial large-scale genome deletion mutants using the Biolog Phenotype MicroArray™ system. Finally, a pipeline is described, and a sample Matlab script is provided, for the integration of the obtained data with a draft metabolic reconstruction for the refinement of the reactions and gene-protein-reaction relationships in a metabolic reconstruction.

  18. A Novel Partial Sequence Alignment Tool for Finding Large Deletions

    PubMed Central

    Aruk, Taner; Ustek, Duran; Kursun, Olcay

    2012-01-01

    Finding large deletions in genome sequences has become increasingly more useful in bioinformatics, such as in clinical research and diagnosis. Although there are a number of publically available next generation sequencing mapping and sequence alignment programs, these software packages do not correctly align fragments containing deletions larger than one kb. We present a fast alignment software package, BinaryPartialAlign, that can be used by wet lab scientists to find long structural variations in their experiments. For BinaryPartialAlign, we make use of the Smith-Waterman (SW) algorithm with a binary-search-based approach for alignment with large gaps that we called partial alignment. BinaryPartialAlign implementation is compared with other straight-forward applications of SW. Simulation results on mtDNA fragments demonstrate the effectiveness (runtime and accuracy) of the proposed method. PMID:22566777

  19. Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis

    PubMed Central

    Nicoletti, Annalisa; Ziccardi, Lucia; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

    2017-01-01

    Aims: X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. Methods: We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by “home-made” MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Results: Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Conclusion: Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene. PMID:27997221

  20. Velo-Cardio-Facial Syndrome: 30 Years of Study

    PubMed Central

    Shprintzen, Robert J.

    2009-01-01

    Velo-cardio-facial syndrome is one of the names that has been attached to one of the most common multiple anomaly syndromes in humans. The labels DiGeorge sequence, 22q11 deletion syndrome, conotruncal anomalies face syndrome, CATCH 22, and Sedlačková syndrome have all been attached to the same disorder. Velo-cardio-facial syndrome has an expansive phenotype with more than 180 clinical features described that involve essentially every organ and system. The syndrome has drawn considerable attention because a number of common psychiatric illnesses are phenotypic features including attention deficit disorder, schizophrenia, and bipolar disorder. The expression is highly variable with some individuals being essentially normal at the mildest end of the spectrum, and the most severe cases having life-threatening and life-impairing problems. The syndrome is caused by a microdeletion from chromosome 22 at the q11.2 band. Although the large majority of affected individuals have identical 3 megabase deletions, less than 10% of cases have smaller deletions of 1.5 or 2.0 megabases. The 3 megabase deletion encompasses a region containing 40 genes. The syndrome has a population prevalence of approximately 1:2,000 in the U.S., although incidence is higher. Although initially a clinical diagnosis, today velo-cardio-facial syndrome can be diagnosed with extremely high accuracy by fluorescence in situ hybridization (FISH) and several other laboratory techniques. Clinical management is age dependent with acute medical problems such as congenital heart disease, immune disorders, feeding problems, cleft palate, and developmental disorders occupying management in infancy and preschool years. Management shifts to cognitive, behavioral, and learning disorders during school years, and then to the potential for psychiatric disorders including psychosis in late adolescence and adult years. Although the majority of people with velo-cardio-facial syndrome do not develop psychosis, the risk for severe psychiatric illness is 25 times higher for people affected with velo-cardio-facial syndrome than the general population. Therefore, interest in understanding the nature of psychiatric illness in the syndrome remains strong. PMID:18636631

  1. Mathematical Learning Disabilities in Children with 22q11.2 Deletion Syndrome: A Review

    ERIC Educational Resources Information Center

    De Smedt, Bert; Swillen, Ann; Verschaffel, Lieven; Ghesquiere, Pol

    2009-01-01

    Mathematical learning disabilities (MLD) occur frequently in children with specific genetic disorders, like Turner syndrome, fragile X syndrome and neurofibromatosis. This review focuses on MLD in children with chromosome 22q11.2 deletion syndrome (22q11DS). This syndrome is the most common known microdeletion syndrome with a prevalence of at…

  2. 77 FR 14297 - Connect America Fund; a National Broadband Plan for Our Future; Establishing Just and Reasonable...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-09

    ... Reduction Act requirements, and finds good cause to delete certain rules that are now obsolete. DATES... Paperwork Reduction Act (PRA) requirements, and finds good cause to delete certain rules that are now... CAF phase I support,'' but excludes Interstate Common Line Support (ICLS) on the basis that it...

  3. Translational Research for Muscular Dystrophy

    DTIC Science & Technology

    2012-05-01

    common in-frame deletions for which clinical information from human Becker muscular dystrophy patients (deletion of exons 44-45, 49-51, 48-53) is lacking... Dystrophy PRINCIPAL INVESTIGATOR: Gregory A. Cox, Ph.D. CONTRACTING ORGANIZATION: The Jackson Laboratory...REPORT TYPE Annual 3. DATES COVERED 1 MAR 2011 - 30 APR 2012 4. TITLE AND SUBTITLE Translational Research for Muscular Dystrophy 5a. CONTRACT

  4. TBX6 Null Variants and a Common Hypomorphic Allele in Congenital Scoliosis

    PubMed Central

    Wu, N.; Ming, X.; Xiao, J.; Wu, Z.; Chen, X.; Shinawi, M.; Shen, Y.; Yu, G.; Liu, J.; Xie, H.; Gucev, Z.S.; Liu, S.; Yang, N.; Al-Kateb, H.; Chen, J.; Zhang, Jian; Hauser, N.; Zhang, T.; Tasic, V.; Liu, P.; Su, X.; Pan, X.; Liu, C.; Wang, L.; Shen, Joseph; Shen, Jianxiong; Chen, Y.; Zhang, T.; Zhang, Jianguo; Choy, K.W.; Wang, Jun; Wang, Q.; Li, S.; Zhou, W.; Guo, J.; Wang, Y.; Zhang, C.; Zhao, H.; An, Y.; Zhao, Y.; Wang, Jiucun; Liu, Z.; Zuo, Y.; Tian, Y.; Weng, X.; Sutton, V.R.; Wang, H.; Ming, Y.; Kulkarni, S.; Zhong, T.P.; Giampietro, P.F.; Dunwoodie, S.L.; Cheung, S.W.; Zhang, X.; Jin, L.; Lupski, J.R.; Qiu, G.; Zhang, F.

    2015-01-01

    BACKGROUND Congenital scoliosis is a common type of vertebral malformation. Genetic susceptibility has been implicated in congenital scoliosis. METHODS We evaluated 161 Han Chinese persons with sporadic congenital scoliosis, 166 Han Chinese controls, and 2 pedigrees, family members of which had a 16p11.2 deletion, using comparative genomic hybridization, quantitative polymerase-chain-reaction analysis, and DNA sequencing. We carried out tests of replication using an additional series of 76 Han Chinese persons with congenital scoliosis and a multi-center series of 42 persons with 16p11.2 deletions. RESULTS We identified a total of 17 heterozygous TBX6 null mutations in the 161 persons with sporadic congenital scoliosis (11%); we did not observe any null mutations in TBX6 in 166 controls (P<3.8×10−6). These null alleles include copy-number variants (12 instances of a 16p11.2 deletion affecting TBX6) and single-nucleotide variants (1 nonsense and 4 frame-shift mutations). However, the discordant intrafamilial phenotypes of 16p11.2 deletion carriers suggest that heterozygous TBX6 null mutation is insufficient to cause congenital scoliosis. We went on to identify a common TBX6 haplotype as the second risk allele in all 17 carriers of TBX6 null mutations (P<1.1×10−6). Replication studies involving additional persons with congenital scoliosis who carried a deletion affecting TBX6 confirmed this compound inheritance model. In vitro functional assays suggested that the risk haplotype is a hypomorphic allele. Hemivertebrae are characteristic of TBX6-associated congenital scoliosis. CONCLUSIONS Compound inheritance of a rare null mutation and a hypomorphic allele of TBX6 accounted for up to 11% of congenital scoliosis cases in the series that we analyzed. PMID:25564734

  5. SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

    PubMed

    Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

    2017-12-18

    Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first-tier diagnostic method of SMA.

  6. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

    PubMed

    Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

    2016-05-10

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Osteopoikilosis, short stature and mental retardation as key features of a new microdeletion syndrome on 12q14.

    PubMed

    Menten, Björn; Buysse, Karen; Zahir, Farah; Hellemans, Jan; Hamilton, Sara J; Costa, Teresa; Fagerstrom, Carrie; Anadiotis, George; Kingsbury, Daniel; McGillivray, Barbara C; Marra, Marco A; Friedman, Jan M; Speleman, Frank; Mortier, Geert

    2007-04-01

    This report presents the detection of a heterozygous deletion at chromosome 12q14 in three unrelated patients with a similar phenotype consisting of mild mental retardation, failure to thrive in infancy, proportionate short stature and osteopoikilosis as the most characteristic features. In each case, this interstitial deletion was found using molecular karyotyping. The deletion occurred as a de novo event and varied between 3.44 and 6 megabases (Mb) in size with a 3.44 Mb common deleted region. The deleted interval was not flanked by low-copy repeats or segmental duplications. It contains 13 RefSeq genes, including LEMD3, which was previously shown to be the causal gene for osteopoikilosis. The observation of osteopoikilosis lesions should facilitate recognition of this new microdeletion syndrome among children with failure to thrive, short stature and learning disabilities.

  8. A pyrosequencing-based assay for the rapid detection of the 22q11.2 deletion in DNA from buccal and dried blood spot samples.

    PubMed

    Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

    2014-09-01

    The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH-confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  9. Theory of prokaryotic genome evolution.

    PubMed

    Sela, Itamar; Wolf, Yuri I; Koonin, Eugene V

    2016-10-11

    Bacteria and archaea typically possess small genomes that are tightly packed with protein-coding genes. The compactness of prokaryotic genomes is commonly perceived as evidence of adaptive genome streamlining caused by strong purifying selection in large microbial populations. In such populations, even the small cost incurred by nonfunctional DNA because of extra energy and time expenditure is thought to be sufficient for this extra genetic material to be eliminated by selection. However, contrary to the predictions of this model, there exists a consistent, positive correlation between the strength of selection at the protein sequence level, measured as the ratio of nonsynonymous to synonymous substitution rates, and microbial genome size. Here, by fitting the genome size distributions in multiple groups of prokaryotes to predictions of mathematical models of population evolution, we show that only models in which acquisition of additional genes is, on average, slightly beneficial yield a good fit to genomic data. These results suggest that the number of genes in prokaryotic genomes reflects the equilibrium between the benefit of additional genes that diminishes as the genome grows and deletion bias (i.e., the rate of deletion of genetic material being slightly greater than the rate of acquisition). Thus, new genes acquired by microbial genomes, on average, appear to be adaptive. The tight spacing of protein-coding genes likely results from a combination of the deletion bias and purifying selection that efficiently eliminates nonfunctional, noncoding sequences.

  10. Heavy ion mutagenesis: linear energy transfer effects and genetic linkage

    NASA Technical Reports Server (NTRS)

    Kronenberg, A.; Gauny, S.; Criddle, K.; Vannais, D.; Ueno, A.; Kraemer, S.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    We have characterized a series of 69 independent mutants at the endogenous hprt locus of human TK6 lymphoblasts and over 200 independent S1-deficient mutants of the human x hamster hybrid cell line AL arising spontaneously or following low-fluence exposures to densely ionizing Fe ions (600 MeV/amu, linear energy transfer = 190 keV/microns). We find that large deletions are common. The entire hprt gene (> 44 kb) was missing in 19/39 Fe-induced mutants, while only 2/30 spontaneous mutants lost the entire hprt coding sequence. When the gene of interest (S1 locus = M1C1 gene) is located on a nonessential human chromosome 11, multilocus deletions of several million base pairs are observed frequently. The S1 mutation frequency is more than 50-fold greater than the frequency of hprt mutants in the same cells. Taken together, these results suggest that low-fluence exposures to Fe ions are often cytotoxic due to their ability to create multilocus deletions that may often include the loss of essential genes. In addition, the tumorigenic potential of these HZE heavy ions may be due to the high potential for loss of tumor suppressor genes. The relative insensitivity of the hprt locus to mutation is likely due to tight linkage to a gene that is required for viability.

  11. Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo

    PubMed Central

    Abdel-Wahab, Omar; Gao, Jie; Adli, Mazhar; Dey, Anwesha; Trimarchi, Thomas; Chung, Young Rock; Kuscu, Cem; Hricik, Todd; Ndiaye-Lobry, Delphine; LaFave, Lindsay M.; Koche, Richard; Shih, Alan H.; Guryanova, Olga A.; Kim, Eunhee; Li, Sheng; Pandey, Suveg; Shin, Joseph Y.; Telis, Leon; Liu, Jinfeng; Bhatt, Parva K.; Monette, Sebastien; Zhao, Xinyang; Mason, Christopher E.; Park, Christopher Y.; Bernstein, Bradley E.

    2013-01-01

    Somatic Addition of Sex Combs Like 1 (ASXL1) mutations occur in 10–30% of patients with myeloid malignancies, most commonly in myelodysplastic syndromes (MDSs), and are associated with adverse outcome. Germline ASXL1 mutations occur in patients with Bohring-Opitz syndrome. Here, we show that constitutive loss of Asxl1 results in developmental abnormalities, including anophthalmia, microcephaly, cleft palates, and mandibular malformations. In contrast, hematopoietic-specific deletion of Asxl1 results in progressive, multilineage cytopenias and dysplasia in the context of increased numbers of hematopoietic stem/progenitor cells, characteristic features of human MDS. Serial transplantation of Asxl1-null hematopoietic cells results in a lethal myeloid disorder at a shorter latency than primary Asxl1 knockout (KO) mice. Asxl1 deletion reduces hematopoietic stem cell self-renewal, which is restored by concomitant deletion of Tet2, a gene commonly co-mutated with ASXL1 in MDS patients. Moreover, compound Asxl1/Tet2 deletion results in an MDS phenotype with hastened death compared with single-gene KO mice. Asxl1 loss results in a global reduction of H3K27 trimethylation and dysregulated expression of known regulators of hematopoiesis. RNA-Seq/ChIP-Seq analyses of Asxl1 in hematopoietic cells identify a subset of differentially expressed genes as direct targets of Asxl1. These findings underscore the importance of Asxl1 in Polycomb group function, development, and hematopoiesis. PMID:24218140

  12. A common deletion in two gamma ray induced rat pulmonary tumor cell lines.

    PubMed

    Van Klaveren, P; De Bruijne, J; Van der Winden, H; Kal, H B; Bentvelzen, P

    1994-01-01

    Subtraction hybridization was performed on normal WAG/Rij rat DNA with DNA from a syngeneic Ir-192 induced pulmonary tumor cell line L37. The residual DNA was amplified by means of sequence-independent PCR. This procedure yielded a sequence, of which multiple copies are present in normal rat DNA. In the tumor line L37 two restriction fragments hybridizing with this repeat sequence are lacking. In another Ir-192 induced pulmonary tumor line, L33, one of these fragments was also lacking. This indicates a common deletion in the two tumor lines.

  13. Molecular characteristic of alpha thalassaemia among patients diagnosed in UKM Medical Centre.

    PubMed

    Azma, Raja Zahratul; Ainoon, Othman; Hafiza, Alauddin; Azlin, Ithnin; Noor Farisah, Abudul Razak; Nor Hidayati, Sardi; Noor Hamidah, Hussin

    2014-04-01

    Alpha (Α) thalassaemia is the most common inherited disorder in Malaysia. The clinical severity is dependant on the number of Α genes involved. Full blood count (FBC) and haemoglobin (Hb) analysis using either gel electrophoresis, high performance liquid chromatography (HPLC) or capillary zone electrophoresis (CE) are unable to detect definitively alpha thalassaemia carriers. Definitive diagnosis of Α-thalassaemias requires molecular analysis and methods of detecting both common deletional and non-deletional molecular abnormailities are easily performed in any laboratory involved in molecular diagnostics. We carried out a retrospective analysis of 1623 cases referred to our laboratory in Universiti Kebangsaan Malaysia Medical Centre (UKMMC) for the diagnosis of Α-thalassaemia during the period October 2001 to December 2012. We examined the frequency of different types of alpha gene abnormalities and their haematologic features. Molecular diagnosis was made using a combination of multiplex polymerase reaction (PCR) and real time PCR to detect deletional and non-deletional alpha genes relevant to southeast Asian population. Genetic analysis confirmed the diagnosis of Α-thalassaemias in 736 cases. Majority of the cases were Chinese (53.1%) followed by Malays (44.2%), and Indians (2.7%). The most common gene abnormality was ΑΑ/--(SEA) (64.0%) followed by ΑΑ/-Α(3.7) (19.8%), -Α(3.7) /--(SEA) (6.9%), ΑΑ/ΑΑCS (3.0%), --(SEA)/--(SEA) (1.2%), -Α(3.7)/-Α(3.7) (1.1%), ΑΑ/-Α(4.2) (0.7%), -Α(4.2)/--(SEA (0.7%), -Α(3.7)/-Α(4.2) (0.5%), ΑΑ(CS)/-- SEA) (0.4%), ΑΑ(CS)/ΑΑ(Cd59) (0.4%), ΑΑ(CS)/ΑΑ(CS) (0.4%), -Α(3.7)/ΑΑ(Cd59) (0.3%), ΑΑ/ΑΑ(Cd59) (0.1%), ΑΑ(Cd59)/ ΑΑ(IVS I-1) (0.1%), -Α(3.7)/ΑΑ(CS) (0.1%) and --(SEA) /ΑΑ(Cd59) (0.1%). This data indicates that the molecular abnormalities of Α-thalassaemia in the Malaysian population is heterogenous. Although Α-gene deletion is the most common cause, non-deletional Α-gene abnormalities are not uncommon and at least 3 different mutations exist. Establishment of rapid and easy molecular techniques is important for definitive diagnosis of alpha thalassaemia, an important prerequisite for genetic counselling to prevent its deleterious complications.

  14. Haploinsufficiency of SOX5 at 12p12.1 is associated with developmental delays with prominent language delay, behavior problems, and mild dysmorphic features.

    PubMed

    Lamb, Allen N; Rosenfeld, Jill A; Neill, Nicholas J; Talkowski, Michael E; Blumenthal, Ian; Girirajan, Santhosh; Keelean-Fuller, Debra; Fan, Zheng; Pouncey, Jill; Stevens, Cathy; Mackay-Loder, Loren; Terespolsky, Deborah; Bader, Patricia I; Rosenbaum, Kenneth; Vallee, Stephanie E; Moeschler, John B; Ladda, Roger; Sell, Susan; Martin, Judith; Ryan, Shawnia; Jones, Marilyn C; Moran, Rocio; Shealy, Amy; Madan-Khetarpal, Suneeta; McConnell, Juliann; Surti, Urvashi; Delahaye, Andrée; Heron-Longe, Bénédicte; Pipiras, Eva; Benzacken, Brigitte; Passemard, Sandrine; Verloes, Alain; Isidor, Bertrand; Le Caignec, Cedric; Glew, Gwen M; Opheim, Kent E; Descartes, Maria; Eichler, Evan E; Morton, Cynthia C; Gusella, James F; Schultz, Roger A; Ballif, Blake C; Shaffer, Lisa G

    2012-04-01

    SOX5 encodes a transcription factor involved in the regulation of chondrogenesis and the development of the nervous system. Despite its important developmental roles, SOX5 disruption has yet to be associated with human disease. We report one individual with a reciprocal translocation breakpoint within SOX5, eight individuals with intragenic SOX5 deletions (four are apparently de novo and one inherited from an affected parent), and seven individuals with larger 12p12 deletions encompassing SOX5. Common features in these subjects include prominent speech delay, intellectual disability, behavior abnormalities, and dysmorphic features. The phenotypic impact of the deletions may depend on the location of the deletion and, consequently, which of the three major SOX5 protein isoforms are affected. One intragenic deletion, involving only untranslated exons, was present in a more mildly affected subject, was inherited from a healthy parent and grandparent, and is similar to a deletion found in a control cohort. Therefore, some intragenic SOX5 deletions may have minimal phenotypic effect. Based on the location of the deletions in the subjects compared to the controls, the de novo nature of most of these deletions, and the phenotypic similarities among cases, SOX5 appears to be a dosage-sensitive, developmentally important gene. © 2012 Wiley Periodicals, Inc.

  15. 1p36 deletion syndrome associated with Prader-Willi-like phenotype.

    PubMed

    Tsuyusaki, Yu; Yoshihashi, Hiroshi; Furuya, Noritaka; Adachi, Masanori; Osaka, Hitoshi; Yamamoto, Kayono; Kurosawa, Kenji

    2010-08-01

    1p36 deletion syndrome is one of the most common subtelomeric deletion syndromes, characterized by moderate to severe mental retardation, characteristic facial appearance, hypotonia, obesity, and seizures. The clinical features often overlap with those of Prader-Willi syndrome (PWS). To elucidate the phenotype-genotype correlation in 1p36 deletion syndrome, two cases involving a PWS-like phenotype were analyzed on molecular cytogenetics. Two patients presenting with the PWS-like phenotype but having negative results for PWS underwent fluorescence in situ hybridization (FISH). The size of the chromosome 1p36 deletions was characterized using probes of BAC clones based on the University of California, Santa Cruz (UCSC) Genome Browser. PWS was excluded on FISH and methylation-specific polymerase chain reaction. Subsequent FISH using the probe D1Z2 showed deletion of the 1p36.3 region, confirming the diagnosis of 1p36 deletion syndrome. Further analysis characterized the 1p36 deletions as being located between 4.17 and 4.36 Mb in patient 1 and between 4.89 and 6.09 Mb in patient 2. Patients with 1p36 deletion syndrome exhibit a PWS-like phenotype and are therefore probably underdiagnosed. The possible involvement of the terminal 4 Mb region of chromosome 1p36 in the PWS-like phenotype is hypothesized. © 2010 Japan Pediatric Society.

  16. Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

    PubMed

    Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

    2015-11-04

    Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all encode metabolism- and growth-related proteins, not the known virulence proteins, indicating that the metabolism- and growth-related genes are important for the pathogenesis of S. agalactiae.

  17. A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion

    PubMed Central

    Viñas-Jornet, Marina; Esteba-Castillo, Susanna; Gabau, Elisabeth; Ribas-Vidal, Núria; Baena, Neus; San, Joan; Ruiz, Anna; Coll, Maria Dolors; Novell, Ramon; Guitart, Miriam

    2014-01-01

    Deletions in the 2p16.3 region that includes the neurexin (NRXN1) gene are associated with intellectual disability and various psychiatric disorders, in particular, autism and schizophrenia. We present three unrelated patients, two adults and one child, in whom we identified an intragenic 2p16.3 deletion within the NRXN1 gene using an oligonucleotide comparative genomic hybridization array. The three patients presented dual diagnosis that consisted of mild intellectual disability and autism and bipolar disorder. Also, they all shared a dysmorphic phenotype characterized by a long face, deep set eyes, and prominent premaxilla. Genetic analysis of family members showed two inherited deletions. A comprehensive neuropsychological examination of the 2p16.3 deletion carriers revealed the same phenotype, characterized by anxiety disorder, borderline intelligence, and dysexecutive syndrome. The cognitive pattern of dysexecutive syndrome with poor working memory and reduced attention switching, mental flexibility, and verbal fluency was the same than those of the adult probands. We suggest that in addition to intellectual disability and psychiatric disease, NRXN1 deletion is a risk factor for a characteristic cognitive and dysmorphic profile. The new cognitive phenotype found in the 2p16.3 deletion carriers suggests that 2p16.3 deletions might have a wide variable expressivity instead of incomplete penetrance. PMID:25614873

  18. Hilar granule cells of the mouse dentate gyrus: effects of age, septotemporal location, strain, and selective deletion of the proapoptotic gene BAX.

    PubMed

    Bermudez-Hernandez, Keria; Lu, Yi-Ling; Moretto, Jillian; Jain, Swati; LaFrancois, John J; Duffy, Aine M; Scharfman, Helen E

    2017-09-01

    The dentate gyrus (DG) principal cells are glutamatergic granule cells (GCs), and they are located in a compact cell layer. However, GCs are also present in the adjacent hilar region, but have been described in only a few studies. Therefore, we used the transcription factor prospero homeobox 1 (Prox1) to quantify GCs at postnatal day (PND) 16, 30, and 60 in a common mouse strain, C57BL/6J mice. At PND16, there was a large population of Prox1-immunoreactive (ir) hilar cells, with more in the septal than temporal hippocampus. At PND30 and 60, the size of the hilar Prox1-ir cell population was reduced. Similar numbers of hilar Prox1-expressing cells were observed in PND30 and 60 Swiss Webster mice. Prox1 is usually considered to be a marker of postmitotic GCs. However, many Prox1-ir hilar cells, especially at PND16, were not double-labeled with NeuN, a marker typically found in mature neurons. Most hilar Prox1-positive cells at PND16 co-expressed doublecortin (DCX) and calretinin, markers of immature GCs. Double-labeling with a marker of actively dividing cells, Ki67, was not detected. These results suggest that, surprisingly, a large population of cells in the hilus at PND16 are immature GCs (Type 2b and Type 3 cells). We also asked whether hilar Prox1-ir cell numbers are modifiable. To examine this issue, we conditionally deleted the proapoptotic gene BAX in Nestin-expressing cells at a time when there are numerous immature GCs in the hilus, PND2-8. When these mice were examined at PND60, the numbers of Prox1-ir hilar cells were significantly increased compared to control mice. However, deletion of BAX did not appear to change the proportion that co-expressed NeuN, suggesting that the size of the hilar Prox1-expressing population is modifiable. However, deleting BAX, a major developmental disruption, does not appear to change the proportion that ultimately becomes neurons.

  19. Differential involvement of the related DNA helicases Pif1p and Rrm3p in mtDNA point mutagenesis and stability.

    PubMed

    O'Rourke, Thomas W; Doudican, Nicole A; Zhang, Hong; Eaton, Jana S; Doetsch, Paul W; Shadel, Gerald S

    2005-07-18

    With the exception of base excision repair, conserved pathways and mechanisms that maintain mitochondrial genome stability have remained largely undelineated. In the budding yeast, Saccharomyces cerevisiae, Pif1p is a unique DNA helicase that is localized both to the nucleus and mitochondria, where it is involved in maintaining DNA integrity. We previously elucidated a role for Pif1p in oxidative mtDNA damage resistance that appears to be distinct from its postulated function in mtDNA recombination. Strains lacking Pif1p (pif1Delta) exhibit an increased rate of formation of petite mutants (an indicator of mtDNA instability) and elevated mtDNA point mutagenesis. Here we show that deletion of the RRM3 gene, which encodes a DNA helicase closely related to Pif1p, significantly rescues the petite-induction phenotype of a pif1Delta strain. However, suppression of this phenotype was not accompanied by a corresponding decrease in mtDNA point mutagenesis. Instead, deletion of RRM3 alone resulted in an increase in mtDNA point mutagenesis that was synergistic with that caused by a pif1Delta mutation. In addition, we found that over-expression of RNR1, encoding a large subunit of ribonucleotide reductase (RNR), rescued the petite-induction phenotype of a pif1Delta mutation to a similar extent as deletion of RRM3. This, coupled to our finding that the Rad53p protein kinase is phosphorylated in the rrm3Delta pif1Delta double-mutant strain, leads us to conclude that one mechanism whereby deletion of RRM3 influences mtDNA stability is by modulating mitochondrial deoxynucleoside triphosphate pools. We propose that this is accomplished by signaling through the conserved Mec1/Rad53, S-phase checkpoint pathway to induce the expression and activity of RNR. Altogether, our results define a novel role for Rrm3p in mitochondrial function and indicate that Pif1p and Rrm3p influence a common process (or processes) involved in mtDNA replication, repair, or stability.

  20. Genetic Modifiers of the Physical Malformations in Velo-Cardio-Facial Syndrome/DiGeorge Syndrome

    ERIC Educational Resources Information Center

    Aggarwal, Vimla S.; Morrow, Bernice E.

    2008-01-01

    Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid, and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that "Tbx1", a…

  1. Structural and dynamic changes associated with beneficial engineered single-amino-acid deletion mutations in enhanced green fluorescent protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arpino, James A. J.; Rizkallah, Pierre J., E-mail: rizkallahp@cardiff.ac.uk; Jones, D. Dafydd, E-mail: rizkallahp@cardiff.ac.uk

    2014-08-01

    The beneficial engineered single-amino-acid deletion variants EGFP{sup D190Δ} and EGFP{sup A227Δ} have been studied. Single-amino-acid deletions are a common part of the natural evolutionary landscape but are rarely sampled during protein engineering owing to limited and prejudiced molecular understanding of mutations that shorten the protein backbone. Single-amino-acid deletion variants of enhanced green fluorescent protein (EGFP) have been identified by directed evolution with the beneficial effect of imparting increased cellular fluorescence. Biophysical characterization revealed that increased functional protein production and not changes to the fluorescence parameters was the mechanism that was likely to be responsible. The structure EGFP{sup D190Δ} containing amore » deletion within a loop revealed propagated changes only after the deleted residue. The structure of EGFP{sup A227Δ} revealed that a ‘flipping’ mechanism was used to adjust for residue deletion at the end of a β-strand, with amino acids C-terminal to the deletion site repositioning to take the place of the deleted amino acid. In both variants new networks of short-range and long-range interactions are generated while maintaining the integrity of the hydrophobic core. Both deletion variants also displayed significant local and long-range changes in dynamics, as evident by changes in B factors compared with EGFP. Rather than being detrimental, deletion mutations can introduce beneficial structural effects through altering core protein properties, folding and dynamics, as well as function.« less

  2. Assessment of copy number variations in 120 patients with Poland syndrome.

    PubMed

    Vaccari, Carlotta Maria; Tassano, Elisa; Torre, Michele; Gimelli, Stefania; Divizia, Maria Teresa; Romanini, Maria Victoria; Bossi, Simone; Musante, Ilaria; Valle, Maura; Senes, Filippo; Catena, Nunzio; Bedeschi, Maria Francesca; Baban, Anwar; Calevo, Maria Grazia; Acquaviva, Massimo; Lerone, Margherita; Ravazzolo, Roberto; Puliti, Aldamaria

    2016-11-25

    Poland Syndrome (PS) is a rare congenital disorder presenting with agenesis/hypoplasia of the pectoralis major muscle variably associated with thoracic and/or upper limb anomalies. Most cases are sporadic, but familial recurrence, with different inheritance patterns, has been observed. The genetic etiology of PS remains unknown. Karyotyping and array-comparative genomic hybridization (CGH) analyses can identify genomic imbalances that can clarify the genetic etiology of congenital and neurodevelopmental disorders. We previously reported a chromosome 11 deletion in twin girls with pectoralis muscle hypoplasia and skeletal anomalies, and a chromosome six deletion in a patient presenting a complex phenotype that included pectoralis muscle hypoplasia. However, the contribution of genomic imbalances to PS remains largely unknown. To investigate the prevalence of chromosomal imbalances in PS, standard cytogenetic and array-CGH analyses were performed in 120 PS patients. Following the application of stringent filter criteria, 14 rare copy number variations (CNVs) were identified in 14 PS patients in different regions outside known common copy number variations: seven genomic duplications and seven genomic deletions, enclosing the two previously reported PS associated chromosomal deletions. These CNVs ranged from 0.04 to 4.71 Mb in size. Bioinformatic analysis of array-CGH data indicated gene enrichment in pathways involved in cell-cell adhesion, DNA binding and apoptosis processes. The analysis also provided a number of candidate genes possibly causing the developmental defects observed in PS patients, among others REV3L, a gene coding for an error-prone DNA polymerase previously associated with Möbius Syndrome with variable phenotypes including pectoralis muscle agenesis. A number of rare CNVs were identified in PS patients, and these involve genes that represent candidates for further evaluation. Rare inherited CNVs may contribute to, or represent risk factors of PS in a multifactorial mode of inheritance.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patrick, N.; Miyakawa, F.; Hunt, J.A.

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5more » of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].« less

  4. Landscape of Insertion Polymorphisms in the Human Genome

    PubMed Central

    Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

    2015-01-01

    Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

  5. Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

    PubMed

    Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

    1999-06-01

    Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

  6. A novel KCNQ4 one-base deletion in a large pedigree with hearing loss: implication for the genotype-phenotype correlation.

    PubMed

    Kamada, Fumiaki; Kure, Shigeo; Kudo, Takayuki; Suzuki, Yoichi; Oshima, Takeshi; Ichinohe, Akiko; Kojima, Kanako; Niihori, Tetsuya; Kanno, Junko; Narumi, Yoko; Narisawa, Ayumi; Kato, Kumi; Aoki, Yoko; Ikeda, Katsuhisa; Kobayashi, Toshimitsu; Matsubara, Yoichi

    2006-01-01

    Autosomal-dominant, nonsyndromic hearing impairment is clinically and genetically heterogeneous. We encountered a large Japanese pedigree in which nonsyndromic hearing loss was inherited in an autosomal-dominant fashion. A genome-wide linkage study indicated linkage to the DFNA2 locus on chromosome 1p34. Mutational analysis of KCNQ4 encoding a potassium channel revealed a novel one-base deletion in exon 1, c.211delC, which generated a profoundly truncated protein without transmembrane domains (p.Q71fsX138). Previously, six missense mutations and one 13-base deletion, c.211_223del, had been reported in KCNQ4. Patients with the KCNQ4 missense mutations had younger-onset and more profound hearing loss than patients with the 211_223del mutation. In our current study, 12 individuals with the c.211delC mutation manifested late-onset and pure high-frequency hearing loss. Our results support the genotype-phenotype correlation that the KCNQ4 deletions are associated with later-onset and milder hearing impairment than the missense mutations. The phenotypic difference may be caused by the difference in pathogenic mechanisms: haploinsufficiency in deletions and dominant-negative effect in missense mutations.

  7. NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

    PubMed Central

    Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

    2000-01-01

    Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

  8. Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes.

    PubMed

    Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

    2014-04-01

    Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader-Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion.

  9. Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability

    PubMed Central

    Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

    2014-01-01

    Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome. PMID:23695276

  10. Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability.

    PubMed

    Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

    2014-01-01

    Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome.

  11. Mucopolysaccharidosis IVA: Four new exonic mutations in patients with N-acetylgalactosamine-6-sulfate sulfatase deficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomatsu, Shunji; Fukuda, Seiji; Yamagishi, Atsushi

    1996-05-01

    We report four new mutations in Japanese patients with mucopolysaccharidosis IVA (MPSIVA) who were heterozygous for a common double gene deletion. A nonsense mutation of CAG to TAG at codon 148 in exon 4 was identified, resulting in a change of Q to a stop codon and three missense mutations: V (GTC) to A (GCC) at codon 138 in exon 4, P (CCC) to S (TCC) at codon 151 in exon 5, and P (CCC) to L (CTC) at codon 151 in exon 5. Introduction of these mutations into the normal GALNS cDNA and transient expression in cultured fibroblasts resultedmore » in a significant decrease in the enzyme activity. V138A and Q148X mutations result in changes of restriction site, which were analyzed by restriction-enzyme assay. P151S and P151L mutations that did not alter the restriction site were detected by direct sequencing or allele specific oligohybridization. Detection of the double gene deletion was initially done using Southern blots and was confirmed by PCR. Haplotypes were determined using seven polymorphisms to the GALNS locus in families with the double gene deletion. Haplotype analysis showed that the common double gene deletion occurred on a single haplotype, except for some variation in a VNTR-like polymorphism. This finding is consistent with a common founder for all individuals with this mutation. 48 refs., 5 figs., 1 tab.« less

  12. Prevalence and Spectrum of Large Deletions or Duplications in the Major Long QT Syndrome-Susceptibility Genes and Implications for Long QT Syndrome Genetic Testing

    PubMed Central

    Tester, David J.; Benton, Amber J.; Train, Laura; Deal, Barbara; Baudhuin, Linnea M.; Ackerman, Michael J.

    2010-01-01

    Long QT Syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for three cardiac ion channel alpha-subunits (LQT1-3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. Here, we set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes among unrelated patients who were mutation-negative following point mutation analysis of LQT1-12-susceptibility genes. Forty-two unrelated clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification (MLPA), a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA-MLPA LQTS Kit from MRC-Holland was used to analyze the three major LQTS-associated genes: KCNQ1, KCNH2, and SCN5A and the two minor genes: KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2/42 (4.8%, CI, 1.7–11%) unrelated patients. A deletion of KCNQ1 exon 3 was identified in a 10 year-old Caucasian boy with a QTc of 660 milliseconds (ms), a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17 year-old Caucasian girl with a QTc of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, since nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. PMID:20920651

  13. Association between prematurity and the evolution of psychotic disorders in 22q11.2 deletion syndrome.

    PubMed

    Midbari Kufert, Yael; Nachmani, Ariela; Nativ, Einat; Weizman, Abraham; Gothelf, Doron

    2016-12-01

    In this study, we report the developmental, physical and psychiatric manifestations of 22q11.2 deletion syndrome (22q11.2DS) in a large Israeli cohort, and search for a possible association between preterm birth and the risk for psychotic disorders. The study population consisted of 128 individuals with 22q11.2DS (77 male, 51 female), aged 1-55 years (mean ± SD 12.9 ± 11.0). All subjects underwent a comprehensive medical evaluation. All subjects older than 5 years (n = 104) were also evaluated psychiatrically. Overall, we found rates of physical manifestations similar to those previously reported in the literature. Psychiatric disorders were very common among our study population, with psychotic disorders occurring in 16.3 % of the psychiatrically evaluated population. We found an association between the presence of psychotic disorders and preterm birth. Our results replicate and extend the findings of a previous work and suggest that the evolution of psychosis in 22q11.2DS is a neurodevelopmental process with early obstetric and medical precursors.

  14. Mutations in ABCA12 Underlie the Severe Congenital Skin Disease Harlequin Ichthyosis

    PubMed Central

    Kelsell, David P.; Norgett, Elizabeth E.; Unsworth, Harriet; Teh, Muy-Teck; Cullup, Thomas; Mein, Charles A.; Dopping-Hepenstal, Patricia J.; Dale, Beverly A.; Tadini, Gianluca; Fleckman, Philip; Stephens, Karen G.; Sybert, Virginia P.; Mallory, Susan B.; North, Bernard V.; Witt, David R.; Sprecher, Eli; E. M. Taylor, Aileen; Ilchyshyn, Andrew; Kennedy, Cameron T.; Goodyear, Helen; Moss, Celia; Paige, David; Harper, John I.; Young, Bryan D.; Leigh, Irene M.; Eady, Robin A. J.; O’Toole, Edel A.

    2005-01-01

    Harlequin ichthyosis (HI) is the most severe and frequently lethal form of recessive congenital ichthyosis. Although defects in lipid transport, protein phosphatase activity, and differentiation have been described, the genetic basis underlying the clinical and cellular phenotypes of HI has yet to be determined. By use of single-nucleotide–polymorphism chip technology and homozygosity mapping, a common region of homozygosity was observed in five patients with HI in the chromosomal region 2q35. Sequencing of the ABCA12 gene, which maps within the minimal region defined by homozygosity mapping, revealed disease-associated mutations, including large intragenic deletions and frameshift deletions in 11 of the 12 screened individuals with HI. Since HI epidermis displays abnormal lamellar granule formation, ABCA12 may play a critical role in the formation of lamellar granules and the discharge of lipids into the intercellular spaces, which would explain the epidermal barrier defect seen in this disorder. This finding paves the way for early prenatal diagnosis. In addition, functional studies of ABCA12 will lead to a better understanding of epidermal differentiation and barrier formation. PMID:15756637

  15. A De Novo Deletion in the Regulators of Complement Activation Cluster Producing a Hybrid Complement Factor H/Complement Factor H-Related 3 Gene in Atypical Hemolytic Uremic Syndrome.

    PubMed

    Challis, Rachel C; Araujo, Geisilaine S R; Wong, Edwin K S; Anderson, Holly E; Awan, Atif; Dorman, Anthony M; Waldron, Mary; Wilson, Valerie; Brocklebank, Vicky; Strain, Lisa; Morgan, B Paul; Harris, Claire L; Marchbank, Kevin J; Goodship, Timothy H J; Kavanagh, David

    2016-06-01

    The regulators of complement activation cluster at chromosome 1q32 contains the complement factor H (CFH) and five complement factor H-related (CFHR) genes. This area of the genome arose from several large genomic duplications, and these low-copy repeats can cause genome instability in this region. Genomic disorders affecting these genes have been described in atypical hemolytic uremic syndrome, arising commonly through nonallelic homologous recombination. We describe a novel CFH/CFHR3 hybrid gene secondary to a de novo 6.3-kb deletion that arose through microhomology-mediated end joining rather than nonallelic homologous recombination. We confirmed a transcript from this hybrid gene and showed a secreted protein product that lacks the recognition domain of factor H and exhibits impaired cell surface complement regulation. The fact that the formation of this hybrid gene arose as a de novo event suggests that this cluster is a dynamic area of the genome in which additional genomic disorders may arise. Copyright © 2016 by the American Society of Nephrology.

  16. Precise excision and self-integration of a composite transposon as a model for spontaneous large-scale chromosome inversion/deletion of the Staphylococcus haemolyticus clinical strain JCSC1435.

    PubMed

    Watanabe, Shinya; Ito, Teruyo; Morimoto, Yuh; Takeuchi, Fumihiko; Hiramatsu, Keiichi

    2007-04-01

    Large-scale chromosomal inversions (455 to 535 kbp) or deletions (266 to 320 kbp) were found to accompany spontaneous loss of beta-lactam resistance during drug-free passage of the multiresistant Staphylococcus haemolyticus clinical strain JCSC1435. Identification and sequencing of the rearranged chromosomal loci revealed that ISSha1 of S. haemolyticus is responsible for the chromosome rearrangements.

  17. Genetic Mapping of Brain Plasticity Across Development in Williams Syndrome: ERP Markers of Face and Language Processing

    PubMed Central

    Mills, D. L.; Dai, L.; Fishman, I.; Yam, A.; Appelbaum, L. G.; Galaburda, A.; Bellugi, U.; Korenberg, J. R.

