Sample records for comparable protective immunity

  1. Correlates of Vaccine-Induced Protection against Mycobacterium tuberculosis Revealed in Comparative Analyses of Lymphocyte Populations

    PubMed Central

    Kurtz, Sherry L.

    2015-01-01

    A critical hindrance to the development of a novel vaccine against Mycobacterium tuberculosis is a lack of understanding of protective correlates of immunity and of host factors involved in a successful adaptive immune response. Studies from our group and others have used a mouse-based in vitro model system to assess correlates of protection. Here, using this coculture system and a panel of whole-cell vaccines with varied efficacy, we developed a comprehensive approach to understand correlates of protection. We compared the gene and protein expression profiles of vaccine-generated immune peripheral blood lymphocytes (PBLs) to the profiles found in immune splenocytes. PBLs not only represent a clinically relevant cell population, but comparing the expression in these populations gave insight into compartmentally specific mechanisms of protection. Additionally, we performed a direct comparison of host responses induced when immune cells were cocultured with either the vaccine strain Mycobacterium bovis BCG or virulent M. tuberculosis. These comparisons revealed host-specific and bacterium-specific factors involved in protection against virulent M. tuberculosis. Most significantly, we identified a set of 13 core molecules induced in the most protective vaccines under all of the conditions tested. Further validation of this panel of mediators as a predictor of vaccine efficacy will facilitate vaccine development, and determining how each promotes adaptive immunity will advance our understanding of antimycobacterial immune responses. PMID:26269537

  2. Supplementation of H1N1pdm09 split vaccine with heterologous tandem repeat M2e5x virus-like particles confers improved cross-protection in ferrets.

    PubMed

    Music, Nedzad; Reber, Adrian J; Kim, Min-Chul; York, Ian A; Kang, Sang-Moo

    2016-01-20

    Current influenza vaccines induce strain-specific immunity to the highly variable hemagglutinin (HA) protein. It is therefore a high priority to develop vaccines that induce broadly cross-protective immunity to different strains of influenza. Since influenza A M2 proteins are highly conserved among different strains, five tandem repeats of the extracellular peptide of M2 in a membrane-anchored form on virus-like particles (VLPs) have been suggested to be a promising candidate for universal influenza vaccine. In this study, ferrets were intramuscularly immunized with 2009 H1N1 split HA vaccine ("Split") alone, influenza split vaccine supplemented with M2e5x VLP ("Split+M2e5x"), M2e5x VLP alone ("M2e5x"), or mock immunized. Vaccine efficacy was measured serologically and by protection against a serologically distinct viral challenge. Ferrets immunized with Split+M2e5x induced HA strain specific and conserved M2e immunity. Supplementation of M2e5x VLP to split vaccination significantly increased the immunogenicity of split vaccine compared to split alone. The Split+M2e5x ferret group showed evidence of cross-reactive protection, including faster recovery from weight loss, and reduced inflammation, as inferred from changes in peripheral leukocyte subsets, compared to mock-immunized animals. In addition, ferrets immunized with Split+M2e5x shed lower viral nasal-wash titers than the other groups. Ferrets immunized with M2e5x alone also show some protective effects, while those immunized with split vaccine alone induced no protective effects compared to mock-immunized ferrets. These studies suggest that supplementation of split vaccine with M2e5x-VLP may provide broader and improved cross-protection than split vaccine alone. Published by Elsevier Ltd.

  3. Supplementation of H1N1pdm09 split vaccine with heterologous tandem repeat M2e5x virus-like particles confers improved cross-protection in ferrets

    PubMed Central

    Music, Nedzad; Reber, Adrian J.; Kim, Min-Chul; York, Ian A.; Kang, Sang-Moo

    2015-01-01

    Current influenza vaccines induce strain-specific immunity to the highly variable hemagglutinin (HA) protein. It is therefore a high priority to develop vaccines that induce broadly cross-protective immunity to different strains of influenza. Since influenza A M2 proteins are highly conserved among different strains, five tandem repeats of the extracellular peptide of M2 in a membrane-anchored form on virus-like particles (VLPs) have been suggested to be a promising candidate for universal influenza vaccine. In this study, ferrets were intramuscularly immunized with 2009 H1N1 split HA vaccine (“Split”) alone, influenza split vaccine supplemented with M2e5x VLP (“Split+M2e5x”), M2e5x VLP alone (“M2e5x”), or mock immunized. Vaccine efficacy was measured serologically and by protection against a serologically distinct viral challenge. Ferrets immunized with Split+M2e5x induced HA strain specific and conserved M2e immunity. Supplementation of M2e5x VLP to split vaccination significantly increased the immunogenicity of split vaccine compared to split alone. The Split+M2e5x ferret group showed evidence of cross-reactive protection, including faster recovery from weight loss, and reduced inflammation, as inferred from changes in peripheral leukocyte subsets, compared to mock-immunized animals. In addition, ferrets immunized with Split+M2e5x shed lower viral nasal-wash titers than the other groups. Ferrets immunized with M2e5x alone also show some protective effects, while those immunized with split vaccine alone induced no protective effects compared to mock-immunized ferrets. These studies suggest that supplementation of split vaccine with M2e5x-VLP may provide broader and improved cross-protection than split vaccine alone. PMID:26709639

  4. Protective immunity against Trypanosoma cruzi provided by oral immunization with Phytomonas serpens: role of nitric oxide.