    2014-01-01

    In Williams Syndrome (WS), a known genetic deletion results in atypical brain function with strengths in face and language processing. We examined how genetic influences on brain activity change with development. In three studies, ERPs from large samples of children, adolescents, and adults with the full genetic deletion for WS were compared to typically developing controls, and two adults with partial deletions for WS. Studies 1 and 2 identified ERP markers of brain plasticity in WS across development. Study 3 suggested that in adults with partial deletions for WS, specific genes may be differentially implicated in face and language processing. PMID:24219698

  18. Large-mutation spectra induced at hemizygous loci by low-LET radiation: evidence for intrachromosomal proximity effects

    NASA Technical Reports Server (NTRS)

    Costes, S.; Sachs, R.; Hlatky, L.; Vannais, D.; Waldren, C.; Fouladi, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    A mathematical model is used to analyze mutant spectra for large mutations induced by low-LET radiation. The model equations are based mainly on two-break misrejoining that leads to deletions or translocations. It is assumed, as a working hypothesis, that the initial damage induced by low-LET radiation is located randomly in the genome. Specifically, we analyzed data for two hemizygous loci: CD59- mutants, mainly very large-scale deletions (>3 Mbp), in human-hamster hybrid cells, and data from the literature on those HPRT- mutants which involve at least deletion of the whole gene, and often of additional flanking markers (approximately 50-kbp to approximately 4.4-Mbp deletions). For five data sets, we estimated f, the probability that two given breaks on the same chromosome will misrejoin to make a deletion, as a function of the separation between the breaks. We found that f is larger for nearby breaks than for breaks that are more widely separated; i.e., there is a "proximity effect". For acute irradiation, the values of f determined from the data are consistent with the corresponding break misrejoining parameters found previously in quantitative modeling of chromosome aberrations. The value of f was somewhat smaller for protracted irradiation than for acute irradiation at a given total dose; i.e., the mutation data show a decrease that was smaller than expected for dose protraction by fractionation or low dose rate.

  19. [Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

    PubMed

    Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

    2016-08-01

    To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia 1.

  20. Copy Number Variation in Obsessive-Compulsive Disorder and Tourette Syndrome: A Cross-Disorder Study

    PubMed Central

    McGrath, Lauren M.; Yu, Dongmei; Marshall, Christian; Davis, Lea K.; Thiruvahindrapuram, Bhooma; Li, Bingbin; Cappi, Carolina; Gerber, Gloria; Wolf, Aaron; Schroeder, Frederick A.; Osiecki, Lisa; O’Dushlaine, Colm; Kirby, Andrew; Illmann, Cornelia; Haddad, Stephen; Gallagher, Patience; Fagerness, Jesen A.; Barr, Cathy L.; Bellodi, Laura; Benarroch, Fortu; Bienvenu, O. Joseph; Black, Donald W.; Bloch, Michael H.; Bruun, Ruth D.; Budman, Cathy L.; Camarena, Beatriz; Cath, Danielle C.; Cavallini, Maria C.; Chouinard, Sylvain; Coric, Vladimir; Cullen, Bernadette; Delorme, Richard; Denys, Damiaan; Derks, Eske M.; Dion, Yves; Rosário, Maria C.; Eapen, Valsama; Evans, Patrick; Falkai, Peter; Fernandez, Thomas; Garrido, Helena; Geller, Daniel; Grabe, Hans J.; Grados, Marco A.; Greenberg, Benjamin D.; Gross-Tsur, Varda; Grünblatt, Edna; Heiman, Gary A.; Hemmings, Sian M.J.; Herrera, Luis D.; Hounie, Ana G.; Jankovic, Joseph; Kennedy, James L; King, Robert A.; Kurlan, Roger; Lanzagorta, Nuria; Leboyer, Marion; Leckman, James F.; Lennertz, Leonhard; Lochner, Christine; Lowe, Thomas L.; Lyon, Gholson J.; Macciardi, Fabio; Maier, Wolfgang; McCracken, James T.; McMahon, William; Murphy, Dennis L.; Naarden, Allan L; Neale, Benjamin M; Nurmi, Erika; Pakstis, Andrew J.; Pato, Michele T.; Pato, Carlos N.; Piacentini, John; Pittenger, Christopher; Pollak, Yehuda; Reus, Victor I.; Richter, Margaret A.; Riddle, Mark; Robertson, Mary M.; Rosenberg, David; Rouleau, Guy A.; Ruhrmann, Stephan; Sampaio, Aline S.; Samuels, Jack; Sandor, Paul; Sheppard, Brooke; Singer, Harvey S.; Smit, Jan H.; Stein, Dan J.; Tischfield, Jay A.; Vallada, Homero; Veenstra-VanderWeele, Jeremy; Walitza, Susanne; Wang, Ying; Wendland, Jens R.; Shugart, Yin Yao; Miguel, Euripedes C.; Nicolini, Humberto; Oostra, Ben A.; Moessner, Rainald; Wagner, Michael; Ruiz-Linares, Andres; Heutink, Peter; Nestadt, Gerald; Freimer, Nelson; Petryshen, Tracey; Posthuma, Danielle; Jenike, Michael A.; Cox, Nancy J.; Hanna, Gregory L.; Brentani, Helena; Scherer, Stephen W.; Arnold, Paul D.; Stewart, S. Evelyn; Mathews, Carol A.; Knowles, James A.; Cook, Edwin H.; Pauls, David L.; Wang, Kai; Scharf, Jeremiah M.

    2014-01-01

    Objective Obsessive-compulsive disorder (OCD) and Tourette syndrome (TS) are heritable, neurodevelopmental disorders with a partially shared genetic etiology. This study represents the first genome-wide investigation of large (>500kb), rare (<1%) copy number variants (CNVs) in OCD and the largest genome-wide CNV analysis in TS to date. Method The primary analyses utilized a cross-disorder design for 2,699 patients (1,613 ascertained for OCD, 1,086 ascertained for TS) and 1,789 controls. Parental data facilitated a de novo analysis in 348 OCD trios. Results Although no global CNV burden was detected in the cross-disorder analysis or in secondary, disease-specific analyses, there was a 3.3-fold increased burden of large deletions previously associated with other neurodevelopmental disorders (p=.09). Half of these neurodevelopmental deletions were located in a single locus, 16p13.11 (5 patient deletions: 0 control deletions, p=0.08 in current study, p=0.025 compared to published controls). Three 16p13.11 deletions were confirmed de novo, providing further support to the etiological significance of this region. The overall OCD de novo rate was 1.4%, which is intermediate between published rates in controls (0.7%) and in autism or schizophrenia (2–4%). Conclusion Several converging lines of evidence implicate 16p13.11 deletions in OCD, with weaker evidence for a role in TS. The trend toward increased overall neurodevelopmental CNV burden in TS and OCD suggests that deletions previously associated with other neurodevelopmental disorders may also contribute to these phenotypes. PMID:25062598

  1. Characterization of a hypoallergenic wheat line lacking ω-5 gliadin.

    PubMed

    Kohno, Kunie; Takahashi, Hitoshi; Endo, Takashi R; Matsuo, Hiroaki; Shiwaku, Kuninori; Morita, Eishin

    2016-10-01

    There is no curative treatment for wheat-dependent exercise-induced anaphylaxis (WDEIA). ω-5 Gliadin is one of the dominant allergens affecting WDEIA patients. The use of ω-5 gliadin-free wheat flour in the regular diet is considered one of the prophylactic approaches against the elicitation of allergic symptoms and sensitization to ω-5 gliadin. We sought to find hypoallergenic bread wheat (or common wheat) that lacked the genes encoding ω-5 gliadin and to evaluate its in vitro allergenicity. We also aimed to evaluate the sensitization ability of one of the selected hypoallergenic wheat lines by using a possible animal model of wheat allergy. We screened the deletion lines of bread wheat by western blotting to ascertain common wheat lines lacking the ω-5 gliadin locus. The deletion lines we used have partial deficiency of chromosome 1B (Endo and Gill, 1996). To assess sensitization ability of gluten from the selected deletion line, guinea pigs were fed with either the gluten from the selected deletion line or commercially available gluten, and allergic score was evaluated after challenging the same gluten preparations. We found that a deletion line 1BS-18 had the least deficiency of chromosome 1B among the deletion stocks lacking the ω-5 gliadin locus. The challenge test using the guinea pigs revealed that the symptoms induced by application of the 1BS-18 gluten were much less than that of commercially available gluten. The deletion line 1BS-18, which lacked the ω-5 gliadin locus, is likely to have a low sensitization capacity in the guinea pig. The use of the wheat products of the 1BS-18 line in daily life may provide a feasible solution for the onset of wheat allergy. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  2. Prevalence of phonological disorders and phonological processes in typical and atypical phonological development.

    PubMed

    Ceron, Marizete Ilha; Gubiani, Marileda Barichello; Oliveira, Camila Rosa de; Gubiani, Marieli Barichello; Keske-Soares, Márcia

    2017-05-08

    To determine the occurrence of phonological disorders by age, gender and school type, and analyze the phonological processes observed in typical and atypical phonological development across different age groups. The sample consisted of 866 children aged between 3:0 and 8:11 years, recruited from public and private schools in the city of Santa Maria/RS. A phonological evaluation was performed to analyze the operative phonological processes. 15.26% (n = 132) of the sample presented atypical phonological acquisition (phonological disorders). Phonological impairments were more frequent in public school students across all age groups. Phonological alterations were most frequent between ages 4 -to 6, and more prevalent in males than females in all but the youngest age group. The most common phonological processes in typical phonological acquisition were: cluster reduction; nonlateral liquid deletion in coda; nonlateral liquid substitution in onset; semivocalization of lateral liquids in coda; and unstressed syllable deletion. In children with phonological disorders, the most common phonological processes were: lateral and nonlateral liquid substitution in onset position; nonlateral liquid deletion; fronting of fricatives in onset position; unstressed syllable deletion; semivocalization of nonlateral liquid in coda; and nonlateral liquid deletion in coda position. Phonological processes were highly prevalent in the present sample, and occurred more often in boys than in girls. Information regarding the type and frequency of phonological processes in both typical phonological acquisition and phonological disorders may contribute to early diagnosis and increase the efficiency of treatment planning.

  3. A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle: Additional Evidence for the Common Occurrence of Balancing Selection in Livestock

    PubMed Central

    Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole; Iso-Touru, Terhi; Guldbrandtsen, Bernt; Karim, Latifa; Nielsen, Ulrik Sander; Panitz, Frank; Aamand, Gert Pedersen; Schulman, Nina; Georges, Michel; Vilkki, Johanna; Lund, Mogens Sandø; Druet, Tom

    2014-01-01

    In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated. PMID:24391517

  4. Genomic Alterations in Biliary Atresia Suggests Region of Potential Disease Susceptibility in 2q37.3

    PubMed Central

    Leyva-Vega, Melissa; Gerfen, Jennifer; Thiel, Brian D.; Jurkiewicz, Dorota; Rand, Elizabeth B.; Pawlowska, Joanna; Kaminska, Diana; Russo, Pierre; Gai, Xiaowu; Krantz, Ian D.; Kamath, Binita M.; Hakonarson, Hakon; Haber, Barbara A.; Spinner, Nancy B.

    2010-01-01

    Biliary atresia (BA) is a progressive, idiopathic obliteration of the extrahepatic biliary system occurring exclusively in the neonatal period. It is the most common disease leading to liver transplantation in children. The etiology of BA is unknown, although infectious, immune and genetic causes have been suggested. While the recurrence of BA in families is not common, there are more than 30 multiplex families reported and an underlying genetic susceptibility has been hypothesized. We screened a cohort of 35 BA patients for genomic alterations that might confer susceptibility to BA. DNA was genotyped on the Illumina Quad550 platform, which analyzes over 550,000 single nucleotide polymorphisms (SNPs) for genomic deletions and duplications. Areas of increased and decreased copy number were compared to those found in control populations. In order to identify regions that could serve as susceptibility factors for BA, we searched for regions that were found in BA patients, but not in controls. We identified two unrelated BA patients with overlapping heterozygous deletions of 2q37.3. Patient 1 had a 1.76 Mb (280 SNP), heterozygous deletion containing thirty genes. Patient 2 had a 5.87 Mb (1,346 SNP) heterozygous deletion containing fifty-five genes. The overlapping 1.76 Mb deletion on chromosome 2q37.3 from 240,936,900 to 242,692,820 constitutes the critical region and the genes within this region could be candidates for susceptibility to BA. PMID:20358598

  5. Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

    PubMed Central

    Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

    2018-01-01

    Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

  6. Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.

    PubMed

    Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang

    2015-10-01

    The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.

  7. Malformations of the middle and inner ear on CT imaging in 22q11 deletion syndrome.

    PubMed

    Loos, Elke; Verhaert, Nicolas; Willaert, Annelore; Devriendt, Koenraad; Swillen, Ann; Hermans, Robert; Op de Beeck, Katya; Hens, Greet

    2016-11-01

    The 22q11 deletion syndrome (22q11DS), the most frequent microdeletion syndrome in humans, presents with a large variety of abnormalities. A common abnormality is hearing impairment. The exact pathophysiological explanation of the observed hearing loss remains largely unknown. The aim of this study was to analyze the middle and inner ear malformations as seen on computer tomographic imaging in patients with 22q11DS. We retrospectively reviewed the charts of 11 22q11DS patients who had undergone a CT of the temporal bone in the past. Of the 22 examined ears, two showed an abnormal malleus and incus, 10 presented with a dense stapes superstructure, and three ears had an abnormal orientation of the stapes. With regard to the inner ear, 12 ears showed an incomplete partition type II with a normal vestibular aqueduct. In four ears the vestibule and lateral semicircular canal were composed of a single cavity, in 14 ears the vestibule was too wide, and three ears had a broadened lateral semicircular canal. These findings suggest that malformations of the stapes, cochlea, vestibule, and lateral semicircular canal are frequent in 22q11DS. To our knowledge, the current study involves the largest case series describing middle and inner ear malformations in 22q11DS. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.

    PubMed

    Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S

    2010-05-01

    Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.

  9. Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

    PubMed

    Todd, Antonette R; Donofrio, Nicole; Sripathi, Venkateswara R; McClean, Phillip E; Lee, Rian K; Pastor-Corrales, Marcial; Kalavacharla, Venu Kal

    2017-05-23

    Common bean ( Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg , (Complements resistance gene), which is required for Ur-3 -mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant "Sierra" and susceptible crg) with rust race 53 of U. appendiculatus , isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of "Sierra" leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations.

  10. Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

    PubMed Central

    Todd, Antonette R.; Donofrio, Nicole; Sripathi, Venkateswara R.; McClean, Phillip E.; Lee, Rian K.; Pastor-Corrales, Marcial; Kalavacharla, Venu (Kal)

    2017-01-01

    Common bean (Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg, (Complements resistance gene), which is required for Ur-3-mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant “Sierra” and susceptible crg) with rust race 53 of U. appendiculatus, isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of “Sierra” leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations. PMID:28545258

  11. Thalassaemia screening among students in a secondary school in Ampang, Malaysia.

    PubMed

    Jameela, S; Sabirah, S O Sharifah; Babam, J; Phan, C L; Visalachy, P; Chang, K M; Salwana, M A; Zuraidah, A; Subramanian, Y; Rahimah, A

    2011-12-01

    Thalassaemia is a common disorder in Malaysia. It is estimated that 4.5% of the population are carriers for beta- or alpha- thalassaemias. We set out to screen Form 4 students aged between 15 and 16 years old in a national school, for thalassaemia in March 2008. Written consent was obtained from 310 students. The carrier rate for the common thalassaemia syndromes was 6.8% (2.9% for beta-thalassaemia, 2.6% for HbE and 1.3% for two-gene deletion for alpha-thalassaemia). Carriers for beta-thalassaemia and two-gene deletion for alpha-thalassaemia were more common in the Chinese (4.3% and 1.4% respectively) while heterozygous HbE was more common in the Malays (3.8%). The laboratory cost of screening one student was RM 45 and the total number of man-hours spent in this screening activity was 600. This screening exercise showed that thalassaemia carriers are common among the Chinese and Malays and it is feasible to carry out a screening programme for secondary school students.

  12. Radiation-induced total-deletion mutations in the human hprt gene: a biophysical model based on random walk interphase chromatin geometry

    NASA Technical Reports Server (NTRS)

    Wu, H.; Sachs, R. K.; Yang, T. C.

    1998-01-01

    PURPOSE: To develop a biophysical model that explains the sizes of radiation-induced hprt deletions. METHODS: Key assumptions: (1) Deletions are produced by two DSB that are closer than an interaction distance at the time of DSB induction; (2) Interphase chromatin is modelled by a biphasic random walk distribution; and (3) Misrejoining of DSB from two separate tracks dominates at low-LET and misrejoining of DSB from a single track dominates at high-LET. RESULTS: The size spectra for radiation-induced total deletions of the hprt gene are calculated. Comparing with the results of Yamada and coworkers for gamma-irradiated human fibroblasts the study finds that an interaction distance of 0.75 microm will fit both the absolute frequency and the size spectrum of the total deletions. It is also shown that high-LET radiations produce, relatively, more total deletions of sizes below 0.5 Mb. The model predicts an essential gene to be located between 2 and 3 Mb from the hprt locus towards the centromere. Using the same assumptions and parameters as for evaluating mutation frequencies, a frequency of intra-arm chromosome deletions is calculated that is in agreement with experimental data. CONCLUSIONS: Radiation-induced total-deletion mutations of the human hprt gene and intrachange chromosome aberrations share a common mechanism for their induction.

  13. Circularized Chromosome with a Large Palindromic Structure in Streptomyces griseus Mutants

    PubMed Central

    Uchida, Tetsuya; Ishihara, Naoto; Zenitani, Hiroyuki; Hiratsu, Keiichiro; Kinashi, Haruyasu

    2004-01-01

    Streptomyces linear chromosomes display various types of rearrangements after telomere deletion, including circularization, arm replacement, and amplification. We analyzed the new chromosomal deletion mutants Streptomyces griseus 301-22-L and 301-22-M. In these mutants, chromosomal arm replacement resulted in long terminal inverted repeats (TIRs) at both ends; different sizes were deleted again and recombined inside the TIRs, resulting in a circular chromosome with an extremely large palindrome. Short palindromic sequences were found in parent strain 2247, and these sequences might have played a role in the formation of this unique structure. Dynamic structural changes of Streptomyces linear chromosomes shown by this and previous studies revealed extraordinary strategies of members of this genus to keep a functional chromosome, even if it is linear or circular. PMID:15150216

  14. Two patients with chromosome 22q11.2 deletion presenting with childhood obesity and hyperphagia.

    PubMed

    Bassett, J K; Chandler, K E; Douzgou, S

    2016-08-01

    Chromosome 22q11.2 deletion syndrome is a clinically heterogeneous condition of intellectual disability, parathyroid and thyroid hypoplasia, palatal abnormalities, cardiac malformations and psychiatric symptoms. Hyperphagia and childhood obesity is widely reported in Prader-Willi Syndrome (PWS) but there is only one previous report of this presentation in chromosome 22q11.2 deletion syndrome. We describe two further cases of chromosome 22q11.2 deletion syndrome in which hyperphagia and childhood obesity were the presenting features. This may be a manifestation of obsessive behaviour secondary to some of the psychiatric features commonly seen in chromosome 22q11.2 deletion syndrome. Serious complications may result from hyperphagia and childhood obesity therefore early recognition and intervention is crucial. Due to the similar clinical presentation of these two patients to patients with PWS, it is suggested that the hyperphagia seen here should be managed in a similar way to how it is managed in PWS. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  15. Refining the 22q11.2 deletion breakpoints in DiGeorge syndrome by aCGH

    PubMed Central

    Bittel, D.C.; Yu, S.; Newkirk, H.; Kibiryeva, N.; Holt, S.; Butler, M.G.; Cooley, L.D.

    2009-01-01

    Hemizygous deletions of the chromosome 22q11.2 region result in the 22q11.2 deletion syndrome also referred to as DiGeorge, Velocardiofacial or Shprintzen syndromes. The phenotype is variable but commonly includes conotruncal cardiac defects, palatal abnormalities, learning and behavioral problems, immune deficiency, and facial anomalies. Four distinct highly homologous blocks of low copy number repeat sequences (LCRs) flank the deletion region. Mispairing of LCRs during meiosis with unequal meiotic exchange is assumed to cause the recurrent and consistent deletions. The proximal LCR is reportedly located at 22q11.2 from 17.037 to 17.083 Mb while the distal LCR is located from 19.835 to 19.880 Mb. Although the chromosome breakpoints are thought to localize to the LCRs, the positions of the breakpoints have been investigated in only a few individuals. Therefore, we used high resolution oligonucleotide-based 244K microarray comparative genomic hybridization (aCGH) to resolve the breakpoints in a cohort of 20 subjects with known 22q11.2 deletions. We also investigated copy number variation (CNV) in the rest of the genome. The 22q11.2 breaks occurred on either side of the LCR in our subjects, although more commonly on the distal side of the reported proximal LCR. The proximal breakpoints in our subjects spanned the region from 17.036 to 17.398 Mb. This region includes the genes DGCR6 (DiGeorge syndrome critical region protein 6) and PRODH (proline dehydrogenase 1), along with three open reading frames that may encode proteins of unknown function. The distal breakpoints spanned the region from 19.788 to 20.122 Mb. This region includes the genes GGT2 (gamma-glutamyltransferase-like protein 2), HIC2 (hypermethylated in cancer 2), and multiple transcripts of unknown function. The genes in these two breakpoint regions are variably hemizygous depending on the location of the breakpoints. Our 20 subjects had 254 CNVs throughout the genome, 94 duplications and 160 deletions, ranging in size from 1 kb to 2.4 Mb. The presence or absence of genes at the breakpoints depending on the size of the deletion plus variation in the rest of the genome due to CNVs likely contribute to the variable phenotype associated with the 22q11.2 deletion or DiGeorge syndrome. PMID:19420922

  16. Identifying Effective Signals to Predict Deleted and Suspended Accounts on Twitter across Languages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volkova, Svitlana; Bell, Eric B.

    Social networks have an ephemerality to them where accounts and messages are constantly being edited, deleted, or marked as private. This continuous change comes from concerns around privacy, a potential desire for deception, and spam-like behavior. In this study we analyze multiple large datasets of thousands of active and deleted Twitter accounts to produce a series of predictive features for the removal or shutdown of an account. We have selected these accounts from speakers of three languages -- Russian, Spanish, and English to evaluate if speakers of various languages behave differently with regards to deleting accounts. We find that unlikemore » previously used profile and network features, the discourse of deleted vs. active accounts forms the basis for highly accurate account deletion prediction. More precisely, we observed that the presence of a certain set of terms in user tweets leads to a higher likelihood for that user's account deletion. We show that the predictive power of profile, language, affect, and network features is not consistent across speakers of the three evaluated languages.« less

  17. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    PubMed

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain.

  18. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

    PubMed Central

    Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

    2014-01-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence interval 2.24–31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. PMID:25281868

  19. A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

    PubMed

    Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

    2016-10-01

    Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

  20. A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

    PubMed Central

    Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

    2010-01-01

    Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

  1. Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

    PubMed Central

    Kirkegaard, K; Nelsen, B

    1990-01-01

    Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

  2. A novel large deletion in the RYR1 gene in a Belgian family with late-onset and recessive core myopathy.

    PubMed

    Remiche, Gauthier; Kadhim, Hazim; Abramowicz, Marc; Mavroudakis, Nicolas; Monnier, Nicole; Lunardi, Joël

    2015-05-01

    We report a novel and particularly unusual type of mutation, namely, large deletion in the RYR1 gene, in a Belgian family with myopathy: Patients were found to be compound heterozygous and presented a clinico-pathological phenotype characterized by late-onset and recessive myopathy with cores. We depict the clinical, electrophysiological, pathological and molecular genetic characteristics of family members. To date, large deletions in the RYR1 gene have been reported in only two cases. Both involved different mutations and, in sharp contrast to our cases, presented with a very early-onset, neonatal, and a very severe or lethal phenotype. Overview of reported clinico-pathologic phenotypes, also highlights the rarity of combined late-onset/recessive co-occurrence in this group of myopathies with cores. Finally, this report underlines the broadening spectrum in this group of myopathologic disorders and highlights the concept of 'RYR1-associated/related core myopathies'. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Relationship between Reaction Time, Fine Motor Control, and Visual-Spatial Perception on Vigilance and Visual-Motor Tasks in 22q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Howley, Sarah A.; Prasad, Sarah E.; Pender, Niall P.; Murphy, Kieran C.

    2012-01-01

    22q11.2 Deletion Syndrome (22q11DS) is a common microdeletion disorder associated with mild to moderate intellectual disability and specific neurocognitive deficits, particularly in visual-motor and attentional abilities. Currently there is evidence that the visual-motor profile of 22q11DS is not entirely mediated by intellectual disability and…

  4. Performance on the Modified Card Sorting Test and Its Relation to Psychopathology in Adolescents and Young Adults with 22Q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Rockers, K.; Ousley, O.; Sutton, T.; Schoenberg, E.; Coleman, K.; Walker, E.; Cubells, J. F.

    2009-01-01

    Background: Approximately one-third of individuals with 22q11.2 deletion syndrome (22q11DS), a common genetic disorder highly associated with intellectual disabilities, may develop schizophrenia, likely preceded by a mild to moderate cognitive decline. Methods: We examined adolescents and young adults with 22q11DS for the presence of executive…

  5. Large Sequence Polymorphisms of the Euro-American lineage of Mycobacterium tuberculosis: a phylogenetic reconstruction and evidence for convergent evolution in the DR locus.

    PubMed

    Rindi, Laura; Lari, Nicoletta; Garzelli, Carlo

    2012-10-01

    The Euro-American lineage of the Mycobacterium tuberculosis complex consists of 10 sublineages, each defined by a deletion of a large genomic region (RD, region of difference); by spoligotyping, that probes the polymorphism of the Direct Repeat (DR) locus, the Euro-American strains are classified into 5 lineages (T, Haarlem, LAM, S and X) and 34 sublineages, but the relationships between the RD-defined sublineages and the spoligotype groupings are largely unclear. By testing a global sample of 158 Euro-American strains, mutually exclusive deletions of RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 or RD761 were found in 122 strains; deletion of RD724, typical of strains from Central Africa, was not found. The RD-defined sublineages, tested for katG463/gyrA95 polymorphism, belonged to Principal Genotypic Group (PGG) 2, with the exception of RD219 sublineage belonging to PGG3; the 36 strains with no deletion were of either PGG2 or 3. Based on these polymorphisms, a phylogenetic reconstruction of the Euro-American lineage, that integrates the previously reported phylogeny, is proposed. Although certain deletions were found to be associated to certain spoligotype lineages (i.e., deletion RD115 to T and LAM, RD174 to LAM, RD182 to Haarlem, RD219 to T), our analysis indicates a general lack of concordance between RD-defined sublineages and spoligotype groupings. Moreover, of the 42 spoligotypes detected among the study strains, sixteen were shared by strains belonging to different RD sublineages. IS6110-RFLP analysis of strains sharing spoligotypes confirmed a poor genetic relatedness between strains of different RD sublineages. These findings provide evidence for the occurrence of a high degree of homoplasy in the DR locus leading to convergent evolution to identical spoligotypes. The incongruence between Large Sequence Polymorphism and spoligotype polymorphism argues against the use of spoligotyping for establishing phylogenetic relationships within the Euro-American lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  7. Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

    PubMed Central

    Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

    2014-01-01

    A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

  8. Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

    PubMed

    Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

    2017-08-16

    The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

  9. High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families.

    PubMed

    Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C

    2014-06-01

    Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

    PubMed

    Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

    2016-04-28

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

  11. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

    PubMed Central

    Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

    2016-01-01

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

  12. A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

    PubMed

    Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

    2001-11-01

    A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

  13. Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

    PubMed

    Möller, M; Hellberg, Å; Olsson, M L

    2018-02-01

    ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

  14. Efficient genome engineering of a virulent Klebsiella bacteriophage using CRISPR-Cas9.

    PubMed

    Shen, Juntao; Zhou, Jinjie; Chen, Guo-Qiang; Xiu, Zhi-Long

    2018-06-13

    Klebsiella pneumoniae is one of the most common nosocomial opportunistic pathogens usually with multiple drug-resistance. Phage therapy, a potential new therapeutics to replace or supplement antibiotics, has attracted much attention. However, very few Klebsiella phages have been well-characterized as the lack of efficient genome editing tools. Here, Cas9 from Streptococcus pyogenes and a single guide RNA (sgRNA) were used to modify a virulent Klebsiella bacteriophage phiKpS2. We firstly evaluated the distribution of sgRNA activity in phages and proved that it's largely inconsistent with the predicted activity from current models trained on eukaryotic cell datasets. A simple CRISPR-based phage genome editing procedure was developed based on the discovery that homologous arms as short as 30-60 bp was sufficient to introduce point mutation, gene deletion and swap. We also demonstrated that weak sgRNAs could be used for precise phage genome editing but failed to select random recombinants, possibly because inefficient cleavage can be tolerated through continuous repair by homologous recombination with the uncut genomes. Small frameshift deletion was proved to be an efficient way to evaluate the essentiality of phage genes. By using the above strategies, a putative promoter and nine genes of phiKpS2 were successfully deleted. Interestingly, the holin gene can be deleted with little effect on phiKpS2 infection, but the reason is not yet clear. This study established an efficient, time-saving, and cost-effective procedure for phage genome editing, which is expected to significantly promote the development of bacteriophage therapy. IMPORTANCE In the present study, we have addressed an efficient, time-saving and cost-effective CRISPR-based phage genome editing of Klebsiella phage, which has the potential to significantly expand our knowledge of phage-host interactions and to promote the applications of phage therapy. The distribution of sgRNA activity was first evaluated in phages. Short homologous arms were proved enough to introduce point mutation, small frameshift deletion, gene deletion and swap into phages, and weak sgRNAs were proved useful for precise phage genome editing but failed to select random recombinants, which all make the CRISPR-based phage genome editing easier to use. Copyright © 2018 American Society for Microbiology.

  15. LARG at chromosome 11q23 has functional characteristics of a tumor suppressor in human breast cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Danny C.T.; Rudduck, Christina; Chin, Koei

    2008-05-06

    Deletion of 11q23-q24 is frequent in a diverse variety of malignancies, including breast and colorectal carcinoma, implicating the presence of a tumor suppressor gene at that chromosomal region. We show here that LARG, from 11q23, has functional characteristics of a tumor suppressor. We examined a 6-Mb region on 11q23 by high-resolution deletion mapping, utilizing both loss of heterozygosity (LOH) analysis and microarray comparative genomic hybridization (CGH). LARG (also called ARHGEF12), identified from the analyzed region, was underexpressed in 34% of primary breast carcinomas and 80% of breast cancer cell lines including the MCF-7 line. Multiplex ligation-dependent probe amplification on 30more » primary breast cancers and six breast cancer cell lines showed that LARG had the highest frequency of deletion compared to the BCSC-1 and TSLC1 genes, two known candidate tumor suppressor genes from 11q. In vitro analysis of breast cancer cell lines that underexpress LARG showed that LARG could be reactivated by trichostatin A, a histone deacetylase inhibitor, but not by 5-Aza-2{prime}-deoxycytidine, a demethylating agent. Bisulfite sequencing and quantitative high-throughput analysis of DNA methylation confirmed the lack of CpG island methylation in LARG in breast cancer. Restoration of LARG expression in MCF-7 cells by stable transfection resulted in reduced proliferation and colony formation, suggesting that LARG has functional characteristics of a tumor suppressor gene.« less

  16. Pfhrp2-Deleted Plasmodium falciparum Parasites in the Democratic Republic of the Congo: A National Cross-sectional Survey.

    PubMed

    Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R

    2017-07-01

    Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  17. Chronic lymphocytic leukemia-associated chromosomal abnormalities and miRNA deregulation.

    PubMed

    Kiefer, Yvonne; Schulte, Christoph; Tiemann, Markus; Bullerdiek, Joern

    2012-01-01

    Chronic lymphocytic leukemia is the most common leukemia in adults. By cytogenetic investigations major subgroups of the disease can be identified that reflect different routes of tumor development. Of these chromosomal deviations, trisomy 12 and deletions of parts of either the long arm of chromosome 13, the long arm of chromosome 11, or the short arm of chromosome 17 are most commonly detected. In some of these aberrations the molecular target has been identified as eg, ataxia telangiectasia mutated (ATM) in case of deletions of chromosomal region 11q22~23 and the genes encoding microRNAs miR-15a/16-1 as likely targets of deletions of chromosomal band 13q14.3. Of note, these aberrations do not characterize independent subgroups but often coexist within the metaphases of one tumor. Generally, complex aberrations are associated with a worse prognosis than simple karyotypic alterations. Due to smaller sizes of the missing segment the detection of recurrent deletions is not always possible by means of classical cytogenetics but requires more advanced techniques as in particular fluorescence in situ hybridization (FISH). Nevertheless, at this time it is not recommended to replace classical cytogenetics by FISH because this would miss additional information given by complex or secondary karyotypic alterations. However, the results of cytogenetic analyses allow the stratification of prognostic and predictive groups of the disease. Of these, the group characterized by deletions involving TP53 is clinically most relevant. In the future refined methods as eg, array-based comparative genomic hybridization will supplement the existing techniques to characterize CLL.

  18. Molecular diagnosis of α-thalassemia in a multiethnic population.

    PubMed

    Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah

    2017-06-01

    α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

    PubMed Central

    Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

    2007-01-01

    Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

  20. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    PubMed

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  1. In vivo DNA deletion assay to detect environmental and genetic predisposition to cancer.

    PubMed

    Reliene, Ramune; Bishop, Alexander J R; Aubrecht, Jiri; Schiestl, Robert H

    2004-01-01

    Large-scale genomic rearrangements such as DNA deletions play a role in the etiology of cancer. The frequency of DNA deletions can be elevated by exposure to carcinogens or by mutations in genes involved in the maintenance of genomic integrity. The in vivo DNA deletion assay allows a visual detection of deletion events within the pink-eyed unstable (pun) locus in developing mouse embryos. A deletion of one copy of a duplicated 70-kb DNA fragment within the pun locus restores the pink-eyed dilute (p) gene, which encodes a protein responsible for the assembly of a black color melanin complex. Deletion events occurring in premelanocytes cause visible black patches (fur-spots) on the light gray fur of offspring and black pigmented cells (eye-spots) on the unpigmented retinal pigment epithelium (RPE). In the fur-spot assay, 10-d-old pups are observed for black spots on the fur. In the eye-spot assay, mice are sacrificed at d 20, eyes are removed, and the wholemount RPE slides are prepared for eye-spot analysis. The frequency, size, and position relative to the optic nerve of the eye-spots are determined. This assay can be used to study the effect of environmental chemicals and physical agents as well as the genetic control of DNA deletions in vivo.

  2. Hypertensive Cerebral Hemorrhage in a Patient with Turner Syndrome Caused by Deletion in the Short Arm of the X Chromosome.

    PubMed

    Hori, Yusuke S; Ohkura, Takahiro; Ebisudani, Yuki; Umakoshi, Michiari; Ishi, Masato; Oda, Kazunori; Aoi, Mizuho; Inoue, Takushi; Furujo, Mahoko; Tanaka, Hiroyuki; Fukuhara, Toru

    2018-01-01

    Turner syndrome is a chromosomal disorder usually caused by complete deletion of an X chromosome, with deletion in the short arm of the X chromosome being a rare cause of the condition. Patients with Turner syndrome commonly develop hypertension, and associated vascular complications such as aortic dissection or cerebral hemorrhage have been reported. Cerebral hemorrhage in Turner syndrome is a rare complication, and only a few reports have been published. In these reports, all patients have XO karyotypes or a mosaic type as the cause of Turner syndrome, while no other Turner syndrome types have been documented. In this report, we present for the first time a patient with Turner syndrome caused by deletion in the short arm of the X chromosome who experienced hypertensive hemorrhage as a late complication. © 2017 S. Karger AG, Basel.

  3. Genetic diagnosis of Duchenne and Becker muscular dystrophy using multiplex ligation-dependent probe amplification in Rwandan patients.

    PubMed

    Uwineza, Annette; Hitayezu, Janvier; Murorunkwere, Seraphine; Ndinkabandi, Janvier; Kalala Malu, Celestin Kaputu; Caberg, Jean Hubert; Dideberg, Vinciane; Bours, Vincent; Mutesa, Leon

    2014-04-01

    Duchenne and Becker muscular dystrophies are the most common clinical forms of muscular dystrophies. They are genetically X-linked diseases caused by a mutation in the dystrophin (DMD) gene. A genetic diagnosis was carried out in six Rwandan patients presenting a phenotype of Duchenne and Becker muscular dystrophies and six asymptomatic female carrier relatives using multiplex ligation-dependent probe amplification (MLPA). Our results revealed deletion of the exons 48-51 in one patient, an inherited deletion of the exons 8-21 in two brothers and a de novo deletion of the exons 46-50 in the fourth patient. No copy number variation was found in two patients. Only one female carrier presented exon deletion in the DMD gene. This is the first cohort of genetic analysis in Rwandan patients affected by Duchenne and Becker muscular dystrophies. This report confirmed that MLPA assay can be easily implemented in low-income countries.

  4. PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

    PubMed

    Drozniewska, Malgorzata; Haus, Olga

    2014-01-01

    Deletions of the PAX3 gene have been rarely reported in the literature. Mutations of this gene are a common cause of Waardenburg syndrome type 1 and 3. We report a 16 year old female presenting hearing loss and normal intellectual development, without major features of Waardenburg syndrome type 1, and without family history of the syndrome. Her phenotype, however, overlaps with features of craniofacial-deafness-hand syndrome. Microarray analysis showed ~862 kb de novo deletion at 2q36.1 including PAX3. The above findings suggest that the rearrangement found in our patient appeared de novo and with high probability is a cause of her phenotype.

  5. Genomic gigantism: DNA loss is slow in mountain grasshoppers.

    PubMed

    Bensasson, D; Petrov, D A; Zhang, D X; Hartl, D L; Hewitt, G M

    2001-02-01

    Several studies have shown DNA loss to be inversely correlated with genome size in animals. These studies include a comparison between Drosophila and the cricket, Laupala, but there has been no assessment of DNA loss in insects with very large genomes. Podisma pedestris, the brown mountain grasshopper, has a genome over 100 times as large as that of Drosophila and 10 times as large as that of Laupala. We used 58 paralogous nuclear pseudogenes of mitochondrial origin to study the characteristics of insertion, deletion, and point substitution in P. pedestris and Italopodisma. In animals, these pseudogenes are "dead on arrival"; they are abundant in many different eukaryotes, and their mitochondrial origin simplifies the identification of point substitutions accumulated in nuclear pseudogene lineages. There appears to be a mononucleotide repeat within the 643-bp pseudogene sequence studied that acts as a strong hot spot for insertions or deletions (indels). Because the data for other insect species did not contain such an unusual region, hot spots were excluded from species comparisons. The rate of DNA loss relative to point substitution appears to be considerably and significantly lower in the grasshoppers studied than in Drosophila or Laupala. This suggests that the inverse correlation between genome size and the rate of DNA loss can be extended to comparisons between insects with large or gigantic genomes (i.e., Laupala and Podisma). The low rate of DNA loss implies that in grasshoppers, the accumulation of point mutations is a more potent force for obscuring ancient pseudogenes than their loss through indel accumulation, whereas the reverse is true for Drosophila. The main factor contributing to the difference in the rates of DNA loss estimated for grasshoppers, crickets, and Drosophila appears to be deletion size. Large deletions are relatively rare in Podisma and Italopodisma.

  6. Detection limit of intragenic deletions with targeted array comparative genomic hybridization

    PubMed Central

    2013-01-01

    Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607

  7. The importance of genetic diagnosis for Duchenne muscular dystrophy

    PubMed Central

    Aartsma-Rus, Annemieke; Ginjaar, Ieke B; Bushby, Kate

    2016-01-01

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy are caused by mutations in the dystrophin-encoding DMD gene. Large deletions and duplications are most common, but small mutations have been found as well. Having a correct diagnosis is important for family planning and providing proper care to patients according to published guidelines. With mutation-specific therapies under development for DMD, a correct diagnosis is now also important for assessing whether patients are eligible for treatments. This review discusses different mutations causing DMD, diagnostic techniques available for making a genetic diagnosis for children suspected of DMD and the importance of having a specific genetic diagnosis in the context of emerging genetic therapies for DMD. PMID:26754139

  8. Velo-Cardio-Facial syndrome and DiGeorge sequence with meningomyelocele and deletions of the 22q11 region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nickel, R.E.; Pillers, D.M.; Merkens, M.

    Approximately 5% of children with neural tube defects (NTDs) have a congenital heart defect and/or cleft lip and palate. The cause of isolated meningomyelocele, congenital heart defects, or cleft lip and palate has been largely thought to be multifactorial. However, chromosomal, teratogenic, and single gene causes of combinations of NTDs with congenital heart defects and/or cleft lip and palate have been reported. We report on 3 patients with meningomyelocele, congenital heart defects, and 22q11 deletions. Two of the children had the clinical diagnosis of velo-cardio-facial syndrome (VCFS); both have bifid uvula. The third child had DiGeorge sequence (DGS). The associationmore » of NTDs with 22q11 deletion has not been reported previously. An accurate diagnosis of the 22q11 deletion is critical as this micro-deletion and its associated clinical problems is transmitted as an autosomal dominant trait due to the inheritance of the deletion-bearing chromosome. We recommend that all children with NTDs and congenital heart defects, with or without cleft palate, have cytogenetic and molecular studies performed to detect 22q11 deletions. 31 refs., 3 figs.« less

  9. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    PubMed

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Internally deleted WNV genomes isolated from exotic birds in New Mexico: function in cells, mosquitoes, and mice.

    PubMed

    Pesko, Kendra N; Fitzpatrick, Kelly A; Ryan, Elizabeth M; Shi, Pei-Yong; Zhang, Bo; Lennon, Niall J; Newman, Ruchi M; Henn, Matthew R; Ebel, Gregory D

    2012-05-25

    Most RNA viruses exist in their hosts as a heterogeneous population of related variants. Due to error prone replication, mutants are constantly generated which may differ in individual fitness from the population as a whole. Here we characterize three WNV isolates that contain, along with full-length genomes, mutants with large internal deletions to structural and nonstructural protein-coding regions. The isolates were all obtained from lorikeets that died from WNV at the Rio Grande Zoo in Albuquerque, NM between 2005 and 2007. The deletions are approximately 2kb, in frame, and result in the elimination of the complete envelope, and portions of the prM and NS-1 proteins. In Vero cell culture, these internally deleted WNV genomes function as defective interfering particles, reducing the production of full-length virus when introduced at high multiplicities of infection. In mosquitoes, the shortened WNV genomes reduced infection and dissemination rates, and virus titers overall, and were not detected in legs or salivary secretions at 14 or 21 days post-infection. In mice, inoculation with internally deleted genomes did not attenuate pathogenesis relative to full-length or infectious clone derived virus, and shortened genomes were not detected in mice at the time of death. These observations provide evidence that large deletions may occur within flavivirus populations more frequently than has generally been appreciated and suggest that they impact population phenotype minimally. Additionally, our findings suggest that highly similar mutants may frequently occur in particular vertebrate hosts. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. A large Indian family with rearrangement of chromosome 4p16 and 3p26.3 and divergent clinical presentations.

    PubMed

    Iype, Thomas; Alakbarzade, Vafa; Iype, Mary; Singh, Royana; Sreekantan-Nair, Ajith; Chioza, Barry A; Mohapatra, Tribhuvan M; Baple, Emma L; Patton, Michael A; Warner, Thomas T; Proukakis, Christos; Kulkarni, Abhi; Crosby, Andrew H

    2015-11-10

    The deletion of the chromosome 4p16.3 Wolf-Hirschhorn syndrome critical region (WHSCR-2) typically results in a characteristic facial appearance, varying intellectual disability, stereotypies and prenatal onset of growth retardation, while gains of the same chromosomal region result in a more variable degree of intellectual deficit and dysmorphism. Similarly the phenotype of individuals with terminal deletions of distal chromosome 3p (3p deletion syndrome) varies from mild to severe intellectual deficit, micro- and trigonocephaly, and a distinct facial appearance. We investigated a large Indian five-generation pedigree with ten affected family members in which chromosomal microarray and fluorescence in situ hybridization analyses disclosed a complex rearrangement involving chromosomal subregions 4p16.1 and 3p26.3 resulting in a 4p16.1 deletion and 3p26.3 microduplication in three individuals, and a 4p16.1 duplication and 3p26.3 microdeletion in seven individuals. A typical clinical presentation of WHS was observed in all three cases with 4p16.1 deletion and 3p26.3 microduplication. Individuals with a 4p16.1 duplication and 3p26.3 microdeletion demonstrated a range of clinical features including typical 3p microdeletion or 4p partial trisomy syndrome to more severe neurodevelopmental delay with distinct dysmorphic features. We present the largest pedigree with complex t(4p;3p) chromosomal rearrangements and diverse clinical outcomes including Wolf Hirschorn-, 3p deletion-, and 4p duplication syndrome amongst affected individuals.

  12. Large Deletions at the SHOX Locus in the Pseudoautosomal Region Are Associated with Skeletal Atavism in Shetland Ponies

    PubMed Central

    Rafati, Nima; Andersson, Lisa S.; Mikko, Sofia; Feng, Chungang; Raudsepp, Terje; Pettersson, Jessica; Janecka, Jan; Wattle, Ove; Ameur, Adam; Thyreen, Gunilla; Eberth, John; Huddleston, John; Malig, Maika; Bailey, Ernest; Eichler, Evan E.; Dalin, Göran; Chowdary, Bhanu; Andersson, Leif; Lindgren, Gabriella; Rubin, Carl-Johan

    2016-01-01

    Skeletal atavism in Shetland ponies is a heritable disorder characterized by abnormal growth of the ulna and fibula that extend the carpal and tarsal joints, respectively. This causes abnormal skeletal structure and impaired movements, and affected foals are usually killed. In order to identify the causal mutation we subjected six confirmed Swedish cases and a DNA pool consisting of 21 control individuals to whole genome resequencing. We screened for polymorphisms where the cases and the control pool were fixed for opposite alleles and observed this signature for only 25 SNPs, most of which were scattered on genome assembly unassigned scaffolds. Read depth analysis at these loci revealed homozygosity or compound heterozygosity for two partially overlapping large deletions in the pseudoautosomal region (PAR) of chromosome X/Y in cases but not in the control pool. One of these deletions removes the entire coding region of the SHOX gene and both deletions remove parts of the CRLF2 gene located downstream of SHOX. The horse reference assembly of the PAR is highly fragmented, and in order to characterize this region we sequenced bacterial artificial chromosome (BAC) clones by single-molecule real-time (SMRT) sequencing technology. This considerably improved the assembly and enabled size estimations of the two deletions to 160−180 kb and 60−80 kb, respectively. Complete association between the presence of these deletions and disease status was verified in eight other affected horses. The result of the present study is consistent with previous studies in humans showing crucial importance of SHOX for normal skeletal development. PMID:27207956

  13. Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes.

    PubMed

    Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; Ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

    2017-08-01

    Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients.

  14. Deletion Diagnostics for the Generalised Linear Mixed Model with independent random effects

    PubMed Central

    Ganguli, B.; Roy, S. Sen; Naskar, M.; Malloy, E. J.; Eisen, E. A.

    2015-01-01

    The Generalised Linear Mixed Model (GLMM) is widely used for modelling environmental data. However, such data are prone to influential observations which can distort the estimated exposure-response curve particularly in regions of high exposure. Deletion diagnostics for iterative estimation schemes commonly derive the deleted estimates based on a single iteration of the full system holding certain pivotal quantities such as the information matrix to be constant. In this paper, we present an approximate formula for the deleted estimates and Cook’s distance for the GLMM which does not assume that the estimates of variance parameters are unaffected by deletion. The procedure allows the user to calculate standardised DFBETAs for mean as well as variance parameters. In certain cases, such as when using the GLMM as a device for smoothing, such residuals for the variance parameters are interesting in their own right. In general, the procedure leads to deleted estimates of mean parameters which are corrected for the effect of deletion on variance components as estimation of the two sets of parameters is interdependent. The probabilistic behaviour of these residuals is investigated and a simulation based procedure suggested for their standardisation. The method is used to identify influential individuals in an occupational cohort exposed to silica. The results show that failure to conduct post model fitting diagnostics for variance components can lead to erroneous conclusions about the fitted curve and unstable confidence intervals. PMID:26626135

  15. An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3.

    PubMed

    Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

    2014-03-01

    With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders.

  16. An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3

    PubMed Central

    Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

    2014-01-01

    With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders. PMID:23860047

  17. Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes

    PubMed Central

    Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

    2017-01-01

    Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients. PMID:28356564

  18. Monosomy1p36.3 and trisomy 19p13.3 in a child with periventricular nodular heterotopia.

    PubMed

    Descartes, Maria; Mikhail, Fady M; Franklin, Judith C; McGrath, Tony M; Bebin, Martina

    2011-10-01

    Monosomy 1p36 is a clinically recognizable syndrome that is considered to be the most common terminal deletion syndrome. It has characteristic clinical features that include craniofacial dysmorphism, congenital anomalies, hearing deficits, developmental delay, mental retardation, hypotonia, seizures, and brain anomalies. Brain anomalies in patients with 1p36 deletion are frequent but inconsistent. To date, 2 cases with monosomy 1p36 associated with periventricular nodular heterotopia (PNH) have been reported. We report a 2-month-old boy with multiple congenital anomalies; brain magnetic resonance imaging revealed PNH. The first 2 described cases were pure terminal deletions, whereas our patient carried unbalanced translocation due to an adjacent 1 segregation of a balanced maternal translocation, resulting in monosomy 1p36.3 and trisomy 19p13.3 identified by whole-genome array comparative genomic hybridization analysis. Our patient, with a smaller deletion that the 2 previously reported cases, can help narrow the critical region for PNH in association with the 1p36 deletion. Several potential candidate genes are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Frequency of heterozygous TET2 deletions in myeloproliferative neoplasms

    PubMed Central

    Tripodi, Joseph; Hoffman, Ronald; Najfeld, Vesna; Weinberg, Rona

    2010-01-01

    The Philadelphia chromosome (Ph)-negative myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a group of clonal hematopoietic stem cell disorders with overlapping clinical and cytogenetic features and a variable tendency to evolve into acute leukemia. These diseases not only share overlapping chromosomal abnormalities but also a number of acquired somatic mutations. Recently, mutations in a putative tumor suppressor gene, ten-eleven translocation 2 (TET2) on chromosome 4q24 have been identified in 12% of patients with MPN. Additionally 4q24 chromosomal rearrangements in MPN, including TET2 deletions, have also been observed using conventional cytogenetics. The goal of this study was to investigate the frequency of genomic TET2 rearrangements in MPN using fluorescence in situ hybridization as a more sensitive method for screening and identifying genomic deletions. Among 146 MPN patients, we identified two patients (1.4%) who showed a common 4q24 deletion, including TET2. Our observations also indicated that the frequency of TET2 deletion is increased in patients with an abnormal karyotype (5%). PMID:21188113

  20. Deletion mapping of chromosome 13q in head and neck squamous cell carcinoma in Indian patients: correlation with prognosis of the tumour

    PubMed Central

    Sabbir, Golam Md; Roy, Anup; Mandal, Syamsundar; Dam, Aniruddha; Roychoudhury, Susanta; Panda, Chinmay Kumar

    2006-01-01

    Deletions in chromosome (chr.) 13q occur frequently in head and neck squamous cell carcinoma (HNSCC). Previous studies failed to identify common deleted regions in chr.13q, though several candidate tumour suppressor genes (TSGs) loci, e.g. BRCA2, RB1 and BRCAX have been localized in this chromosome, as well as no prognostic significance of the deletion has been reported. Thus, in the present study, deletion mapping of chr. 13q has been done in 55 primary HNSCC samples of Indian patients using 11 highly polymorphic microsatellite markers of which three were intragenic to BRCA2 gene, one intragenic to RB1 gene and another from BRCAX locus. The deletion in chr.13q was significantly associated with progression of HNSCC. High frequencies (27–39%) of loss of heterozygosity were found in 13q13.1 (BRCA2), 13q14.2 (RB1), 13q21.2–22.1 (BRCAX) and 13q31.1 regions. Deletions in the BRCA2 and RB1 regions were significantly correlated. The four highly deleted regions were associated with clinical stage and histological grades of the tumour as well as poor patient outcome. Deletion in the 13q31.1 region was only found to be associated with HPV infection. High frequencies (11–23%) of microsatellite size alteration (MA) were seen to overlap with the highly deleted regions. Forty per cent of the samples showed rare biallelic alteration whereas loss of normal copy of chromosome 13q was seen in five tumours. Thus, it seems that the putative TSGs located in the BRCAX and 13q31.1 regions as well as the BRCA2 and RB1 genes may have some cumulative effect in progression and poor prognosis of HNSCC. Significant association between deletion in BRCA2 and RB1 gene loci may indicate functional relationship between the genes in this tumour progression. PMID:16623759

  1. PTEN genomic deletion predicts prostate cancer recurrence and is associated with low AR expression and transcriptional activity

    PubMed Central

    2012-01-01

    Background Prostate cancer (PCa), a leading cause of cancer death in North American men, displays a broad range of clinical outcome from relatively indolent to lethal metastatic disease. Several genomic alterations have been identified in PCa which may serve as predictors of progression. PTEN, (10q23.3), is a negative regulator of the phosphatidylinositol 3-kinase (PIK3)/AKT survival pathway and a tumor suppressor frequently deleted in PCa. The androgen receptor (AR) signalling pathway is known to play an important role in PCa and its blockade constitutes a commonly used treatment modality. In this study, we assessed the deletion status of PTEN along with AR expression levels in 43 primary PCa specimens with clinical follow-up. Methods Fluorescence In Situ Hybridization (FISH) was done on formalin fixed paraffin embedded (FFPE) PCa samples to examine the deletion status of PTEN. AR expression levels were determined using immunohistochemistry (IHC). Results Using FISH, we found 18 cases of PTEN deletion. Kaplan-Meier analysis showed an association with disease recurrence (P=0.03). Concurrently, IHC staining for AR found significantly lower levels of AR expression within those tumors deleted for PTEN (P<0.05). To validate these observations we interrogated a copy number alteration and gene expression profiling dataset of 64 PCa samples, 17 of which were PTEN deleted. We confirmed the predictive value of PTEN deletion in disease recurrence (P=0.03). PTEN deletion was also linked to diminished expression of PTEN (P<0.01) and AR (P=0.02). Furthermore, gene set enrichment analysis revealed a diminished expression of genes downstream of AR signalling in PTEN deleted tumors. Conclusions Altogether, our data suggest that PTEN deleted tumors expressing low levels of AR may represent a worse prognostic subset of PCa establishing a challenge for therapeutic management. PMID:23171135

  2. An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

    PubMed

    Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

    2016-06-01

    The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

  3. Functional Studies and Homology Modeling of Msh2-Msh3 Predict that Mispair Recognition Involves DNA Bending and Strand Separation▿ †

    PubMed Central

    Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.

    2010-01-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420

  4. Functional studies and homology modeling of Msh2-Msh3 predict that mispair recognition involves DNA bending and strand separation.

    PubMed

    Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D

    2010-07-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.

  5. Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

    PubMed Central

    Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

    2010-01-01

    We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

  6. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    PubMed Central

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional domains. Images PMID:3003386

  7. Cytogenetic and molecular analysis in Angelman syndrome.

    PubMed

    Zackowski, J L; Nicholls, R D; Gray, B A; Bent-Williams, A; Gottlieb, W; Harris, P J; Waters, M F; Driscoll, D J; Zori, R T; Williams, C A

    1993-04-01

    We report on cytogenetic and molecular analyses of 29 Angelman syndrome (AS) individuals ascertained in 1990 through the first National Angelman Syndrome Conference. High resolution GTG- and GBG-banded chromosomes were studied. Standard molecular analysis with six 15q11q13 DNA sequences was used to analyze copy number and parental origin of 15q11q13. Concordance between molecular and cytogenetic data was excellent. The combined data showed that 23 of the 27 probands (85%) on whom we had definitive results have deletions of the chromosome 15q11q13 region. Two classes of deletion were detected molecularly: most patients were deleted for the 5 more proximal probes, but in 2 cases the deletion extended distally to include in sixth probe. In the 13 cases where the parental origin of the deleted chromosome 15 could be established, it was maternal. There were no cases of uniparental disomy. Cytological observations of the relative sizes of the heterochromatic regions of the short arm of chromosome 15 suggested that chromosomes with large heterochromatic blocks may be more prone to de novo deletion.

  8. Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular dystrophy patients: introducing three novel variants.

    PubMed

    Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar

    2016-06-01

    Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.

  9. Molecular analyses of 17p11.2 deletions in 62 Smith-Magenis syndrome patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Juyal, R.C.; Figuera, L.E.; Hauge, X.

    1996-05-01

    Smith-Magenis syndrome (SMS) is a clinically recognizable, multiple congenital anomalies/mental retardation syndrome caused by an interstitial deletion involving band p11.2 of chromosome 17. Toward the molecular definition of the interval defining this microdeletion syndrome, 62 unrelated SMS patients in conjunction with 70 available unaffected parents were molecularly analyzed with respect to the presence or absence of 14 loci in the proximal region of the short arm of chromosome 17. A multifaceted approach was used to determine deletion status at the various loci that combined (1) FISH analysis, (2) PCR and Southern analysis of somatic cell hybrids retaining the deleted chromosomemore » 17 from selected patients, and (3) genotype determination of patients for whom a parent(s) was available at four microsatellite marker loci and at four loci with associated RFLPs. The relative order of two novel anonymous markers and a new microsatellite marker was determined in 17p11.2. The results confirmed that the proximal deletion breakpoint in the majority of SMS patients is located between markers D17S58 (EW301) and D17S446 (FG1) within the 17p11.1-17p11.2 region. The common distal breakpoint was mapped between markers cCI17-638, which lies distal to D17S71, and cCI17-498, which lies proximal to the Charcot Marie-Tooth disease type 1A locus. The locus D17S258 was found to be deleted in all 62 patients, and probes from this region can be used for diagnosis of the SMS deletion by FISH. Ten patients demonstrated molecularly distinct deletions; of these, two patients had smaller deletions and will enable the definition of the critical interval for SMS. 49 refs.« less

  10. Microarray and FISH-based genotype-phenotype analysis of 22 Japanese patients with Wolf-Hirschhorn syndrome.

    PubMed

    Shimizu, Kenji; Wakui, Keiko; Kosho, Tomoki; Okamoto, Nobuhiko; Mizuno, Seiji; Itomi, Kazuya; Hattori, Shigeto; Nishio, Kimio; Samura, Osamu; Kobayashi, Yoshiyuki; Kako, Yuko; Arai, Takashi; Tsutomu, Oh-ishi; Kawame, Hiroshi; Narumi, Yoko; Ohashi, Hirofumi; Fukushima, Yoshimitsu

    2014-03-01

    Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome of the distal 4p chromosome, characterized by craniofacial features, growth impairment, intellectual disability, and seizures. Although genotype-phenotype correlation studies have previously been published, several important issues remain to be elucidated including seizure severity. We present detailed clinical and molecular-cytogenetic findings from a microarray and fluorescence in situ hybridization (FISH)-based genotype-phenotype analysis of 22 Japanese WHS patients, the first large non-Western series. 4p deletions were terminal in 20 patients and interstitial in two, with deletion sizes ranging from 2.06 to 29.42 Mb. The new Wolf-Hirschhorn syndrome critical region (WHSCR2) was deleted in all cases, and duplication of other chromosomal regions occurred in four. Complex mosaicism was identified in two cases: two different 4p terminal deletions; a simple 4p terminal deletion and an unbalanced translocation with the same 4p breakpoint. Seizures began in infancy in 33% (2/6) of cases with small (<6 Mb) deletions and in 86% (12/14) of cases with larger deletions (>6 Mb). Status epilepticus occurred in 17% (1/6) with small deletions and in 87% (13/15) with larger deletions. Renal hypoplasia or dysplasia and structural ocular anomalies were more prevalent in those with larger deletions. A new susceptible region for seizure occurrence is suggested between 0.76 and 1.3 Mb from 4 pter, encompassing CTBP1 and CPLX1, and distal to the previously-supposed candidate gene LETM1. The usefulness of bromide therapy for seizures and additional clinical features including hypercholesterolemia are also described. © 2013 Wiley Periodicals, Inc.

  11. Do the exome: A case of Williams-Beuren syndrome with severe epilepsy due to a truncating de novo variant in GABRA1.

    PubMed

    Popp, Bernt; Trollmann, Regina; Büttner, Christian; Caliebe, Almuth; Thiel, Christian T; Hüffmeier, Ulrike; Reis, André; Zweier, Christiane

    2016-10-01

    Williams-Beuren syndrome (WBS) is a relatively common, clinically recognizable microdeletion syndrome. In most cases the typical heterozygous deletion of 1.5 Mb on chromosome 7q11.23 spanning about 26 genes can be identified. Also some larger or smaller atypical deletions have been reported and associated with additional or atypical phenotypic aspects. We report on an individual with typical WBS due to the common deletion and with refractory infantile spasms. Using trio-exome sequencing, we identified a de novo truncating variant c.1200del, p (Lys401Serfs*25) in GABRA1 as the likely cause of the early onset epilepsy. This unique case not only allows to further define the phenotypic spectrum of infantile epileptic encephalopathy associated with rare de novo GABRA1 variants but exemplifies the need for a sensitive review of unclear associations in clinically defined syndromes and for extended diagnostic work-up in individuals with unusual presentations of a genetically confirmed diagnosis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  12. Co-inheritance of α-thalassaemia and β-thalassaemia in a prenatal screening population in mainland China.

    PubMed

    Li, Jian; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi

    2014-12-01

    To determine the prevalence of α-thalassaemia in β-thalassaemia individuals in a Chinese population. The standard diagnostic marker for β-thalassaemia was elevation of the Hb A2 level (>3.5%) with low mean corpuscular volume. The common α-thalassaemia mutations were studied by molecular analysis in all identified β-thalassaemia carriers. A prevalence rate of 3.3% for β-thalassaemia was found in our population; α- and β-thalassaemia interactions were found to co-exist in 17.8% of the β-thalassaemia carriers. The -SEA deletion was the most common α-thalassaemia mutation co-inherited with β-thalassaemia, followed by the -α3.7 deletion, the -α4.2 deletion, Hb Quong Sze, and Hb Constant Spring. Our results suggest that it could be valuable to study co-existing α-globin mutations in subjects with β-thalassaemia trait in a prenatal screening programme, especially in populations with a high prevalence of haemoglobinopathies. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. Genetic basis of Bartter syndrome in Korea.

    PubMed

    Lee, Beom Hee; Cho, Hee Yeon; Lee, HyunKyung; Han, Kyoung Hee; Kang, Hee Gyung; Ha, Il Soo; Lee, Joo Hoon; Park, Young Seo; Shin, Jae Il; Lee, Dae-Yeol; Kim, Su-Yung; Choi, Yong; Cheong, Hae Il

    2012-04-01

    Bartter syndrome (BS) is clinically classified into antenatal or neonatal BS (aBS) and classic BS (cBS) as well as five subtypes based on the underlying mutant gene; SLC12A1 (BS I), KCNJ1 (BS II), CLCNKB (BS III), BSND (BS IV) and CASR (BS V). Clinico-genetic features of a nationwide cohort of 26 Korean children with BS were investigated. The clinical diagnosis was aBS in 8 (30.8%), cBS in 15 (57.7%) and mixed Bartter-Gitelman phenotype in 3 cases (11.5%). Five of eight patients with aBS and all 18 patients with either cBS or mixed Bartter-Gitelman phenotype had CLCNKB mutations. Among the 23 patients (46 alleles) with CLCNKB mutations, p.W610X and large deletions were detected in 25 (54.3%) and 10 (21.7%) alleles, respectively. There was no genotype-phenotype correlation in patients with CLCNKB mutations. Twenty-three (88.5%) of the 26 BS patients involved in this study had CLCNKB mutations. The p.W610X mutation and large deletion were two common types of mutations in CLCNKB. The clinical manifestations of BS III were heterogeneous without a genotype-phenotype correlation, typically manifesting cBS phenotype but also aBS or mixed Bartter-Gitelman phenotypes. The molecular diagnostic steps for patients with BS in our population should be designed taking these peculiar genotype distributions into consideration, and a new more clinically relevant classification including BS and Gitelman syndrome is required.

  14. p16/CDKN2A FISH in Differentiation of Diffuse Malignant Peritoneal Mesothelioma From Mesothelial Hyperplasia and Epithelial Ovarian Cancer.

    PubMed

    Ito, Tomohiro; Hamasaki, Makoto; Matsumoto, Shinji; Hiroshima, Kenzo; Tsujimura, Tohru; Kawai, Toshiaki; Shimao, Yoshiya; Marutsuka, Kousuke; Moriguchi, Sayaka; Maruyama, Riruke; Miyamoto, Shingo; Nabeshima, Kazuki

    2015-06-01

    It can be difficult to differentiate diffuse malignant peritoneal mesothelioma (DMPM) from reactive mesothelial hyperplasia (RMH) or peritoneal dissemination of gynecologic malignancies, such as epithelial ovarian cancer (EOC), which cause a large amount of ascites. Detection of the homozygous deletion of p16/CDKN2A (p16) by fluorescence in situ hybridization (FISH) is an effective adjunct in the diagnosis of malignant pleural mesothelioma. The aim of this study was to investigate the ability of the p16 FISH assay to differentiate DMPM from RMH and EOC. p16 FISH was performed in 28 DMPMs (successful in 19), 30 RMHs, and 40 EOC cases. The cutoff values of p16 FISH were more than 10% for homozygous deletion and more than 40% for heterozygous deletion. According to the above criteria, nine (47.4%) of 19 successful DMPM cases were homozygous deletion positive, and three (15.8%) of 19 were heterozygous deletion positive, whereas all RMH cases were negative for the p16 deletion. In all four major histologic subtypes of EOC, neither p16 homozygous nor heterozygous deletions were detected. To differentiate DMPM from RMH or EOC, the sensitivity of the p16 homozygous deletion was 32% (9/28), and the specificity was 100%. Our study suggests that p16 FISH analysis is useful in differentiating DMPM from RMH and EOC when homozygous deletion is detected. Copyright© by the American Society for Clinical Pathology.

  15. Generation of megabase-scale deletions, inversions and duplications involving the Contactin-6 gene in mice by CRISPR/Cas9 technology.

    PubMed

    Korablev, Alexei N; Serova, Irina A; Serov, Oleg L

    2017-12-28

    Copy Number Variation (CNV) of the human CNTN6 gene (encoding the contactin-6 protein), caused by deletions or duplications, is responsible for severe neurodevelopmental impairments, often in combination with facial dysmorphias. Conversely, deleterious point mutations of this gene do not show any clinical phenotypes. The aim of this study is to generate mice carrying large deletions, duplications and inversions involving the Cntn6 gene as a new experimental model to study CNV of the human CNTN6 locus. To generate large chromosomal rearrangements on mouse chromosome 6, we applied CRISPR/Cas9 technology in zygotes. Two guide RNAs (gRNAs) (flanking a DNA fragment of 1137 Mb) together with Cas9 mRNA and single-stranded DNA oligonucleotides (ssODN) were microinjected into the cytoplasm of 599 zygotes of F1 (C57BL x CBA) mice, and 256 of them were transplanted into oviducts of CD-1 females. As a result, we observed the birth of 41 viable F0 offspring. Genotyping of these mice was performed by PCR analysis and sequencing of PCR products. Among the 41 F0 offspring, we identified seven mice with deletions, two animals carrying duplications of the gene and four carrying inversions. Interestingly, two F0 offspring had both deletions and duplications. It is important to note that while three of seven deletion carriers showed expected sequences at the new joint sites, in another three, we identified an absence of 1-10 nucleotides at the CRISPR/Cas9 cut sites, and in one animal, 103 bp were missing, presumably due to error-prone non-homologous end joining. In addition, we detected the absence of 5 and 13 nucleotides at these sites in two F0 duplication carriers. Similar sequence changes at CRISPR/Cas9 cut sites were observed at the right and left boundaries of inversions. Thus, megabase-scale deletions, duplications and inversions were identified in 11 F0 offspring among 41 analyzed, i.e., approximately 25% efficiency. All genetically modified F0 offspring were viable and able to transmit these large chromosomal rearrangements to the next generation. Using CRISPR/Cas9 technology, we created mice carrying megabase-scale deletions, duplications, and inversions involving the full-sized Cntn6 gene. These mice became founders of new mouse lines, which may be more appropriate experimental models of CNV in the human 3p26.3 region than Сntn6 knockout mice.

  16. A comprehensive study of small non-frameshift insertions/deletions in proteins and prediction of their phenotypic effects by a machine learning method (KD4i)

    PubMed Central

    2014-01-01

    Background Small insertion and deletion polymorphisms (Indels) are the second most common mutations in the human genome, after Single Nucleotide Polymorphisms (SNPs). Recent studies have shown that they have significant influence on genetic variation by altering human traits and can cause multiple human diseases. In particular, many Indels that occur in protein coding regions are known to impact the structure or function of the protein. A major challenge is to predict the effects of these Indels and to distinguish between deleterious and neutral variants. When an Indel occurs within a coding region, it can be either frameshifting (FS) or non-frameshifting (NFS). FS-Indels either modify the complete C-terminal region of the protein or result in premature termination of translation. NFS-Indels insert/delete multiples of three nucleotides leading to the insertion/deletion of one or more amino acids. Results In order to study the relationships between NFS-Indels and Mendelian diseases, we characterized NFS-Indels according to numerous structural, functional and evolutionary parameters. We then used these parameters to identify specific characteristics of disease-causing and neutral NFS-Indels. Finally, we developed a new machine learning approach, KD4i, that can be used to predict the phenotypic effects of NFS-Indels. Conclusions We demonstrate in a large-scale evaluation that the accuracy of KD4i is comparable to existing state-of-the-art methods. However, a major advantage of our approach is that we also provide the reasons for the predictions, in the form of a set of rules. The rules are interpretable by non-expert humans and they thus represent new knowledge about the relationships between the genotype and phenotypes of NFS-Indels and the causative molecular perturbations that result in the disease. PMID:24742296

  17. Molecular cytogenetic analysis of Xq critical regions in premature ovarian failure

    PubMed Central

    2013-01-01

    Background One of the frequent reasons for unsuccessful conception is premature ovarian failure/primary ovarian insufficiency (POF/POI) that is defined as the loss of functional follicles below the age of 40 years. Among the genetic causes the most common one involves the X chromosome, as in Turner syndrome, partial X deletion and X-autosome translocations. Here we report a case of a 27-year-old female patient referred to genetic counselling because of premature ovarian failure. The aim of this case study to perform molecular genetic and cytogenetic analyses in order to identify the exact genetic background of the pathogenic phenotype. Results For premature ovarian failure disease diagnostics we performed the Fragile mental retardation 1 gene analysis using Southern blot technique and Repeat Primed PCR in order to identify the relationship between the Fragile mental retardation 1 gene premutation status and the premature ovarion failure disease. At this early onset, the premature ovarian failure affected patient we detected one normal allele of Fragile mental retardation 1 gene and we couldn’t verify the methylated allele, therefore we performed the cytogenetic analyses using G-banding and fluorescent in situ hybridization methods and a high resolution molecular cytogenetic method, the array comparative genomic hybridization technique. For this patient applying the G-banding, we identified a large deletion on the X chromosome at the critical region (ChrX q21.31-q28) which is associated with the premature ovarian failure phenotype. In order to detect the exact breakpoints, we used a special cytogenetic array ISCA plus CGH array and we verified a 67.355 Mb size loss at the critical region which include total 795 genes. Conclusions We conclude for this case study that the karyotyping is definitely helpful in the evaluation of premature ovarian failure patients, to identify the non submicroscopic chromosomal rearrangement, and using the array CGH technique we can contribute to the most efficient detection and mapping of exact deletion breakpoints of the deleted Xq region. PMID:24359613

  18. Subtelomeric deletions of chromosome 6p: molecular and cytogenetic characterization of three new cases with phenotypic overlap with Ritscher-Schinzel (3C) syndrome.

    PubMed

    Descipio, Cheryl; Schneider, Lori; Young, Terri L; Wasserman, Nora; Yaeger, Dinah; Lu, Fengmin; Wheeler, Patricia G; Williams, Marc S; Bason, Lynn; Jukofsky, Lori; Menon, Ammini; Geschwindt, Ryan; Chudley, Albert E; Saraiva, Jorge; Schinzel, Albert A G L; Guichet, Agnes; Dobyns, William E; Toutain, Annick; Spinner, Nancy B; Krantz, Ian D

    2005-04-01

    We have identified six children in three families with subtelomeric deletions of 6p25 and a recognizable phenotype consisting of ptosis, posterior embryotoxon, optic nerve abnormalities, mild glaucoma, Dandy-Walker malformation, hydrocephalus, atrial septal defect, patent ductus arteriosus, and mild mental retardation. There is considerable clinical overlap between these children and individuals with the Ritscher-Schinzel (or cranio-cerebello-cardiac (3C)) syndrome (OMIM #220210). Clinical features of 3C syndrome include craniofacial anomalies (macrocephaly, prominent forehead and occiput, foramina parietalia, hypertelorism, down-slanting palpebral fissures, ocular colobomas, depressed nasal bridge, narrow or cleft palate, and low-set ears), cerebellar malformations (variable manifestations of a Dandy-Walker malformation with moderate mental retardation), and cardiac defects (primarily septal defects). Since the original report, over 25 patients with 3C syndrome have been reported. Recessive inheritance has been postulated based on recurrence in siblings born to unaffected parents and parental consanguinity in two familial cases. Molecular and cytogenetic mapping of the 6p deletions in these three families with subtelomeric deletions of chromosome 6p have defined a 1.3 Mb minimally deleted critical region. To determine if 6p deletions are common in 3C syndrome, we analyzed seven unrelated individuals with 3C syndrome for deletions of this region. Three forkhead genes (FOXF1 and FOXQ1 from within the critical region, and FOXC1 proximal to this region) were evaluated as potential candidate disease genes for this disorder. No deletions or disease-causing mutations were identified.

  19. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.

    PubMed

    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M

    2014-01-01

    The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lachiewicz, A.; Rao, K.; Aylsworth, A.

    A 2-year-old boy with Martin-Bell syndrome was referred for molecular testing and found to have a large deletion of FMRI. His mother was found to have two FMR-1 alleles in the normal range for CGG repeats. DNA probes located both proximal and distal to FRAXA were used to delineate the approximation location of the deletion endpoints. Proximal to the fragile site, DXS312 (pX135) was absent but DXS98 (4D8) was present. Distal to the fragile site, DXS296 (VK21) was absent but DXS304 (U6.2) was present. Our patient does not appear to have clinical findings other than those typically associated with fragilemore » X syndrome suggesting that the deletion does not remove other contiguous genes, e.g., IDS. The deletion in this patient is larger than the patient reported by Gedeon et al., in whom approximately 2.5 megabases were estimated to be deleted. Using the physical map of Schlessinger et al., the physical extent of the deletion can be estimated to be at least 3 megabases. This patient may be useful in physical mapping of the chromosomal region near FMR-1. Continued long-term evaluation of this patient may uncover clinical findings suggestive that the deletion removes other genes near to FMR-1 or, alternatively, no findings atypical of the fragile X syndrome suggesting that no other genes lie in the deletion interval.« less

  1. Haptoglobin genotyping of Vietnamese: global distribution of HP del, complete deletion allele of the HP gene.

    PubMed

    Soejima, Mikiko; Agusa, Tetsuro; Iwata, Hisato; Fujihara, Junko; Kunito, Takashi; Takeshita, Haruo; Lan, Vi Thi Mai; Minh, Tu Binh; Takahashi, Shin; Trang, Pham Thi Kim; Viet, Pham Hung; Tanabe, Shinsuke; Koda, Yoshiro

    2015-01-01

    The haptoglobin (HP) gene deletion allele (HP(del)) is responsible for anhaptoglobinemia and a genetic risk factor for anaphylaxis reaction after transfusion due to production of the anti-HP antibody. The distribution of this allele has been explored by several groups including ours. Here, we studied the frequency of HP(del) in addition to the distribution of common HP genotypes in 293 Vietnamese. The HP(del) was encountered with the frequency of 0.020. The present result suggested that this deletion allele is restricted to East and Southeast Asians. Thus, this allele seems to be a potential ancestry informative marker for these populations. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Bovine Polledness – An Autosomal Dominant Trait with Allelic Heterogeneity

    PubMed Central

    Medugorac, Ivica; Seichter, Doris; Graf, Alexander; Russ, Ingolf; Blum, Helmut; Göpel, Karl Heinrich; Rothammer, Sophie; Förster, Martin; Krebs, Stefan

    2012-01-01

    The persistent horns are an important trait of speciation for the family Bovidae with complex morphogenesis taking place briefly after birth. The polledness is highly favourable in modern cattle breeding systems but serious animal welfare issues urge for a solution in the production of hornless cattle other than dehorning. Although the dominant inhibition of horn morphogenesis was discovered more than 70 years ago, and the causative mutation was mapped almost 20 years ago, its molecular nature remained unknown. Here, we report allelic heterogeneity of the POLLED locus. First, we mapped the POLLED locus to a ∼381-kb interval in a multi-breed case-control design. Targeted re-sequencing of an enlarged candidate interval (547 kb) in 16 sires with known POLLED genotype did not detect a common allele associated with polled status. In eight sires of Alpine and Scottish origin (four polled versus four horned), we identified a single candidate mutation, a complex 202 bp insertion-deletion event that showed perfect association to the polled phenotype in various European cattle breeds, except Holstein-Friesian. The analysis of the same candidate interval in eight Holsteins identified five candidate variants which segregate as a 260 kb haplotype also perfectly associated with the POLLED gene without recombination or interference with the 202 bp insertion-deletion. We further identified bulls which are progeny tested as homozygous polled but bearing both, 202 bp insertion-deletion and Friesian haplotype. The distribution of genotypes of the two putative POLLED alleles in large semi-random sample (1,261 animals) supports the hypothesis of two independent mutations. PMID:22737241

  3. A large-scale survey of the novel 15q24 microdeletion syndrome in autism spectrum disorders identifies an atypical deletion that narrows the critical region

    PubMed Central

    2010-01-01

    Background The 15q24 microdeletion syndrome has been recently described as a recurrent, submicroscopic genomic imbalance found in individuals with intellectual disability, typical facial appearance, hypotonia, and digital and genital abnormalities. Gene dosage abnormalities, including copy number variations (CNVs), have been identified in a significant fraction of individuals with autism spectrum disorders (ASDs). In this study we surveyed two ASD cohorts for 15q24 abnormalities to assess the frequency of genomic imbalances in this interval. Methods We screened 173 unrelated subjects with ASD from the Central Valley of Costa Rica and 1336 subjects with ASD from 785 independent families registered with the Autism Genetic Resource Exchange (AGRE) for CNVs across 15q24 using oligonucleotide arrays. Rearrangements were confirmed by array comparative genomic hybridization and quantitative PCR. Results Among the patients from Costa Rica, an atypical de novo deletion of 3.06 Mb in 15q23-q24.1 was detected in a boy with autism sharing many features with the other 13 subjects with the 15q24 microdeletion syndrome described to date. He exhibited intellectual disability, constant smiling, characteristic facial features (high anterior hairline, broad medial eyebrows, epicanthal folds, hypertelorism, full lower lip and protuberant, posteriorly rotated ears), single palmar crease, toe syndactyly and congenital nystagmus. The deletion breakpoints are atypical and lie outside previously characterized low copy repeats (69,838-72,897 Mb). Genotyping data revealed that the deletion had occurred in the paternal chromosome. Among the AGRE families, no large 15q24 deletions were observed. Conclusions From the current and previous studies, deletions in the 15q24 region represent rare causes of ASDs with an estimated frequency of 0.1 to 0.2% in individuals ascertained for ASDs, although the proportion might be higher in sporadic cases. These rates compare with a frequency of about 0.3% in patients ascertained for unexplained intellectual disability and congenital anomalies. This atypical deletion reduces the minimal interval for the syndrome from 1.75 Mb to 766 kb, implicating a reduced number of genes (15 versus 38). Sequencing of genes in the 15q24 interval in large ASD and intellectual disability samples may identify mutations of etiologic importance in the development of these disorders. PMID:20678247

  4. Array-based comparative genomic hybridization analysis reveals recurrent chromosomal alterations and prognostic parameters in primary cutaneous large B-cell lymphoma.

    PubMed

    Dijkman, Remco; Tensen, Cornelis P; Jordanova, Ekaterina S; Knijnenburg, Jeroen; Hoefnagel, Juliette J; Mulder, Aat A; Rosenberg, Carla; Raap, Anton K; Willemze, Rein; Szuhai, Károly; Vermeer, Maarten H

    2006-01-10

    To evaluate the clinical relevance of genomic aberrations in primary cutaneous large B-cell lymphoma (PCLBCL). Skin biopsy samples of 31 patients with a PCLBCL classified as either primary cutaneous follicle center lymphoma (PCFCL; n = 19) or PCLBCL, leg type (n = 12), according to the WHO-European Organisation for Research and Treatment of Cancer (EORTC) classification, were investigated using array-based comparative genomic hybridization, fluorescence in situ hybridization (FISH), and examination of promoter hypermethylation. The most recurrent alterations in PCFCL were high-level DNA amplifications at 2p16.1 (63%) and deletion of chromosome 14q32.33 (68%). FISH analysis confirmed c-REL amplification in patients with gains at 2p16.1. In PCLBCL, leg type, most prominent aberrations were a high-level DNA amplification of 18q21.31-q21.33 (67%), including the BCL-2 and MALT1 genes as confirmed by FISH, and deletions of a small region within 9p21.3 containing the CDKN2A, CDKN2B, and NSG-x genes. Homozygous deletion of 9p21.3 was detected in five of 12 patients with PCLBCL, leg type, but in zero of 19 patients with PCFCL. Complete methylation of the promoter region of the CDKN2A gene was demonstrated in one PCLBCL, leg type, patient with hemizygous deletion, in one patient without deletion, but in zero of 19 patients with PCFCL. Seven of seven PCLBCL, leg type, patients with deletion of 9p21.3 and/or complete methylation of CDKN2A died as a result of their lymphoma. Our results demonstrate prominent differences in chromosomal alterations between PCFCL and PCLBCL, leg type, that support their classification as separate entities within the WHO-EORTC scheme. Inactivation of CDKN2A by either deletion or methylation of its promoter could be an important prognostic parameter for the group of PCLBCL, leg type.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mavrakis, K. J.; McDonald, E. R.; Schlabach, M. R.

    5-Methylthioadenosine phosphorylase (MTAP) is a key enzyme in the methionine salvage pathway. The MTAP gene is frequently deleted in human cancers because of its chromosomal proximity to the tumor suppressor gene CDKN2A. By interrogating data from a large-scale short hairpin RNA–mediated screen across 390 cancer cell line models, we found that the viability of MTAP-deficient cancer cells is impaired by depletion of the protein arginine methyltransferase PRMT5. MTAP-deleted cells accumulate the metabolite methylthioadenosine (MTA), which we found to inhibit PRMT5 methyltransferase activity. Deletion of MTAP in MTAP-proficient cells rendered them sensitive to PRMT5 depletion. Conversely, reconstitution of MTAP in anmore » MTAP-deficient cell line rescued PRMT5 dependence. Thus, MTA accumulation in MTAP–deleted cancers creates a hypomorphic PRMT5 state that is selectively sensitized toward further PRMT5 inhibition. Inhibitors of PRMT5 that leverage this dysregulated metabolic state merit further investigation as a potential therapy for MTAP/CDKN2A-deleted tumors.« less

  6. Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

    PubMed Central

    Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

    2010-01-01

    Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

  7. A role for catalase-peroxidase large loop 2 revealed by deletion mutagenesis: control of active site water and ferric enzyme reactivity.

    PubMed

    Kudalkar, Shalley N; Njuma, Olive J; Li, Yongjiang; Muldowney, Michelle; Fuanta, N Rene; Goodwin, Douglas C

    2015-03-03

    Catalase-peroxidases (KatGs), the only catalase-active members of their superfamily, all possess a 35-residue interhelical loop called large loop 2 (LL2). It is essential for catalase activity, but little is known about its contribution to KatG function. LL2 shows weak sequence conservation; however, its length is nearly identical across KatGs, and its apex invariably makes contact with the KatG-unique C-terminal domain. We used site-directed and deletion mutagenesis to interrogate the role of LL2 and its interaction with the C-terminal domain in KatG structure and catalysis. Single and double substitutions of the LL2 apex had little impact on the active site heme [by magnetic circular dichroism or electron paramagnetic resonance (EPR)] and activity (catalase or peroxidase). Conversely, deletion of a single amino acid from the LL2 apex reduced catalase activity by 80%. Deletion of two or more apex amino acids or all of LL2 diminished catalase activity by 300-fold. Peroxide-dependent but not electron donor-dependent kcat/KM values for deletion variant peroxidase activity were reduced 20-200-fold, and kon for cyanide binding diminished by 3 orders of magnitude. EPR spectra for deletion variants were all consistent with an increase in the level of pentacoordinate high-spin heme at the expense of hexacoordinate high-spin states. Together, these data suggest a shift in the distribution of active site waters, altering the reactivity of the ferric state, toward, among other things, compound I formation. These results identify the importance of LL2 length conservation for maintaining an intersubunit interaction that is essential for an active site water distribution that facilitates KatG catalytic activity.