    PubMed

    Pinge-Filho, P; Peron, J P S; de Moura, T R; Menolli, R A; Graça, V K; Estevão, D; Tadokoro, C E; Jankevicius, J V; Rizzo, L V

    2005-01-31

    We have previously demonstrated that Phytomonas serpens, a tomato parasite, shares antigens with Trypanosoma cruzi, the protozoa that causes Chagas' disease. These antigens are recognized by human sera and induce protective immunity in Balb/c mice. In the present study, inducible nitric oxide synthase (iNOS) knockout (KO) mice and C57BL/6 mice treated with the nitric oxide inhibitor, aminoguanidine (AG, 50 mg kg(-1)) infected with T. cruzi, were used to demonstrate the role of nitric oxide (NO) to host protection against T. cruzi infection achieved by oral immunization with live P. serpens. A reduction in parasitaemia and an increase in survival were observed in C57BL/6 infected mice and previously immunized with P. serpens, when compared to non-immunized mice. iNOS (KO) mice immunized and C57BL/6 immunized and treated with AG presented parasitaemia and mortality rates comparable to those of infected and non-immunized mice. By itself, immunization with P. serpens did not induce inflammation in the myocardium, but C57BL/6 mice so immunized showed fewer amastigotes nests in the heart following an acute T. cruzi infection than those in non-immunized mice. These results suggest that protective immunity against T. cruzi infection induced by immunization with P. serpens is dependent upon enhanced NO production during the acute phase of T. cruzi infection.

  5. Immunity to sporozoite-induced malaria infection in mice. I. The effect of immunization of T and B cell-deficient mice. [X Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, D.H.; Tigelaar, R.E.; Weinbaum, F.I.

    1977-04-01

    The cellular basis of immunity to sporozoites was investigated by examining the effect of immunization of T and B cell-deficient C57BL/6N x BALB/c AnN F/sub 1/ (BLCF/sub 1/) mice compared to immunocompetent controls. Immunization of T cell-deficient (ATX-BM-ATS) BLCF/sub 1/ mice with x-irradiated sporozoites did not result in the generation of protective immunity. The same immunization protocols protected all immunocompetent controls. In contrast, B cell-deficient (..mu..-suppressed) BLCF/sub 1/ mice were protected by immunization in the majority of cases. The absence of detectable serum circumsporozoite precipitins or sporozoite neutralizing activity in the ..mu..-suppressed mice that resisted a sporozoite challenge suggests amore » minor role for these humoral factors in protection. These data demonstrate a preeminent role for T cells in the induction of protective immunity in BLCF/sub 1/ mice against a P. berghei sporozoite infection.« less

  6. Differential protective effects of immune lymphoid cells against transplanted line Ib leukemia and immune polioencephalomyelitis. [X radiation, mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duffey, P.S.; Lukasewycz, O.A.; Olson, D.S.

    1978-12-01

    The capacity of immune cells obtained from the major lymphoid compartments to protect C58 mice from transplanted line Ib leukemia, and from an age-dependent autoimmune CNS disease (immune polioencephalomyelitis = IPE) elicited by immunizing old C58 mice with inactivated Ib cells was quantified. Cells used for comparative adoptive protection tests were harvested from the major lymphoid compartments 14 to 15 days after young C58 mice were immunized with inactivated Ib cell preparations. Regression curves were plotted from survival data and the log/sub 10/PD/sub 50/ values were determined. Immune spleen (ISC) and peritoneal cells (IPEC) were significantly more protective against transplantedmore » Ib cells than immune lymph node (ILNC), thymic (ITC), and marrow cells (IMC). In contrast, IPEC and IMC were not protective against IPE and ITC were only marginally protective. ILNC afforded significant protection to transplantable leukemia but were only marginally protective to IPE. When ISC were treated with anti-thy 1.2 serum and complement, protection against transplanted leukemia and IPE was reduced > 99%. When donors of immune lymphoid cells were treated with 12.5 mg of cortisone acetate daily for 2 days before lymphoid cells were harvested, protection against transplanted Ib cells by ISC was reduced by approximately 90% whereas protection against IPE was totally eliminated. Considered together, these results indicate that the protective mechanisms to transplantable leukemia and IPE differ significantly in the same indicator mouse strain.« less

  7. Stabilization of Influenza Vaccine Enhances Protection by Microneedle Delivery in the Mouse Skin

    PubMed Central

    Yoo, Dae-Goon; Compans, Richard W.; Prausnitz, Mark R.; Kang, Sang-Moo

    2009-01-01

    Background Simple and effective vaccine administration is particularly important for annually recommended influenza vaccination. We hypothesized that vaccine delivery to the skin using a patch containing vaccine-coated microneedles could be an attractive approach to improve influenza vaccination compliance and efficacy. Methodology/Principal Findings Solid microneedle arrays coated with inactivated influenza vaccine were prepared for simple vaccine delivery to the skin. However, the stability of the influenza vaccine, as measured by hemagglutination activity, was found to be significantly damaged during microneedle coating. The addition of trehalose to the microneedle coating formulation retained hemagglutination activity, indicating stabilization of the coated influenza vaccine. For both intramuscular and microneedle skin immunization, delivery of un-stabilized vaccine yielded weaker protective immune responses including viral neutralizing antibodies, protective efficacies, and recall immune responses to influenza virus. Immunization using un-stabilized vaccine also shifted the pattern of antibody isotypes compared to the stabilized vaccine. Importantly, a single microneedle-based vaccination using stabilized influenza vaccine was found to be superior to intramuscular immunization in controlling virus replication as well as in inducing rapid recall immune responses post challenge. Conclusions/Significance The functional integrity of hemagglutinin is associated with inducing improved protective immunity against influenza. Simple microneedle influenza vaccination in the skin produced superior protection compared to conventional intramuscular immunization. This approach is likely to be applicable to other vaccines too. PMID:19779615

  8. Evaluation of TcpF-A2-CTB Chimera and Evidence of Additive Protective Efficacy of Immunizing with TcpF and CTB in the Suckling Mouse Model of Cholera

    PubMed Central

    Price, Gregory A.; Holmes, Randall K.