  8. Contribution of BRCA1 large genomic rearrangements to early-onset and familial breast/ovarian cancer in Pakistan.

    PubMed

    Rashid, Muhammad U; Muhammad, Noor; Amin, Asim; Loya, Asif; Hamann, Ute

    2017-01-01

    Germline mutations in BRCA1 and BRCA2 (BRCA1/2) account for the majority of hereditary breast and/or ovarian cancers. Pakistan has one of the highest rates of breast cancer incidence in Asia, where BRCA1/2 small-range mutations account for 17% of early-onset and familial breast/ovarian cancer patients. We report the first study from Pakistan evaluating the prevalence of BRCA1/2 large genomic rearrangements (LGRs) in breast and/or ovarian cancer patients who do not harbor small-range BRCA1/2 mutations. Both BRCA1/2 genes were comprehensively screened for LGRs using multiplex ligation-dependent probe amplification in 120 BRCA1/2 small-range mutations negative early-onset or familial breast/ovarian cancer patients from Pakistan (Group 1). The breakpoints were characterized by long-range PCR- and DNA-sequencing analyses. An additional cohort of 445 BRCA1/2 negative high-risk patients (Group 2) was analyzed for the presence of LGRs identified in Group 1. Three different BRCA1 LGRs were identified in Group 1 (4/120; 3.3%), two of these were novel. Exon 1-2 deletion was observed in two unrelated patients: an early-onset breast cancer patient and another bilateral breast cancer patient from a hereditary breast cancer (HBC) family. Novel exon 20-21 deletion was detected in a 29-year-old breast cancer patient from a HBC family. Another novel exon 21-24 deletion was identified in a breast-ovarian cancer patient from a hereditary breast and ovarian cancer family. The breakpoints of all deletions were characterized. Screening of the 445 patients in Group 2 for the three LGRs revealed ten additional patients harboring exon 1-2 deletion or exon 21-24 deletion (10/445; 2.2%). No BRCA2 LGRs were identified. LGRs in BRCA1 are found with a considerable frequency in Pakistani breast/ovarian cancer cases. Our findings suggest that BRCA1 exons 1-2 deletion and exons 21-24 deletion should be included in the recurrent BRCA1/2 mutations panel for genetic testing of high-risk Pakistani breast/ovarian cancer patients.

  9. Analytic Validation of a Clinical-Grade PTEN Immunohistochemistry Assay in Prostate Cancer by Comparison to PTEN FISH

    PubMed Central

    Lotan, Tamara L.; Wei, Wei; Ludkovski, Olga; Morais, Carlos L.; Guedes, Liana B.; Jamaspishvili, Tamara; Lopez, Karen; Hawley, Sarah T.; Feng, Ziding; Fazli, Ladan; Hurtado-Coll, Antonio; McKenney, Jesse K.; Simko, Jeffrey; Carroll, Peter R.; Gleave, Martin; Lin, Daniel W.; Nelson, Peter S.; Thompson, Ian M.; True, Lawrence D.; Brooks, James D.; Lance, Raymond; Troyer, Dean; Squire, Jeremy A.

    2016-01-01

    PTEN loss is a promising prognostic and predictive biomarker in prostate cancer. Because it occurs most commonly via PTEN gene deletion, we developed a clinical-grade, automated and inexpensive immunohistochemical assay to detect PTEN loss. We studied the sensitivity and specificity of PTEN immunohistochemistry relative to 4-color fluorescence in situ hybridization (FISH) for detection of PTEN gene deletion in a multi-institutional cohort of 731 primary prostate tumors. Intact PTEN immunostaining was 91% specific for absence of PTEN gene deletion, (549/602 tumors with 2 copies of the PTEN gene by FISH showed intact expression of PTEN by immunohistochemistry) and 97% sensitive for presence of homozygous PTEN gene deletion (absent PTEN protein expression by immunohistochemistry in 65/67 tumors with homozygous deletion). PTEN immunohistochemistry was 65% sensitive for presence of hemizygous PTEN gene deletion, with protein loss in 40/62 hemizygous tumors. We reviewed the 53 cases where immunohistochemistry showed PTEN protein loss and FISH showed 2 intact copies of the PTEN gene. On re-review, there was ambiguous immunohistochemistry loss in 6% (3/53) and failure to analyze the same tumor area by both methods in 34% (18/53). Of the remaining discordant cases, 41% (13/32) revealed hemizygous (n=8) or homozygous (n=5) PTEN gene deletion that was focal in most cases (11/13). The remaining 19 cases had 2 copies of the PTEN gene by FISH, representing truly discordant cases. Our automated PTEN immunohistochemistry assay is a sensitive method for detection of homozygous PTEN gene deletions. Immunohistochemistry screening is particularly useful to identify cases with heterogeneous PTEN gene deletion in a subset of tumor glands. Mutations, small insertions or deletions and/or epigenetic or microRNA-mediated mechanisms may lead to PTEN protein loss in tumors with normal or hemizygous PTEN gene copy number. PMID:27174589

  10. A 1.5 Mb submicroscopic deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lorenzetti, D.; Roa, B.B.; Abbas, N.E.

    1994-09-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies that was recently associated with a 1.5 Mb deletion in chromosome 17p11.2-p12. Duplication of the same region is known to be associated with Charcot-Marie-Tooth disease type 1A (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity. The CMT1A duplication and HNPP deletion are reciprocal recombination products involving a repeat element (CMT1A-REP) which flanks the 1.5 Mb region involved in the duplication/deletion. Patients from 9 unrelated HNPP Italian families were clinically, electrophysiologically and histologically evaluated. Families were typed with amore » polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125 and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, suggesting the presence of deletion. Southern blot analysis of EcoRI digested genomic DNA from HNPP patients and control subjects was performed using a probe mapping within the CMT1A-REP elements. A reduced hybridization signal of a 6.0 kb EcoRI fragment, mapping within the distal CMT1A-REP, was observed in all HNPP patients suggesting the loss of one copy of this fragment in the HNPP-deleted chromosome. PFGE analysis of SacII digested genomic DNA from selected HNPP subjects showed the presence of a junction fragment which has previously been found in association with the 1.5 Mb HNPP deletion. Evidence for deletion could be demonstrated in all 9 families suggesting that the 17p11.2-p12 deletion is commonly associated with HNPP.« less

  11. A 1.5-Mb deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lorenzetti, D.; Pandolfo, M.; Pareyson, D.

    1995-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies. A 1.5-Mb deletion in chromosome 17p11.2-p12 has been associated with HNPP. Duplication of the same 1.5-Mb region is known to be associated with Charcot-Marie-Tooth disease type 1 (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity (NCV). The CMT1A duplication and HNPP deletion appear to be the reciprocal products of a recombination event involving a repeat element (CMT1A-REP) that flanks the 1.5-Mb region involved in the duplication/deletion. Patients from nine unrelated Italian families who were diagnosed with HNPP onmore » the basis of clinical, electrophysiological, and histological evaluations were analyzed by molecular methods for DNA deletion on chromosome 17p. In all nine families, Southern analysis using a CMT1A-REP probe detected a reduced hybridization signal of a 6.0-kb EcoRI fragment mapping within the distal CMT1A-REP, indicating deletion of one copy of CMT1A-REP in these HNPP patients. Families were also typed with a polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125, and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, providing an independent indication for deletion. Furthermore, pulsed-field gel electrophoresis analysis of SacII-digested genomic DNA detected junction fragments specific to the 1.5-Mb HNPP deletion in seven of nine Italian families included in this study. These findings suggest that a 1.5-Mb deletion on 17p11.2-p12 is the most common mutation associated with HNPP. 51 refs., 5 figs., 1 tab.« less

  12. Identification of single gene deletions at 15q13.3: further evidence that CHRNA7 causes the 15q13.3 microdeletion syndrome phenotype.

    PubMed

    Hoppman-Chaney, N; Wain, K; Seger, P R; Superneau, D W; Hodge, J C

    2013-04-01

    The 15q13.3 microdeletion syndrome (OMIM #612001) is characterized by a wide range of phenotypic features, including intellectual disability, seizures, autism, and psychiatric conditions. This deletion is inherited in approximately 75% of cases and has been found in mildly affected and normal parents, consistent with variable expressivity and incomplete penetrance. The common deletion is approximately 2 Mb and contains several genes; however, the gene(s) responsible for the resulting clinical features have not been clearly defined. Recently, four probands were reported with small deletions including only the CHRNA7 gene. These patients showed a wide range of phenotypic features similar to those associated with the larger 15q13.3 microdeletion. To further correlate genotype and phenotype, we queried our database of >15,000 patients tested in the Mayo Clinic Cytogenetics Laboratory from 2008 to 2011 and identified 19 individuals (10 probands and 9 family members) with isolated heterozygous CHRNA7 gene deletions. All but two infants displayed multiple features consistent with 15q13.3 microdeletion syndrome. We also identified the first de novo deletion confined to CHRNA7 as well as the second known case with homozygous deletion of CHRNA7 only. These results provide further evidence implicating CHRNA7 as the gene responsible for the clinical findings associated with 15q13.3 microdeletion. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  13. A new deletion refines the boundaries of the murine Prader–Willi syndrome imprinting center

    PubMed Central

    DuBose, Amanda J.; Smith, Emily Y.; Yang, Thomas P.; Johnstone, Karen A.; Resnick, James L.

    2011-01-01

    The human chromosomal 15q11–15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader–Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality. PMID:21659337

  14. A new deletion refines the boundaries of the murine Prader-Willi syndrome imprinting center.

    PubMed

    Dubose, Amanda J; Smith, Emily Y; Yang, Thomas P; Johnstone, Karen A; Resnick, James L

    2011-09-01

    The human chromosomal 15q11-15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader-Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality.

  15. Detection of BRCA1 gross rearrangements by droplet digital PCR.

    PubMed

    Preobrazhenskaya, Elena V; Bizin, Ilya V; Kuligina, Ekatherina Sh; Shleykina, Alla Yu; Suspitsin, Evgeny N; Zaytseva, Olga A; Anisimova, Elena I; Laptiev, Sergey A; Gorodnova, Tatiana V; Belyaev, Alexey M; Imyanitov, Evgeny N; Sokolenko, Anna P

    2017-10-01

    Large genomic rearrangements (LGRs) constitute a significant share of pathogenic BRCA1 mutations. Multiplex ligation-dependent probe amplification (MLPA) is a leading method for LGR detection; however, it is entirely based on the use of commercial kits, includes relatively time-consuming hybridization step, and is not convenient for large-scale screening of recurrent LGRs. We developed and validated the droplet digital PCR (ddPCR) assay, which covers the entire coding region of BRCA1 gene and is capable to precisely quantitate the copy number for each exon. 141 breast cancer (BC) patients, who demonstrated evident clinical features of hereditary BC but turned out to be negative for founder BRCA1/2 mutations, were subjected to the LGR analysis. Four patients with LGR were identified, with three cases of exon 8 deletion and one women carrying the deletion of exons 5-7. Excellent concordance with MLPA test was observed. Exon 8 copy number was tested in additional 720 BC and 184 ovarian cancer (OC) high-risk patients, and another four cases with the deletion were revealed; MLPA re-analysis demonstrated that exon 8 loss was a part of a larger genetic alteration in two cases, while the remaining two patients had isolated defect of exon 8. Long-range PCR and next generation sequencing of DNA samples carrying exon 8 deletion revealed two types of recurrent LGRs. Droplet digital PCR is a reliable tool for the detection of large genomic rearrangements.

  16. Pleiotropy in microdeletion syndromes: Neurologic and spermatogenic abnormalities in mice homozygous for the p{sup 6H} deletion are likely due to dysfunction of a single gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rinchik, E.M.; Carpenter, D.A.; Handel, M.A.

    1995-07-03

    Variability and complexity of phenotypes observed in microdeletion syndromes can be due to deletion of a single gene whose product participates in several aspects of development or can be due to the deletion of a number of tightly linked genes, each adding its own effect to the syndrome. The p{sup 6H} deletion in mouse chromosome 7 presents a good model with which to address this question of multigene vs. single-gene pleiotropy. Mice homozygous for the p{sup 6H} deletion are diluted in pigmentation, are smaller than their littermates, and manifest a nervous jerky-gait phenotype. Male homozygotes are sterile and exhibit profoundmore » abnormalities in spermiogenesis. By using N-ethyl-N-nitrosourea (EtNU) mutagenesis and a breeding protocol designed to recover recessive mutations expressed hemizygously opposite a large p-locus deletion, we have generated three noncomplementing mutations that map to the p{sup 6H} deletion. Each of these EtNU-induced mutations has adverse effects on the size, nervous behavior, and progression of spermiogenesis that characterize p{sup 6H} deletion homozygotes. Because etNU is thought to induce primarily intragenic (point) mutations in mouse stem-cell spermatogonia, we propose that the trio of phenotypes (runtiness, nervous jerky gait, and male sterility) expressed in p{sup 6H} deletion homozygotes is the result of deletion of a single highly pleiotropic gene. We also predict that a homologous single locus, quite possibly tightly linked and distal to the D15S12 (P) locus in human chromosome 15q11-q13, may be associated with similar developmental abnormalities in humans. 29 refs., 3 figs., 1 tab.« less

  17. Abnormal brain magnetic resonance imaging in two patients with Smith-Magenis syndrome.

    PubMed

    Maya, Idit; Vinkler, Chana; Konen, Osnat; Kornreich, Liora; Steinberg, Tamar; Yeshaya, Josepha; Latarowski, Victoria; Shohat, Mordechai; Lev, Dorit; Baris, Hagit N

    2014-08-01

    Smith-Magenis syndrome (SMS) is a clinically recognizable contiguous gene syndrome ascribed to an interstitial deletion in chromosome 17p11.2. Seventy percent of SMS patients have a common deletion interval spanning 3.5 megabases (Mb). Clinical features of SMS include characteristic mild dysmorphic features, ocular anomalies, short stature, brachydactyly, and hypotonia. SMS patients have a unique neurobehavioral phenotype that includes intellectual disability, self-injurious behavior and severe sleep disturbance. Little has been reported in the medical literature about anatomical brain anomalies in patients with SMS. Here we describe two patients with SMS caused by the common deletion in 17p11.2 diagnosed using chromosomal microarray (CMA). Both patients had a typical clinical presentation and abnormal brain magnetic resonance imaging (MRI) findings. One patient had subependymal periventricular gray matter heterotopia, and the second had a thin corpus callosum, a thin brain stem and hypoplasia of the cerebellar vermis. This report discusses the possible abnormal MRI images in SMS and reviews the literature on brain malformations in SMS. Finally, although structural brain malformations in SMS patients are not a common feature, we suggest baseline routine brain imaging in patients with SMS in particular, and in patients with chromosomal microdeletion/microduplication syndromes in general. Structural brain malformations in these patients may affect the decision-making process regarding their management. © 2014 Wiley Periodicals, Inc.

  18. Genetic heterogeneity in patients with Bartter syndrome type 1

    PubMed Central

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-01-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888

  19. Genetic heterogeneity in patients with Bartter syndrome type 1.

    PubMed

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-02-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

  20. Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

    PubMed

    Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

    2017-03-27

    Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

  1. Copy number variation at the 7q11.23 segmental duplications is a susceptibility factor for the Williams-Beuren syndrome deletion

    PubMed Central

    Cuscó, Ivon; Corominas, Roser; Bayés, Mònica; Flores, Raquel; Rivera-Brugués, Núria; Campuzano, Victoria; Pérez-Jurado, Luis A.

    2008-01-01

    Large copy number variants (CNVs) have been recently found as structural polymorphisms of the human genome of still unknown biological significance. CNVs are significantly enriched in regions with segmental duplications or low-copy repeats (LCRs). Williams-Beuren syndrome (WBS) is a neurodevelopmental disorder caused by a heterozygous deletion of contiguous genes at 7q11.23 mediated by nonallelic homologous recombination (NAHR) between large flanking LCRs and facilitated by a structural variant of the region, a ∼2-Mb paracentric inversion present in 20%–25% of WBS-transmitting progenitors. We now report that eight out of 180 (4.44%) WBS-transmitting progenitors are carriers of a CNV, displaying a chromosome with large deletion of LCRs. The prevalence of this CNV among control individuals and non-transmitting progenitors is much lower (1%, n = 600), thus indicating that it is a predisposing factor for the WBS deletion (odds ratio 4.6-fold, P = 0.002). LCR duplications were found in 2.22% of WBS-transmitting progenitors but also in 1.16% of controls, which implies a non–statistically significant increase in WBS-transmitting progenitors. We have characterized the organization and breakpoints of these CNVs, encompassing ∼100–300 kb of genomic DNA and containing several pseudogenes but no functional genes. Additional structural variants of the region have also been defined, all generated by NAHR between different blocks of segmental duplications. Our data further illustrate the highly dynamic structure of regions rich in segmental duplications, such as the WBS locus, and indicate that large CNVs can act as susceptibility alleles for disease-associated genomic rearrangements in the progeny. PMID:18292220

  2. DRD2 Promoter Region Variation Predicts Antipsychotic-Induced Weight Gain in First Episode Schizophrenia

    PubMed Central

    Lencz, Todd; Robinson, Delbert G.; Napolitano, Barbara; Sevy, Serge; Kane, John M.; Goldman, David; Malhotra, Anil K.

    2010-01-01

    Many antipsychotic medications carry a substantial liability for weight gain, and one mechanism common to all antipsychotics is binding to the dopamine D2 receptor. We therefore examined the relationship between −141C Ins/Del (rs1799732), a functional promoter region polymorphism in DRD2, and antipsychotic-induced weight gain in 58 first episode schizophrenia patients enrolled in a randomized trial of risperidone (RIS) vs. olanzapine (OLZ). Carriers of the deletion allele (n=29) were compared to Ins/Ins homozygotes (non-carriers, n=29) in a mixed model encompassing 10 weight measurements over 16 weeks. Deletion allele carriers demonstrated significantly more weight gain after 6 weeks of treatment regardless of assigned medication. While deletion carriers were prescribed higher doses of OLZ (but not RIS), dose did not appear to account for the genotype effects on weight gain. Given previous evidence that deletion carriers demonstrate reduced symptom response to medication, additional study of appropriate treatment options for these patients appears warranted. PMID:20664489

  3. Comparison of the efficacy of icotinib in patients with non-small-cell lung cancer according to the type of epidermal growth factor receptor mutation.

    PubMed

    Xue, Zhang Xiao; Wen, Wang Xiu; Zhuang, Yu; Hua, Zang Jian; Xia, Yang Ni

    2016-09-01

    Icotinib hydrochloride is a novel epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) with preclinical and clinical activity in non-small-cell lung cancer (NSCLC). Exon 19 deletion and L858R point mutation are the most commonly encountered EGFR mutations in NSCLC, and they predict improved clinical outcomes following treatment with icotinib. The objective of this study was to evaluate the differential clinical efficacy of icotinib in patients with exon 19 deletion or L858R point mutation of the EGFR gene. A total of 104 patients with advanced NSCLC, who harbored exon 19 deletion or L858R point mutation of EGFR and were treated with icotinib, were enrolled in this study. The tumor response and progression-free survival were evaluated. There were no significant differences between patients with EGFR exon 19 deletion and those with L858R point mutation who received treatment with icotinib.

  4. Low levels of LTR retrotransposon deletion by ectopic recombination in the gigantic genomes of salamanders.

    PubMed

    Frahry, Matthew Blake; Sun, Cheng; Chong, Rebecca A; Mueller, Rachel Lockridge

    2015-02-01

    Across the tree of life, species vary dramatically in nuclear genome size. Mutations that add or remove sequences from genomes-insertions or deletions, or indels-are the ultimate source of this variation. Differences in the tempo and mode of insertion and deletion across taxa have been proposed to contribute to evolutionary diversity in genome size. Among vertebrates, most of the largest genomes are found within the salamanders, an amphibian clade with genome sizes ranging from ~14 to ~120 Gb. Salamander genomes have been shown to experience slower rates of DNA loss through small (i.e., <30 bp) deletions than do other vertebrate genomes. However, no studies have addressed DNA loss from salamander genomes resulting from larger deletions. Here, we focus on one type of large deletion-ectopic-recombination-mediated removal of LTR retrotransposon sequences. In ectopic recombination, double-strand breaks are repaired using a "wrong" (i.e., ectopic, or non-allelic) template sequence-typically another locus of similar sequence. When breaks occur within the LTR portions of LTR retrotransposons, ectopic-recombination-mediated repair can produce deletions that remove the internal transposon sequence and the equivalent of one of the two LTR sequences. These deletions leave a signature in the genome-a solo LTR sequence. We compared levels of solo LTRs in the genomes of four salamander species with levels present in five vertebrates with smaller genomes. Our results demonstrate that salamanders have low levels of solo LTRs, suggesting that ectopic-recombination-mediated deletion of LTR retrotransposons occurs more slowly than in other vertebrates with smaller genomes.

  5. Relationship of sleep abnormalities to patient genotypes in Prader-Willi syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vgontzas, A.N.; Kales, A.; Bixler, E.O.

    To assess whether sleep abnormalities are related to the genetic abnormalities in Prader-Willi Syndrome (PWS), we performed polysomnographic studies (nighttime and daytime) and determined the chromosome 15 genotypes in eight patients with PWS. Four patients demonstrated sleep onset REM periods (SOREM), and five met the objective polysomnographic criteria for severe or moderate excessive daytime sleepiness (EDS). Three of the four patients with SOREM displayed a paternally derived deletion of chromosome 15q11-q13, whereas the fourth exhibited maternal uniparental heterodisomy in this chromosomal region (UPD). Two of the four patients that did not display SOREM carried paternally derived deletions; the remaining twomore » demonstrated UPD. Four of the five patients with EDS displayed paternal deletions, and the fifth exhibited UPD. One of three patients without evidence of EDS demonstrated paternal deletion; the remaining two showed UPD. Although neither EDS nor SOREM was not consistently associated with a specific genetic abnormality, these phenotypes may be more common in patients with paternal deletions than in those with UPD. Sleep abnormalities in PWS cannot be explained by a single genetic model. 32 refs., 1 tab.« less

  6. Random single amino acid deletion sampling unveils structural tolerance and the benefits of helical registry shift on GFP folding and structure.

    PubMed

    Arpino, James A J; Reddington, Samuel C; Halliwell, Lisa M; Rizkallah, Pierre J; Jones, D Dafydd

    2014-06-10

    Altering a protein's backbone through amino acid deletion is a common evolutionary mutational mechanism, but is generally ignored during protein engineering primarily because its effect on the folding-structure-function relationship is difficult to predict. Using directed evolution, enhanced green fluorescent protein (EGFP) was observed to tolerate residue deletion across the breadth of the protein, particularly within short and long loops, helical elements, and at the termini of strands. A variant with G4 removed from a helix (EGFP(G4Δ)) conferred significantly higher cellular fluorescence. Folding analysis revealed that EGFP(G4Δ) retained more structure upon unfolding and refolded with almost 100% efficiency but at the expense of thermodynamic stability. The EGFP(G4Δ) structure revealed that G4 deletion caused a beneficial helical registry shift resulting in a new polar interaction network, which potentially stabilizes a cis proline peptide bond and links secondary structure elements. Thus, deletion mutations and registry shifts can enhance proteins through structural rearrangements not possible by substitution mutations alone. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat.

    PubMed

    Lu, Mingjie; Lu, Yuqing; Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement.

  8. Limb Girdle Muscular Dystrophy Type 2E Due to a Novel Large Deletion in SGCB Gene.

    PubMed

    Ghafouri-Fard, Soudeh; Hashemi-Gorji, Feyzollah; Fardaei, Majid; Miryounesi, Mohammad

    2017-01-01

    Autosomal recessive limb-girdle muscular dystrophies (LGMD type 2) are a group of clinically and genetically heterogeneous diseases with the main characteristics of weakness and wasting of the pelvic and shoulder girdle muscles. Among them are sarcoglycanopathies caused by mutations in at least four genes named SGCA, SGCB, SGCG and SGCD. Here we report a consanguineous Iranian family with two children affected with LGMD type 2E. Mutation analysis revealed a novel homozygous exon 2 deletion of SGCB gene in the patients with the parents being heterozygous for this deletion. This result presents a novel underlying genetic mechanism for LGMD type 2E.

  9. Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

    PubMed Central

    Prontera, Paolo; Rogaia, Daniela; Mencarelli, Amedea; Ottaviani, Valentina; Guercini, Giorgio; Bersano, Anna; Stangoni, Gabriela

    2017-01-01

    Moyamoya angiopathy (MA) is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735). Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1). In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA. PMID:28926972

  10. An atypical case of fragile X syndrome caused by a deletion that includes the FMR1 gene.

    PubMed Central

    Quan, F; Zonana, J; Gunter, K; Peterson, K L; Magenis, R E; Popovich, B W

    1995-01-01

    Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and > or = 9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure of RK's DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5'-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient's unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. Images Figure 5 Figure 2 Figure 4 Figure 6 Figure 7 PMID:7726157

  11. Disparities in visuo-spatial constructive abilities in Williams syndrome patients with typical deletion on chromosome 7q11.23.

    PubMed

    Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho

    2017-02-01

    Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  12. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

    PubMed

    Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

    2018-01-01

    Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

  13. Analagous Population Structures for Two Alphabaculoviruses Highlight a Functional Role for Deletion Mutants

    PubMed Central

    Serrano, Amaya; Williams, Trevor; Simón, Oihane; López-Ferber, Miguel; Caballero, Primitivo

    2013-01-01

    A natural Spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) isolate from Florida shares a strikingly similar genotypic composition to that of a natural Spodoptera frugiperda MNPV (SfMNPV) isolate from Nicaragua. Both isolates comprise a high proportion of large-deletion genotypes that lack genes that are essential for viral replication or transmission. To determine the likely origins of such genotypically similar population structures, we performed genomic and functional analyses of these genotypes. The homology of nucleotides in the deleted regions was as high as 79%, similar to those of other colinear genomic regions, although some SfMNPV genes were not present in SeMNPV. In addition, no potential consensus sequences were shared between the deletion flanking sequences. These results indicate an evolutionary mechanism that independently generates and sustains deletion mutants within each virus population. Functional analyses using different proportions of complete and deletion genotypes were performed with the two viruses in mixtures of occlusion bodies (OBs) or co-occluded virions. Ratios greater than 3:1 of complete/deletion genotypes resulted in reduced pathogenicity (expressed as median lethal dose), but there were no significant changes in the speed of kill. In contrast, OB yields increased only in the 1:1 mixture. The three phenotypic traits analyzed provide a broader picture of the functional significance of the most extensively deleted SeMNPV genotype and contribute toward the elucidation of the role of such mutants in baculovirus populations. PMID:23204420

  14. Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

    PubMed

    Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

    2006-01-01

    Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

  15. Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

    PubMed Central

    Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

    2013-01-01

    Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

  16. VHL deletion impairs mammary alveologenesis but is not sufficient for mammary tumorigenesis.

    PubMed

    Seagroves, Tiffany N; Peacock, Danielle L; Liao, Debbie; Schwab, Luciana P; Krueger, Robin; Handorf, Charles R; Haase, Volker H; Johnson, Randall S

    2010-05-01

    Overexpression of hypoxia inducible factor-1 (HIF-1)alpha, which is common in most solid tumors, correlates with poor prognosis and high metastatic risk in breast cancer patients. Because HIF-1alpha protein stability is tightly controlled by the tumor suppressor von Hippel-Lindau (VHL), deletion of VHL results in constitutive HIF-1alpha expression. To determine whether VHL plays a role in normal mammary gland development, and if HIF-1alpha overexpression is sufficient to initiate breast cancer, Vhl was conditionally deleted in the mammary epithelium using the Cre/loxP system. During first pregnancy, loss of Vhl resulted in decreased mammary epithelial cell proliferation and impaired alveolar differentiation; despite these phenotypes, lactation was sufficient to support pup growth. In contrast, in multiparous dams, Vhl(-/-) mammary glands exhibited a progressive loss of alveolar epithelium, culminating in lactation failure. Deletion of Vhl in the epithelium also impacted the mammary stroma, as there was increased microvessel density accompanied by hemorrhage and increased immune cell infiltration. However, deletion of Vhl was not sufficient to induce mammary tumorigenesis in dams bred continuously for up to 24 months of age. Moreover, co-deletion of Hif1a could not rescue the Vhl(-/-)-dependent phenotype as dams were unable to successfully lactate during the first lactation. These results suggest that additional VHL-regulated genes besides HIF1A function to maintain the proliferative and regenerative potential of the breast epithelium.

  17. Interrelationship between TP53 gene deletion, protein expression and chromosome 17 aneusomy in gastric adenocarcinoma

    PubMed Central

    2009-01-01

    Background This study evaluates the existence of numerical alterations of chromosome 17 and TP53 gene deletion in gastric adenocarcinoma. The p53 protein expression was also evaluated, as well as, possible associations with clinicopathological characteristics. Methods Dual-color fluorescence in situ hybridization and immunostaining were performed in twenty gastric cancer samples of individuals from Northern Brazil. Results Deletion of TP53 was found in all samples. TP53 was inactivated mainly by single allelic deletion, varying to 7–39% of cells/case. Aneusomy of chromosome 17 was observed in 85% of cases. Chromosome 17 monosomy and gain were both observed in about half of cases. Cells with gain of chromosome 17 frequently presented TP53 deletion. The frequency of cells with two chr17 and one TP53 signals observed was higher in diffuse than in intestinal-type GC. Immunoreactivity of p53 was found only in intestinal-type samples. The frequency of cells with two chr17 and two TP53 signals found was higher in samples with positive p53 expression than in negative cases in intestinal-type GC. Conclusion We suggest that TP53 deletion and chromosome 17 aneusomy is a common event in GC and other TP53 alterations, as mutation, may be implicated in the distinct carcinogenesis process of diffuse and intestinal types. PMID:19619279

  18. F7 gene variants modulate protein levels in a large cohort of patients with factor VII deficiency. Results from a genotype-phenotype study.

    PubMed

    Quintavalle, Gabriele; Riccardi, Federica; Rivolta, Gianna Franca; Martorana, Davide; Di Perna, Caterina; Percesepe, Antonio; Tagliaferri, Annarita

    2017-08-01

    Congenital factor VII (FVII) deficiency is a rare bleeding disorder caused by mutations in F7 gene with autosomal recessive inheritance. A clinical heterogeneity with poor correlation with FVII:C levels has been described. It was the objective of this study to identify genetic defects and to evaluate their relationships with phenotype in a large cohort of patients with FVII:C<50 %. One hundred twenty-three probands were genotyped for F7 mutations and three polymorphic variants and classified according to recently published clinical scores. Forty out of 123 patients (33 %) were symptomatic (43 bleedings). A severe bleeding tendency was observed only in patients with FVII:C<0.10 %. Epistaxis (11 %) and menorrhagia (32 % of females in fertile age) were the most frequent bleedings. Molecular analysis detected 48 mutations, 20 not reported in the F7 international databases. Most mutations (62 %) were missense, large deletions were 6.2 %. Compound heterozygotes/homozygotes for mutations presented lower FVII:C levels compared to the other classes (Chi 2 =43.709, p<0,001). The polymorphisms distribution was significantly different among the three F7 genotypic groups (Chi 2 =72.289, p<0,001). The presence of truncating mutations was associated with lowest FVII:C levels (Chi 2 =21.351, p=0.002). This study confirms the clinical and molecular variability of the disease and the type of symptoms. It shows a good correlation between the type of F7 mutation and/or polymorphisms and FVII:C levels, without a direct link between FVII:C and bleeding tendency. The results suggest that large deletions are underestimated and that they represent a common mechanism of F7 gene inactivation which should always be investigated in the diagnostic testing for FVII deficiency.

  19. Complex and Dynamic Chromosomal Rearrangements in a Family With Seemingly Non-Mendelian Inheritance of Dopa-Responsive Dystonia.

    PubMed

    Lohmann, Katja; Redin, Claire; Tönnies, Holger; Bressman, Susan B; Subero, Jose Ignacio Martin; Wiegers, Karin; Hinrichs, Frauke; Hellenbroich, Yorck; Rakovic, Aleksandar; Raymond, Deborah; Ozelius, Laurie J; Schwinger, Eberhard; Siebert, Reiner; Talkowski, Michael E; Saunders-Pullman, Rachel; Klein, Christine

    2017-07-01

    Chromosomal rearrangements are increasingly recognized to underlie neurologic disorders and are often accompanied by additional clinical signs beyond the gene-specific phenotypic spectrum. To elucidate the causal genetic variant in a large US family with co-occurrence of dopa-responsive dystonia as well as skeletal and eye abnormalities (ie, ptosis, myopia, and retina detachment). We examined 10 members of a family, including 5 patients with dopa-responsive dystonia and skeletal and/or eye abnormalities, from a US tertiary referral center for neurological diseases using multiple conventional molecular methods, including fluorescence in situ hybridization and array comparative genomic hybridization as well as large-insert whole-genome sequencing to survey multiple classes of genomic variations. Of note, there was a seemingly implausible transmission pattern in this family due to a mutation-negative obligate mutation carrier. Genetic diagnosis in affected family members and insight into the formation of large deletions. Four members were diagnosed with definite and 1 with probable dopa-responsive dystonia. All 5 affected individuals carried a large heterozygous deletion encompassing all 6 exons of GCH1. Additionally, all mutation carriers had congenital ptosis requiring surgery, 4 had myopia, 2 had retinal detachment, and 2 showed skeletal abnormalities of the hands, ie, polydactyly or syndactyly or missing a hand digit. Two individuals were reported to be free of any disease. Analyses revealed complex chromosomal rearrangements on chromosome 14q21-22 in unaffected individuals that triggered the expansion to a larger deletion segregating with affection status. The expansion occurred recurrently, explaining the seemingly non-mendelian inheritance pattern. These rearrangements included a deletion of GCH1, which likely contributes to the dopa-responsive dystonia, as well as a deletion of BMP4 as a potential cause of digital and eye abnormalities. Our findings alert neurologists to the importance of clinical red flags, ie, unexpected co-occurrence of clinical features that may point to the presence of chromosomal rearrangements as the primary disease cause. The clinical management and diagnostics of such patients requires an interdisciplinary approach in modern clinical-diagnostic care.

  20. The short arm deletion syndrome of chromosome 4 (4p- syndrome).

    PubMed

    Zellweger, H; Bardach, J; Bordwell, J; Williams, K

    1975-01-01

    Partial deletion of the short arm of chromosome 4 (4p-) represents another (rare) cause of cleft lip and cleft palate. Further characteristic manifestations of the syndrome (also called Wolf or Wolf-Hirschhorn syndrome) are growth failure, microcephaly, prominent glabella, hypertelorism, beaked nose, poorly differentiated and low set ears, cardiac and renal malformation and hypospadias. Life expectancy is often shortened. The 4p- syndrome has many features in common with another deletion syndrome, the cri-du-chat syndrome, and also with the Smith-Lemli-Opitz syndrome. The latter is a hereditary condition with normal karyotype. The cri-du-chat syndrome is characterized by a peculiar high-pitched, mewing cry and can be differentiated from the Wolf syndrome by the different staining characteristics (banding) of chromosomes 4 and 5.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chitayat, D.; Thomas, M.; Silver, M.M.

    Homozygosity for the South-Asian {alpha}-thalassemia (--{sup SEA}/) deletion is a serious hematological condition that results, in most cases, in intrauterine or postnatal death due to anemia and severe hypoxia of prenatal onset. A relationship between congenital abnormalities and intrauterine hypoxia has been postulated. However, since homozygosity for the (--{sup SEA}/) deletion is most common in underdeveloped countries where detailed autopsies are lacking, the incidence of congenital abnormalities among these babies has not been well delineated. We report on three newborn infants, homozygous for the (--{sup SEA}/) deletion, who were born with limb defects. We postulate that this combination is themore » result of prenatal hypoxia which may affect other fetal body organs. This should be taken into consideration when prenatal treatment of affected fetuses, with intrauterine blood transfusion, is suggested. 47 refs., 3 figs.« less

  2. Alternative Splicing of CHEK2 and Codeletion with NF2 Promote Chromosomal Instability in Meningioma1

    PubMed Central

    Yang, Hong Wei; Kim, Tae-Min; Song, Sydney S; Shrinath, Nihal; Park, Richard; Kalamarides, Michel; Park, Peter J; Black, Peter M; Carroll, Rona S; Johnson, Mark D

    2012-01-01

    Mutations of the NF2 gene on chromosome 22q are thought to initiate tumorigenesis in nearly 50% of meningiomas, and 22q deletion is the earliest and most frequent large-scale chromosomal abnormality observed in these tumors. In aggressive meningiomas, 22q deletions are generally accompanied by the presence of large-scale segmental abnormalities involving other chromosomes, but the reasons for this association are unknown. We find that large-scale chromosomal alterations accumulate during meningioma progression primarily in tumors harboring 22q deletions, suggesting 22q-associated chromosomal instability. Here we show frequent codeletion of the DNA repair and tumor suppressor gene, CHEK2, in combination with NF2 on chromosome 22q in a majority of aggressive meningiomas. In addition, tumor-specific splicing of CHEK2 in meningioma leads to decreased functional Chk2 protein expression. We show that enforced Chk2 knockdown in meningioma cells decreases DNA repair. Furthermore, Chk2 depletion increases centrosome amplification, thereby promoting chromosomal instability. Taken together, these data indicate that alternative splicing and frequent codeletion of CHEK2 and NF2 contribute to the genomic instability and associated development of aggressive biologic behavior in meningiomas. PMID:22355270

  3. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    PubMed

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of 23 (35%) of 'missing' mutations in Usher type 2 probands with only a single heterozygous USH2A mutation detected with Sanger sequencing could be attributed to deletions, duplications or a pathogenic deep intronic variant. Future mutation detection strategies and genetic counselling will need to take into account the prevalence of these types of mutations in order to provide a more comprehensive diagnostic service.

  4. Deletions spanning the neurofibromatosis I gene: Identification and phenotype of five patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kayes, L.M.; Burke, W.; Bennett, R.

    Neurofibromatosis type 1 (NF1) is an autosomal dominant disorder characterized by marked variation in clinical severity. To investigate the contribution to variability by genes either contiguous to or contained within the NF1 gene, the authors screened six NF1 patients with mild facial dysmorphology, mental retardation, and/or learning disabilities, for DNA rearrangement of the NF1 region. Five of the six patients had NF1 gene deletions on the basis of quantitative densitometry, locus hemizygosity, and analysis of somatic cell hybrid lines. Analysis of hybrid lines carrying each of the patient's chromosomes 17, with 15 regional DNA markers, demonstrated that each of themore » five patients carried a deletion >700 kb in size. Minimally, each of the deletions involved the entire 350-kb NF1 gene; the three genes - EVI2A, EVI2B, and OMG-that are contained within an NF1 intron; and considerable flanking DNA. For four of the patients, the deletions mapped to the same interval; the deletion in the fifth patient was larger, extending farther in both directions. The remaining NF1 allele presumably produced functional neurofibromin; no gene rearrangements were detected, and RNA-PCR demonstrated that it was transcribed. These data provide compelling evidence that the NF1 disorder results from haploid insufficiency of neurofibromin. Of the three documented de novo deletion cases, two involved the paternal NF1 allele and one the maternal allele. The parental origin of the single remaining expresses NF1 allele had no dramatic effect on patient phenotype. The deletion patients exhibited a variable number of physical anomalies that were not correlated with the extent of their deletion. All five patients with deletions were remarkable for exhibiting a large number of neurfibromas for their age, suggesting that deletion of an unknown gene in the NF1 region may affect tumor initiation or development. 69 refs., 5 figs., 1 tab.« less

  5. Small values in big data: The continuing need for appropriate metadata

    USGS Publications Warehouse

    Stow, Craig A.; Webster, Katherine E.; Wagner, Tyler; Lottig, Noah R.; Soranno, Patricia A.; Cha, YoonKyung

    2018-01-01

    Compiling data from disparate sources to address pressing ecological issues is increasingly common. Many ecological datasets contain left-censored data – observations below an analytical detection limit. Studies from single and typically small datasets show that common approaches for handling censored data — e.g., deletion or substituting fixed values — result in systematic biases. However, no studies have explored the degree to which the documentation and presence of censored data influence outcomes from large, multi-sourced datasets. We describe left-censored data in a lake water quality database assembled from 74 sources and illustrate the challenges of dealing with small values in big data, including detection limits that are absent, range widely, and show trends over time. We show that substitutions of censored data can also bias analyses using ‘big data’ datasets, that censored data can be effectively handled with modern quantitative approaches, but that such approaches rely on accurate metadata that describe treatment of censored data from each source.

  6. A patient with congenital hyperlactataemia and Leigh syndrome: an uncommon mitochondrial variant.

    PubMed

    Ching, C K; Mak, Chloe M; Au, K M; Chan, K Y; Yuen, Y P; Yau, Eric K C; Ma, Louis C K; Chow, H L; Chan, Albert Y W

    2013-08-01

    We report an uncommon mitochondrial variant in a baby girl with congenital hyperlactataemia and Leigh syndrome. The patient presented with a single episode of generalised clonic convulsion at day 19, and was found to have isolated and persistent hyperlactataemia ranging from 3.34 to 9.26 mmol/L. She had elevated serum lactate-to-pyruvate ratios of up to 35 and high plasma alanine concentration, indicative of a respiratory chain defect. At the age of 8 months, she developed evolving neurological and imaging features compatible with Leigh syndrome. Genetic testing for common mitochondrial DNA mutations, large mitochondrial DNA deletions, and selected nuclear genes was negative. Further analysis of lymphocyte mitochondrial DNA by sequencing revealed an uncommon heteroplasmic variant, NC_012920.1(MT-ND5):m.13094T>C (p.Val253Ala), which was previously shown to reduce complex I activity. In patients in whom there was a high suspicion of mitochondrial disorder, entire mitochondrial DNA analysis may be warranted if initial screening of common mitochondrial DNA mutations is negative.