    2012-01-01

    The secreted colonization factor, TcpF, which is produced by Vibrio cholerae 01 and 0139, has generated interest as a potential protective antigen in the development of a subunit vaccine against cholera. This study evaluated immunogenicity/protective efficacy of a TcpF holotoxin-like chimera (TcpF-A2-CTB) following intraperitoneal immunization compared to TcpF alone, a TcpF+CTB mixture, or CTB alone. Immunization with the TcpF-A2-CTB chimera elicited significantly greater amounts of anti-TcpF IgG than immunization with the other antigens (P<0.05). Protective efficacy was measured using 6-day-old pups reared from immunized dams and orogastrically challenged with a lethal dose of El Tor V. cholerae 01 Inaba strain N16961. Protection from death, and weight loss analysis at 24 and 48 hours post-infection demonstrated that immunization with TcpF alone was poorly protective. However, immunization with TcpF+CTB was highly protective and showed a trend toward greater protection than immunization with CTB alone (82% vs 64% survival). Immunization with the TcpF-A2-CTB chimera demonstrated less protection (50% survival) than immunization with the TcpF+CTB mixture. The TcpF-A2-CTB chimera used for this study contained the heterologous classical CTB variant whereas the El Tor CTB variant (expressed by the challenge strain) was used in the other immunization groups. For all immunization groups that received CTB, quantitative ELISA data demonstrated that the amounts of serum IgG directed against the homologous immunizing CTB antigen was statistically greater than the amount to the heterologous CTB antigen (P≤0.003). This finding provides a likely explanation for the poorer protection observed following immunization with the TcpF-A2-CTB chimera and the relatively high level of protection seen after immunization with homologous CTB alone. Though immunization with TcpF alone provided no protection, the additive protective effect when TcpF was combined with CTB demonstrates its possible value as a component of a multivalent subunit vaccine against Vibrio cholerae 01 and 0139. PMID:22879984

  9. Mycobacterium smegmatis proteoliposome induce protection in a murine progressive pulmonary tuberculosis model.

    PubMed

    Tirado, Yanely; Puig, Alina; Alvarez, Nadine; Borrero, Reinier; Aguilar, Alicia; Camacho, Frank; Reyes, Fatima; Fernandez, Sonsire; Perez, Jose Luis; Acevedo, Reynaldo; Mata Espinoza, Dulce; Payan, Jorge Alberto Barrios; Garcia, Maria de Los A; Kadir, Ramlah; Sarmiento, María E; Hernandez-Pando, Rogelio; Norazmi, Mohd-Nor; Acosta, Armando

    2016-12-01

    Tuberculosis (TB) remains an important cause of mortality and morbidity. The TB vaccine, BCG, is not fully protective against the adult form of the disease and is unable to prevent its transmission although it is still useful against severe childhood TB. Hence, the search for new vaccines is of great interest. In a previous study, we have shown that proteoliposomes obtained from Mycobacterium smegmatis (PLMs) induced cross reactive humoral and cellular response against Mycobacterium tuberculosis (Mtb) antigens. With the objective to evaluate the protective capability of PLMs, a murine model of progressive pulmonary TB was used. Animals immunized with PLMs with and without alum (PLMs/PLMsAL respectively) showed protection compared to non-immunized animals. Mice immunized with PLMsAL induced similar protection as that of BCG. Animals immunized with BCG, PLMs and PLMsAL showed a significant decrease in tissue damage (percentage of pneumonic area/lung) compared to non-immunized animals, with a more prominent effect in BCG vaccinated mice. The protective effect of the administration of PLMs in mice supports its future evaluation as experimental vaccine candidate against Mtb. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Immune Responses to HCV and Other Hepatitis Viruses

    PubMed Central

    Park, Su-Hyung; Rehermann, Barbara

    2014-01-01

    Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265

  11. Differential Requirements for T Cells in Viruslike Particle- and Rotavirus-Induced Protective Immunity▿

    PubMed Central

    Blutt, Sarah E.; Warfield, Kelly L.; Estes, Mary K.; Conner, Margaret E.

    2008-01-01

    Correlates of protection from rotavirus infection are controversial. We compared the roles of B and T lymphocytes in protective immunity induced either by intranasally administered nonreplicating viruslike particles or inactivated virus or by orally administered murine rotavirus. We found that protection induced by nonreplicating vaccines requires CD4+ T cells and CD40/CD40L. In contrast, T cells were not required for short-term protective immunity induced by infection, but both T-cell-dependent and -independent mechanisms contributed to long-term maintenance of protection. Our findings indicate that more than one marker of protective immunity exists and that these markers depend on the vaccine that is administered. PMID:18184712

  12. Intranasal boosting with an adenovirus-vectored vaccine markedly enhances protection by parenteral Mycobacterium bovis BCG immunization against pulmonary tuberculosis.

    PubMed

    Santosuosso, Michael; McCormick, Sarah; Zhang, Xizhong; Zganiacz, Anna; Xing, Zhou

    2006-08-01

    Parenterally administered Mycobacterium bovis BCG vaccine confers only limited immune protection from pulmonary tuberculosis in humans. There is a need for developing effective boosting vaccination strategies. We examined a heterologous prime-boost regimen utilizing BCG as a prime vaccine and our recently described adenoviral vector expressing Ag85A (AdAg85A) as a boost vaccine. Since we recently demonstrated that a single intranasal but not intramuscular immunization with AdAg85A was able to induce potent protection from pulmonary Mycobacterium tuberculosis challenge in a mouse model, we compared the protective effects of parenteral and mucosal booster immunizations following subcutaneous BCG priming. Protection by BCG prime immunization was not effectively boosted by subcutaneous BCG or intramuscular AdAg85A. In contrast, protection by BCG priming was remarkably boosted by intranasal AdAg85A. Such enhanced protection by intranasal AdAg85A was correlated to the numbers of gamma interferon-positive CD4 and CD8 T cells residing in the airway lumen of the lung. Our study demonstrates that intranasal administration of AdAg85A represents an effective way to boost immune protection by parenteral BCG vaccination.