  7. Recombination of mitochondrial DNA in skeletal muscle of individuals with multiple mitochondrial DNA heteroplasmy.

    PubMed

    Zsurka, Gábor; Kraytsberg, Yevgenia; Kudina, Tatiana; Kornblum, Cornelia; Elger, Christian E; Khrapko, Konstantin; Kunz, Wolfram S

    2005-08-01

    Experimental evidence for human mitochondrial DNA (mtDNA) recombination was recently obtained in an individual with paternal inheritance of mtDNA and in an in vitro cell culture system. Whether mtDNA recombination is a common event in humans remained to be determined. To detect mtDNA recombination in human skeletal muscle, we analyzed the distribution of alleles in individuals with multiple mtDNA heteroplasmy using single-cell PCR and allele-specific PCR. In all ten individuals who carried a heteroplasmic D-loop mutation and a distantly located tRNA point mutation or a large deletion, we observed a mixture of four allelic combinations (tetraplasmy), a hallmark of recombination. Twelve of 14 individuals with closely located heteroplasmic D-loop mutation pairs contained a mixture of only three types of mitochondrial genomes (triplasmy), consistent with the absence of recombination between adjacent markers. These findings indicate that mtDNA recombination is common in human skeletal muscle.

  8. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa

    PubMed Central

    García-García, Gema; Jaijo, Teresa; Aparisi, Maria J.; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M.

    2014-01-01

    Purpose The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. Methods The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. Results We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Conclusions Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures. PMID:25352746

  9. An assessment of heavy ion irradiation mutagenesis for reverse genetics in wheat (Triticum aestivum L.).

    PubMed

    Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal

    2015-01-01

    Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.

  10. An Assessment of Heavy Ion Irradiation Mutagenesis for Reverse Genetics in Wheat (Triticum aestivum L.)

    PubMed Central

    Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal

    2015-01-01

    Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507

  11. Multi-agent chemotherapy overcomes glucocorticoid resistance conferred by a BIM deletion polymorphism in pediatric acute lymphoblastic leukemia.

    PubMed

    Soh, Sheila Xinxuan; Lim, Joshua Yew Suang; Huang, John W J; Jiang, Nan; Yeoh, Allen Eng Juh; Ong, S Tiong

    2014-01-01

    A broad range of anti-cancer agents, including glucocorticoids (GCs) and tyrosine kinase inhibitors (TKIs), kill cells by upregulating the pro-apoptotic BCL2 family member, BIM. A common germline deletion in the BIM gene was recently shown to favor the production of non-apoptotic BIM isoforms, and to predict inferior responses in TKI-treated chronic myeloid leukemia (CML) and EGFR-driven lung cancer patients. Given that both in vitro and in vivo GC resistance are predictive of adverse outcomes in acute lymphoblastic leukemia (ALL), we hypothesized that this polymorphism would mediate GC resistance, and serve as a biomarker of poor response in ALL. Accordingly, we used zinc finger nucleases to generate ALL cell lines with the BIM deletion, and confirmed the ability of the deletion to mediate GC resistance in vitro. In contrast to CML and lung cancer, the BIM deletion did not predict for poorer clinical outcome in a retrospective analysis of 411 pediatric ALL patients who were uniformly treated with GCs and chemotherapy. Underlying the lack of prognostic significance, we found that the chemotherapy agents used in our cohort (vincristine, L-asparaginase, and methotrexate) were each able to induce ALL cell death in a BIM-independent fashion, and resensitize BIM deletion-containing cells to GCs. Together, our work demonstrates how effective therapy can overcome intrinsic resistance in ALL patients, and suggests the potential of using combinations of drugs that work via divergent mechanisms of cell killing to surmount BIM deletion-mediated drug resistance in other cancers.

  12. The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

    PubMed

    Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

    2017-03-01

    Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  13. Genotyping of alpha-thalassemia deletions using multiplex polymerase chain reactions and gold nanoparticle-filled capillary electrophoresis.

    PubMed

    Chen, Yen-Ling; Shih, Chi-Jen; Ferrance, Jerome; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

    2009-02-13

    A gold nanoparticle-filled capillary electrophoresis method combined with three multiplex polymerase chain reactions (PCRs) was established for simultaneous diagnosis of five common alpha-thalassemia deletions, including the -alpha(3.7) deletion, -alpha(4.2) deletion, Southeast Asian (--(SEA)), Filipino (--(FIL)) and Thai (--(THAI)) deletions. Gold nanoparticles (GNPs) were used as a pseudostationary phase to improve the resolution between DNA fragments in a low-viscosity polymer. To achieve the best CE separation, several parameters were evaluated for optimizing the separation conditions, including the capillary coating, the concentrations of polymer sieving matrix, the sizes and concentrations of GNPs, the buffer concentrations, and the pH. The final CE method for separating a 200-base pair (bp) DNA ladder and alpha-thalassemia deletions used a DB-17 capillary, 0.6% poly(ethylene oxide) (PEO) prepared in a mixture of GNP(32nm) solution and glycine buffer (25mM, pH 9.0) (80:20, v/v) as the sieving matrix with 1microM YO-PRO-1 for fluorescence detection; the applied voltage was -10kV (detector at anode side) and the separation temperature was 25 degrees C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2kb to 3.0kb were resolved within 11.5min. The RSDs of migration times were less than 2.81%. A total of 21 patients with alpha-thalassemia deletions were analyzed using this method, and all results showed good agreement with those obtained by gel electrophoresis.

  14. Enhancement of astaxanthin production in Xanthophyllomyces dendrorhous by efficient method for the complete deletion of genes.

    PubMed

    Yamamoto, Keisuke; Hara, Kiyotaka Y; Morita, Toshihiko; Nishimura, Akira; Sasaki, Daisuke; Ishii, Jun; Ogino, Chiaki; Kizaki, Noriyuki; Kondo, Akihiko

    2016-09-13

    Red yeast, Xanthophyllomyces dendrorhous is the only yeast known to produce astaxanthin, an anti-oxidant isoprenoid (carotenoid) widely used in the aquaculture, food, pharmaceutical and cosmetic industries. The potential of this microorganism as a platform cell factory for isoprenoid production has been recognized because of high flux through its native terpene pathway. Recently, we developed a multiple gene expression system in X. dendrorhous and enhanced the mevalonate synthetic pathway to increase astaxanthin production. In contrast, the mevalonate synthetic pathway is suppressed by ergosterol through feedback inhibition. Therefore, releasing the mevalonate synthetic pathway from this inhibition through the deletion of genes involved in ergosterol synthesis is a promising strategy to improve isoprenoid production. An efficient method for deleting diploid genes in X. dendrorhous, however, has not yet been developed. Xanthophyllomyces dendrorhous was cultivated under gradually increasing concentrations of antibiotics following the introduction of antibiotic resistant genes to be replaced with target genes. Using this method, double CYP61 genes encoding C-22 sterol desaturases relating to ergosterol biosynthesis were deleted sequentially. This double CYP61 deleted strain showed decreased ergosterol biosynthesis compared with the parental strain and single CYP61 disrupted strain. Additionally, this double deletion of CYP61 genes showed increased astaxanthin production compared with the parental strain and the single CYP61 knockout strain. Finally, astaxanthin production was enhanced by 1.4-fold compared with the parental strain, although astaxanthin production was not affected in the single CYP61 knockout strain. In this study, we developed a system to completely delete target diploid genes in X. dendrorhous. Using this method, we deleted diploid CYP61 genes involved in the synthesis of ergosterol that inhibits the pathway for mevalonate, which is a common substrate for isoprenoid biosynthesis. The resulting decrease in ergosterol biosynthesis increased astaxanthin production. The efficient method for deleting diploid genes developed in this study has the potential to improve industrial production of various isoprenoids in X. dendrorhous.

  15. Deletion 21pterq22.11: Report of a Patient with Dysmorphic Features, Hypertonia, and Café-au-Lait Macules and Review of the Literature.

    PubMed

    Malinverni, Andréa C M; Yamashiro Coelho, Érika M; Chen, Kelin; Colovati, Mileny E; Soares Pinho Cernach, Mirlene C; Bragagnolo, Silvia; Melaragno, Maria Isabel

    2017-01-01

    Partial monosomy 21 results in a great variability of clinical features that may be associated with the size and location of the deletion. In this study, we report a 22-month-old girl who showed a 45,XX,add(12)(p13)dn,-21 karyotype. The final cytogenomic result was 45,XX,der(12)t(12;21)(p13;q22.11) dn,-21.arr[hg19] 21q11.2q22.11(14824453_33868129)×1 revealing a deletion from 21pter to 21q22.11. Clinical manifestation of the patient included hypertonia, a long philtrum, epicanthic folds, low-set ears, and café-au-lait macules - a phenotype considered as mild despite the relatively large size of the deletion compared to patients from the literature. © 2017 S. Karger AG, Basel.

  16. Myeloablation-associated deletion of ORF4 in a human coronavirus 229E infection.

    PubMed

    Greninger, Alexander L; Pepper, Gregory; Shean, Ryan C; Cent, Anne; Palileo, Isabel; Kuypers, Jane M; Schiffer, Joshua T; Jerome, Keith R

    2017-01-01

    We describe metagenomic next-generation sequencing (mNGS) of a human coronavirus 229E from a patient with AML and persistent upper respiratory symptoms, who underwent hematopoietic cell transplantation (HCT). mNGS revealed a 548-nucleotide deletion, which comprised the near entirety of the ORF4 gene, and no minor allele variants were detected to suggest a mixed infection. As part of her pre-HCT conditioning regimen, the patient received myeloablative treatment with cyclophosphamide and 12 Gy total body irradiation. Iterative sequencing and RT-PCR confirmation of four respiratory samples over the 4-week peritransplant period revealed that the pre-conditioning strain contained an intact ORF4 gene, while the deletion strain appeared just after conditioning and persisted over a 2.5-week period. This sequence represents one of the largest genomic deletions detected in a human RNA virus and describes large-scale viral mutation associated with myeloablation for HCT.

  17. Understanding the differences between genome sequences of Escherichia coli B strains REL606 and BL21(DE3), and comparison of the closely related E. coli B and K-12 genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Studier, F.W.; Daegelen, P.; Lenski, R. E.

    2009-12-01

    Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less

  18. Apolipoprotein B-52 mutation associated with hypobetalipoproteinemia is compatible with a misaligned pairing deletion mechanism.

    PubMed

    Groenewegen, W A; Krul, E S; Schonfeld, G

    1993-06-01

    We have identified a new truncation of apoB in a large kindred with hypobetalipoproteinemia that arose by an ambiguous deletion of one of four different groups of base-pairs. Eleven affected members of the kindred had total cholesterols (C) of 114 +/- 28, LDL-Cs of 46 +/- 21, and apoBs of 47 +/- 25 (all in mg/dl, mean +/- SD). These levels were lower (P < 0.0001) than in 15 unaffected relatives. On Western blotting, apoB-100 and a second major band corresponding to apoB-52 were seen in the affected individuals. The majority of the plasma apoB-52 was associated with a smaller than normal low density lipoprotein (LDL) particle. The molecular basis for this apoB-52 truncation is a 5-bp deletion, converting the sequence between cDNA nucleotide 7276 and 7283 from 5'-AAGTTAAG-3' into the mutant sequence 5'-AAG-3'. This results in a frameshift starting at amino acid residue 2357 and a termination codon at amino acid residue 2362. Deletion of one of four different groups of five consecutive bases, i.e., AAGTT, AGTTA, GTTAA, and TTAAG, all result in the same mutant sequence. Thus, the precise deletion is ambiguous. We propose that a misaligned pairing mechanism involving repeat sequences is compatible with this deletion mutation. We have noted similar ambiguous deletions associated with apoB-37, apoB-40, and a number of single base deletions and some may also be explained by a misaligned pairing mechanism. Small ambiguous deletions appear to constitute a major proportion of the apoB gene mutation spectrum suggesting that it may be a suitable model for studying the mechanisms of such mutations.

  19. Molecular analysis and comparison of radiation-induced large deletions of the HPRT locus in primary human skin fibroblasts

    NASA Technical Reports Server (NTRS)

    Yamada, Y.; Park, M. S.; Okinaka, R. T.; Chen, D. J.

    1996-01-01

    Genetic alterations in gamma-ray- and alpha-particle-induced HPRT mutants were examined by multiplex polymerase chain reaction (PCR) analysis. A total of 39-63% of gamma-ray-induced and 31-57% of alpha-particle-induced mutants had partial or total deletions of the HPRT gene. The proportion of these deletion events was dependent on radiation dose, and at the resolution limits employed there were no significant differences between the spectra induced by equitoxic doses of alpha particles (0.2-0.4 Gy) and gamma rays (3 Gy). The molecular nature of the deletions was analyzed by the use of sequence tagged site (STS) primers and PCR amplification as a "probe" for specific regions of the human X chromosome within the Xq26 region. These STSs were closely linked and spanned regions approximately 1.7 Mbp from the telomeric side and 1.7 Mbp from the centromeric side of the HPRT gene. These markers include: DXS53, 299R, DXS79, yH3L, 3/19, PR1, PR25, H2, yH3R, 1/44, 1/67, 1/1, DXS86, D8C6, DXS10 and DXS144. STS analyses indicated that the maximum size of total deletions in radiation-induced HPRT mutants can be greater than 2.7 Mbp and deletion size appears to be dependent on radiation dose. There were no apparent differences in the sizes of the deletions induced by alpha particles or gamma rays. On the other hand, deletions containing portions of the HPRT gene were observed to be 800 kbp or less, and the pattern of the partial deletion induced by alpha particles appeared to be different from that induced by gamma rays.

  20. Comparison of facial features of DiGeorge syndrome (DGS) due to deletion 10p13-10pter with DGS due to 22q11 deletion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodship, J.; Lynch, S.; Brown, J.

    1994-09-01

    DiGeorge syndrome (DGS) is a congenital anomaly consisting of cardiac defects, aplasia or hypoplasia of the thymus and parathroid glands, and dysmorphic facial features. The majority of DGS cases have a submicroscopic deletion within chromosome 22q11. However there have been a number of reports of DGS in association with other chromosomal abnormalities including four cases with chromosome 10p deletions. We describe a further 10p deletion case and suggest that the facial features in children with DGS due to deletions of 10p are different from those associated with chromosome 22 deletions. The propositus was born at 39 weeks gestation to unrelatedmore » caucasian parents, birth weight 2580g (10th centile) and was noted to be dysmorphic and cyanosed shortly after birth. The main dysmorphic facial features were a broad nasal bridge with very short palpebral fissures. Echocardiography revealed a large subsortic VSD and overriding aorta. She had a low ionised calcium and low parathroid hormone level. T cell subsets and PHA response were normal. Abdominal ultrasound showed duplex kidneys and on further investigation she was found to have reflux and raised plasma creatinine. She had an anteriorly placed anus. Her karyotype was 46,XX,-10,+der(10)t(3;10)(p23;p13)mat. The dysmorphic facial features in this baby are strikingly similar to those noted by Bridgeman and Butler in child with DGS as the result of a 10p deletion and distinct from the face seen in children with DiGeorge syndrome resulting from interstitial chromosome 22 deletions.« less

  1. Aberrant interchromosomal exchanges are the predominant cause of the 22q11.2 deletion

    PubMed Central

    Saitta, Sulagna C.; Harris, Stacy E.; Gaeth, Ann P.; Driscoll, Deborah A.; McDonald-McGinn, Donna M.; Maisenbacher, Melissa K.; Yersak, Jill M.; Chakraborty, Prabir K.; Hacker, April M.; Zackai, Elaine H.; Ashley, Terry; Emanuel, Beverly S.

    2010-01-01

    Chromosome 22q11.2 deletions are found in almost 90% of patients with DiGeorge/velocardiofacial syndrome (DGS/VCFS). Large, chromosome-specific low copy repeats (LCRs), flanking and within the deletion interval, are presumed to lead to misalignment and aberrant recombination in meiosis resulting in this frequent microdeletion syndrome. We traced the grandparental origin of regions flanking de novo 3 Mb deletions in 20 informative three-generation families. Haplotype reconstruction showed an unexpectedly high number of proximal interchromosomal exchanges between homologs, occurring in 19/20 families. Instead, the normal chromosome 22 in these probands showed interchromosomal exchanges in 2/15 informative meioses, a rate consistent with the genetic distance. Meiotic exchanges, visualized as MLH1 foci, localize to the distal long arm of chromosome 22 in 75% of human spermatocytes tested, also reflecting the genetic map. Additionally, we found no effect of proband gender or parental age on the crossover frequency. Parental origin studies in 65 de novo 3 Mb deletions (including these 20 patients) demonstrated no bias. Unlike Williams syndrome, we found no chromosomal inversions flanked by LCRs in 22 sets of parents of 22q11 deleted patients, or in eight non-deleted patients with a DGS/VCFS phenotype using FISH. Our data are consistent with significant aberrant interchromosomal exchange events during meiosis I in the proximal region of the affected chromosome 22 as the likely etiology for the deletion. This type of exchange occurs more often than is described for deletions of chromosomes 7q11, 15q11, 17p11 and 17q11, implying a difference in the meiotic behavior of chromosome 22. PMID:14681306

  2. MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

    Cancer.gov

    The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

  3. Performance on a computerized neurocognitive battery in 22q11.2 deletion syndrome: A comparison between US and Israeli cohorts

    PubMed Central

    Yi, James J.; Weinberger, Ronnie; Moore, Tyler M.; Calkins, Monica E.; Guri, Yael; McDonald-McGinn, Donna M.; Zackai, Elaine H.; Emanuel, Beverly S.; Gur, Raquel E.; Gothelf, Doron; Gur, Ruben C.

    2016-01-01

    Increasingly, the effects of copy number variation (CNV) in the genome on brain function and behaviors are recognized as means to elucidate pathophysiology of psychiatric disorders. Such studies require large samples and we characterized the neurocognitive profile of two cohorts of individuals with 22q11.2 deletion syndrome (22q11DS), the most common CNV associated with schizophrenia, in an effort to harmonize phenotyping in multi-site global collaborations. The Penn Computerized Neurocognitive Battery (PCNB) was administered to individuals with 22q11DS in Philadelphia (PHL; n=155, aged 12–40) and Tel Aviv (TLV; n=59, aged 12–36). We examined effect sizes of performance differences between the cohorts and confirmed the factor structure of PCNB performance efficiency in the combined sample based on data from a large comparison community sample. The cohorts performed comparably with notable deficits in executive function, episodic memory and social cognition domains that were previously associated with abnormal neuroimaging findings in 22q11DS. In mixed model analysis, while there was a main effect for site for accuracy (number of correct response) and speed (time to correct response) independently, there were no main site effects for standardized efficiency (average of accuracy and speed). The fit of a structural model was excellent indicating that PCNB tests were related to the targeted cognitive domains. Thus, our results provide preliminary support for the use of the PCNB as an efficient tool for neurocognitive assessment in international 22q11DS collaborations. PMID:27200494

  4. Performance on a computerized neurocognitive battery in 22q11.2 deletion syndrome: A comparison between US and Israeli cohorts.

    PubMed

    Yi, James J; Weinberger, Ronnie; Moore, Tyler M; Calkins, Monica E; Guri, Yael; McDonald-McGinn, Donna M; Zackai, Elaine H; Emanuel, Beverly S; Gur, Raquel E; Gothelf, Doron; Gur, Ruben C

    2016-07-01

    Increasingly, the effects of copy number variation (CNV) in the genome on brain function and behaviors are recognized as means to elucidate pathophysiology of psychiatric disorders. Such studies require large samples and we characterized the neurocognitive profile of two cohorts of individuals with 22q11.2 deletion syndrome (22q11DS), the most common CNV associated with schizophrenia, in an effort to harmonize phenotyping in multi-site global collaborations. The Penn Computerized Neurocognitive Battery (PCNB) was administered to individuals with 22q11DS in Philadelphia (PHL; n=155, aged 12-40) and Tel Aviv (TLV; n=59, aged 12-36). We examined effect sizes of performance differences between the cohorts and confirmed the factor structure of PCNB performance efficiency in the combined sample based on data from a large comparison community sample. The cohorts performed comparably with notable deficits in executive function, episodic memory and social cognition domains that were previously associated with abnormal neuroimaging findings in 22q11DS. In mixed model analysis, while there was a main effect for site for accuracy (number of correct response) and speed (time to correct response) independently, there were no main site effects for standardized efficiency (average of accuracy and speed). The fit of a structural model was excellent indicating that PCNB tests were related to the targeted cognitive domains. Thus, our results provide preliminary support for the use of the PCNB as an efficient tool for neurocognitive assessment in international 22q11DS collaborations. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Telomere healing following DNA polymerase arrest-induced breakages is likely the main mechanism generating chromosome 4p terminal deletions.

    PubMed

    Hannes, Femke; Van Houdt, Jeroen; Quarrell, Oliver W; Poot, Martin; Hochstenbach, Ron; Fryns, Jean-Pierre; Vermeesch, Joris R

    2010-12-01

    Constitutional developmental disorders are frequently caused by terminal chromosomal deletions. The mechanisms and/or architectural features that might underlie those chromosome breakages remain largely unexplored. Because telomeres are the vital DNA protein complexes stabilizing linear chromosomes against chromosome degradation, fusion, and incomplete replication, those terminal-deleted chromosomes acquired new telomeres either by telomere healing or by telomere capture. To unravel the mechanisms leading to chromosomal breakage and healing, we sequenced nine chromosome 4p terminal deletion boundaries. A computational analysis of the breakpoint flanking region, including 12 previously published pure terminal breakage sites, was performed in order to identify architectural features that might be involved in this process. All terminal 4p truncations were likely stabilized by telomerase-mediated telomere healing. In the majority of breakpoints multiple genetic elements have a potential to induce secondary structures and an enrichment in replication stalling site motifs were identified. These findings suggest DNA replication stalling-induced chromosome breakage during early development is the first mechanistic step leading toward terminal deletion syndromes. © 2010 Wiley-Liss, Inc.

  6. V beta-specific deletion of mature thymocytes induced by the plant superantigen Urtica dioica agglutinin.

    PubMed

    Delcourt, M; Peumans, W J; Wagner, M C; Truffa-Bachi, P

    1996-03-15

    Urtica dioica agglutinin (UDA), a plant protein, is a superantigen activating in a MHC class II-restricted manner the V beta 8. 3-bearing T-cells (Galelli and Truffa-Bachi, J. Immunol. 151, 1821, 1993). Administration of UDA to adult mice provokes the clonal expansion of the responding cells which is followed by the deletion of the major fraction of the UDA-sensitive cells, whereas the remaining cells become anergic (Galelli et al., J. Immunol. 154, 2600, 1995). We have analyzed the effect of UDA on thymocytes. Injection of UDA resulted in a rapid, but transient, deletion of a large fraction of the V beta 8.3-bearing mature T-cells. In contrast to other exogenous superantigens, this deletion was not preceded by the clonal expansion of the UDA-responding thymocytes. Moreover, the V beta 8.3-bearing mature T-cells escaping the deletion were not anergic to an in vitro UDA restimulation. UDA and the other superantigens also differ as the general, V beta-unrestricted, thymic atrophy induced by classical superantigens was not observed with UDA.

  7. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    PubMed Central

    Mayeur, Hélène; Roche, Olivier; Vêtu, Christelle; Jaliffa, Carolina; Marchant, Dominique; Dollfus, Hélène; Bonneau, Dominique; Munier, Francis L; Schorderet, Daniel F; Levin, Alex V; Héon, Elise; Sutherland, Joanne; Lacombe, Didier; Said, Edith; Mezer, Eedy; Kaplan, Josseline; Dufier, Jean-Louis; Marsac, Cécile; Menasche, Maurice; Abitbol, Marc

    2006-01-01

    Background Ocular albinism type 1 (OA1) is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand. PMID:16646960

  8. Detailed analysis of targeted gene mutations caused by the Platinum-Fungal TALENs in Aspergillus oryzae RIB40 strain and a ligD disruptant.

    PubMed

    Mizutani, Osamu; Arazoe, Takayuki; Toshida, Kenji; Hayashi, Risa; Ohsato, Shuichi; Sakuma, Tetsushi; Yamamoto, Takashi; Kuwata, Shigeru; Yamada, Osamu

    2017-03-01

    Transcription activator-like effector nucleases (TALENs), which can generate DNA double-strand breaks at specific sites in the desired genome locus, have been used in many organisms as a tool for genome editing. In Aspergilli, including Aspergillus oryzae, however, the use of TALENs has not been validated. In this study, we performed genome editing of A. oryzae wild-type strain via error of nonhomologous end-joining (NHEJ) repair by transient expression of high-efficiency Platinum-Fungal TALENs (PtFg TALENs). Targeted mutations were observed as various mutation patterns. In particular, approximately half of the PtFg TALEN-mediated deletion mutants had deletions larger than 1 kb in the TALEN-targeting region. We also conducted PtFg TALEN-based genome editing in A. oryzae ligD disruptant (ΔligD) lacking the ligD gene involved in the final step of the NHEJ repair and found that mutations were still obtained as well as wild-type. In this case, the ratio of the large deletions reduced compared to PtFg TALEN-based genome editing in the wild-type. In conclusion, we demonstrate that PtFg TALENs are sufficiently functional to cause genome editing via error of NHEJ in A. oryzae. In addition, we reveal that genome editing using TALENs in A. oryzae tends to cause large deletions at the target region, which were partly suppressed by deletion of ligD. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. A molecular and clinical study of Larsen syndrome caused by mutations in FLNB.

    PubMed

    Bicknell, Louise S; Farrington-Rock, Claire; Shafeghati, Yousef; Rump, Patrick; Alanay, Yasemin; Alembik, Yves; Al-Madani, Navid; Firth, Helen; Karimi-Nejad, Mohammad Hassan; Kim, Chong Ae; Leask, Kathryn; Maisenbacher, Melissa; Moran, Ellen; Pappas, John G; Prontera, Paolo; de Ravel, Thomy; Fryns, Jean-Pierre; Sweeney, Elizabeth; Fryer, Alan; Unger, Sheila; Wilson, L C; Lachman, Ralph S; Rimoin, David L; Cohn, Daniel H; Krakow, Deborah; Robertson, Stephen P

    2007-02-01

    Larsen syndrome is an autosomal dominant osteochondrodysplasia characterised by large-joint dislocations and craniofacial anomalies. Recently, Larsen syndrome was shown to be caused by missense mutations or small inframe deletions in FLNB, encoding the cytoskeletal protein filamin B. To further delineate the molecular causes of Larsen syndrome, 20 probands with Larsen syndrome together with their affected relatives were evaluated for mutations in FLNB and their phenotypes studied. Probands were screened for mutations in FLNB using a combination of denaturing high-performance liquid chromatography, direct sequencing and restriction endonuclease digestion. Clinical and radiographical features of the patients were evaluated. The clinical signs most frequently associated with a FLNB mutation are the presence of supernumerary carpal and tarsal bones and short, broad, spatulate distal phalanges, particularly of the thumb. All individuals with Larsen syndrome-associated FLNB mutations are heterozygous for either missense or small inframe deletions. Three mutations are recurrent, with one mutation, 5071G-->A, observed in 6 of 20 subjects. The distribution of mutations within the FLNB gene is non-random, with clusters of mutations leading to substitutions in the actin-binding domain and filamin repeats 13-17 being the most common cause of Larsen syndrome. These findings collectively define autosomal dominant Larsen syndrome and demonstrate clustering of causative mutations in FLNB.

  10. Synaptic plasticity and spatial working memory are impaired in the CD mouse model of Williams-Beuren syndrome.

    PubMed

    Borralleras, Cristina; Mato, Susana; Amédée, Thierry; Matute, Carlos; Mulle, Christophe; Pérez-Jurado, Luis A; Campuzano, Victoria

    2016-08-02

    Mice heterozygous for a complete deletion (CD) equivalent to the most common deletion found in individuals with Williams-Beuren syndrome (WBS) recapitulate relevant features of the neurocognitive phenotype, such as hypersociability, along with some neuroanatomical alterations in specific brain areas. However, the pathophysiological mechanisms underlying these phenotypes still remain largely unknown. We have studied the synaptic function and cognition in CD mice using hippocampal slices and a behavioral test sensitive to hippocampal function. We have found that long-term potentiation (LTP) elicited by theta burst stimulation (TBS) was significantly impaired in hippocampal field CA1 of CD animals. This deficit might be associated with the observed alterations in spatial working memory. However, we did not detect changes in presynaptic function, LTP induction mechanisms or AMPA and NMDA receptor function. Reduced levels of Brain-derived neurotrophic factor (BDNF) were present in the CA1-CA3 hippocampal region of CD mice, which could account for LTP deficits in these mice. Taken together, these results suggest a defect of CA1 synapses in CD mice to sustain synaptic strength after stimulation. These data represent the first description of synaptic functional deficits in CD mice and further highlights the utility of the CD model to study the mechanisms underlying the WBS neurocognitive profile.

  11. Account Deletion Prediction on RuNet: A Case Study of Suspicious Twitter Accounts Active During the Russian-Ukrainian Crisis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volkova, Svitlana; Bell, Eric B.

    Social networks are dynamically changing over time e.g., some accounts are being created and some are being deleted or become private. This ephemerality at both an account level and content level results from a combination of privacy concerns, spam, and deceptive behaviors. In this study we analyze a large dataset of 180,340 accounts active during the Russian-Ukrainian crisis to discover a series of predictive features for the removal or shutdown of a suspicious account. We find that unlike previously reported profile and net- work features, lexical features form the basis for highly accurate prediction of the deletion of an account.

  12. Attenuation and efficacy of live-attenuated Rift Valley fever virus vaccine candidates in non-human primates.

    PubMed

    Smith, Darci R; Johnston, Sara C; Piper, Ashley; Botto, Miriam; Donnelly, Ginger; Shamblin, Joshua; Albariño, César G; Hensley, Lisa E; Schmaljohn, Connie; Nichol, Stuart T; Bird, Brian H

    2018-05-09

    Rift Valley fever virus (RVFV) is an important mosquito-borne veterinary and human pathogen that has caused large outbreaks of severe disease throughout Africa and the Arabian Peninsula. Currently, no licensed vaccine or therapeutics exists to treat this potentially deadly disease. The explosive nature of RVFV outbreaks and the severe consequences of its accidental or intentional introduction into RVFV-free areas provide the impetus for the development of novel vaccine candidates for use in both livestock and humans. Rationally designed vaccine candidates using reverse genetics have been used to develop deletion mutants of two known RVFV virulence factors, the NSs and NSm genes. These recombinant viruses were demonstrated to be protective and immunogenic in rats, mice, and sheep, without producing clinical illness in these animals. Here, we expand upon those findings and evaluate the single deletion mutant (ΔNSs rRVFV) and double deletion mutant (ΔNSs-ΔNSm rRVFV) vaccine candidates in the common marmoset (Callithrix jacchus), a non-human primate (NHP) model resembling severe human RVF disease. We demonstrate that both the ΔNSs and ΔNSs-ΔNSm rRVFV vaccine candidates were found to be safe and immunogenic in the current study. The vaccinated animals received a single dose of vaccine that led to the development of a robust antibody response. No vaccine-induced adverse reactions, signs of clinical illness or infectious virus were detected in the vaccinated marmosets. All vaccinated animals that were subsequently challenged with RVFV were protected against viremia and liver disease. In summary, our results provide the basis for further development of the ΔNSs and ΔNSs-ΔNSm rRVFV as safe and effective human RVFV vaccines for this significant public health threat.

  13. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    PubMed

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  14. Surgical Outcomes for Speech Surgery in 22q11.2 Deletion Syndrome: The Dilemma of Persistent Velopharyngeal Insufficiency After Pharyngeal Flap Operation.

    PubMed

    Wagner, Ryan D; Wolfswinkel, Erik M; Buchanan, Edward P; Khechoyan, David Y

    2017-07-01

    The majority of patients with 22q11.2 deletion syndrome suffer from velopharyngeal insufficiency (VPI). Patients with 22q11.2 deletion syndrome (22qDS) commonly present with a large central velopharyngeal gap in the setting of poor velar and pharyngeal wall motion. The posterior pharyngeal flap is considered the most effective technique to treat VPI in this complex patient group. This study aims to critically evaluate success rates of surgical management of VPI in 22qDS patients and discuss options for management of a failed posterior pharyngeal flap (PPF) with persistent VPI. A systematic review was performed through MEDLINE and Scopus to examine the outcomes of PPF surgery to treat VPI in patients with 22qDS. Complications were defined as persistent VPI, hyponasal speech, and obstructive sleep apnea. To demonstrate an approach to management, the authors outline a recent patient with a failed PPF in this patient population at the authors' institution. The authors comprehensively reviewed 58 articles, 13 of which contained relevant information with extractable data. Of the 159 patients with 22qDS who underwent PPF to treat VPI, successful outcomes were reported in 135 patients (80%; range: 0%-100%). Complications were reported in 14% of patients, with need for revision operations in 3%. Surgical management of VPI in patients with 22qDS is challenging, with variable success rates reported in the literature. If unsuccessful, the surgeon faces additional challenges with the revision surgery including a scarred PPF donor site, distorted palatal recipient site, and further medialization of internal carotid arteries. Surgical revision of a failed PPF requires meticulous preoperative planning and technical execution.

  15. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    PubMed

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  16. Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

    PubMed

    Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

    2018-03-01

    Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

  17. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism.

    PubMed

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb

    2013-06-01

    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  18. Evidence from the structure and function of cytochromes c(2) that nonsulfur purple bacterial photosynthesis followed the evolution of oxygen respiration.

    PubMed

    Meyer, Terry; Van Driessche, Gonzalez; Ambler, Richard; Kyndt, John; Devreese, Bart; Van Beeumen, Jozef; Cusanovich, Michael

    2010-10-01

    Cytochromes c(2) are the nearest bacterial homologs of mitochondrial cytochrome c. The sequences of the known cytochromes c(2) can be placed in two subfamilies based upon insertions and deletions, one subfamily is most like mitochondrial cytochrome c (the small C2s, without significant insertions and deletions), and the other, designated large C2, shares 3- and 8-residue insertions as well as a single-residue deletion. C2s generally function between cytochrome bc(1) and cytochrome oxidase in respiration (ca 80 examples known to date) and between cytochrome bc(1) and the reaction center in nonsulfur purple bacterial photosynthesis (ca 21 examples). However, members of the large C2 subfamily are almost always involved in photosynthesis (12 of 14 examples). In addition, the gene for the large C2 (cycA) is associated with those for the photosynthetic reaction center (pufBALM). We hypothesize that the insertions in the large C2s, which were already functioning in photosynthesis, allowed them to replace the membrane-bound tetraheme cytochrome, PufC, that otherwise mediates between the small C2 or other redox proteins and photosynthetic reaction centers. Based upon our analysis, we propose that the involvement of C2 in nonsulfur purple bacterial photosynthesis was a metabolic feature subsequent to the evolution of oxygen respiration.

  19. Methylation-Specific Multiplex Ligation-Dependent Probe Amplification and Identification of Deletion Genetic Subtypes in Prader-Willi Syndrome

    PubMed Central

    Henkhaus, Rebecca S.; Kim, Soo-Jeong; Kimonis, Virginia E.; Gold, June-Anne; Dykens, Elisabeth M.; Driscoll, Daniel J.

    2012-01-01

    Purpose: Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are complex neurodevelopmental disorders caused by loss of expression of imprinted genes from the 15q11-q13 region depending on the parent of origin. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) kits from MRC-Holland (Amsterdam, The Netherlands) were used to detect PWS and AS deletion subtypes. We report our experience with two versions of the MS-MLPA-PWS/AS kit (original A1 and newer B1) in determining methylation status and deletion subtypes in individuals with PWS. Methods: MS-MLPA analysis was performed on DNA isolated from a large cohort of PWS subjects with the MS-MLPA-PWS/AS-A1 and -B1 probe sets. Results: Both MS-MLPA kits will identify deletions in the 15q11-q13 region but the original MS-MLPA-A1 kit has a higher density of probes at the telomeric end of the 15q11-q13 region, which is more useful for identifying individuals with atypical deletions. The newer B1 kit contains more probes in the imprinting center (IC) and adjoining small noncoding RNAs useful in identifying small microdeletions. Conclusion: The A1 kit identified the typical deletions and smaller atypical deletions, whereas the B1 kit was more informative for identifying microdeletions including the IC and SNORD116 regions. Both kits should be made available for accurate characterization of PWS/AS deletion subtypes as well as evaluating for IC and SNORD116 microdeletions. PMID:21977908

  20. Autistic disorder in patients with Williams-Beuren syndrome: a reconsideration of the Williams-Beuren syndrome phenotype.

    PubMed

    Tordjman, Sylvie; Anderson, George M; Botbol, Michel; Toutain, Annick; Sarda, Pierre; Carlier, Michèle; Saugier-Veber, Pascale; Baumann, Clarisse; Cohen, David; Lagneaux, Céline; Tabet, Anne-Claude; Verloes, Alain

    2012-01-01

    Williams-Beuren syndrome (WBS), a rare developmental disorder caused by deletion of contiguous genes at 7q11.23, has been characterized by strengths in socialization (overfriendliness) and communication (excessive talkativeness). WBS has been often considered as the polar opposite behavioral phenotype to autism. Our objective was to better understand the range of phenotypic expression in WBS and the relationship between WBS and autistic disorder. The study was conducted on 9 French individuals aged from 4 to 37 years old with autistic disorder associated with WBS. Behavioral assessments were performed using Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) scales. Molecular characterization of the WBS critical region was performed by FISH. FISH analysis indicated that all 9 patients displayed the common WBS deletion. All 9 patients met ADI-R and ADOS diagnostic criteria for autism, displaying stereotypies and severe impairments in social interaction and communication (including the absence of expressive language). Additionally, patients showed improvement in social communication over time. The results indicate that comorbid autism and WBS is more frequent than expected and suggest that the common WBS deletion can result in a continuum of social communication impairment, ranging from excessive talkativeness and overfriendliness to absence of verbal language and poor social relationships. Appreciation of the possible co-occurrence of WBS and autism challenges the common view that WBS represents the opposite behavioral phenotype of autism, and might lead to improved recognition of WBS in individuals diagnosed with autism.

  1. Isolation of expressed sequences from the region commonly deleted in Velo-cardio-facial syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sirotkin, H.; Morrow, B.; DasGupta, R.

    Velo-cardio-facial syndrome (VCFS) is a relatively common autosomal dominant genetic disorder characterized by cleft palate, cardiac abnormalities, learning disabilities and a characteristic facial dysmorphology. Most VCFS patients have interstitial deletions of 22q11 of 1-2 mb. In an effort to isolate the gene(s) responsible for VCFS we have utilized a hybrid selection protocol to recover expressed sequences from three non-overlapping YACs comprising almost 1 mb of the commonly deleted region. Total yeast genomic DNA or isolated YAC DNA was immobilized on Hybond-N filters, blocked with yeast and human ribosomal and human repetitive sequences and hybridized with a mixture of random primedmore » short fragment cDNA libraries. Six human short fragment libraries derived from total fetus, fetal brain, adult brain, testes, thymus and spleen have been used for the selections. Short fragment cDNAs retained on the filter were passed through a second round of selection and cloned into lambda gt10. cDNAs shown to originate from the YACs and from chromosome 22 are being used to isolate full length cDNAs. Three genes known to be present on these YACs, catechol-O-methyltransferase, tuple 1 and clathrin heavy chain have been recovered. Additionally, a gene related to the murine p120 gene and a number of novel short cDNAs have been isolated. The role of these genes in VCFS is being investigated.« less

  2. Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

    PubMed

    Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

    2014-06-01

    Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

    PubMed

    Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

    2014-01-01

    Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

  4. Genomic interval engineering of mice identified a novel modulator of triglyceride production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Y.; Jong, M.C.; Frazer, K.A.

    1999-10-01

    To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

  5. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

    PubMed

    Flibotte, Stephane; Moerman, Donald G

    2008-10-21

    Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

  6. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat

    PubMed Central

    Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

  7. Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

    PubMed

    Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

    2010-12-15

    Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occurred in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein.

  8. Meta-analysis confirms the LCE3C_LCE3B deletion as a risk factor for psoriasis in several ethnic groups and finds interaction with HLA-Cw6

    PubMed Central

    Riveira-Munoz, Eva; He, Su-Min; Escaramís, Georgia; Stuart, Philip E; Hüffmeier, Ulrike; Lee, Catherine; Kirby, Brian; Oka, Akira; Giardina, Emiliano; Liao, Wilson; Bergboer, Judith; Kainu, Kati; de Cid, Rafael; Munkhbat, Batmunkh; Zeeuwen, Patrick L J M; Armour, John A L; Poon, Annie; Mabuchi, Tomotaka; Ozawa, Akira; Zawirska, Agnieszka; Burden, David A; Barker, Jonathan N; Capon, Francesca; Traupe, Heiko; Sun, Liang-Dan; Cui, Yong; Yin, Xian-Yong; Chen, Gang; Lim, Henry; Nair, Rajan; Voorhess, John; Tejasvi, Trilokraj; Pujol, Ramón; Munkhtuvshin, Namid; Fischer, Judith; Kere, Juha; Schalkwijk, Joost; Bowcock, Anne; Kwok, Pui-Yan; Novelli, Giuseppe; Inoko, Hidetoshi; Ryan, Anthony W; Trembath, Richard C; Reis, André; Zhang, Xue-Jun; Elder, James T; Estivill, Xavier

    2012-01-01

    A multicenter meta-analysis including data from 9389 psoriasis patients and 9477 control subjects was performed to investigate the contribution of the deletion of genes LCE3C and LCE3B, involved in skin barrier defense, to psoriasis susceptibility in different populations. The study confirms that the deletion of LCE3C and LCE3B is a common genetic factor for susceptibility to psoriasis in European populations [OROverall = 1.21 (1.15–1.27)], and for the first time directly demonstrated the deletion's association with psoriasis in [Chinese OR = 1.27 (1.16–1.34); Mongolian OR = 2.08 (1.44–2.99)] populations. The analysis of the HLA-Cw6 locus showed significant differences in the epistatic interaction with the LCE3C and LCE3B deletion in at least some European populations, indicating epistatic effects between these two major genetic contributors to psoriasis. The study highlights the value of examining genetic risk factors in multiple populations to identify genetic interactions, and indicates the need of further studies to understand the interaction of the skin barrier and the immune system in susceptibility to psoriasis. PMID:21107349

  9. Coincidence of synteny breakpoints with malignancy-related deletions on human chromosome 3

    PubMed Central

    Kost-Alimova, Maria; Kiss, Hajnalka; Fedorova, Ludmila; Yang, Ying; Dumanski, Jan P.; Klein, George; Imreh, Stefan

    2003-01-01

    We have found previously that during tumor growth intact human chromosome 3 transferred into tumor cells regularly looses certain 3p regions, among them the ≈1.4-Mb common eliminated region 1 (CER1) at 3p21.3. Fluorescence in situ hybridization analysis of 12 mouse orthologous loci revealed that CER1 splits into two segments in mouse and therefore contains a murine/human conservation breakpoint region (CBR). Several breaks occurred in tumors within the region surrounding the CBR, and this sequence has features that characterize unstable chromosomal regions: deletions in yeast artificial chromosome clones, late replication, gene and segment duplications, and pseudogene insertions. Sequence analysis of the entire 3p12-22 revealed that other cancer-associated deletions (regions eliminated from monochromosomal hybrids carrying an intact chromosome 3 during tumor growth and homozygous deletions found in human tumors) colocalized nonrandomly with murine/human CBRs and were characterized by an increased number of local gene duplications and murine/human conservation mismatches (single genes that do not match into the conserved chromosomal segment). The CBR within CER1 contains a simple tandem TATAGA repeat capable of forming a 40-bp-long secondary hairpin-like structure. This repeat is nonrandomly localized within the other tumor-associated deletions and in the vicinity of 3p12-22 CBRs. PMID:12738884

  10. Kabuki syndrome is not caused by a microdeletion in the DiGeorge/velocardiofacial chromosomal region within 22q11.2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, M.; Zackai, E.H.; Kaplan, P.

    1996-10-16

    Kabuki syndrome (KS) or Niikawa-Kuroki syndrome is a sporadic disorder characterized by postnatal growth retardation, developmental delay, mild to moderate retardation, and a characteristic facial appearance. Cardiovascular defects, clefts of the lip, palate, or both, and musculoskeletal abnormalities occur in about 50% of patients with KS. The cause of this multiple congenital anomaly syndrome is unknown, and investigators have speculated that KS is a contiguous gene-deletion syndrome. Based on the presence of congenital heart defects in patients with KS, it was suggested that this disorder might share a common cause with the 22q11 deletion syndromes. A preliminary study of 2more » patients with KS failed to detect a deletion within 22q11. We report the results of fluorescence in situ hybridization with cosmid probes for loci D22S75 (N25) and D22S259 (1132) within the DiGeorge chromosomal region (DGCR) on metaphase spreads from an additional 5 patients, 2 non-Japanese and 3 Japanese, with KS. None of the 5 had deletions at either locus. It is unlikely that KS is caused by a deletion within 22q11. 16 refs.« less

  11. Prader-Willi syndrome: intellectual abilities and behavioural features by genetic subtype.

    PubMed

    Milner, Katja M; Craig, Ellen E; Thompson, Russell J; Veltman, Marijcke W M; Thomas, N Simon; Roberts, Sian; Bellamy, Margaret; Curran, Sarah R; Sporikou, Caroline M J; Bolton, Patrick F

    2005-10-01

    Studies of chromosome 15 abnormality have implicated over-expression of paternally imprinted genes in the 15q11-13 region in the aetiology of autism. To test this hypothesis we compared individuals with Prader-Willi syndrome (PWS) due to uniparental disomy (UPD--where paternally imprinted genes are over-expressed) to individuals with the 15q11-13 deletion form of the syndrome (where paternally imprinted genes are not over-expressed). We also tested reports that PWS cases due to the larger type I (TI) form of deletion show differences to cases with the smaller type II (TII) deletion. Ninety-six individuals with PWS were recruited from genetic centres and the PWS association. Forty-nine individuals were confirmed as having maternal UPD of chromosome 15 and were age and sex matched to 47 individuals with a deletion involving 15q11-13 (32 had the shorter (T II) deletion, and 14 had the longer (TI) deletion). Behavioural assessments were carried out blind to genetic status, using the Autism Diagnostic Observation Schedule (ADOS), the Autism Diagnostic Interview (ADI), the Autism Screening Questionnaire (ASQ), the Children's Yale-Brown Obsessive-Compulsive Scale (CY-BOCS), the Vineland Adaptive Behaviour Scales (VABS), and measurements of intellectual ability, including the Wechsler and Mullen Scales and Raven's Matrices. UPD cases exhibited significantly more autistic-like impairments in reciprocal social interaction on questionnaire, interview and standardised observational measures. Comparison of TI and TII deletion cases revealed few differences, but ability levels tended to be lower in the TI deletion cases. Findings from a large study comparing deletion and UPD forms of Prader-Willi syndrome were consistent with other evidence in indicating that paternally imprinted genes in the 15q11-13 region constitute a genetic risk factor for aspects of autistic symptomatology. These genes may therefore play a role in the aetiology of autism. By contrast with another report, there was no clear-cut relationship between the size of the deletion and the form of cognitive and behavioural phenotype.

  12. Neonatal hypocalcemia, neonatal seizures, and intellectual disability in 22q11.2 deletion syndrome

    PubMed Central

    Cheung, Evelyn Ning Man; George, Susan R.; Andrade, Danielle M.; Chow, Eva W. C.; Silversides, Candice K.; Bassett, Anne S.

    2015-01-01

    Purpose Hypocalcemia is a common endocrinological condition in 22q11.2 deletion syndrome. Neonatal hypocalcemia may affect neurodevelopment. We hypothesized that neonatal hypocalcemia would be associated with rare, more severe forms of intellectual disability in 22q11.2 deletion syndrome. Methods We used a logistic regression model to investigate potential predictors of intellectual disability severity, including neonatal hypocalcemia, neonatal seizures, and complex congenital heart disease, e.g., interrupted aortic arch, in 149 adults with 22q11.2 deletion syndrome. Ten subjects had moderate-to-severe intellectual disability. Results The model was highly significant (P < 0.0001), showing neonatal seizures (P = 0.0018) and neonatal hypocalcemia (P = 0.047) to be significant predictors of a more severe level of intellectual disability. Neonatal seizures were significantly associated with neonatal hypocalcemia in the entire sample (P < 0.0001), regardless of intellectual level. There was no evidence for the association of moderate- to-severe intellectual disability with other factors such as major structural brain malformations in this sample. Conclusion The results suggest that neonatal seizures may increase the risk for more severe intellectual deficits in 22q11.2 deletion syndrome, likely mediated by neonatal hypocalcemia. Neonatal hypocalcemia often remains unrecognized until the postseizure period, when damage to neurons may already have occurred. These findings support the importance of early recognition and treatment of neonatal hypocalcemia and potentially neonatal screening for 22q11.2 deletions. PMID:23765047

  13. Phenotypic expression of partial AZFc deletions is independent of the variations in DAZL and BOULE in a Han population.

    PubMed

    Chen, Pu; Ma, Mingyi; Li, Lei; Zhang, Sizhong; Su, Dan; Ma, Yongxin; Liu, Yunqiang; Tao, Dachang; Lin, Li; Yang, Yuan

    2010-01-01

    DAZ on the Y chromosome and 2 autosomal ancestral genes DAZL and BOULE are suggested to represent functional conservation in spermatogenesis. The partial AZFc deletion, a common mutation of the Y chromosome, always involves 2 DAZ copies and represents a different spermatogenic phenotype in the populations studied. To investigate whether the variations in DAZL and BOULE influence partial AZFc deletion phenotype, the genotyping of 15 loci variations, including 4 known mutations and 11 single-nucleotide polymorphisms (SNPs), was carried out in 157 azoo-/oligzoospermic men and 57 normozoospermic men, both groups with partial AZFc deletions. The frequencies of the alleles, genotypes, and haplotypes of the variations were compared between the 2 groups. As a result, for 9 exonic variations in DAZL and BOULE, only T12A was observed in both groups with similar frequency, and I71V was identified in an azoospermic man with b2/b3 deletion, whereas the rest were absent in the population. The distribution of DAZL haplotypes from 4 variations, including T12A, and of BOULE haplotypes from 2 SNPs was similar between men with normozoospermia and spermatogenic failure. Our findings indicate that the contribution of DAZL and BOULE variations to spermatogenic impairment in men with the DAZ defect is greatly limited, suggesting that expression of spermatogenic phenotypes of partial AZFc deletions is independent of the variations in DAZL and BOULE in the Han population.

  14. Reduction of Aspergillus niger Virulence in Apple Fruits by Deletion of the Catalase Gene cpeB.

    PubMed

    Zhang, Meng-Ke; Tang, Jun; Huang, Zhong-Qin; Hu, Kang-Di; Li, Yan-Hong; Han, Zhuo; Chen, Xiao-Yan; Hu, Lan-Ying; Yao, Gai-Fang; Zhang, Hua

    2018-05-30

    Aspergillus niger, a common saprophytic fungus, causes rot in many fruits. We studied the role of a putative catalase-peroxidase-encoding gene, cpeB, in oxidative stress and virulence in fruit. The cpeB gene was deleted in A. niger by homologous recombination, and the Δ cpeB mutant showed decreased CAT activity compared with that of the wild type. The cpeB gene deletion caused increased sensitivity to H 2 O 2 stress, and spore germination was significantly reduced; in addition, the reactive-oxygen-species (ROS) metabolites superoxide anions (·O 2 - ), hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) accumulated in the Δ cpeB mutant during H 2 O 2 stress. Furthermore, ROS metabolism in A. niger infected apples was determined, and our results showed that the Δ cpeB mutant induced an attenuated response in apple fruit during the fruit-pathogen interaction; the cpeB gene deletion significantly reduced the development of lesions, suggesting that the cpeB gene in A. niger is essential for full virulence in apples.

  15. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides.

    PubMed

    Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

    2017-05-31

    Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

  16. Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides

    PubMed Central

    Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall’Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

    2017-01-01

    Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome. PMID:28561789

  17. Nested Inversion Polymorphisms Predispose Chromosome 22q11.2 to Meiotic Rearrangements.

    PubMed

    Demaerel, Wolfram; Hestand, Matthew S; Vergaelen, Elfi; Swillen, Ann; López-Sánchez, Marcos; Pérez-Jurado, Luis A; McDonald-McGinn, Donna M; Zackai, Elaine; Emanuel, Beverly S; Morrow, Bernice E; Breckpot, Jeroen; Devriendt, Koenraad; Vermeesch, Joris R

    2017-10-05

    Inversion polymorphisms between low-copy repeats (LCRs) might predispose chromosomes to meiotic non-allelic homologous recombination (NAHR) events and thus lead to genomic disorders. However, for the 22q11.2 deletion syndrome (22q11.2DS), the most common genomic disorder, no such inversions have been uncovered as of yet. Using fiber-FISH, we demonstrate that parents transmitting the de novo 3 Mb LCR22A-D 22q11.2 deletion, the reciprocal duplication, and the smaller 1.5 Mb LCR22A-B 22q11.2 deletion carry inversions of LCR22B-D or LCR22C-D. Hence, the inversions predispose chromosome 22q11.2 to meiotic rearrangements and increase the individual risk for transmitting rearrangements. Interestingly, the inversions are nested or flanking rather than coinciding with the deletion or duplication sizes. This finding raises the possibility that inversions are a prerequisite not only for 22q11.2 rearrangements but also for all NAHR-mediated genomic disorders. Copyright © 2017. Published by Elsevier Inc.

  18. Array-based comparative genomic hybridization in 190 Korean patients with developmental delay and/or intellectual disability: a single tertiary care university center study.

    PubMed

    Lee, Cha Gon; Park, Sang-Jin; Yun, Jun-No; Ko, Jung Min; Kim, Hyon-Ju; Yim, Shin-Young; Sohn, Young Bae

    2013-11-01

    This study analyzed and evaluated the demographic, clinical, and cytogenetic data [G-banded karyotyping and array-based comparative genomic hybridization (array CGH)] of patients with unexplained developmental delay or intellectual disability at a single Korean institution. We collected clinical and cytogenetic data based on retrospective charts at Ajou University Medical Center, Suwon, Korea from April 2008 to March 2012. A total of 190 patients were identified. Mean age was 5.1±1.87 years. Array CGH yielded abnormal results in 26 of 190 patients (13.7%). Copy number losses were about two-fold more frequent than gains. A total of 61.5% of all patients had copy number losses. The most common deletion disorders included 22q11.2 deletion syndrome, 15q11.2q12 deletion and 18q deletion syndrome. Copy number gains were identified in 34.6% of patients, and common diseases among these included Potocki-Lupski syndrome, 15q11-13 duplication syndrome and duplication 22q. Abnormal karyotype with normal array CGH results was exhibited in 2.6% of patients; theses included balanced translocation (n=2), inversion (n=2) and low-level mosaicism (n=1). Facial abnormalities (p<0.001) and failure to thrive were (p<0.001) also more frequent in the group of patients with abnormal CGH findings. Array CGH is a useful diagnostic tool in clinical settings in patients with developmental delay or intellectual disability combined with facial abnormalities or failure to thrive.

  19. Alpha-thalassemia (3.7 kb deletion) in a population from the Brazilian Amazon region: Santarém, Pará State.

    PubMed

    Souza, A E S; Cardoso, G L; Takanashi, S Y L; Guerreiro, J F

    2009-04-28

    The ethnic composition of the Brazilian population favors high frequencies of the -alpha3.7 deletion, responsible for alpha-thalassemia, because this mutation is very common in African populations. In spite of its importance, this hemoglobinopathy has been poorly investigated in Brazil, especially at the molecular level. We investigated the prevalence of the -alpha3.7 mutation in 220 individuals attended at the Municipal Hospital of Santarém, in the state of Pará. These patients were distributed into three different groups: i) 103 individuals with anemia who had microcytosis and hypochromia, ii) 11 individuals without anemia who had microcytosis and hypochromia, and iii) 106 individuals with no hematological alterations. We examined the usefulness of investigating alpha-thalassemia carrier status for microcytosis. Among the 103 patients with anemia, 20 (19.4%) were heterozygotes (-alpha3.7/alphaalpha) and one (1.0%) was a homozygote (-alpha3.7/-alpha3.7). Among the 11 patients without anemia, one heterozygote (-alpha3.7/alphaalpha) was identified; in the third group, composed of normal individuals (106 samples), deletion -alpha3.7 was found in seven samples (6.6%), all of which were heterozygotes (-alpha/alphaalpha).These frequencies are within the expected range, given available data on the distribution of this hemoglobin disorder in human populations and the ethnic composition of the population of Santarém. We found that alpha-thalassemia is a common cause of microcytosis, given that a high proportion (19.2%) of the microcytic population carried alpha-globin gene deletions.

  20. 75 FR 10223 - Procurement List Proposed Additions and Deletions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-05

    ... Uniform, T-Shirts X Small to XXX Large NSN: 8465-00-NIB-0189--XSmall NSN: 8465-00-NIB-0190--Small NSN..., AR Coast Guard Physical Fitness Uniform, Trunks X Small to XXX Large NSN: 8465-00-NIB-0196--XSmall...

  1. Williams syndrome and mature B-Leukemia: A random association?

    PubMed

    Decimi, Valentina; Fazio, Grazia; Dell'Acqua, Fabiola; Maitz, Silvia; Galbiati, Marta; Rizzari, Carmelo; Biondi, Andrea; Cazzaniga, Giovanni; Selicorni, Angelo

    2016-12-01

    Williams syndrome (WBS) is a rare neurodevelopmental disorder with specific phenotypic characteristics and cardiac abnormalities, but is not considered as a cancer predisposing condition. However, in rare cases, malignancies have been described in patients with WBS, with hematologic cancer (mainly Burkitt Lymphoma and Acute Lymphoblastic Leukemia) as the most represented. We report here the case of a boy with WS and B-NHL. This is the unique case within the large cohort of patients (n = 117) followed in our institution for long time (mean clinical follow-up, 13 years). We herewith propose that the BCL7B gene, located in the chromosomal region commonly deleted in Williams syndrome, could potentially have a role in this particular association. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Distinctive genotypes in infants with T-cell acute lymphoblastic leukaemia.

    PubMed

    Mansur, Marcela B; van Delft, Frederik W; Colman, Susan M; Furness, Caroline L; Gibson, Jane; Emerenciano, Mariana; Kempski, Helena; Clappier, Emmanuelle; Cave, Hélène; Soulier, Jean; Pombo-de-Oliveira, Maria S; Greaves, Mel; Ford, Anthony M

    2015-11-01

    Infant T-cell acute lymphoblastic leukaemia (iT-ALL) is a very rare and poorly defined entity with a poor prognosis. We assembled a unique series of 13 infants with T-ALL, which allowed us to identify genotypic abnormalities and to investigate prenatal origins. Matched samples (diagnosis/remission) were analysed by single nucleotide polymorphism-array to identify genomic losses and gains. In three cases, we identified a recurrent somatic deletion on chromosome 3. These losses result in the complete deletion of MLF1 and have not previously been described in T-ALL. We observed two cases with an 11p13 deletion (LMO2-related), one of which also harboured a deletion of RB1. Another case presented a large 11q14·1-11q23·2 deletion that included ATM and only five patients (38%) showed deletions of CDKN2A/B. Four cases showed NOTCH1 mutations; in one case FBXW7 was the sole mutation and three cases showed alterations in PTEN. KMT2A rearrangements (KMT2A-r) were detected in three out of 13 cases. For three patients, mutations and copy number alterations (including deletion of PTEN) could be backtracked to birth using neonatal blood spot DNA, demonstrating an in utero origin. Overall, our data indicates that iT-ALL has a diverse but distinctive profile of genotypic abnormalities when compared to T-ALL in older children and adults. © 2015 The Authors. British Journal of Haematology published by John Wiley & Sons Ltd.

  3. Fluorescence in situ hybridization for the diagnosis of NPHP1 deletion-related nephronophthisis on renal biopsy.

    PubMed

    Larsen, Christopher P; Bonsib, Stephen M; Beggs, Marjorie L; Wilson, Jon D

    2018-06-24

    Nephronophthisis is an autosomal recessive tubulointerstitial nephropathy that is a leading genetic etiology of end stage renal disease in children and young adults. Approximately 60% of patients with a known genetic etiology of nephronophthisis are due to homozygous deletion of the NPHP1 gene. We identified a total of 45 renal biopsies from young patients with chronic kidney disease of undetermined etiology and analyzed them for the possibility of nephronophthisis due to NPHP1 deletion using interphase fluorescence in situ hybridization and/or polymerase chain reaction. Homozygous NPHP1 deletion was identified in nine patients (20%). In cases with adequate tissue, both assays were performed and showed 100% agreement. Blinded histopathologic analysis was then performed and identified six lesions that were significantly more common in biopsies from patients with NPHP1 deletion-proven nephronophthisis than chronic kidney injury of other known etiologies. Many of the classically described nephronophthisis biopsy lesions such as tubular basement membrane duplication, presence of cysts, and mononuclear interstitial inflammation were not significantly associated with this disease when compared with biopsies from patients with chronic kidney injury due to other etiologies. There were, however, morphologic lesions that were strongly associated with NPHP1 deletion including tubular abnormalities such as diverticulum, florets, and macula densa-like change as well as interstitial Tamm-Horsfall aggregates, periglomerular fibrosis, and the absence of arteriosclerosis. Awareness of the histopathologic pattern of injury in nephronophthisis combined with testing for NPHP1 deletion enables renal pathologists to provide a definitive pathologic and genetic diagnosis in a subset of patients with this disease. Copyright © 2018. Published by Elsevier Inc.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quan, F.; Zonana, J.; Gunter, K.

    Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and {ge}9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure ofmore » RK`s DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5{prime}-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient`s unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. 36 refs., 7 figs.« less

  5. Genetic subtype differences in neural circuitry of food motivation in Prader-Willi syndrome.

    PubMed

    Holsen, L M; Zarcone, J R; Chambers, R; Butler, M G; Bittel, D C; Brooks, W M; Thompson, T I; Savage, C R

    2009-02-01

    Differences in behavioral phenotypes between the two most common subtypes of Prader-Willi syndrome (PWS) (chromosome 15q deletions and maternal uniparental disomy 15 (UPD) indicate that distinct neural networks may be affected. Though both subtypes display hyperphagia, the deletion subgroup shows reduced behavioral inhibition around food, whereas those with UPD are generally more able to maintain cognitive control over food intake impulses. To examine the neural basis of phenotypic differences to better understand relationships between genetic subtypes and behavioral outcomes. We predicted greater food motivation circuitry activity in the deletion subtype and greater activity in higher order cognitive regions in the UPD group, especially after eating. Nine individuals with PWS due to UPD and nine individuals with PWS due to (type 2) deletion, matched for age, gender and body mass index, underwent functional magnetic resonance imaging (fMRI) while viewing food images during two food motivation states: one before (pre-meal) and one after (post-meal) eating a standardized 500 kcal meal. Both PWS subgroups showed greater activity in response to food pre- and post-meal compared with the healthy-weight group. Compared with UPD, the deletion subtype showed increased food motivation network activation both pre- and post-meal, especially in the medial prefrontal cortex (mPFC) and amygdala. In contrast, the UPD group showed greater activation than the deletion subtype post-meal in the dorsolateral prefrontal cortex (DLPFC) and parahippocampal gyrus (PHG). These preliminary findings are the first functional neuroimaging findings to support divergent neural mechanisms associated with behavioral phenotypes in genetic subtypes of PWS. Results are discussed within the framework of genetic mechanisms such as haploinsufficiency and gene dosage effects and their differential influence on deletion and UPD subtypes, respectively.

  6. β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

    PubMed

    Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

    2014-01-01

    Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p < 0.0001 and 0.0082, respectively) among mutations associated with β-thal. The IVS-I-5, 619 bp deletion, codons 41/42 (-CTTT), codons 8/9 (+G) and IVS-I-1 (G > T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

  7. Characterization of a Spontaneous Nonmagnetic Mutant of Magnetospirillum gryphiswaldense Reveals a Large Deletion Comprising a Putative Magnetosome Island

    PubMed Central

    Schübbe, Sabrina; Kube, Michael; Scheffel, André; Wawer, Cathrin; Heyen, Udo; Meyerdierks, Anke; Madkour, Mohamed H.; Mayer, Frank; Reinhardt, Richard; Schüler, Dirk

    2003-01-01

    Frequent spontaneous loss of the magnetic phenotype was observed in stationary-phase cultures of the magnetotactic bacterium Magnetospirillum gryphiswaldense MSR-1. A nonmagnetic mutant, designated strain MSR-1B, was isolated and characterized. The mutant lacked any structures resembling magnetosome crystals as well as internal membrane vesicles. The growth of strain MSR-1B was impaired under all growth conditions tested, and the uptake and accumulation of iron were drastically reduced under iron-replete conditions. A large chromosomal deletion of approximately 80 kb was identified in strain MSR-1B, which comprised both the entire mamAB and mamDC clusters as well as further putative operons encoding a number of magnetosome-associated proteins. A bacterial artificial chromosome clone partially covering the deleted region was isolated from the genomic library of wild-type M. gryphiswaldense. Sequence analysis of this fragment revealed that all previously identified mam genes were closely linked with genes encoding other magnetosome-associated proteins within less than 35 kb. In addition, this region was remarkably rich in insertion elements and harbored a considerable number of unknown gene families which appeared to be specific for magnetotactic bacteria. Overall, these findings suggest the existence of a putative large magnetosome island in M. gryphiswaldense and other magnetotactic bacteria. PMID:13129949

  8. A rare example of germ-line chromothripsis resulting in large genomic imbalance.

    PubMed

    Anderson, Sarah E; Kamath, Arveen; Pilz, Daniela T; Morgan, Sian M

    2016-04-01

    Chromothripsis is a recently described 'chromosome catastrophe' phenomenon in which multiple genomic rearrangements are generated in a single catastrophic event. Chromothripsis has most frequently been associated with cancer, but there have also been rare reports of chromothripsis in patients with developmental disorders and congenital anomalies. In contrast to the massive DNA loss that often accompanies chromothripsis in cancer, only minimal DNA loss has been reported in the majority of cases of chromothripsis that have occurred in the germ line. Presumably, this is because in most instances, large genomic losses would be lethal in utero. We report on a female patient with developmental delay and dysmorphism. G-banded chromosome analysis detected a subtle, interstitial deletion of chromosome 13 and a complex rearrangement of one X chromosome. Subsequent array comparative genomic hybridisation studies indicated nine deletions on the X chromosome ranging from 327 kb to 8 Mb in size. A 4.4 Mb deletion on chromosome 13 was also confirmed, compatible with the patient's clinical phenotype. We propose that this is a rare example of constitutional chromothripsis in association with relatively large genomic imbalances and that these have been tolerated in this case as they have occurred in a female on the X chromosome, which has undergone preferential X inactivation.

  9. Large FVIII gene deletion confers very high risk of inhibitor development in three related severe haemophiliacs.

    PubMed

    Salviato, R; Belvini, D; Are, A; Radossi, P; Tagariello, G

    2002-01-01

    Haemophilia A displays a broad heterogeneity of genetic defects and of clinical severity. Inhibitor development is the main complication of replacement therapy in severe cases and most patients with inhibitors have gross gene rearrangement or point mutations, which hamper the production of normal circulating factor VIII (FVIII). We have investigated three related severe haemophilia A patients, all of whom have high titre inhibitors. By using long-range polymerase chain reaction (PCR) for FVIII gene inversion, we observed an unusual pattern in these patients. We therefore decided to screen the whole FVIII gene by conformation-sensitive gel electrophoresis. A large FVIII gene deletion spanning exon 2 to exon 25 was identified and we were able to obtain a 18.5 kb PCR product, which is specific for this mutation and useful for determining the carrier state in this family. All three haemophiliacs carrying this very large gene deletion show similar clinical history and very high-titre inhibitors, supporting the observation that inhibitor development seems to be an inherited characteristic. On the basis of our observations we think that this subgroup of patients at very high risk of inhibitor development should be identified by mutation analysis whenever possible, before the beginning of replacement therapy.

  10. Familial hypercholesterolemia with extensive coronary artery disease and tuberous and tendinous xanthomas: A case report and mutation analysis.

    PubMed

    Agirbasli, Deniz; Hyatt, Tommy; Agirbasli, Mehmet

    2018-04-26

    This is a case report of a 38-year-old Syrian refugee male with early-onset extensive atherosclerosis. The physical and laboratory examination were remarkable with severe xanthomas in the upper and lower extremities and with low-density lipoprotein cholesterol (LDL-C) 417 mg/dL, total cholesterol 495 mg/dL, high-density lipoprotein cholesterol 30 mg/dL, and triglycerides 242 mg/dL. LDL-C level responded poorly to the high-dose statin treatment. The genetic analysis indicated that the patient had a large homozygous deletion in LDL receptor gene including the exons 7-14. A 12-kb deletion had occurred between the 2 Alu repetitive sequences that were oriented in opposite directions, one in intron 6 and the other in intron 14. This deletion eliminated exons 7-14, which exactly corresponded to the entire exon sequence coding the epidermal growth factor precursor homology domain. This deletion in LDL receptor was previously reported. This rare case of homozygous familial hypercholesterolemia presenting with multiple large and widely distributed xanthomas implicates the need for novel treatment options in familial hypercholesterolemia patients. The case is a Syrian refugee and emphasizes the urgent need to address orphan disease in refugee populations throughout the world. Copyright © 2018 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  11. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  12. Construction and applications of yellow fever virus replicons.

    PubMed

    Jones, Christopher T; Patkar, Chinmay G; Kuhn, Richard J

    2005-01-20

    Subgenomic replicons of yellow fever virus (YFV) were constructed to allow expression of heterologous reporter genes in a replication-dependent manner. Expression of the antibiotic resistance gene neomycin phosphotransferase II (Neo) from one of these YFV replicons allowed selection of a stable population of cells (BHK-REP cells) in which the YFV replicon persistently replicated. BHK-REP cells were successfully used to trans-complement replication-defective YFV replicons harboring large internal deletions within either the NS1 or NS3 proteins. Although replicons with large deletions in either NS1 or NS3 were trans-complemented in BHK-REP, replicons that contained deletions of NS3 were trans-complemented at lower levels. In addition, replicons that retained the N-terminal protease domain of NS3 in cis were trans-complemented with higher efficiency than replicons in which both the protease and helicase domains of NS3 were deleted. To study packaging of YFV replicons, Sindbis replicons were constructed that expressed the YFV structural proteins in trans. Using these Sindbis replicons, both replication-competent and trans-complemented, replication-defective YFV replicons could be packaged into pseudo-infectious particles (PIPs). Although these results eliminate a potential role of either NS1 or full-length NS3 in cis for packaging and assembly of the flavivirus virion, they do not preclude the possibility that these proteins may act in trans during these processes.

  13. Chromosomal instability in enterohaemorrhagic Escherichia coli O157:H7: impact on adherence, tellurite resistance and colony phenotype

    PubMed Central

    Bielaszewska, Martina; Middendorf, Barbara; Tarr, Phillip I; Zhang, Wenlan; Prager, Rita; Aldick, Thomas; Dobrindt, Ulrich; Karch, Helge; Mellmann, Alexander

    2011-01-01

    Tellurite (Tel) resistant enterohaemorrhagic Escherichia coli (EHEC) O157:H7 is a global pathogen. In strain EDL933 Tel resistance (TelR) is encoded by duplicate ter cluster in O islands (OI) 43 and 48, which also harbour iha, encoding the adhesin and siderophore receptor Iha. We identified five EHEC O157:H7 strains that differentiate into large (L) colonies and small (S) colonies with high and low Tel minimal inhibitory concentrations (MICs) respectively. S colonies (Tel-MICs ≤ 4 µg ml−1) sustained large internal deletions within the TelR OIs via homologous recombination between IS elements and lost ter and iha. Moreover, complete excision of the islands occurred by site-specific recombination between flanking direct repeats. Complete excision of OI 43 and OI 48 occurred in 1.81 × 10−3 and 1.97 × 10−4 cells in culture, respectively; internal deletion of OI 48 was more frequent (9.7 × 10−1 cells). Under iron limitation that promotes iha transcription, iha-negative derivatives adhered less well to human intestinal epithelial cells and grew slower than did their iha-positive counterparts. Experiments utilizing iha deletion and complementation mutants identified Iha as the major factor responsible for these phenotypic differences. Spontaneous deletions affecting TelR OIs contribute to EHEC O157 genome plasticity and might impair virulence and/or fitness. PMID:21299654

  14. Genetic Background of the Sickle Cell Disease Pediatric Population of Dakar, Senegal, and Characterization of a Novel Frameshift β-Thalassemia Mutation [HBB: c.265_266del; p.Leu89Glufs*2].

    PubMed

    Gueye Tall, Fatou; Martin, Cyril; Malick Ndour, El Hadji; Déme Ly, Indou; Renoux, Céline; Chillotti, Louis; Veyrenche, Nicolas; Connes, Philippe; Madieye Gueye, Papa; Ndiaye Diallo, Rokhaya; Lacan, Philippe; Diagne, Ibrahima; Amadou Diop, Pape; Cissé, Aynina; Lopez Sall, Philomène; Joly, Philippe

    2017-03-01

    Sickle cell disease is a genetic disorder with a large variability in the pattern and severity of clinical manifestations. Different genetic modulators have been identified but very few epidemiologic data are available on these modifier genes in Senegal. This study aimed to determine their prevalence in a Senegalese sickle cell disease pediatric population. The following genetic parameters were genotyped in 295 sickle cell disease children of the Dakar pediatric hospital: sickle cell disease genotype [β S /β S (HBB: c.20A>T), β S /β C (HBB: c.19G>A), β S /β 0 -thalassemia (β 0 -thal)], XmnI polymorphism, the five most common α-thalassemia (α-thal) deletions and the A(-) and Betica glucose-6-phosphate-dehydrogenase (G6PD) deficient variants. Despite very few β S /β C and β S /β 0 -thal children (1.0% each), a novel frameshift β 0 -thal mutation was characterized: HBB: c.265_266del; p.Leu89Glufs*2. The -α 3.7 (rightward) deletion was the only α-thal deletion identified in this cohort (12.0% allelic frequency). Most of β S /β S patients (61.9%) were homozygous for the XmnI polymorphism and assumed to carry a Senegal/Senegal β S haplotype. The remaining haplotypes were predominantly of the Benin type. While the Betica G6PD variant was quite frequent (13.0%), a low frequency of the A(-) variant was detected (1.0-2.0%). The systematic genotyping of the -α 3.7 deletion and of the G6PD Betica variant in sickle cell disease patients from Senegal could be useful to identify patients at risk for several complications, such as cerebral vasculopathy, where it has been demonstrated that a normal α-globin genotype and G6PD deficiency are predisposing factors. These patients should be eligible for a transcranial Doppler examination that is not routinely offered in Senegal.

  15. A deletion and a duplication in distal 22q11.2 deletion syndrome region. Clinical implications and review

    PubMed Central

    Fernández, Luis; Nevado, Julián; Santos, Fernando; Heine-Suñer, Damià; Martinez-Glez, Victor; García-Miñaur, Sixto; Palomo, Rebeca; Delicado, Alicia; Pajares, Isidora López; Palomares, María; García-Guereta, Luis; Valverde, Eva; Hawkins, Federico; Lapunzina, Pablo

    2009-01-01

    Background Individuals affected with DiGeorge and Velocardiofacial syndromes present with both phenotypic diversity and variable expressivity. The most frequent clinical features include conotruncal congenital heart defects, velopharyngeal insufficiency, hypocalcemia and a characteristic craniofacial dysmorphism. The etiology in most patients is a 3 Mb recurrent deletion in region 22q11.2. However, cases of infrequent deletions and duplications with different sizes and locations have also been reported, generally with a milder, slightly different phenotype for duplications but with no clear genotype-phenotype correlation to date. Methods We present a 7 month-old male patient with surgically corrected ASD and multiple VSDs, and dysmorphic facial features not clearly suggestive of 22q11.2 deletion syndrome, and a newborn male infant with cleft lip and palate and upslanting palpebral fissures. Karyotype, FISH, MLPA, microsatellite markers segregation studies and SNP genotyping by array-CGH were performed in both patients and parents. Results Karyotype and FISH with probe N25 were normal for both patients. MLPA analysis detected a partial de novo 1.1 Mb deletion in one patient and a novel partial familial 0.4 Mb duplication in the other. Both of these alterations were located at a distal position within the commonly deleted region in 22q11.2. These rearrangements were confirmed and accurately characterized by microsatellite marker segregation studies and SNP array genotyping. Conclusion The phenotypic diversity found for deletions and duplications supports a lack of genotype-phenotype correlation in the vicinity of the LCRC-LCRD interval of the 22q11.2 chromosomal region, whereas the high presence of duplications in normal individuals supports their role as polymorphisms. We suggest that any hypothetical correlation between the clinical phenotype and the size and location of these alterations may be masked by other genetic and/or epigenetic modifying factors. PMID:19490635

  16. HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

    PubMed

    George, E; Teh, Lai Kuan; Tan, Jama; Lai, Mei I; Wong, Lily

    2013-01-01

    Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser. The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations. The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia. The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

  17. Heterozygous Deletion of FOXA2 Segregates with Disease in a Family with Heterotaxy, Panhypopituitarism, and Biliary Atresia

    PubMed Central

    Tsai, Ellen A.; Grochowski, Christopher M.; Falsey, Alexandra M.; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D.; Loomes, Kathleen M.; Spinner, Nancy B.

    2015-01-01

    Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277kb heterozygous deletion on chromosome 20 which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. PMID:25765999

  18. Functional correction of dystrophin actin binding domain mutations by genome editing

    PubMed Central

    Kyrychenko, Viktoriia; Kyrychenko, Sergii; Tiburcy, Malte; Shelton, John M.; Long, Chengzu; Schneider, Jay W.; Zimmermann, Wolfram-Hubertus; Bassel-Duby, Rhonda

    2017-01-01

    Dystrophin maintains the integrity of striated muscles by linking the actin cytoskeleton with the cell membrane. Duchenne muscular dystrophy (DMD) is caused by mutations in the dystrophin gene (DMD) that result in progressive, debilitating muscle weakness, cardiomyopathy, and a shortened lifespan. Mutations of dystrophin that disrupt the amino-terminal actin-binding domain 1 (ABD-1), encoded by exons 2–8, represent the second-most common cause of DMD. In the present study, we compared three different strategies for CRISPR/Cas9 genome editing to correct mutations in the ABD-1 region of the DMD gene by deleting exons 3–9, 6–9, or 7–11 in human induced pluripotent stem cells (iPSCs) and by assessing the function of iPSC-derived cardiomyocytes. All three exon deletion strategies enabled the expression of truncated dystrophin protein and restoration of cardiomyocyte contractility and calcium transients to varying degrees. We show that deletion of exons 3–9 by genomic editing provides an especially effective means of correcting disease-causing ABD-1 mutations. These findings represent an important step toward eventual correction of common DMD mutations and provide a means of rapidly assessing the expression and function of internally truncated forms of dystrophin-lacking portions of ABD-1. PMID:28931764

  19. The Common Inversion of the Williams–Beuren Syndrome Region at 7q11.23 Does Not Cause Clinical Symptoms

    PubMed Central

    Tam, Elaine; Young, Edwin J.; Morris, Colleen A.; Marshall, Christian R.; Loo, Wayne; Scherer, Stephen W.; Mervis, Carolyn B.; Osborne, Lucy R.

    2010-01-01

    Williams–Beuren syndrome (WBS) is caused by a ~1.5 million base pair deletion at 7q11.23. A common inversion of the region, WBSinv-1, exists as a polymorphism but was also found in individuals with WBS-like features but no deletion, suggesting it could cause clinical symptoms. We performed a full clinical, developmental and genetic assessment of two previously reported individuals with clinical symptoms and WBSinv-1 but no 7q11.23 deletion. We also examined expression of genes at 7q11.23 in individuals in the general population who have WBSinv-1. We show that individuals with clinical symptoms and WBSinv-1 do not show significant clinical or psychological overlap with individuals with WBS. In addition, a 1.3 Mb duplication of part of the velocardiofacial syndrome region on chromosome 22q11.2 was found in one participant with WBSinv-1 and clinical symptoms. We also demonstrate that individuals with WBSinv-1 show normal expression of genes from the WBS region. These results suggest that WBSinv-1 does not cause clinical symptoms and we advise caution when diagnosing individuals with atypical presentation of rare syndromes. Whole genome analysis may reveal previously unidentified copy number variants that could contribute to syndromic features. PMID:18553513

  20. Defective interfering particles of poliovirus: mapping of the deletion and evidence that the deletions in the genomes of DI(1), (2), and (3) are located in the same region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nomoto, A.; Jacobson, A.; Lee, Y.F.

    1979-01-01

    The deletions in RNAs of three defective interfering (DI) particles of poliovirus type 1 have been located and their approximate extent determined by three methods. (1) Digestion with RNase III of DI RNAs yields the same 3'-terminal fragments as digestion wth RNase III of standard virus RNA. The longest 3'-terminal located in the 5'-terminal half of the polio genome. (2) Fingerprints of RNase T/sub 1/-resistant oligonucleotides of all three DI RNAs are identical and lack four large oligonucleotides as compared to the fingerprints of standard virus, an observation suggesting that the deletions in all three DI RNAs are located inmore » the same reregion of the viral genome. The deletion-specific oligonucleotides have also been shown to be within the 5'-terminal half of the viral genome by alkali fragmentation of the RNA and fingerprinting poly(A)-linked (3'-terminal) fragments of decreasing size. (3) Virion RNA of DI(2) particles was annealed with denatured double-stranded RNA (RF) of standard virus and the hybrid heteroduplex molcules examined in the electron microscope. A single loop, approximately 900 nucleotides long and 20% from one end of the molecules, was observed. Both the size and extent of individual deletions is somewhat variable in different hetereoduplex molecules, an observation suggesting heterogeneity in the size of the deletion in RNA of the DI(2) population. Our data show that the DI RNAs of poliovirus contain an internal deletion in that region of the viral genome known to specify the capsid polypeptides. This result provides an explanation as to why poliovirus DI particles are unable to synthesize viral coat proteins.« less

  1. Homozygous deletion of six genes including corneodesmosin on chromosome 6p21.3 is associated with generalized peeling skin disease.

    PubMed

    Teye, Kwesi; Hamada, Takahiro; Krol, Rafal P; Numata, Sanae; Ishii, Norito; Matsuda, Mitsuhiro; Ohata, Chika; Furumura, Minao; Hashimoto, Takashi

    2014-07-01

    Peeling skin syndrome (PSS) is a rare autosomal recessive form of ichthyosis showing skin exfoliation. PSS is divided into acral and generalized PSS, and the latter is further classified into non-inflammatory type (PSS type A) and inflammatory type (PSS type B). PSS type B is now called peeling skin disease (PSD). Different loss-of-function mutations in the corneodesmosin (CDSN) gene have been reported to cause PSD. The aim of this study was to determine genetic basis of disease in a 14-year-old Japanese patient with PSD. Immunohistochemical study showed lack of corneodesmosin (CDSN) in the skin, and standard PCR for genomic DNA failed to amplify CDSN product, suggesting CDSN defect. Multiplex ligation-dependent probe amplification and genomic quantitative real-time PCR analyses detected large homozygous deletion of 59,184bp extending from 40.6kb upstream to 13.2kb downstream of CDSN, which included 6 genes (TCF19, CCHCR1, PSORS1C2, PSORS1C1, CDSN and C6orf15). The continuous gene lost did not result in additional clinical features. Inverted repeats with 85% similarity flanking the deletion breakpoint were considered to mediate the deletion by non-homologous end joining or fork stalling and template switching/microhomology-mediated break-induced replication. Parents were clinically unaffected and were heterozygote carriers of the same deletion, which was absent in 284 ethnically matched control alleles. We also developed simple PCR method, which is useful for detection of this deletion. Although 5 other genes were also deleted, homozygous deletion of CDSN was considered to be responsible for this PSD. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Deletion at the SLC1A1 glutamate transporter gene co-segregates with schizophrenia and bipolar schizoaffective disorder in a 5-generation family.