  13. Eimeria maxima recombinant Gam82 gametocyte antigen vaccine protects against coccidiosis and augments humoral and cell-mediated immunity.

    PubMed

    Jang, Seung I; Lillehoj, Hyun S; Lee, Sung Hyen; Lee, Kyung Woo; Park, Myeong Seon; Cha, Sung-Rok; Lillehoj, Erik P; Subramanian, B Mohana; Sriraman, R; Srinivasan, V A

    2010-04-09

    Intestinal infection with Eimeria, the etiologic agent of avian coccidiosis, stimulates protective immunity to subsequent colonization by the homologous parasite, while cross-protection against heterologous species is poor. As a first step toward the development of a broad specificity Eimeria vaccine, this study was designed to assess a purified recombinant protein from Eimeria maxima gametocytes (Gam82) in stimulating immunity against experimental infection with live parasites. Following Gam82 intramuscular immunization and oral parasite challenge, body weight gain, fecal oocyst output, lesion scores, serum antibody response, and cytokine production were assessed to evaluate vaccination efficacy. Animals vaccinated with Gam82 and challenged with E. maxima showed lower oocyst shedding and reduced intestinal pathology compared with non-vaccinated and parasite-challenged animals. Gam82 vaccination also stimulated the production of antigen-specific serum antibodies and induced greater levels of IL-2 and IL-15 mRNAs compared with non-vaccinated controls. These results demonstrate that the Gam82 recombinant protein protects against E. maxima and augments humoral and cell-mediated immunity. Published by Elsevier Ltd.

  14. [IMMUNE SYSTEM INTERNSHIP WITH SYMBIOTIC MICROORGANISMS IN GNOTOBIOTIC ANIMAL'S INTESTINUM ILEUM].

    PubMed

    Kochlamasashvili, B; Gogiashvili, L; Jandieri, K

    2017-11-01

    Structures, responsible for acceptive (comensaling relation) and protective (pathogenic defense) immunity, were studied and compared in small intestine - to ileum mucosa. Data shown, that main application of the both domains of immune system is to support the correlation between body and foreign microbes, but they response is different. Most significant differences are as follows: in acceptive reactions presented only in aseptic animals - gnotobionts, inflammatory changes absent, so immune reaction complex develops into physiological condition. Symbiotic reactions release in mucosa epithelial cells, also in cells, responsible for adaptive and congenital immune reactivity. Thus, acceptive immune reactions contribute symbiotic biocenosis versus elimination; which is function of protective immunity.

  15. Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis.

    PubMed

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K; Joshi, Amritanshu B; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D; KuKuruga, Mark A; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L

    2016-08-01

    Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice.

  16. Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis

    PubMed Central

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Joshi, Amritanshu B.; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D.; KuKuruga, Mark A.; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L.

    2016-01-01

    Background Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Methodology Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Conclusions Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice. PMID:27580076

  17. Insect immunity shows specificity in protection upon secondary pathogen exposure.

    PubMed

    Sadd, Ben M; Schmid-Hempel, Paul

    2006-06-20

    Immunological memory in vertebrates, conferring lasting specific protection after an initial pathogen exposure, has implications for a broad spectrum of evolutionary, epidemiological, and medical phenomena . However, the existence of specificity in protection upon secondary pathogen exposure in invertebrates remains controversial . To separate this functional phenomenon from a particular mechanism, we refer to it as specific immune priming. We investigate the presence of specific immune priming in workers of the social insect Bombus terrestris. Using three bacterial pathogens, we test whether a prior homologous pathogen exposure gives a benefit in terms of long-term protection against a later challenge, over and above a heterologous combination. With a reciprocally designed initial and second-exposure protocol (i.e., all combinations of bacteria were tested), we demonstrate, even several weeks after the clearance of a first exposure, increased protection and narrow specificity upon secondary exposure. This demonstrates that the invertebrate immune system is functionally capable of unexpectedly specific and durable induced protection. Ultimately, despite general broad differences between vertebrates and invertebrates, the ability of both immune systems to show specificity in protection suggests that their immune defenses have found comparable solutions to similar selective pressures over evolutionary time.

  18. Evaluation of lipopolysaccharide and capsular polysaccharide as subunit vaccines against experimental melioidosis.

    PubMed

    Nelson, Michelle; Prior, Joann L; Lever, M Stephen; Jones, Helen E; Atkins, Timothy P; Titball, Richard W

    2004-12-01

    Burkholderia pseudomallei is the causative agent of melioidosis, which is a major cause of morbidity and mortality in endemic regions. Currently there is no human vaccine against melioidosis. In this study, LPS or capsular polysaccharide was used to immunize BALB/c mice. The different polysaccharide antigens induced antibody responses. Mice vaccinated with LPS developed predominantly IgM and IgG3 responses. Contrastingly, mice vaccinated with capsular polysaccharide developed a predominantly IgG2b response. After immunization, mice were challenged by the intra-peritoneal route and an increased mean time to death was observed compared with unvaccinated controls. Immunization with LPS provided an optimal protective response. Mice challenged by the aerosol route showed a small increase in the mean time to death compared with the unvaccinated controls. The passive transfer of antigen from immunized into naive mice provided protection against a subsequent challenge. This study is the first time antigens protective by active immunization have been identified and suggests that polysaccharides have potential as vaccine candidates against melioidosis.