    PubMed

    Myles-Worsley, Marina; Tiobech, Josepha; Browning, Sharon R; Korn, Jeremy; Goodman, Sarah; Gentile, Karen; Melhem, Nadine; Byerley, William; Faraone, Stephen V; Middleton, Frank A

    2013-03-01

    Growing evidence for genetic overlap between schizophrenia (SCZ) and bipolar disorder (BPD) suggests that causal variants of large effect on disease risk may cross traditional diagnostic boundaries. Extended multigenerational families with both SCZ and BPD cases can be a valuable resource for discovery of shared biological pathways because they can reveal the natural evolution of the underlying genetic disruptions and their phenotypic expression. We investigated a deletion at the SLC1A1 glutamate transporter gene originally identified as a copy number variant exclusively carried by members of a 5-generation Palauan family. Using an expanded sample of 21 family members, quantitative PCR confirmed the deletion in all seven individuals with psychosis, three "obligate-carrier" parents and one unaffected sibling, while four marry-in parents were non-carriers. Linkage analysis under an autosomal dominant model generated a LOD-score of 3.64, confirming co-segregation of the deletion with psychosis. For more precise localization, we determined the approximate deletion end points using alignment of next-generation sequencing data for one affected deletion-carrier and then designed PCR amplicons to span the entire deletion locus. These probes established that the deletion spans 84,298 bp, thus eliminating the entire promoter, the transcription start site, and the first 59 amino acids of the protein, including the first transmembrane Na(2+)/dicarboxylate symporter domain, one of the domains that perform the glutamate transport action. Discovery of this functionally relevant SLC1A1 mutation and its co-segregation with psychosis in an extended multigenerational pedigree provides further support for the important role played by glutamatergic transmission in the pathophysiology of psychotic disorders. Copyright © 2013 Wiley Periodicals, Inc.

  3. “Black holes” and bacterial pathogenicity: A large genomic deletion that enhances the virulence of Shigella spp. and enteroinvasive Escherichia coli

    PubMed Central

    Maurelli, Anthony T.; Fernández, Reinaldo E.; Bloch, Craig A.; Rode, Christopher K.; Fasano, Alessio

    1998-01-01

    Plasmids, bacteriophages, and pathogenicity islands are genomic additions that contribute to the evolution of bacterial pathogens. For example, Shigella spp., the causative agents of bacillary dysentery, differ from the closely related commensal Escherichia coli in the presence of a plasmid in Shigella that encodes virulence functions. However, pathogenic bacteria also may lack properties that are characteristic of nonpathogens. Lysine decarboxylase (LDC) activity is present in ≈90% of E. coli strains but is uniformly absent in Shigella strains. When the gene for LDC, cadA, was introduced into Shigella flexneri 2a, virulence became attenuated, and enterotoxin activity was inhibited greatly. The enterotoxin inhibitor was identified as cadaverine, a product of the reaction catalyzed by LDC. Comparison of the S. flexneri 2a and laboratory E. coli K-12 genomes in the region of cadA revealed a large deletion in Shigella. Representative strains of Shigella spp. and enteroinvasive E. coli displayed similar deletions of cadA. Our results suggest that, as Shigella spp. evolved from E. coli to become pathogens, they not only acquired virulence genes on a plasmid but also shed genes via deletions. The formation of these “black holes,” deletions of genes that are detrimental to a pathogenic lifestyle, provides an evolutionary pathway that enables a pathogen to enhance virulence. Furthermore, the demonstration that cadaverine can inhibit enterotoxin activity may lead to more general models about toxin activity or entry into cells and suggests an avenue for antitoxin therapy. Thus, understanding the role of black holes in pathogen evolution may yield clues to new treatments of infectious diseases. PMID:9520472

  4. A large deletion of the AVPR2 gene causing severe nephrogenic diabetes insipidus in a Turkish family.

    PubMed

    Saglar, Emel; Deniz, Ferhat; Erdem, Beril; Karaduman, Tugce; Yönem, Arif; Cagiltay, Eylem; Mergen, Hatice

    2014-05-01

    X-linked nephrogenic diabetes insipidus (NDI) is a rare hereditary disease caused by mutations in arginine vasopressin type 2 receptor (AVPR2) and characterized by the production of large amounts of urine and an inability to concentrate urine in response to the antidiuretic hormone vasopressin. We have identified a novel 388 bp deletion starting in intron 1 and ending in exon 2 in the AVPR2 gene in a patient with NDI and in his family. We have revealed that this mutation is a de novo mutation for the mother of the proband patient. Prospective clinical data were collected for all family members. The water deprivation test confirmed the diagnosis of diabetes insipidus. The patient has severe symptoms like deep polyuria nocturia, polydipsia, and fatigue. He was given arginine vasopressin treatment while he was a child. However, he could not get well due to his nephrogenic type of illness. Both of his nephews have the same complains in addition to failure to grow. We have sequenced all exons and intron-exon boundaries of the AVPR2 gene of all family members. The analyses of bioinformatics and comparative genomics of the deletion were done via considering the DNA level damage. AVPR2 gene mutation results in the absence of the three transmembrane domains, two extracellular domains, and one cytoplasmic domain. Three-dimensional protein structure prediction was shown. We concluded that X-linked NDI and severity of illness in this family is caused by a novel 388 bp deletion in the AVPR2 gene that is predicted to truncate the receptor protein, and also this deletion may lead to dysfunctioning in protein activity and inefficient or inadequate binding abilities.

  5. Copy number variation in CEP57L1 predisposes to congenital absence of bilateral ACL and PCL ligaments.

    PubMed

    Liu, Yichuan; Li, Yun; March, Michael E; Nguyen, Kenny; Kenny, Nguyen; Xu, Kexiang; Wang, Fengxiang; Guo, Yiran; Keating, Brendan; Glessner, Joseph; Li, Jiankang; Ganley, Theodore J; Zhang, Jianguo; Deardorff, Matthew A; Xu, Xun; Hakonarson, Hakon

    2015-11-11

    Absence of the anterior (ACL) or posterior cruciate ligament (PCL) are rare congenital malformations that result in knee joint instability, with a prevalence of 1.7 per 100,000 live births and can be associated with other lower-limb abnormalities such as ACL agnesia and absence of the menisci of the knee. While a few cases of absence of ACL/PCL are reported in the literature, a number of large familial case series of related conditions such as ACL agnesia suggest a potential underlying monogenic etiology. We performed whole exome sequencing of a family with two individuals affected by ACL/PCL. We identified copy number variation (CNV) deletion impacting the exon sequences of CEP57L1, present in the affected mother and her affected daughter based on the exome sequencing data. The deletion was validated using quantitative PCR (qPCR), and the gene was confirmed to be expressed in ACL ligament tissue. Interestingly, we detected reduced expression of CEP57L1 in Epstein-Barr virus (EBV) cells from the two patients in comparison with healthy controls. Evaluation of 3D protein structure showed that the helix-binding sites of the protein remain intact with the deletion, but other functional binding sites related to microtubule attachment are missing. The specificity of the CNV deletion was confirmed by showing that it was absent in ~700 exome sequencing samples as well as in the database of genomic variations (DGV), a database containing large numbers of annotated CNVs from previous scientific reports. We identified a novel CNV deletion that was inherited through an autosomal dominant transmission from an affected mother to her affected daughter, both of whom suffered from the absence of the anterior and posterior cruciate ligaments of the knees.

  6. ``Black Holes" and Bacterial Pathogenicity: A Large Genomic Deletion that Enhances the Virulence of Shigella spp. and Enteroinvasive Escherichia coli

    NASA Astrophysics Data System (ADS)

    Maurelli, Anthony T.; Fernandez, Reinaldo E.; Bloch, Craig A.; Rode, Christopher K.; Fasano, Alessio

    1998-03-01

    Plasmids, bacteriophages, and pathogenicity islands are genomic additions that contribute to the evolution of bacterial pathogens. For example, Shigella spp., the causative agents of bacillary dysentery, differ from the closely related commensal Escherichia coli in the presence of a plasmid in Shigella that encodes virulence functions. However, pathogenic bacteria also may lack properties that are characteristic of nonpathogens. Lysine decarboxylate (LDC) activity is present in ≈ 90% of E. coli strains but is uniformly absent in Shigella strains. When the gene for LDC, cadA, was introduced into Shigella flexneri 2a, virulence became attenuated, and enterotoxin activity was inhibited greatly. The enterotoxin inhibitor was identified as cadaverine, a product of the reaction catalyzed by LDC. Comparison of the S. flexneri 2a and laboratory E. coli K-12 genomes in the region of cadA revealed a large deletion in Shigella. Representative strains of Shigella spp. and enteroinvasive E. coli displayed similar deletions of cadA. Our results suggest that, as Shigella spp. evolved from E. coli to become pathogens, they not only acquired virulence genes on a plasmid but also shed genes via deletions. The formation of these ``black holes,'' deletions of genes that are detrimental to a pathogenic lifestyle, provides an evolutionary pathway that enables a pathogen to enhance virulence. Furthermore, the demonstration that cadaverine can inhibit enterotoxin activity may lead to more general models about toxin activity or entry into cells and suggests an avenue for antitoxin therapy. Thus, understanding the role of black holes in pathogen evolution may yield clues to new treatments of infectious diseases.

  7. Identification of the first multi-exonic WDR72 deletion in isolated amelogenesis imperfecta, and generation of a WDR72-specific copy number screening tool.

    PubMed

    Hentschel, Julia; Tatun, Dana; Parkhomchuk, Dmitri; Kurth, Ingo; Schimmel, Bettina; Heinrich-Weltzien, Roswitha; Bertzbach, Sabine; Peters, Hartmut; Beetz, Christian

    2016-09-15

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous disorder of tooth development which is due to aberrant deposition or composition of enamel. Both syndromic and isolated forms exist; they may be inherited in an X-linked, autosomal recessive, or autosomal dominant manner. WDR72 is one of ten currently known genes for recessive isolated AI; nine WDR72 mutations affecting single nucleotides have been described to date. Based on whole exome sequencing in a large consanguineous AI pedigree, we obtained evidence for presence of a multi-exonic WDR72 deletion. A home-made multiplex ligation-dependent probe amplification assay was used to confirm the aberration, to narrow its extent, and to identify heterozygous carriers. Our study extends the mutational spectrum for WDR72 to include large deletions, and supports a relevance of the previously proposed loss-of-function mechanism. It also introduces an easy-to-use and highly sensitive tool for detecting WDR72 copy number alterations. Copyright © 2016. Published by Elsevier B.V.

  8. Large deletion at the CDC73 gene locus and search for predictive markers of the presence of a CDC73 genetic lesion.

    PubMed

    Muscarella, Lucia Anna; Turchetti, Daniela; Fontana, Andrea; Baorda, Filomena; Palumbo, Orazio; la Torre, Annamaria; de Martino, Danilo; Franco, Renato; Losito, Nunzia Simona; Repaci, Andrea; Pagotto, Uberto; Cinque, Luigia; Copetti, Massimiliano; Chiofalo, Maria Grazia; Pezzullo, Luciano; Graziano, Paolo; Scillitani, Alfredo; Guarnieri, Vito

    2018-04-17

    The Hyperparathyroidism with Jaw-Tumours syndrome is caused by mutations of the CDC73 gene: it has been suggested that early onset of the disease and high Ca 2+ levels may predict the presence of a CDC73 mutation. We searched for large deletions at the CDC73 locus in patients with: HPT-JT (nr 2), atypical adenoma (nr 7) or sporadic parathyroid carcinoma (nr 11) with a specific MLPA and qRT-PCR assays applied on DNA extracted from whole blood. A Medline search in database for all the papers reporting a CDC73 gene mutation, clinical/histological diagnosis, age at onset, Ca 2+ , PTH levels for familial/sporadic cases was conducted with the aim to possibly identify biochemical/clinical markers predictive, in first diagnosis, of the presence of a CDC73 gene mutation. A novel genomic deletion of the first 10 exons of the CDC73 gene was found in a 3-generation HPT-JT family, confirmed by SNP array analysis. A classification tree built on the published data, showed the highest probability of having a CDC73 mutation in subjects with age at the onset < 41.5 years (44/47 subjects, 93.6%, had the mutation). Whereas the lowest probability was found in subjects with age at the onset ≥ 41.5 years and Ca 2+ levels <13.96 mg/dL (7/20 subjects, 35.0%, had the mutation, odds ratio = 27.1, p < 0.001). We report a novel large genomic CDC73 gene deletion identified in an Italian HPT-JT family. Age at onset < 41.5 ys and Ca 2+ > 13.96 mg/dL are predictive for the presence of a CDC73 genetic lesion.

  9. Association Between Early-Onset Parkinson Disease and 22q11.2 Deletion Syndrome

    PubMed Central

    Butcher, Nancy J.; Kiehl, Tim-Rasmus; Hazrati, Lili-Naz; Chow, Eva W. C.; Rogaeva, Ekaterina; Lang, Anthony E.; Bassett, Anne S.

    2015-01-01

    IMPORTANCE Clinical case reports of parkinsonism co-occurring with hemizygous 22q11.2 deletions and the associated multisystem syndrome, 22q11.2 deletion syndrome (22q11.2DS), suggest that 22q11.2 deletions may lead to increased risk of early-onset Parkinson disease (PD). The frequency of PD and its neuropathological presentation remain unknown in this common genetic condition. OBJECTIVE To evaluate a possible association between 22q11.2 deletions and PD. DESIGN, SETTING, AND PARTICIPANTS An observational study of the occurrence of PD in the world’s largest cohort of well-characterized adults with a molecularly confirmed diagnosis of 22q11.2DS (n = 159 [6 with postmortem tissue]; age range, 18.1–68.6 years) was conducted in Toronto, Ontario, Canada. Rare postmortem brain tissue from individuals with 22q11.2DS and a clinical history of PD was investigated for neurodegenerative changes and compared with that from individuals with no history of a movement disorder. MAIN OUTCOMES AND MEASURES A clinical diagnosis of PD made by a neurologist and neuropathological features of PD. RESULTS Adults with 22q11.2DS had a significantly elevated occurrence of PD compared with standard population estimates (standardized morbidity ratio = 69.7; 95% CI, 19.0–178.5). All cases showed early onset and typical PD symptom pattern, treatment response, and course. All were negative for family history of PD and known pathogenic PD-related mutations. The common use of antipsychotics in patients with 22q11.2DS to manage associated psychiatric symptoms delayed diagnosis of PD by up to 10 years. Postmortem brain tissue revealed classic loss of midbrain dopaminergic neurons in all 3 postmortem 22q11.2DS-PD cases. Typical α-synuclein–positive Lewy bodies were present in the expected distribution in 2 cases but absent in another. CONCLUSIONS AND RELEVANCE These findings suggest that 22q11.2 deletions represent a novel genetic risk factor for early-onset PD with variable neuropathological presentation reminiscent of LRRK2-associated PD neuropathology. Individuals with early-onset PD and classic features of 22q11.2DS should be considered for genetic testing, and those with a known 22q11.2 deletion should be monitored for the development of parkinsonian symptoms. Molecular studies of the implicated genes, including DGCR8, may help shed light on the underlying pathophysiology of PD in 22q11.2DS and idiopathic PD. PMID:24018986

  10. Genome-Wide Estimates of Transposable Element Insertion and Deletion Rates in Drosophila Melanogaster

    PubMed Central

    Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.

    2017-01-01

    Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986

  11. Temporal and Region-Specific Requirements of αCaMKII in Spatial and Contextual Learning

    PubMed Central

    Achterberg, Katharina G.; Buitendijk, Gabriëlle H.S.; Kool, Martijn J.; Goorden, Susanna M.I.; Post, Laura; Slump, Denise E.; Silva, Alcino J.; van Woerden, Geeske M.

    2014-01-01

    The α isoform of the calcium/calmodulin-dependent protein kinase II (αCaMKII) has been implicated extensively in molecular and cellular mechanisms underlying spatial and contextual learning in a wide variety of species. Germline deletion of Camk2a leads to severe deficits in spatial and contextual learning in mice. However, the temporal and region-specific requirements for αCaMKII have remained largely unexplored. Here, we generated conditional Camk2a mutants to examine the influence of spatially restricted and temporally controlled expression of αCaMKII. Forebrain-specific deletion of the Camk2a gene resulted in severe deficits in water maze and contextual fear learning, whereas mice with deletion restricted to the cerebellum learned normally. Furthermore, we found that temporally controlled deletion of the Camk2a gene in adult mice is as detrimental as germline deletion for learning and synaptic plasticity. Together, we confirm the requirement for αCaMKII in the forebrain, but not the cerebellum, in spatial and contextual learning. Moreover, we highlight the absolute requirement for intact αCaMKII expression at the time of learning. PMID:25143599

  12. Infantile ictal apneas in a child with williams-beuren syndrome.

    PubMed

    Myers, Kenneth A; McLeod, D Ross; Bello-Espinosa, Luis

    2013-02-01

    Williams-Beuren syndrome is a genetic disorder rarely associated with seizures. The few described cases of Williams-Beuren syndrome and epilepsy have primarily involved infantile spasms and deletions extending beyond the common deletion region for this disorder. We present the case of a 5-week-old child with ictal apneas and typical Williams-Beuren syndrome deletion. Diagnosis was challenging, because the child had cardiac, respiratory, and gastrointestinal abnormalities typically associated with Williams-Beuren syndrome, which are also associated with cyanotic episodes. The results of interictal electroencephalography were normal, illustrating that prolonged electroencephalography is often essential in evaluation of suspected ictal apneas. Seizure freedom was achieved with carbamazepine. Sudden death is seen in Williams-Beuren syndrome, and this case raises the question whether some of these cases may be related to ictal apneas and could potentially be preventable with appropriate pharmaceutical intervention. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  14. Novel germline SDHD deletion associated with an unusual sympathetic head and neck paraganglioma.

    PubMed

    Cadiñanos, Juan; Llorente, José L; de la Rosa, Jorge; Villameytide, José A; Illán, Rafael; Durán, Noelia S; Murias, Eduardo; Cabanillas, Rubén

    2011-08-01

    Paragangliomas (PGLs) are rare tumors arising either from sympathetic or parasympathetic-associated chromaffin tissue. PGLs can occur either sporadically or as part of a hereditary syndrome. Sympathetic head and neck PGLs are extremely rare tumors and only a few cases have been reported to date. We report the pedigree of a patient with a head and neck PGL arising from the right sympathetic trunk. SDHD mutation analysis was performed using standard sequencing, multiplex ligation-dependent probe amplification, chromosome 11-specific comparative genome hybridization, and long-range/short-range polymerase chain reaction (PCR) approaches. A previously unreported chromosome 11q deletion encompassing 5 annotated genes (SDHD, DLAT, PIH1D2, C11Orf57, and TIMM8B) was detected in the proband. PGL families considered "mutation-negative" may be attributable to large gene deletions not detectable by standard sequencing methods. Therefore, deletion analysis should be offered to families or individuals at risk for hereditary PGLs. Copyright © 2010 Wiley Periodicals, Inc.

  15. Differential requirements of androgen receptor in luminal progenitors during prostate regeneration and tumor initiation

    PubMed Central

    Chua, Chee Wai; Epsi, Nusrat J; Leung, Eva Y; Xuan, Shouhong; Lei, Ming; Li, Bo I; Bergren, Sarah K; Hibshoosh, Hanina; Mitrofanova, Antonina

    2018-01-01

    Master regulatory genes of tissue specification play key roles in stem/progenitor cells and are often important in cancer. In the prostate, androgen receptor (AR) is a master regulator essential for development and tumorigenesis, but its specific functions in prostate stem/progenitor cells have not been elucidated. We have investigated AR function in CARNs (CAstration-Resistant Nkx3.1-expressing cells), a luminal stem/progenitor cell that functions in prostate regeneration. Using genetically--engineered mouse models and novel prostate epithelial cell lines, we find that progenitor properties of CARNs are largely unaffected by AR deletion, apart from decreased proliferation in vivo. Furthermore, AR loss suppresses tumor formation after deletion of the Pten tumor suppressor in CARNs; however, combined Pten deletion and activation of oncogenic Kras in AR-deleted CARNs result in tumors with focal neuroendocrine differentiation. Our findings show that AR modulates specific progenitor properties of CARNs, including their ability to serve as a cell of origin for prostate cancer. PMID:29334357

  16. Partial deletion of the AGXT gene (EX1_EX7del): A new genotype in hyperoxaluria type 1.

    PubMed

    Nogueira, P K; Vuong, T S; Bouton, O; Maillard, A; Marchand, M; Rolland, M O; Cochat, P; Bozon, D

    2000-04-01

    Primary hyperoxaluria type 1 (PH1) is a rare autosomal (2q37.3) recessive metabolic disease caused by a deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate amino transferase. Molecular heterogeneity is important in PH1 as most of the patients (if the parents are unrelated) are compound heterozygotes for rare mutations. We describe the first large deletion in the AGXT gene, removing exons 1 to 7 (EX1_EX7del) that was responsible for one case of severe PH1. This 10 kb deletion was identified by Southern blotting of genomic DNA digested by Xba I and hybridized with different exonic probes. Both parents (from Turkey) are first cousin and carry the deletion. It is of note that the presently reported patient did not exhibit any AGT catalytic activity and even so, he progressed towards end-stage renal disease only at 19 years old. Copyright 2000 Wiley-Liss, Inc.

  17. Detection, breakpoint identification and detailed characterisation of a CNV at the FRA16D site using SNP assays.

    PubMed

    Winchester, L; Newbury, D F; Monaco, A P; Ragoussis, J

    2008-01-01

    Copy Number Variants (CNV) and other submicroscopic structural changes are now recognised to be widespread across the human genome. We show that SNP data generated for association study can be utilised for the identification of deletion CNVs. During analysis of data for an SNP association study for Specific Language Impairment (SLI) a deletion was identified. SLI adversely affects the language development of children in the absence of any obvious cause. Previous studies have found linkage to a region on chromosome 16. The deletion was located in a known fragile site FRA16D in intron 5-6 of the WWOX gene (also known as FOR). Changes in the FRA16D site have been previously linked to cancer and are often characterised in cell lines. A long-range PCR assay was used to confirm the existence of the deletion. We also show the breakpoint identification and large-scale characterisation of this CNV in a normal human sample set. Copyright 2009 S. Karger AG, Basel.

  18. Deletion and anergy of polyclonal B cells specific for ubiquitous membrane-bound self-antigen

    PubMed Central

    Taylor, Justin J.; Martinez, Ryan J.; Titcombe, Philip J.; Barsness, Laura O.; Thomas, Stephanie R.; Zhang, Na; Katzman, Shoshana D.; Jenkins, Marc K.

    2012-01-01

    B cell tolerance to self-antigen is critical to preventing antibody-mediated autoimmunity. Previous work using B cell antigen receptor transgenic animals suggested that self-antigen–specific B cells are either deleted from the repertoire, enter a state of diminished function termed anergy, or are ignorant to the presence of self-antigen. These mechanisms have not been assessed in a normal polyclonal repertoire because of an inability to detect rare antigen-specific B cells. Using a novel detection and enrichment strategy to assess polyclonal self-antigen–specific B cells, we find no evidence of deletion or anergy of cells specific for antigen not bound to membrane, and tolerance to these types of antigens appears to be largely maintained by the absence of T cell help. In contrast, a combination of deleting cells expressing receptors with high affinity for antigen with anergy of the undeleted lower affinity cells maintains tolerance to ubiquitous membrane-bound self-antigens. PMID:23071255

  19. A highly penetrant form of childhood apraxia of speech due to deletion of 16p11.2

    PubMed Central

    Fedorenko, Evelina; Morgan, Angela; Murray, Elizabeth; Cardinaux, Annie; Mei, Cristina; Tager-Flusberg, Helen; Fisher, Simon E; Kanwisher, Nancy

    2016-01-01

    Individuals with heterozygous 16p11.2 deletions reportedly suffer from a variety of difficulties with speech and language. Indeed, recent copy-number variant screens of children with childhood apraxia of speech (CAS), a specific and rare motor speech disorder, have identified three unrelated individuals with 16p11.2 deletions. However, the nature and prevalence of speech and language disorders in general, and CAS in particular, is unknown for individuals with 16p11.2 deletions. Here we took a genotype-first approach, conducting detailed and systematic characterization of speech abilities in a group of 11 unrelated children ascertained on the basis of 16p11.2 deletions. To obtain the most precise and replicable phenotyping, we included tasks that are highly diagnostic for CAS, and we tested children under the age of 18 years, an age group where CAS has been best characterized. Two individuals were largely nonverbal, preventing detailed speech analysis, whereas the remaining nine met the standard accepted diagnostic criteria for CAS. These results link 16p11.2 deletions to a highly penetrant form of CAS. Our findings underline the need for further precise characterization of speech and language profiles in larger groups of affected individuals, which will also enhance our understanding of how genetic pathways contribute to human communication disorders. PMID:26173965

  20. A resource for functional profiling of noncoding RNA in the yeast Saccharomyces cerevisiae.

    PubMed

    Parker, Steven; Fraczek, Marcin G; Wu, Jian; Shamsah, Sara; Manousaki, Alkisti; Dungrattanalert, Kobchai; de Almeida, Rogerio Alves; Estrada-Rivadeneyra, Diego; Omara, Walid; Delneri, Daniela; O'Keefe, Raymond T

    2017-08-01

    Eukaryotic genomes are extensively transcribed, generating many different RNAs with no known function. We have constructed 1502 molecular barcoded ncRNA gene deletion strains encompassing 443 ncRNAs in the yeast Saccharomyces cerevisiae as tools for ncRNA functional analysis. This resource includes deletions of small nuclear RNAs (snRNAs), transfer RNAs (tRNAs), small nucleolar RNAs (snoRNAs), and other annotated ncRNAs as well as the more recently identified stable unannotated transcripts (SUTs) and cryptic unstable transcripts (CUTs) whose functions are largely unknown. Specifically, deletions have been constructed for ncRNAs found in the intergenic regions, not overlapping genes or their promoters (i.e., at least 200 bp minimum distance from the closest gene start codon). The deletion strains carry molecular barcodes designed to be complementary with the protein gene deletion collection enabling parallel analysis experiments. These strains will be useful for the numerous genomic and molecular techniques that utilize deletion strains, including genome-wide phenotypic screens under different growth conditions, pooled chemogenomic screens with drugs or chemicals, synthetic genetic array analysis to uncover novel genetic interactions, and synthetic dosage lethality screens to analyze gene dosage. Overall, we created a valuable resource for the RNA community and for future ncRNA research. © 2017 Parker et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

    PubMed

    Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

    2017-12-01

    Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

  2. Phenotypic Association Analyses With Copy Number Variation in Recurrent Depressive Disorder.

    PubMed

    Rucker, James J H; Tansey, Katherine E; Rivera, Margarita; Pinto, Dalila; Cohen-Woods, Sarah; Uher, Rudolf; Aitchison, Katherine J; Craddock, Nick; Owen, Michael J; Jones, Lisa; Jones, Ian; Korszun, Ania; Barnes, Michael R; Preisig, Martin; Mors, Ole; Maier, Wolfgang; Rice, John; Rietschel, Marcella; Holsboer, Florian; Farmer, Anne E; Craig, Ian W; Scherer, Stephen W; McGuffin, Peter; Breen, Gerome

    2016-02-15

    Defining the molecular genomic basis of the likelihood of developing depressive disorder is a considerable challenge. We previously associated rare, exonic deletion copy number variants (CNV) with recurrent depressive disorder (RDD). Sex chromosome abnormalities also have been observed to co-occur with RDD. In this reanalysis of our RDD dataset (N = 3106 cases; 459 screened control samples and 2699 population control samples), we further investigated the role of larger CNVs and chromosomal abnormalities in RDD and performed association analyses with clinical data derived from this dataset. We found an enrichment of Turner's syndrome among cases of depression compared with the frequency observed in a large population sample (N = 34,910) of live-born infants collected in Denmark (two-sided p = .023, odds ratio = 7.76 [95% confidence interval = 1.79-33.6]), a case of diploid/triploid mosaicism, and several cases of uniparental isodisomy. In contrast to our previous analysis, large deletion CNVs were no more frequent in cases than control samples, although deletion CNVs in cases contained more genes than control samples (two-sided p = .0002). After statistical correction for multiple comparisons, our data do not support a substantial role for CNVs in RDD, although (as has been observed in similar samples) occasional cases may harbor large variants with etiological significance. Genetic pleiotropy and sample heterogeneity suggest that very large sample sizes are required to study conclusively the role of genetic variation in mood disorders. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  3. Positive predictive value estimates for cell-free noninvasive prenatal screening from data of a large referral genetic diagnostic laboratory.

    PubMed

    Petersen, Andrea K; Cheung, Sau Wai; Smith, Janice L; Bi, Weimin; Ward, Patricia A; Peacock, Sandra; Braxton, Alicia; Van Den Veyver, Ignatia B; Breman, Amy M

    2017-12-01

    Since its debut in 2011, cell-free fetal DNA screening has undergone rapid expansion with respect to both utilization and coverage. However, conclusive data regarding the clinical validity and utility of this screening tool, both for the originally included common autosomal and sex-chromosomal aneuploidies as well as the more recently added chromosomal microdeletion syndromes, have lagged behind. Thus, there is a continued need to educate clinicians and patients about the current benefits and limitations of this screening tool to inform pre- and posttest counseling, pre/perinatal decision making, and medical risk assessment/management. The objective of this study was to determine the positive predictive value and false-positive rates for different chromosomal abnormalities identified by cell-free fetal DNA screening using a large data set of diagnostic testing results on invasive samples submitted to the laboratory for confirmatory studies. We tested 712 patient samples sent to our laboratory to confirm a cell-free fetal DNA screening result, indicating high risk for a chromosome abnormality. We compiled data from all cases in which the indication for confirmatory testing was a positive cell-free fetal DNA screen, including the common trisomies, sex chromosomal aneuploidies, microdeletion syndromes, and other large genome-wide copy number abnormalities. Testing modalities included fluorescence in situ hybridization, G-banded karyotype, and/or chromosomal microarray analysis performed on chorionic villus samples, amniotic fluid, or postnatally obtained blood samples. Positive predictive values and false-positive rates were calculated from tabulated data. The positive predictive values for trisomy 13, 18, and 21 were consistent with previous reports at 45%, 76%, and 84%, respectively. For the microdeletion syndrome regions, positive predictive values ranged from 0% for detection of Cri-du-Chat syndrome and Prader-Willi/Angelman syndrome to 14% for 1p36 deletion syndrome and 21% for 22q11.2 deletion syndrome. Detection of sex chromosomal aneuploidies had positive predictive values of 26% for monosomy X, 50% for 47,XXX, and 86% for 47,XXY. The positive predictive values for detection of common autosomal and sex chromosomal aneuploidies by cell-free fetal DNA screening were comparable with other studies. Identification of microdeletions was associated with lower positive predictive values and higher false-positive rates, likely because of the low prevalence of the individual targeted microdeletion syndromes in the general population. Although the obtained positive predictive values compare favorably with those seen in traditional screening approaches for common aneuploidies, they highlight the importance of educating clinicians and patients on the limitations of cell-free fetal DNA screening tests. Improvement of the cell-free fetal DNA screening technology and continued monitoring of its performance after introduction into clinical practice will be important to fully establish its clinical utility. Nonetheless, our data provide valuable information that may aid result interpretation, patient counseling, and clinical decision making/management. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Infection and Transmission of Rift Valley Fever Viruses Lacking the NSs and/or NSm Genes in Mosquitoes: Potential Role for NSm in Mosquito Infection

    PubMed Central

    Crabtree, Mary B.; Kent Crockett, Rebekah J.; Bird, Brian H.; Nichol, Stuart T.; Erickson, Bobbie Rae; Biggerstaff, Brad J.; Horiuchi, Kalanthe; Miller, Barry R.

    2012-01-01

    Background Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Methodology and Principal Findings Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. Conclusions/Significance In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes. PMID:22563517

  5. Infection and transmission of Rift Valley fever viruses lacking the NSs and/or NSm genes in mosquitoes: potential role for NSm in mosquito infection.

    PubMed

    Crabtree, Mary B; Kent Crockett, Rebekah J; Bird, Brian H; Nichol, Stuart T; Erickson, Bobbie Rae; Biggerstaff, Brad J; Horiuchi, Kalanthe; Miller, Barry R

    2012-01-01

    Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes.

  6. Autistic Disorder in Patients with Williams-Beuren Syndrome: A Reconsideration of the Williams-Beuren Syndrome Phenotype

    PubMed Central

    Tordjman, Sylvie; Anderson, George M.; Botbol, Michel; Toutain, Annick; Sarda, Pierre; Carlier, Michèle; Saugier-Veber, Pascale; Baumann, Clarisse; Cohen, David; Lagneaux, Céline; Tabet, Anne-Claude; Verloes, Alain

    2012-01-01

    Background Williams-Beuren syndrome (WBS), a rare developmental disorder caused by deletion of contiguous genes at 7q11.23, has been characterized by strengths in socialization (overfriendliness) and communication (excessive talkativeness). WBS has been often considered as the polar opposite behavioral phenotype to autism. Our objective was to better understand the range of phenotypic expression in WBS and the relationship between WBS and autistic disorder. Methodology The study was conducted on 9 French individuals aged from 4 to 37 years old with autistic disorder associated with WBS. Behavioral assessments were performed using Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) scales. Molecular characterization of the WBS critical region was performed by FISH. Findings FISH analysis indicated that all 9 patients displayed the common WBS deletion. All 9 patients met ADI-R and ADOS diagnostic criteria for autism, displaying stereotypies and severe impairments in social interaction and communication (including the absence of expressive language). Additionally, patients showed improvement in social communication over time. Conclusions The results indicate that comorbid autism and WBS is more frequent than expected and suggest that the common WBS deletion can result in a continuum of social communication impairment, ranging from excessive talkativeness and overfriendliness to absence of verbal language and poor social relationships. Appreciation of the possible co-occurrence of WBS and autism challenges the common view that WBS represents the opposite behavioral phenotype of autism, and might lead to improved recognition of WBS in individuals diagnosed with autism. PMID:22412832

  7. Biasing genome-editing events toward precise length deletions with an RNA-guided TevCas9 dual nuclease.

    PubMed

    Wolfs, Jason M; Hamilton, Thomas A; Lant, Jeremy T; Laforet, Marcon; Zhang, Jenny; Salemi, Louisa M; Gloor, Gregory B; Schild-Poulter, Caroline; Edgell, David R

    2016-12-27

    The CRISPR/Cas9 nuclease is commonly used to make gene knockouts. The blunt DNA ends generated by cleavage can be efficiently ligated by the classical nonhomologous end-joining repair pathway (c-NHEJ), regenerating the target site. This repair creates a cycle of cleavage, ligation, and target site regeneration that persists until sufficient modification of the DNA break by alternative NHEJ prevents further Cas9 cutting, generating a heterogeneous population of insertions and deletions typical of gene knockouts. Here, we develop a strategy to escape this cycle and bias events toward defined length deletions by creating an RNA-guided dual active site nuclease that generates two noncompatible DNA breaks at a target site, effectively deleting the majority of the target site such that it cannot be regenerated. The TevCas9 nuclease, a fusion of the I-TevI nuclease domain to Cas9, functions robustly in HEK293 cells and generates 33- to 36-bp deletions at frequencies up to 40%. Deep sequencing revealed minimal processing of TevCas9 products, consistent with protection of the DNA ends from exonucleolytic degradation and repair by the c-NHEJ pathway. Directed evolution experiments identified I-TevI variants with broadened targeting range, making TevCas9 an easy-to-use reagent. Our results highlight how the sequence-tolerant cleavage properties of the I-TevI homing endonuclease can be harnessed to enhance Cas9 applications, circumventing the cleavage and ligation cycle and biasing genome-editing events toward defined length deletions.

  8. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    PubMed

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  9. Prader-Willi-like phenotype: investigation of 1p36 deletion in 41 patients with delayed psychomotor development, hypotonia, obesity and/or hyperphagia, learning disabilities and behavioral problems.

    PubMed

    D'Angelo, Carla S; Da Paz, José A; Kim, Chong A; Bertola, Débora R; Castro, Claudia I E; Varela, Monica C; Koiffmann, Célia P

    2006-01-01

    Monosomy 1p36 is one of the most commonly observed mental retardation (MR) syndromes that results in a clinically recognizable phenotype including delayed psychomotor development and/or MR, hypotonia, epilepsy, hearing loss, growth delay, microcephaly, deep-set eyes, flat nasal bridge and pointed chin. Besides, a Prader-Willi syndrome (PWS)-like phenotype has been described in patients with 1p36 monosomy. Forty-one patients presenting hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who tested negative for PWS were investigated by FISH and/or microsatellite markers. Twenty-six were analyzed with a 1p-specific subtelomeric probe, and one terminal deletion was identified. Thirty patients (15 of which also studied by FISH) were investigated by microsatellite markers, and no interstitial 1p36 deletion was found. Our patient presenting the 1p36 deletion did not have the striking features of this monosomy, but her clinical and behavioral features were quite similar to those observed in patients with PWS, except for the presence of normal sucking at birth. The extent of the deletion could be limited to the most terminal 2.5 Mb of 1p36, within the chromosomal region 1p36.33-1p36.32, that is smaller than usually seen in monosomy 1p36 patients. Therefore, chromosome 1p36.33 deletion should be investigated in patients with hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who test negative for PWS.

  10. Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

    PubMed

    Hassan, Maaz; Butler, Merlin G

    2016-11-01

    We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases

    PubMed Central

    Feschenko, Vladimir V.; Rajman, Luis A.; Lovett, Susan T.

    2003-01-01

    Rearrangements between tandemly repeated DNA sequences are a common source of genetic instability. Such rearrangements underlie several human genetic diseases. In many organisms, the mismatch-repair (MMR) system functions to stabilize repeats when the repeat unit is short or when sequence imperfections are present between the repeats. We show here that the action of single-stranded DNA (ssDNA) exonucleases plays an additional, important role in stabilizing tandem repeats, independent of their role in MMR. For perfect repeats of ≈100 bp in Escherichia coli that are not susceptible to MMR, exonuclease (Exo)-I, ExoX, and RecJ exonuclease redundantly inhibit deletion. Our data suggest that >90% of potential deletion events are avoided by the combined action of these three exonucleases. Imperfect tandem repeats, less prone to rearrangements, are stabilized by both the MMR-pathway and ssDNA-specific exonucleases. For 100-bp repeats containing four mispairs, ExoI alone aborts most deletion events, even in the presence of a functional MMR system. By genetic analysis, we show that the inhibitory effect of ssDNA exonucleases on deletion formation is independent of the MutS and UvrD proteins. Exonuclease degradation of DNA displaced during the deletion process may abort slipped misalignment. Exonuclease action is therefore a significant force in genetic stabilization of many forms of repetitive DNA. PMID:12538867

  12. Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

    PubMed

    Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B

    2006-09-01

    PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

  13. Genetic Diversity of the Q Fever Agent, Coxiella burnetii, Assessed by Microarray-Based Whole-Genome Comparisons†

    PubMed Central

    Beare, Paul A.; Samuel, James E.; Howe, Dale; Virtaneva, Kimmo; Porcella, Stephen F.; Heinzen, Robert A.

    2006-01-01

    Coxiella burnetii, a gram-negative obligate intracellular bacterium, causes human Q fever and is considered a potential agent of bioterrorism. Distinct genomic groups of C. burnetii are revealed by restriction fragment-length polymorphisms (RFLP). Here we comprehensively define the genetic diversity of C. burnetii by hybridizing the genomes of 20 RFLP-grouped and four ungrouped isolates from disparate sources to a high-density custom Affymetrix GeneChip containing all open reading frames (ORFs) of the Nine Mile phase I (NMI) reference isolate. We confirmed the relatedness of RFLP-grouped isolates and showed that two ungrouped isolates represent distinct genomic groups. Isolates contained up to 20 genomic polymorphisms consisting of 1 to 18 ORFs each. These were mostly complete ORF deletions, although partial deletions, point mutations, and insertions were also identified. A total of 139 chromosomal and plasmid ORFs were polymorphic among all C. burnetii isolates, representing ca. 7% of the NMI coding capacity. Approximately 67% of all deleted ORFs were hypothetical, while 9% were annotated in NMI as nonfunctional (e.g., frameshifted). The remaining deleted ORFs were associated with diverse cellular functions. The only deletions associated with isogenic NMI variants of attenuated virulence were previously described large deletions containing genes involved in lipopolysaccharide (LPS) biosynthesis, suggesting that these polymorphisms alone are responsible for the lower virulence of these variants. Interestingly, a variant of the Australia QD isolate producing truncated LPS had no detectable deletions, indicating LPS truncation can occur via small genetic changes. Our results provide new insight into the genetic diversity and virulence potential of Coxiella species. PMID:16547017

  14. Radiation leukemogenesis in mice: loss of PU.1 on chromosome 2 in CBA and C57BL/6 mice after irradiation with 1 GeV/nucleon 56Fe ions, X rays or gamma rays. Part I. Experimental observations.

    PubMed

    Peng, Yuanlin; Brown, Natalie; Finnon, Rosemary; Warner, Christy L; Liu, Xianan; Genik, Paula C; Callan, Matthew A; Ray, F Andrew; Borak, Thomas B; Badie, Christophe; Bouffler, Simon D; Ullrich, Robert L; Bedford, Joel S; Weil, Michael M

    2009-04-01

    Since deletion of the PU.1 gene on chromosome 2 is a crucial acute myeloid leukemia (AML) initiating step in the mouse model, we quantified PU.1 deleted cells in the bone marrow of gamma-, X- and 56Fe-ion-irradiated mice at various times postirradiation. Although 56Fe ions were initially some two to three times more effective than X or gamma rays in inducing PU.1 deletions, by 1 month postirradiation, the proportions of cells with PU.1 deletions were similar for the HZE particles and the sparsely ionizing radiations. These results indicate that while 56Fe ions are more effective in inducing PU.1 deletions, they are also more effective in causing collateral damage that removes hit cells from the bone marrow. After X, gamma or 56Fe-ion irradiation, AML-resistant C57BL/6 mice have fewer cells with PU.1 deletions than CBA mice, and those cells do not persist in the bone marrow of the C57B6/6 mice. Our findings suggest that quantification of PU.1 deleted bone marrow cells 1 month postirradiation can be used as surrogate for the incidence of radiation-induced AML measured in large-scale mouse studies. If so, PU.1 loss could be used to systematically assess the potential leukemogenic effects of other ions and energies in the space radiation environment.

  15. Copy number variation analysis implicates the cell polarity gene glypican 5 as a human spina bifida candidate gene

    PubMed Central

    Bassuk, Alexander G.; Muthuswamy, Lakshmi B.; Boland, Riley; Smith, Tiffany L.; Hulstrand, Alissa M.; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M.; Yung, Christina K.; Long, Abby; Brouillette, Rachel B.; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W.; Cornell, Robert A.; Manak, J. Robert

    2013-01-01

    Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Caucasian and 61 Hispanic patients with non-syndromic lumbar-sacral myelomeningocele. We also performed aCGH analysis on the parents of affected individuals with rare CNVs where parental DNA was available (42 sets). Among the eight de novo CNVs that we identified, three generated copy number changes of entire genes. One large heterozygous deletion removed 27 genes, including PAX3, a known spina bifida-associated gene. A second CNV altered genes (PGPD8, ZC3H6) for which little is known regarding function or expression. A third heterozygous deletion removed GPC5 and part of GPC6, genes encoding glypicans. Glypicans are proteoglycans that modulate the activity of morphogens such as Sonic Hedgehog (SHH) and bone morphogenetic proteins (BMPs), both of which have been implicated in NTDs. Additionally, glypicans function in the planar cell polarity (PCP) pathway, and several PCP genes have been associated with NTDs. Here, we show that GPC5 orthologs are expressed in the neural tube, and that inhibiting their expression in frog and fish embryos results in NTDs. These results implicate GPC5 as a gene required for normal neural tube development. PMID:23223018

  16. BRG1 and LKB1: tales of two tumor suppressor genes on chromosome 19p and lung cancer.

    PubMed

    Rodriguez-Nieto, Salvador; Sanchez-Cespedes, Montse

    2009-04-01

    Losses of heterozygosity (LOH) of the short arm of chromosome 19 are frequent in lung cancer, suggesting that one or more tumor suppressor genes are present in this region. The LKB1 gene, also called STK11, is somatically inactivated through point mutations and large deletions in lung tumors, demonstrating that LKB1 is a target of the LOH of this chromosomal arm. Data from several independent groups have provided information about the profiles of lung tumors with LKB1 inactivation and it is generally agreed that this alteration strongly predominates in non-small cell lung cancer, in particular adenocarcinomas, in smokers. The LKB1 protein has serine-threonine kinase activity and is involved in the regulation of the cell energetic checkpoint through the phosphorylation and activation of adenosine monophosphate-dependent kinase (AMPK). LKB1 is also involved in other processes such as cell polarization, probably through substrates other than AMPK. Interestingly, another gene on chromosome 19p, BRG1, encoding a component of the SWI/SNF chromatin-remodeling complex, has emerged as a tumor suppressor gene that is altered in lung tumors. Similar to LKB1, BRG1 is somatically inactivated by point mutations or large deletions in lung tumors featuring LOH of chromosome 19p. These observations suggest an important role for BRG1 in lung cancer and highlight the need to further our understanding of the function of Brahma/SWI2-related gene 1 (BRG1) in cancer. Finally, simultaneous mutations at LKB1 and BRG1 are common in lung cancer cells, which exemplifies how a single event, LOH of chromosome 19p in this instance, targets two different tumor suppressors.

  17. Domain architecture conservation in orthologs

    PubMed Central

    2011-01-01

    Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are functionally more similar than other types of homologs at the same evolutionary distance. PMID:21819573

  18. Massively parallel sequencing of 68 insertion/deletion markers identifies novel microhaplotypes for utility in human identity testing.

    PubMed

    Wendt, Frank R; Warshauer, David H; Zeng, Xiangpei; Churchill, Jennifer D; Novroski, Nicole M M; Song, Bing; King, Jonathan L; LaRue, Bobby L; Budowle, Bruce

    2016-11-01

    Short tandem repeat (STR) loci are the traditional markers used for kinship, missing persons, and direct comparison human identity testing. These markers hold considerable value due to their highly polymorphic nature, amplicon size, and ability to be multiplexed. However, many STRs are still too large for use in analysis of highly degraded DNA. Small bi-allelic polymorphisms, such as insertions/deletions (INDELs), may be better suited for analyzing compromised samples, and their allele size differences are amenable to analysis by capillary electrophoresis. The INDEL marker allelic states range in size from 2 to 6 base pairs, enabling small amplicon size. In addition, heterozygote balance may be increased by minimizing preferential amplification of the smaller allele, as is more common with STR markers. Multiplexing a large number of INDELs allows for generating panels with high discrimination power. The Nextera™ Rapid Capture Custom Enrichment Kit (Illumina, Inc., San Diego, CA) and massively parallel sequencing (MPS) on the Illumina MiSeq were used to sequence 68 well-characterized INDELs in four major US population groups. In addition, the STR Allele Identification Tool: Razor (STRait Razor) was used in a novel way to analyze INDEL sequences and detect adjacent single nucleotide polymorphisms (SNPs) and other polymorphisms. This application enabled the discovery of unique allelic variants, which increased the discrimination power and decreased the single-locus random match probabilities (RMPs) of 22 of these well-characterized INDELs which can be considered as microhaplotypes. These findings suggest that additional microhaplotypes containing human identification (HID) INDELs may exist elsewhere in the genome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Whole exome sequencing is an efficient, sensitive and specific method of mutation detection in osteogenesis imperfecta and Marfan syndrome

    PubMed Central

    McInerney-Leo, Aideen M; Marshall, Mhairi S; Gardiner, Brooke; Coucke, Paul J; Van Laer, Lut; Loeys, Bart L; Summers, Kim M; Symoens, Sofie; West, Jennifer A; West, Malcolm J; Paul Wordsworth, B; Zankl, Andreas; Leo, Paul J; Brown, Matthew A; Duncan, Emma L

    2013-01-01

    Osteogenesis imperfecta (OI) and Marfan syndrome (MFS) are common Mendelian disorders. Both conditions are usually diagnosed clinically, as genetic testing is expensive due to the size and number of potentially causative genes and mutations. However, genetic testing may benefit patients, at-risk family members and individuals with borderline phenotypes, as well as improving genetic counseling and allowing critical differential diagnoses. We assessed whether whole exome sequencing (WES) is a sensitive method for mutation detection in OI and MFS. WES was performed on genomic DNA from 13 participants with OI and 10 participants with MFS who had known mutations, with exome capture followed by massive parallel sequencing of multiplexed samples. Single nucleotide polymorphisms (SNPs) and small indels were called using Genome Analysis Toolkit (GATK) and annotated with ANNOVAR. CREST, exomeCopy and exomeDepth were used for large deletion detection. Results were compared with the previous data. Specificity was calculated by screening WES data from a control population of 487 individuals for mutations in COL1A1, COL1A2 and FBN1. The target capture of five exome capture platforms was compared. All 13 mutations in the OI cohort and 9/10 in the MFS cohort were detected (sensitivity=95.6%) including non-synonymous SNPs, small indels (<10 bp), and a large UTR5/exon 1 deletion. One mutation was not detected by GATK due to strand bias. Specificity was 99.5%. Capture platforms and analysis programs differed considerably in their ability to detect mutations. Consumable costs for WES were low. WES is an efficient, sensitive, specific and cost-effective method for mutation detection in patients with OI and MFS. Careful selection of platform and analysis programs is necessary to maximize success. PMID:24501682

  20. Proteomic profiling of a mouse model of acute intestinal Apc deletion leads to identification of potential novel biomarkers of human colorectal cancer (CRC).

    PubMed

    Hammoudi, Abeer; Song, Fei; Reed, Karen R; Jenkins, Rosalind E; Meniel, Valerie S; Watson, Alastair J M; Pritchard, D Mark; Clarke, Alan R; Jenkins, John R

    2013-10-25

    Colorectal cancer (CRC) is the fourth most common cause of cancer-related death worldwide. Accurate non-invasive screening for CRC would greatly enhance a population's health. Adenomatous polyposis coli (Apc) gene mutations commonly occur in human colorectal adenomas and carcinomas, leading to Wnt signalling pathway activation. Acute conditional transgenic deletion of Apc in murine intestinal epithelium (AhCre(+)Apc(fl)(/)(fl)) causes phenotypic changes similar to those found during colorectal tumourigenesis. This study comprised a proteomic analysis of murine small intestinal epithelial cells following acute Apc deletion to identify proteins that show altered expression during human colorectal carcinogenesis, thus identifying proteins that may prove clinically useful as blood/serum biomarkers of colorectal neoplasia. Eighty-one proteins showed significantly increased expression following iTRAQ analysis, and validation of nine of these by Ingenuity Pathaway Analysis showed they could be detected in blood or serum. Expression was assessed in AhCre(+)Apc(fl)(/)(fl) small intestinal epithelium by immunohistochemistry, western blot and quantitative real-time PCR; increased nucelolin concentrations were also detected in the serum of AhCre(+)Apc(fl)(/)(fl) and Apc(Min)(/)(+) mice by ELISA. Six proteins; heat shock 60kDa protein 1, Nucleolin, Prohibitin, Cytokeratin 18, Ribosomal protein L6 and DEAD (Asp-Glu-Ala-Asp) box polypeptide 5,were selected for further investigation. Increased expression of 4 of these was confirmed in human CRC by qPCR. In conclusion, several novel candidate biomarkers have been identified from analysis of transgenic mice in which the Apc gene was deleted in the intestinal epithelium that also showed increased expression in human CRC. Some of these warrant further investigation as potential serum-based biomarkers of human CRC. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate.

    PubMed

    Zhang, Z; Cavalier-Smith, T; Green, B R

    2001-08-01

    Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.

  2. A French multicenter study of over 700 patients with 22q11 deletions diagnosed using FISH or aCGH.

    PubMed

    Poirsier, Céline; Besseau-Ayasse, Justine; Schluth-Bolard, Caroline; Toutain, Jérôme; Missirian, Chantal; Le Caignec, Cédric; Bazin, Anne; de Blois, Marie Christine; Kuentz, Paul; Catty, Marie; Choiset, Agnès; Plessis, Ghislaine; Basinko, Audrey; Letard, Pascaline; Flori, Elisabeth; Jimenez, Mélanie; Valduga, Mylène; Landais, Emilie; Lallaoui, Hakima; Cartault, François; Lespinasse, James; Martin-Coignard, Dominique; Callier, Patrick; Pebrel-Richard, Céline; Portnoi, Marie-France; Busa, Tiffany; Receveur, Aline; Amblard, Florence; Yardin, Catherine; Harbuz, Radu; Prieur, Fabienne; Le Meur, Nathalie; Pipiras, Eva; Kleinfinger, Pascale; Vialard, François; Doco-Fenzy, Martine

    2016-06-01

    Although 22q11.2 deletion syndrome (22q11.2DS) is the most recurrent human microdeletion syndrome associated with a highly variable phenotype, little is known about the condition's true incidence and the phenotype at diagnosis. We performed a multicenter, retrospective analysis of postnatally diagnosed patients recruited by members of the Association des Cytogénéticiens de Langue Française (the French-Speaking Cytogeneticists Association). Clinical and cytogenetic data on 749 cases diagnosed between 1995 and 2013 were collected by 31 French cytogenetics laboratories. The most frequent reasons for referral of postnatally diagnosed cases were a congenital heart defect (CHD, 48.6%), facial dysmorphism (49.7%) and developmental delay (40.7%). Since 2007 (the year in which array comparative genomic hybridization (aCGH) was introduced for the routine screening of patients with intellectual disability), almost all cases have been diagnosed using FISH (96.1%). Only 15 cases (all with an atypical phenotype) were diagnosed with aCGH; the deletion size ranged from 745 to 2904 kb. The deletion was inherited in 15.0% of cases and was of maternal origin in 85.5% of the latter. This is the largest yet documented cohort of patients with 22q11.2DS (the most commonly diagnosed microdeletion) from the same population. French cytogenetics laboratories diagnosed at least 108 affected patients (including fetuses) per year from among a national population of ∼66 million. As observed for prenatal diagnoses, CHDs were the most frequently detected malformation in postnatal diagnoses. The most common CHD in postnatal diagnoses was an isolated septal defect.

  3. Genomic deletions created upon LINE-1 retrotransposition.

    PubMed

    Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V

    2002-08-09

    LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.

  4. The Role of Inhibition in Age-related Off-Topic Verbosity: Not Access but Deletion and Restraint Functions.

    PubMed

    Yin, Shufei; Peng, Huamao

    2016-01-01

    The speech of older adults is commonly described as verbose and off-topic, which is thought to influence their social communication. This study investigated the role of inhibition in age-related off-topic verbosity (OTV). Inhibition consists of three functions: access, deletion, and restraint. The access function is responsible for preventing irrelevant information from accessing the attention center (pre-mechanism of inhibition); The deletion function is responsible for deleting previously relevant but currently irrelevant information from working memory, and the restraint function is responsible for restraining strong but inappropriate responses (post-mechanisms of inhibition). A referential communication task was used to determine whether OTV was influenced by the pre-mechanism of inhibition. A self-involved event interview task was used to investigate the effect of the post-mechanisms of inhibition on OTV. Results showed that the OTV of the elderly participants was associated with an age-related decline in the post-mechanisms of inhibition, while the OTV exhibited by young adults was most likely due to deficits in the pre-mechanism function of inhibition. This research contributed to fill gaps in the existing knowledge about the potential relationship between specific functions of inhibition and age-related OTV.

  5. Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy

    PubMed Central

    Amoasii, Leonela; Long, Chengzu; Li, Hui; Mireault, Alex A.; Shelton, John M.; Sanchez-Ortiz, Efrain; McAnally, John R.; Bhattacharyya, Samadrita; Schmidt, Florian; Grimm, Dirk; Hauschka, Stephen D.; Bassel-Duby, Rhonda; Olson, Eric N.

    2017-01-01

    Duchenne muscular dystrophy (DMD) is a severe, progressive muscle disease caused by mutations in the dystrophin gene. The majority of DMD mutations are deletions that prematurely terminate the dystrophin protein. Deletions of exon 50 of the dystrophin gene are among the most common single exon deletions causing DMD. Such mutations can be corrected by skipping exon 51, thereby restoring the dystrophin reading frame. Using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9), we generated a DMD mouse model by deleting exon 50. These ΔEx50 mice displayed severe muscle dysfunction, which was corrected by systemic delivery of adeno-associated virus encoding CRISPR/Cas9 genome editing components. We optimized the method for dystrophin reading frame correction using a single guide RNA that created reframing mutations and allowed skipping of exon 51. In conjunction with muscle-specific expression of Cas9, this approach restored up to 90% of dystrophin protein expression throughout skeletal muscles and the heart of ΔEx50 mice. This method of permanently bypassing DMD mutations using a single cut in genomic DNA represents a step toward clinical correction of DMD mutations and potentially those of other neuromuscular disorders. PMID:29187645

  6. Aspm sustains postnatal cerebellar neurogenesis and medulloblastoma growth in mice

    PubMed Central

    Williams, Scott E.; Garcia, Idoia; Crowther, Andrew J.; Li, Shiyi; Stewart, Alyssa; Liu, Hedi; Lough, Kendall J.; O'Neill, Sean; Veleta, Katherine; Oyarzabal, Esteban A.; Merrill, Joseph R.; Shih, Yen-Yu Ian; Gershon, Timothy R.

    2015-01-01

    Alterations in genes that regulate brain size may contribute to both microcephaly and brain tumor formation. Here, we report that Aspm, a gene that is mutated in familial microcephaly, regulates postnatal neurogenesis in the cerebellum and supports the growth of medulloblastoma, the most common malignant pediatric brain tumor. Cerebellar granule neuron progenitors (CGNPs) express Aspm when maintained in a proliferative state by sonic hedgehog (Shh) signaling, and Aspm is expressed in Shh-driven medulloblastoma in mice. Genetic deletion of Aspm reduces cerebellar growth, while paradoxically increasing the mitotic rate of CGNPs. Aspm-deficient CGNPs show impaired mitotic progression, altered patterns of division orientation and differentiation, and increased DNA damage, which causes progenitor attrition through apoptosis. Deletion of Aspm in mice with Smo-induced medulloblastoma reduces tumor growth and increases DNA damage. Co-deletion of Aspm and either of the apoptosis regulators Bax or Trp53 (also known as p53) rescues the survival of neural progenitors and reduces the growth restriction imposed by Aspm deletion. Our data show that Aspm functions to regulate mitosis and to mitigate DNA damage during CGNP cell division, causes microcephaly through progenitor apoptosis when mutated, and sustains tumor growth in medulloblastoma. PMID:26450969

  7. Ocular Findings in Children With 22q11.2 Deletion Syndrome.

    PubMed

    Gokturk, Bahar; Topcu-Yilmaz, Pinar; Bozkurt, Banu; Yildirim, Mahmut Selman; Guner, Sukru Nail; Sayar, Esra Hazar; Reisli, Ismail

    2016-07-01

    To identify the ocular features of children diagnosed as having 22q11.2 deletion syndrome in a Turkish population, which is the most common microdeletion syndrome with a wide range of facial and ocular abnormalities. Sixteen children aged between 4 months and 18 years with a microdeletion in chromosome 22q11.2 underwent a detailed ophthalmological examination including uncorrected and best corrected visual acuity testing, stereoscopic vision examination, biomicroscopic and indirect fundus examination, and ocular motility testing. All patients had at least one ocular abnormality. The major abnormalities were eyelid abnormalities (eye hooding, narrow palpebral fissure, telecanthus, hypertelorism, sparse and thin eyebrows and eyelashes, blepharitis, and distichiasis), posterior embryotoxon, and tortuous retinal vessels in at least half of the patients. Other ophthalmological disorders were refractive errors, iris remnants, and strabismus. The chromosome 22q11.2 deletion syndrome is associated with a wide range of ocular disorders, which necessitates a comprehensive eye examination for appropriate treatment and follow-up. Ocular findings sometimes can provide a clue to the diagnosis of 22q11.2 deletion. [J Pediatr Ophthalmol Strabismus. 2016;53(4):218-222]. Copyright 2016, SLACK Incorporated.

  8. A new case of interstitial 6q16.2 deletion in a patient with Prader-Willi-like phenotype and investigation of SIM1 gene deletion in 87 patients with syndromic obesity.

    PubMed

    Varela, Monica C; Simões-Sato, Alex Y; Kim, Chong A; Bertola, Débora R; De Castro, Claudia I E; Koiffmann, Celia P

    2006-01-01

    The association of obesity, phenotypic abnormalities and mental retardation characterizes syndromic obesity. Its most common form is the Prader-Willi syndrome (PWS-- neonatal hypotonia, poor sucking, delayed psychomotor development, hyperphagia, severe obesity, short stature, small hands and feet, hypogonadism, mild to moderate mental retardation and behavioral disorders). A PWS-like phenotype has been described in patients with chromosome abnormalities involving the chromosome region 6q16.2 that includes the SIM1 gene. Herein we report cytogenetic and gene studies including a screening for the SIM1 gene deletion, performed on 87 patients with PWS-like phenotype, and describe the fifth case of syndromic obesity with an interstitial deletion of the chromosome segment 6q16-q21 and suggest that mutational analysis and further studies of the parental origin of chromosome alterations of 6q16.2 in patients with and without PWS-like phenotype are needed to evaluate possible imprinting effects of SIM1 gene and establish the contribution that alterations in this gene makes to the etiology of syndromic and non-syndromic obesity.

  9. First evidence of a large CHEK2 duplication involved in cancer predisposition in an Italian family with hereditary breast cancer

    PubMed Central

    2014-01-01

    Background CHEK2 is a multi-cancer susceptibility gene whose common germline mutations are known to contribute to the risk of developing breast and prostate cancer. Case presentation Here, we describe an Italian family with a high number of cases of breast cancer and other types of tumour subjected to the MLPA test to verify the presence of BRCA1, BRCA2 and CHEK2 deletions and duplications. We identified a new 23-kb duplication in the CHEK2 gene extending from intron 5 to 13 that was associated with breast cancer in the family. The presence and localisation of the alteration was confirmed by a second analysis by Next-Generation Sequencing. Conclusions This finding suggests that CHEK2 mutations are heterogeneous and that techniques other than sequencing, such as MLPA, are needed to identify CHEK2 mutations. It also indicates that CHEK2 rare variants, such as duplications, can confer a high susceptibility to cancer development and should thus be studied in depth as most of our knowledge of CHEK2 concerns common mutations. PMID:24986639

  10. First evidence of a large CHEK2 duplication involved in cancer predisposition in an Italian family with hereditary breast cancer.

    PubMed

    Tedaldi, Gianluca; Danesi, Rita; Zampiga, Valentina; Tebaldi, Michela; Bedei, Lucia; Zoli, Wainer; Amadori, Dino; Falcini, Fabio; Calistri, Daniele

    2014-07-01

    CHEK2 is a multi-cancer susceptibility gene whose common germline mutations are known to contribute to the risk of developing breast and prostate cancer. Here, we describe an Italian family with a high number of cases of breast cancer and other types of tumour subjected to the MLPA test to verify the presence of BRCA1, BRCA2 and CHEK2 deletions and duplications. We identified a new 23-kb duplication in the CHEK2 gene extending from intron 5 to 13 that was associated with breast cancer in the family. The presence and localisation of the alteration was confirmed by a second analysis by Next-Generation Sequencing. This finding suggests that CHEK2 mutations are heterogeneous and that techniques other than sequencing, such as MLPA, are needed to identify CHEK2 mutations. It also indicates that CHEK2 rare variants, such as duplications, can confer a high susceptibility to cancer development and should thus be studied in depth as most of our knowledge of CHEK2 concerns common mutations.

  11. The Janthinobacterium sp. HH01 Genome Encodes a Homologue of the V. cholerae CqsA and L. pneumophila LqsA Autoinducer Synthases

    PubMed Central

    Hornung, Claudia; Poehlein, Anja; Haack, Frederike S.; Schmidt, Martina; Dierking, Katja; Pohlen, Andrea; Schulenburg, Hinrich; Blokesch, Melanie; Plener, Laure; Jung, Kirsten; Bonge, Andreas; Krohn-Molt, Ines; Utpatel, Christian; Timmermann, Gabriele; Spieck, Eva; Pommerening-Röser, Andreas; Bode, Edna; Bode, Helge B.; Daniel, Rolf; Schmeisser, Christel; Streit, Wolfgang R.

    2013-01-01

    Janthinobacteria commonly form biofilms on eukaryotic hosts and are known to synthesize antibacterial and antifungal compounds. Janthinobacterium sp. HH01 was recently isolated from an aquatic environment and its genome sequence was established. The genome consists of a single chromosome and reveals a size of 7.10 Mb, being the largest janthinobacterial genome so far known. Approximately 80% of the 5,980 coding sequences (CDSs) present in the HH01 genome could be assigned putative functions. The genome encodes a wealth of secretory functions and several large clusters for polyketide biosynthesis. HH01 also encodes a remarkable number of proteins involved in resistance to drugs or heavy metals. Interestingly, the genome of HH01 apparently lacks the N-acylhomoserine lactone (AHL)-dependent signaling system and the AI-2-dependent quorum sensing regulatory circuit. Instead it encodes a homologue of the Legionella- and Vibrio-like autoinducer (lqsA/cqsA) synthase gene which we designated jqsA. The jqsA gene is linked to a cognate sensor kinase (jqsS) which is flanked by the response regulator jqsR. Here we show that a jqsA deletion has strong impact on the violacein biosynthesis in Janthinobacterium sp. HH01 and that a jqsA deletion mutant can be functionally complemented with the V. cholerae cqsA and the L. pneumophila lqsA genes. PMID:23405110

  12. Characteristics and outcome of myelodysplastic syndromes (MDS) with isolated 20q deletion: a report on 62 cases.

    PubMed

    Braun, Thorsten; de Botton, Stéphane; Taksin, Anne-Laure; Park, Sophie; Beyne-Rauzy, Odile; Coiteux, Valérie; Sapena, Rosa; Lazareth, Anne; Leroux, Geneviève; Guenda, Khaled; Cassinat, Bruno; Fontenay, Michaela; Vey, Norbert; Guerci, Agnès; Dreyfus, François; Bordessoule, Dominique; Stamatoullas, Aspasia; Castaigne, Sylvie; Terré, Christine; Eclache, Virginie; Fenaux, Pierre; Adès, Lionel

    2011-07-01

    Isolated 20q deletion is common in MDS and considered of good prognosis, but no large series have been reported. We compared characteristics of 62 MDS patients with isolated del 20q, 36 patients with del 20q and other cytogenetic abnormalities, and 1335 MDS patients without del20q. Significant differences between MDS with isolated del 20q and patients without del 20q were lower platelet count (mean 144 vs. 196 G/l, p=0.005), lower marrow blast count (mean 3.9% vs. 5.6%, p=0.0008), and higher reticulocyte count (mean 72.5 vs. 51.7 G/l, p=0.04). Ten (16%) patients with isolated del 20q had Hb>12 g/dl and platelets <100 G/l, compared to 7.3% of patients without del 20q (p=0.025). Review of marrow slides of those 10 patients showed that could be readily identified as MDS prior to cytogenetics. Fourteen percent of patients with isolated del 20q progressed to AML compared to 11% with one and 24% with several additional abnormalities. Median survival was 54 months in patients with isolated del 20q, not reached and 12 months for del 20q with one and several additional abnormalities, respectively (p=0.035) confirming the favorable prognosis of del 20q without complex abnormalities. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Germline rearrangements in families with strong family history of glioma and malignant melanoma, colon, and breast cancer

    PubMed Central

    Andersson, Ulrika; Wibom, Carl; Cederquist, Kristina; Aradottir, Steina; Borg, Åke; Armstrong, Georgina N.; Shete, Sanjay; Lau, Ching C.; Bainbridge, Matthew N.; Claus, Elizabeth B.; Barnholtz-Sloan, Jill; Lai, Rose; Il'yasova, Dora; Houlston, Richard S.; Schildkraut, Joellen; Bernstein, Jonine L.; Olson, Sara H.; Jenkins, Robert B.; Lachance, Daniel H.; Wrensch, Margaret; Davis, Faith G.; Merrell, Ryan; Johansen, Christoffer; Sadetzki, Siegal; Bondy, Melissa L.; Melin, Beatrice S.; Adatto, Phyllis; Morice, Fabian; Payen, Sam; McQuinn, Lacey; McGaha, Rebecca; Guerra, Sandra; Paith, Leslie; Roth, Katherine; Zeng, Dong; Zhang, Hui; Yung, Alfred; Aldape, Kenneth; Gilbert, Mark; Weinberger, Jeffrey; Colman, Howard; Conrad, Charles; de Groot, John; Forman, Arthur; Groves, Morris; Levin, Victor; Loghin, Monica; Puduvalli, Vinay; Sawaya, Raymond; Heimberger, Amy; Lang, Frederick; Levine, Nicholas; Tolentino, Lori; Saunders, Kate; Thach, Thu-Trang; Iacono, Donna Dello; Sloan, Andrew; Gerson, Stanton; Selman, Warren; Bambakidis, Nicholas; Hart, David; Miller, Jonathan; Hoffer, Alan; Cohen, Mark; Rogers, Lisa; Nock, Charles J; Wolinsky, Yingli; Devine, Karen; Fulop, Jordonna; Barrett, Wendi; Shimmel, Kristen; Ostrom, Quinn; Barnett, Gene; Rosenfeld, Steven; Vogelbaum, Michael; Weil, Robert; Ahluwalia, Manmeet; Peereboom, David; Staugaitis, Susan; Schilero, Cathy; Brewer, Cathy; Smolenski, Kathy; McGraw, Mary; Naska, Theresa; Rosenfeld, Steven; Ram, Zvi; Blumenthal, Deborah T.; Bokstein, Felix; Umansky, Felix; Zaaroor, Menashe; Cohen, Avi; Tzuk-Shina, Tzeela; Voldby, Bo; Laursen, René; Andersen, Claus; Brennum, Jannick; Henriksen, Matilde Bille; Marzouk, Maya; Davis, Mary Elizabeth; Boland, Eamon; Smith, Marcel; Eze, Ogechukwu; Way, Mahalia; Lada, Pat; Miedzianowski, Nancy; Frechette, Michelle; Paleologos, Nina; Byström, Gudrun; Svedberg, Eva; Huggert, Sara; Kimdal, Mikael; Sandström, Monica; Brännström, Nikolina; Hayat, Amina; Tihan, Tarik; Zheng, Shichun; Berger, Mitchel; Butowski, Nicholas; Chang, Susan; Clarke, Jennifer; Prados, Michael; Rice, Terri; Sison, Jeannette; Kivett, Valerie; Duo, Xiaoqin; Hansen, Helen; Hsuang, George; Lamela, Rosito; Ramos, Christian; Patoka, Joe; Wagenman, Katherine; Zhou, Mi; Klein, Adam; McGee, Nora; Pfefferle, Jon; Wilson, Callie; Morris, Pagan; Hughes, Mary; Britt-Williams, Marlin; Foft, Jessica; Madsen, Julia; Polony, Csaba; McCarthy, Bridget; Zahora, Candice; Villano, John; Engelhard, Herbert; Borg, Ake; Chanock, Stephen K; Collins, Peter; Elston, Robert; Kleihues, Paul; Kruchko, Carol; Petersen, Gloria; Plon, Sharon; Thompson, Patricia; Johansen, C.; Sadetzki, S.; Melin, B.; Bondy, Melissa L.; Lau, Ching C.; Scheurer, Michael E.; Armstrong, Georgina N.; Liu, Yanhong; Shete, Sanjay; Yu, Robert K.; Aldape, Kenneth D.; Gilbert, Mark R.; Weinberg, Jeffrey; Houlston, Richard S.; Hosking, Fay J.; Robertson, Lindsay; Papaemmanuil, Elli; Claus, Elizabeth B.; Claus, Elizabeth B.; Barnholtz-Sloan, Jill; Sloan, Andrew E.; Barnett, Gene; Devine, Karen; Wolinsky, Yingli; Lai, Rose; McKean-Cowdin, Roberta; Il'yasova, Dora; Schildkraut, Joellen; Sadetzki, Siegal; Yechezkel, Galit Hirsh; Bruchim, Revital Bar-Sade; Aslanov, Lili; Sadetzki, Siegal; Johansen, Christoffer; Kosteljanetz, Michael; Broholm, Helle; Bernstein, Jonine L.; Olson, Sara H.; Schubert, Erica; DeAngelis, Lisa; Jenkins, Robert B.; Yang, Ping; Rynearson, Amanda; Andersson, Ulrika; Wibom, Carl; Henriksson, Roger; Melin, Beatrice S.; Cederquist, Kristina; Aradottir, Steina; Borg, Åke; Merrell, Ryan; Lada, Patricia; Wrensch, Margaret; Wiencke, John; Wiemels, Joe; McCoy, Lucie; McCarthy, Bridget J.; Davis, Faith G.

    2014-01-01

    Background Although familial susceptibility to glioma is known, the genetic basis for this susceptibility remains unidentified in the majority of glioma-specific families. An alternative approach to identifying such genes is to examine cancer pedigrees, which include glioma as one of several cancer phenotypes, to determine whether common chromosomal modifications might account for the familial aggregation of glioma and other cancers. Methods Germline rearrangements in 146 glioma families (from the Gliogene Consortium; http://www.gliogene.org/) were examined using multiplex ligation-dependent probe amplification. These families all had at least 2 verified glioma cases and a third reported or verified glioma case in the same family or 2 glioma cases in the family with at least one family member affected with melanoma, colon, or breast cancer.The genomic areas covering TP53, CDKN2A, MLH1, and MSH2 were selected because these genes have been previously reported to be associated with cancer pedigrees known to include glioma. Results We detected a single structural rearrangement, a deletion of exons 1-6 in MSH2, in the proband of one family with 3 cases with glioma and one relative with colon cancer. Conclusions Large deletions and duplications are rare events in familial glioma cases, even in families with a strong family history of cancers that may be involved in known cancer syndromes. PMID:24723567

  14. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

    PubMed

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

    2008-04-01

    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  15. Mitochondrial Hepatopathies: Advances in Genetics and Pathogenesis

    PubMed Central

    Lee, Way S.; Sokol, Ronald J.

    2013-01-01

    Hepatic involvement is a common feature in childhood mitochondrial hepatopathies, particularly in the neonatal period. Respiratory chain disorders may present as neonatal acute liver failure, hepatic steatohepatitis, cholestasis, or cirrhosis with chronic liver failure of insidious onset. In recent years, specific molecular defects (mutations in nuclear genes such as SCO1, BCS1L, POLG, DGUOK, and MPV17 and the deletion or rearrangement of mitochondrial DNA) have been identified, with the promise of genetic and prenatal diagnosis. The current treatment of mitochondrial hepatopathies is largely ineffective, and the prognosis is generally poor. The role of liver transplantation in patients with liver failure remains poorly defined because of the systemic nature of the disease, which does not respond to transplantation. Prospective, longitudinal, multicentered studies will be needed to address the gaps in our knowledge in these rare liver diseases. PMID:17538929

  16. Mutations in ppe38 block PE_PGRS secretion and increase virulence of Mycobacterium tuberculosis.

    PubMed

    Ates, Louis S; Dippenaar, Anzaan; Ummels, Roy; Piersma, Sander R; van der Woude, Aniek D; van der Kuij, Kim; Le Chevalier, Fabien; Mata-Espinosa, Dulce; Barrios-Payán, Jorge; Marquina-Castillo, Brenda; Guapillo, Carolina; Jiménez, Connie R; Pain, Arnab; Houben, Edith N G; Warren, Robin M; Brosch, Roland; Hernández-Pando, Rogelio; Bitter, Wilbert

    2018-02-01

    Mycobacterium tuberculosis requires a large number of secreted and exported proteins for its virulence, immune modulation and nutrient uptake. Most of these proteins are transported by the different type VII secretion systems 1,2 . The most recently evolved type VII secretion system, ESX-5, secretes dozens of substrates belonging to the PE and PPE families, which are named for conserved proline and glutamic acid residues close to the amino terminus 3,4 . However, the role of these proteins remains largely elusive 1 . Here, we show that mutations of ppe38 completely block the secretion of two large subsets of ESX-5 substrates, that is, PPE-MPTR and PE_PGRS, together comprising >80 proteins. Importantly, hypervirulent clinical M. tuberculosis strains of the Beijing lineage have such a mutation and a concomitant loss of secretion 5 . Restoration of PPE38-dependent secretion partially reverted the hypervirulence phenotype of a Beijing strain, and deletion of ppe38 in moderately virulent M. tuberculosis increased virulence. This indicates that these ESX-5 substrates have an important role in virulence attenuation. Phylogenetic analysis revealed that deletion of ppe38 occurred at the branching point of the 'modern' Beijing sublineage and is shared by Beijing outbreak strains worldwide, suggesting that this deletion may have contributed to their success and global distribution 6,7 .

  17. A large deletion in GPR98 causes type IIC Usher syndrome in male and female members of an Iranian family.

    PubMed

    Hilgert, N; Kahrizi, K; Dieltjens, N; Bazazzadegan, N; Najmabadi, H; Smith, R J H; Van Camp, G

    2009-04-01

    Usher syndrome (USH) is a clinically and genetically heterogeneous disease. The three recognised clinical phenotypes (types I, II and III; USH1, USH2 and USH3) are caused by mutations in nine different genes. USH2C is characterised by moderate to severe hearing loss, retinitis pigmentosa and normal vestibular function. One earlier report describes mutations in GPR98 (VLGR1) in four families segregating this phenotype. To detect the disease-causing mutation in an Iranian family segregating USH2C. In this family, five members had a phenotype compatible with Usher syndrome, and two others had nonsyndromic hearing loss. Mutation analysis of all 90 coding exons of GPR98. Consistent with these clinical findings, the five subjects with USH carried a haplotype linked to the USH2C locus, whereas the two subjects with nonsyndromic hearing loss did not. We identified a new mutation in GPR98 segregating with USH2C in this family. The mutation is a large deletion g.371657_507673del of exons 84 and 85, presumably leading to a frameshift. A large GPR98 deletion of 136 017 bp segregates with USH2C in an Iranian family. To our knowledge, this is only the second report of a GPR98 mutation, and the first report on male subjects with USH2C and a GPR98 mutation.

  18. Cleft Palate, Retrognathia and Congenital Heart Disease in Velo-Cardio-Facial Syndrome: A Phenotype Correlation Study

    PubMed Central

    Friedman, Marcia A.; Miletta, Nathanial; Roe, Cheryl; Wang, Dongliang; Morrow, Bernice E.; Kates, Wendy R.; Higgins, Anne Marie; Shprintzen, Robert J.

    2011-01-01

    Objective Velo-cardio-facial syndrome (VCFS) is caused by a microdeletion of approximately 40 genes from one copy of chromosome 22. Expression of the syndrome is a variable combination of over 190 phenotypic characteristics. As of yet, little is known about how these phenotypes correlate with one another or whether there are predictable patterns of expression. Two of the most common phenotypic categories, congenital heart disease and cleft palate, have been proposed to have a common genetic relationship to the deleted T-box 1 gene (TBX1). The purpose of this study is to determine if congenital heart disease and cleft palate are correlated in a large cohort of human subjects with VCFS. Methods This study is a retrospective chart review including 316 Caucasian non-Hispanic subjects with FISH or CGH microarray confirmed chromosome 22q11.2 deletions. All subjects were evaluated by the interdisciplinary team at the Velo-Cardio-Facial Syndrome International Center at Upstate Medical University, Syracuse, NY. Each combination of congenital heart disease, cleft palates, and retrognathia was analyzed by chi square or Fisher exact test. Results For all categories of congenital heart disease and cleft palate or retrognathia no significant associations were found, with the exception of submucous cleft palate and retrognathia (nominal p=0.0325) and occult submucous cleft palate and retrognathia (nominal p=0.000013). Conclusions Congenital heart disease and cleft palate do not appear to be correlated in human subjects with VCFS despite earlier suggestions from animal models. Possible explanations include modification of the effect of TBX1 by genes outside of the 22q11.2 region that may further influence the formation of the palate or heart, or the presence of epigenetic factors that may effect genes within the deleted region, modifying genes elsewhere, or polymorphisms on the normal copy of chromosome 22. Lastly, it is possible that TBX1 plays a role in palate formation in some species, but not in humans. In VCFS, retrognathia is caused by an obtuse angulation of the skull base. It is unknown if the correlation between retrognathia and cleft palate in VCFS indicates a developmental sequence related to skull morphology, or direct gene effects of both anomalies. Much work remains to be done to fully understand the complex relationships between phenotypic characteristics in VCFS. PMID:21763005

  19. Cleft palate, retrognathia and congenital heart disease in velo-cardio-facial syndrome: a phenotype correlation study.

    PubMed

    Friedman, Marcia A; Miletta, Nathanial; Roe, Cheryl; Wang, Dongliang; Morrow, Bernice E; Kates, Wendy R; Higgins, Anne Marie; Shprintzen, Robert J

    2011-09-01

    Velo-cardio-facial syndrome (VCFS) is caused by a microdeletion of approximately 40 genes from one copy of chromosome 22. Expression of the syndrome is a variable combination of over 190 phenotypic characteristics. As of yet, little is known about how these phenotypes correlate with one another or whether there are predictable patterns of expression. Two of the most common phenotypic categories, congenital heart disease and cleft palate, have been proposed to have a common genetic relationship to the deleted T-box 1 gene (TBX1). The purpose of this study is to determine if congenital heart disease and cleft palate are correlated in a large cohort of human subjects with VCFS. This study is a retrospective chart review including 316 Caucasian non-Hispanic subjects with FISH or CGH microarray confirmed chromosome 22q11.2 deletions. All subjects were evaluated by the interdisciplinary team at the Velo-Cardio-Facial Syndrome International Center at Upstate Medical University, Syracuse, NY. Each combination of congenital heart disease, cleft palates, and retrognathia was analyzed by Chi square or Fisher exact test. For all categories of congenital heart disease and cleft palate or retrognathia no significant associations were found, with the exception of submucous cleft palate and retrognathia (nominal p=0.0325) and occult submucous cleft palate and retrognathia (nominal p=0.000013). Congenital heart disease and cleft palate do not appear to be correlated in human subjects with VCFS despite earlier suggestions from animal models. Possible explanations include modification of the effect of TBX1 by genes outside of the 22q11.2 region that may further influence the formation of the palate or heart, or the presence of epigenetic factors that may effect genes within the deleted region, modifying genes elsewhere, or polymorphisms on the normal copy of chromosome 22. Lastly, it is possible that TBX1 plays a role in palate formation in some species, but not in humans. In VCFS, retrognathia is caused by an obtuse angulation of the skull base. It is unknown if the correlation between retrognathia and cleft palate in VCFS indicates a developmental sequence related to skull morphology, or direct gene effects of both anomalies. Much work remains to be done to fully understand the complex relationships between phenotypic characteristics in VCFS. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  20. Characterization of hemizygous deletions in Citrus using array-Comparative Genomic Hybridization and microsynteny comparisons with the poplar genome

    PubMed Central

    Ríos, Gabino; Naranjo, Miguel A; Iglesias, Domingo J; Ruiz-Rivero, Omar; Geraud, Marion; Usach, Antonio; Talón, Manuel

    2008-01-01

    Background Many fruit-tree species, including relevant Citrus spp varieties exhibit a reproductive biology that impairs breeding and strongly constrains genetic improvements. In citrus, juvenility increases the generation time while sexual sterility, inbreeding depression and self-incompatibility prevent the production of homozygous cultivars. Genomic technology may provide citrus researchers with a new set of tools to address these various restrictions. In this work, we report a valuable genomics-based protocol for the structural analysis of deletion mutations on an heterozygous background. Results Two independent fast neutron mutants of self-incompatible clementine (Citrus clementina Hort. Ex Tan. cv. Clemenules) were the subject of the study. Both mutants, named 39B3 and 39E7, were expected to carry DNA deletions in hemizygous dosage. Array-based Comparative Genomic Hybridization (array-CGH) using a Citrus cDNA microarray allowed the identification of underrepresented genes in these two mutants. Subsequent comparison of citrus deleted genes with annotated plant genomes, especially poplar, made possible to predict the presence of a large deletion in 39B3 of about 700 kb and at least two deletions of approximately 100 and 500 kb in 39E7. The deletion in 39B3 was further characterized by PCR on available Citrus BACs, which helped us to build a partial physical map of the deletion. Among the deleted genes, ClpC-like gene coding for a putative subunit of a multifunctional chloroplastic protease involved in the regulation of chlorophyll b synthesis was directly related to the mutated phenotype since the mutant showed a reduced chlorophyll a/b ratio in green tissues. Conclusion In this work, we report the use of array-CGH for the successful identification of genes included in a hemizygous deletion induced by fast neutron irradiation on Citrus clementina. The study of gene content and order into the 39B3 deletion also led to the unexpected conclusion that microsynteny and local gene colinearity in this species were higher with Populus trichocarpa than with the phylogenetically closer Arabidopsis thaliana. This work corroborates the potential of Citrus genomic resources to assist mutagenesis-based approaches for functional genetics, structural studies and comparative genomics, and hence to facilitate citrus variety improvement. PMID:18691431

Top