  19. RGD capsid modification enhances mucosal protective immunity of a non-human primate adenovirus vector expressing Pseudomonas aeruginosa OprF

    PubMed Central

    Krause, A; Whu, W Z; Qiu, J; Wafadari, D; Hackett, N R; Sharma, A; Crystal, R G; Worgall, S

    2013-01-01

    Replication-deficient adenoviral (Ad) vectors of non-human serotypes can serve as Ad vaccine platforms to circumvent pre-existing anti-human Ad immunity. We found previously that, in addition to that feature, a non-human primate-based AdC7 vector expressing outer membrane protein F of P. aeruginosa (AdC7OprF) was more potent in inducing lung mucosal and protective immunity compared to a human Ad5-based vector. In this study we analysed if genetic modification of the AdC7 fibre to display an integrin-binding arginine–glycine–aspartic acid (RGD) sequence can further enhance lung mucosal immunogenicity of AdC7OprF. Intratracheal immunization of mice with either AdC7OprF.RGD or AdC7OprF induced robust serum levels of anti-OprF immunoglobulin (Ig)G up to 12 weeks that were higher compared to immunization with the human vectors Ad5OprF or Ad5OprF.RGD. OprF-specific cellular responses in lung T cells isolated from mice immunized with AdC7OprF.RGD and AdC7OprF were similar for T helper type 1 (Th1) [interferon (IFN)-γ in CD8+ and interleukin (IL)-12 in CD4+], Th2 (IL-4, IL-5 and IL-13 in CD4+) and Th17 (IL-17 in CD4+). Interestingly, AdC7OprF.RGD induced more robust protective immunity against pulmonary infection with P. aeruginosa compared to AdC7OprF or the control Ad5 vectors. The enhanced protective immunity induced by AdC7OprF.RGD was maintained in the absence of alveolar macrophages (AM) or CD1d natural killer T cells. Together, the data suggest that addition of RGD to the fibre of an AdC7-based vaccine is useful to enhance its mucosal protective immunogenicity. PMID:23607394

  20. Effect of different forms of adenylate cyclase toxin of Bordetella pertussis on protection afforded by an acellular pertussis vaccine in a murine model.

    PubMed

    Cheung, Gordon Y C; Xing, Dorothy; Prior, Sandra; Corbel, Michael J; Parton, Roger; Coote, John G

    2006-12-01

    Four recombinant forms of the cell-invasive adenylate cyclase toxin (CyaA) of Bordetella pertussis were compared for the ability to enhance protection against B. pertussis in mice when coadministered with an acellular pertussis vaccine (ACV). The four forms were as follows: fully functional CyaA, a CyaA form lacking adenylate cyclase enzymatic activity (CyaA*), and the nonacylated forms of these toxins, i.e., proCyaA and proCyaA*, respectively. None of these forms alone conferred significant (P > 0.05) protection against B. pertussis in a murine intranasal challenge model. Mice immunized with ACV alone showed significant (P < 0.05) reductions in bacterial numbers in the lungs after intranasal challenge compared with those for control mice. When administered with ACV, both CyaA and CyaA* further reduced bacterial numbers in the lungs of mice after intranasal challenge compared with those for ACV-immunized mice, but the enhanced protection was only significant (P < 0.05) with CyaA*. Coadministration of CyaA* with ACV caused a significant (P < 0.05) increase in immunoglobulin G2a antibody levels against pertactin compared with those in mice immunized with ACV alone. Spleen cells from mice immunized with ACV plus CyaA* secreted larger amounts of interleukin-5 (IL-5), IL-6, gamma interferon (IFN-gamma), and granulocyte-macrophage colony-stimulating factor (GM-CSF) than did cells from mice immunized with ACV plus CyaA or ACV alone after stimulation in vitro with a mixture of B. pertussis antigens. Spleen cells from mice immunized with ACV plus CyaA* also secreted larger amounts of IFN-gamma and GM-CSF than did cells from mice immunized with CyaA* alone after stimulation in vitro with CyaA*. Macrophages from mice immunized with ACV plus CyaA* produced significantly (P < 0.05) higher levels of nitric oxide than did macrophages from mice immunized with CyaA* alone, ACV alone, or ACV plus CyaA after stimulation in vitro with a mixture of B. pertussis antigens or heat-killed B. pertussis cells. These data suggest that the enhancement of protection provided by CyaA* was due to an augmentation of both Th1 and Th2 immune responses to B. pertussis antigens.

  1. Protective Efficacy of Plasmodium vivax Radiation-Attenuated Sporozoites in Colombian Volunteers: A Randomized Controlled Trial

    PubMed Central

    Arévalo-Herrera, Myriam; Vásquez-Jiménez, Juan M.; Lopez-Perez, Mary; Vallejo, Andrés F.; Amado-Garavito, Andrés B.; Céspedes, Nora; Castellanos, Angélica; Molina, Karen; Trejos, Johanna; Oñate, José; Epstein, Judith E.; Richie, Thomas L.; Herrera, Sócrates

    2016-01-01

    Background Immunizing human volunteers by mosquito bite with radiation-attenuated Plasmodium falciparum sporozoites (RAS) results in high-level protection against infection. Only two volunteers have been similarly immunized with P. vivax (Pv) RAS, and both were protected. A phase 2 controlled clinical trial was conducted to assess the safety and protective efficacy of PvRAS immunization. Methodology/Principal Findings A randomized, single-blinded trial was conducted. Duffy positive (Fy+; Pv susceptible) individuals were enrolled: 14 received bites from irradiated (150 ± 10 cGy) Pv-infected Anopheles mosquitoes (RAS) and 7 from non-irradiated non-infected mosquitoes (Ctl). An additional group of seven Fy- (Pv refractory) volunteers was immunized with bites from non-irradiated Pv-infected mosquitoes. A total of seven immunizations were carried out at mean intervals of nine weeks. Eight weeks after last immunization, a controlled human malaria infection (CHMI) with non-irradiated Pv-infected mosquitoes was performed. Nineteen volunteers completed seven immunizations (12 RAS, 2 Ctl, and 5 Fy-) and received a CHMI. Five of 12 (42%) RAS volunteers were protected (receiving a median of 434 infective bites) compared with 0/2 Ctl. None of the Fy- volunteers developed infection by the seventh immunization or after CHMI. All non-protected volunteers developed symptoms 8–13 days after CHMI with a mean pre-patent period of 12.8 days. No serious adverse events related to the immunizations were observed. Specific IgG1 anti-PvCS response was associated with protection. Conclusion Immunization with PvRAS was safe, immunogenic, and induced sterile immunity in 42% of the Fy+ volunteers. Moreover, Fy- volunteers were refractory to Pv malaria. Trial registration Identifier: NCT01082341. PMID:27760143

  2. Protective Efficacy of Plasmodium vivax Radiation-Attenuated Sporozoites in Colombian Volunteers: A Randomized Controlled Trial.

    PubMed

    Arévalo-Herrera, Myriam; Vásquez-Jiménez, Juan M; Lopez-Perez, Mary; Vallejo, Andrés F; Amado-Garavito, Andrés B; Céspedes, Nora; Castellanos, Angélica; Molina, Karen; Trejos, Johanna; Oñate, José; Epstein, Judith E; Richie, Thomas L; Herrera, Sócrates

    2016-10-01

    Immunizing human volunteers by mosquito bite with radiation-attenuated Plasmodium falciparum sporozoites (RAS) results in high-level protection against infection. Only two volunteers have been similarly immunized with P. vivax (Pv) RAS, and both were protected. A phase 2 controlled clinical trial was conducted to assess the safety and protective efficacy of PvRAS immunization. A randomized, single-blinded trial was conducted. Duffy positive (Fy+; Pv susceptible) individuals were enrolled: 14 received bites from irradiated (150 ± 10 cGy) Pv-infected Anopheles mosquitoes (RAS) and 7 from non-irradiated non-infected mosquitoes (Ctl). An additional group of seven Fy- (Pv refractory) volunteers was immunized with bites from non-irradiated Pv-infected mosquitoes. A total of seven immunizations were carried out at mean intervals of nine weeks. Eight weeks after last immunization, a controlled human malaria infection (CHMI) with non-irradiated Pv-infected mosquitoes was performed. Nineteen volunteers completed seven immunizations (12 RAS, 2 Ctl, and 5 Fy-) and received a CHMI. Five of 12 (42%) RAS volunteers were protected (receiving a median of 434 infective bites) compared with 0/2 Ctl. None of the Fy- volunteers developed infection by the seventh immunization or after CHMI. All non-protected volunteers developed symptoms 8-13 days after CHMI with a mean pre-patent period of 12.8 days. No serious adverse events related to the immunizations were observed. Specific IgG1 anti-PvCS response was associated with protection. Immunization with PvRAS was safe, immunogenic, and induced sterile immunity in 42% of the Fy+ volunteers. Moreover, Fy- volunteers were refractory to Pv malaria. Identifier: NCT01082341.

  3. Phytol-based novel adjuvants in vaccine formulation: 2. Assessment of efficacy in the induction of protective immune responses to lethal bacterial infections in mice.

    PubMed

    Lim, So-Yon; Bauermeister, Adam; Kjonaas, Richard A; Ghosh, Swapan K

    2006-10-23

    Adjuvants are known to significantly enhance vaccine efficacy. However, commercial adjuvants often have limited use because of toxicity in humans. The objective of this study was to determine the comparative effectiveness of a diterpene alcohol, phytol and its hydrogenated derivative PHIS-01, relative to incomplete Freund's adjuvant (IFA), a commonly used adjuvant in augmenting protective immunity in mice against E. coli and S. aureus, and in terms of inflammatory cytokines. Vaccines, consisting of heat-attenuated E. coli or S. aureus and either of the two phytol-based adjuvants or IFA, were tested in female BALB/c mice. The vaccines were administered intraperitoneally at 10-day intervals. The efficacy of the phytol and PHIS-01, as compared to IFA, was assessed by ELISA in terms of anti-bacterial antibody and inflammatory cytokines. We also examined the ability of the vaccines to induce specific protective immunity by challenging mice with different doses of live bacteria. IFA, phytol, and PHIS-01 were equally efficient in evoking anti-E. coli antibody response and in providing protective immunity against live E. coli challenges. In contrast, the antibody response to S. aureus was significant when PHIS-01 was used as the adjuvant. However, in terms of the ability to induce protective immunity, phytol was most effective against S. aureus. Moreover, during challenges with live E. coli and S. aureus immune mice produced much less IL-6, the mediators of fatal septic shock syndromes. Our results show that vaccine formulations containing phytol and PHIS-01 as adjuvants confer a robust and protective immunity against both Gram-negative and Gram-positive bacteria without inducing adverse inflammatory cytokine due to IL-6.

  4. Live Attenuated Leishmania donovani Centrin Gene-Deleted Parasites Induce IL-23-Dependent IL-17-Protective Immune Response against Visceral Leishmaniasis in a Murine Model.

    PubMed

    Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L

    2018-01-01

    No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.

  5. T lymphocyte-mediated protection against Pseudomonas aeruginosa infection in granulocytopenic mice.

    PubMed Central

    Powderly, W G; Pier, G B; Markham, R B

    1986-01-01

    BALB/c mice immunized with Pseudomonas aeruginosa immunotype 1 polysaccharide develop protective T cell immunity to bacterial challenge. In vitro, T cells from immunized mice kill P. aeruginosa by production of a bactericidal lymphokine. The present study demonstrates that adoptive transfer of T cells from immunized BALB/c mice to granulocytopenic mice resulted in 97% survival on challenge with P. aeruginosa, compared with 17% survival with adoptive transfer of T cells from nonimmune BALB/c mice. This protection is specifically elicited by reexposure to the original immunizing antigen; adoptive recipients cannot withstand challenge with immunotype 3 P. aeruginosa. However, the adoptive recipients do survive simultaneous infection with both P. aeruginosa immunotypes 1 and 3. Adoptive transfer of T cells from the congenic CB.20 mice, which are unable to kill P. aeruginosa in vitro, provides only 20% protection to granulocytopenic mice. These studies indicate that transfer of specific immune T lymphocytes can significantly enhance the resistance to P. aeruginosa infection in granulocytopenic mice. PMID:2426306

  6. Interaction Between 2 Nutraceutical Treatments and Host Immune Status in the Pediatric Critical Illness Stress-Induced Immune Suppression Comparative Effectiveness Trial.

    PubMed

    Carcillo, Joseph A; Dean, J Michael; Holubkov, Richard; Berger, John; Meert, Kathleen L; Anand, Kanwaljeet J S; Zimmerman, Jerry J; Newth, Christopher J L; Harrison, Rick; Burr, Jeri; Willson, Douglas F; Nicholson, Carol; Bell, Michael J; Berg, Robert A; Shanley, Thomas P; Heidemann, Sabrina M; Dalton, Heidi; Jenkins, Tammara L; Doctor, Allan; Webster, Angie; Tamburro, Robert F

    2017-11-01

    The pediatric Critical Illness Stress-induced Immune Suppression (CRISIS) trial compared the effectiveness of 2 nutraceutical supplementation strategies and found no difference in the development of nosocomial infection and sepsis in the overall population. We performed an exploratory post hoc analysis of interaction between nutraceutical treatments and host immune status related to the development of nosocomial infection/sepsis. Children from the CRISIS trial were analyzed according to 3 admission immune status categories marked by decreasing immune competence: immune competent without lymphopenia, immune competent with lymphopenia, and previously immunocompromised. The comparative effectiveness of the 2 treatments was analyzed for interaction with immune status category. There were 134 immune-competent children without lymphopenia, 79 previously immune-competent children with lymphopenia, and 27 immunocompromised children who received 1 of the 2 treatments. A significant interaction was found between treatment arms and immune status on the time to development of nosocomial infection and sepsis ( P < .05) and on the rate of nosocomial infection and sepsis per 100 patient days ( P < .05). Whey protein treatment protected immune-competent patients without lymphopenia from infection and sepsis, both nutraceutical strategies were equivalent in immune-competent patients with lymphopenia, and zinc, selenium, glutamine, and metoclopramide treatment protected immunocompromised patients from infection and sepsis. The science of immune nutrition is more complex than previously thought. Future trial design should consider immune status at the time of trial entry because differential effects of nutraceuticals may be related to this patient characteristic.

  7. Cytokine and chemokine expression in the central nervous system associated with protective cell-mediated immunity against Cryptococcus neoformans.

    PubMed

    Uicker, William C; Doyle, Hester A; McCracken, James P; Langlois, Mary; Buchanan, Kent L

    2005-02-01

    Cryptococcus neoformans is a yeast that causes cryptococcosis, a life-threatening disease that develops following inhalation and dissemination of the organisms. C. neoformans has a predilection for the central nervous system (CNS) and mortality is most frequently associated with meningoencephalitis. Susceptibility to cryptococcosis is increased in patients with deficiencies in cell-mediated immunity (CMI). Because cryptococcal CNS infections are associated with mortality and diagnosis of cryptococcosis is often not made until after dissemination to the CNS, a better understanding of host defense mechanisms against C. neoformans in the CNS is needed to design improved therapies for immunocompromised individuals suffering from cryptococcosis. Using a mouse model, we previously described a protective cell-mediated immune response induced in the periphery that limited the growth of C. neoformans in the CNS. In the current investigation, we examined cytokine and chemokine expression in the CNS to identify factors important in achieving protective immunity. We observed increased expression of IL-1beta, TNF-alpha, IFN-gamma, MCP-1, RANTES, and IP-10 in C. neoformans-infected brains of immune mice compared to control mice suggesting that these cytokines and chemokines are associated with the protective immune response. Furthermore, the Th1-type cytokines TNF-alpha and IFN-gamma, but not the Th2 cytokines IL-4 and IL-5, were secreted at significantly higher levels in C. neoformans-infected brains of immune mice compared to control mice. Our results demonstrate that cytokines and chemokines associated with CMI are produced following infection in the CNS of immunized mice, and the expression of these factors correlates with protection against C. neoformans in the CNS.

  8. Intranasal immunization with novel EspA-Tir-M fusion protein induces protective immunity against enterohemorrhagic Escherichia coli O157:H7 challenge in mice.

    PubMed

    Lin, Ruqin; Zhu, Bo; Zhang, Yiduo; Bai, Yang; Zhi, Fachao; Long, Beiguo; Li, Yawen; Wu, Yuhua; Wu, Xianbo; Fan, Hongying

    2017-04-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Due to the risks associated with antibiotic treatment against EHEC O157:H7 infection, vaccines represent a promising method for prevention of EHEC O157:H7 infection. Therefore, we constructed the novel bivalent antigen EspA-Tir-M as a candidate EHEC O157:H7 subunit vaccine. We then evaluated the immunogenicity of this novel EHEC O157:H7 subunit vaccine. Immune responses to the fusion protein administered by intranasal and subcutaneous routes were compared in mice. Results showed higher levels of specific mucosal and systemic antibody responses induced by intranasal as compared to subcutaneous immunization. Intranasal immunization enhanced the concentration of interleukin-4, interleukin-10, and interferon-γ, while subcutaneous immunization enhanced only the latter two. In addition, intranasal immunization protected against EHEC O157:H7 colonization and infection in mice at a rate of 90%.Histopathological analysis revealed that vaccination reduced colon damage, especially when administered intranasally. In contrast, subcutaneous immunization elicited a weak immune response and exhibited a low protection rate. These findings demonstrate that intranasal immunization with the fusion protein induces both humoral and cellular immune (Th1/Th2) responses in mice. The novel EspA-Tir-M novel fusion protein therefore represents a promising subunit vaccine against EHEC O157:H7 infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Genetic immunization based on the ubiquitin-fusion degradation pathway against Trypanosoma cruzi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, Bin; Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582; Hiromatsu, Kenji, E-mail: khiromatsu@fukuoka-u.ac.jp

    2010-02-12

    Cytotoxic CD8{sup +} T cells are particularly important to the development of protective immunity against the intracellular protozoan parasite, Trypanosoma cruzi, the etiological agent of Chagas disease. We have developed a new effective strategy of genetic immunization by activating CD8{sup +} T cells through the ubiquitin-fusion degradation (UFD) pathway. We constructed expression plasmids encoding the amastigote surface protein-2 (ASP-2) of T. cruzi. To induce the UFD pathway, a chimeric gene encoding ubiquitin fused to ASP-2 (pUB-ASP-2) was constructed. Mice immunized with pUB-ASP-2 presented lower parasitemia and longer survival period, compared with mice immunized with pASP-2 alone. Depletion of CD8{sup +}more » T cells abolished protection against T. cruzi in mice immunized with pUB-ASP-2 while depletion of CD4{sup +} T cells did not influence the effective immunity. Mice deficient in LMP2 or LMP7, subunits of immunoproteasomes, were not able to develop protective immunity induced. These results suggest that ubiquitin-fused antigens expressed in antigen-presenting cells were effectively degraded via the UFD pathway, and subsequently activated CD8{sup +} T cells. Consequently, immunization with pUB-ASP-2 was able to induce potent protective immunity against infection of T. cruzi.« less

  10. Evaluation of immunogenicity and protective efficacy of adjuvanted Salmonella Typhimurium ghost vaccine against salmonellosis in chickens.

    PubMed

    Jawale, Chetan V; Lee, John Hwa

    2016-09-01

    Salmonella Typhimurium, a non-host-adapted Gram-negative intracellular pathogen, is capable of infecting a variety of animal hosts and humans. This study utilized the prime-booster immunization strategy using Salmonella Typhimurium-LTB (S. Typhimurium-LTB) ghost with the aim of inducing a robust immune response for the prevention of avian salmonellosis. In addition, the effect of Montanide(TM) ISA 70VG adjuvant on S. Typhimurium-LTB ghost vaccination was investigated. A total of 75 chickens were divided into three groups (n=25) for intramuscular immunization: group A (non-immunized control injected with sterile PBS), group B (immunized with S. Typhimurium-LTB ghost), and group C (immunized with S. Typhimurium-LTB ghost plus Montanide(TM) ISA70VG adjuvant). Compared with group A, the immunized chickens (groups B and C) exhibited increased titers of antigen specific plasma IgG and intestinal secretory IgA antibodies. In addition, group C showed enhanced induction of the humoral immune response compared to group B. The populations of splenic CD3+CD4+ and CD3+CD8+ T-cells increased significantly in both immunized groups. In addition, increased mRNA expression of the Th1 cytokines, IFN-γ, and IL-2 were observed in S. Typhimurium antigen-stimulated peripheral blood mononuclear cells from groups B and C chickens. Chickens from both vaccinated groups showed significant protection against virulent S. Typhimurium oral challenge compared to non-vaccinated chickens and a lower challenge strain count was recovered from the internal organs of group C. Injection of S. Typhimurium-LTB ghost with or without Montanide(TM) ISA70VG adjuvant is capable of inducing protective immunity against the virulent S. Typhimurium infection in chickens.

  11. Induction of Broad-Spectrum Protective Immunity against Disparate Cryptococcus Serotypes

    PubMed Central

    Van Dyke, Marley C. Caballero; Chaturvedi, Ashok K.; Hardison, Sarah E.; Leopold Wager, Chrissy M.; Castro-Lopez, Natalia; Hole, Camaron R.; Wozniak, Karen L.; Wormley, Floyd L.

    2017-01-01

    Cryptococcosis is a fungal disease caused by multiple Cryptococcus serotypes; particularly C. neoformans (serotypes A and D) and C. gattii (serotypes B and C). To date, there is no clinically available vaccine to prevent cryptococcosis. Mice given an experimental pulmonary vaccination with a C. neoformans serotype A strain engineered to produce interferon-γ, denoted H99γ, are protected against a subsequent otherwise lethal experimental infection with C. neoformans serotype A. Thus, we determined the efficacy of immunization with C. neoformans strain H99γ to elicit broad-spectrum protection in BALB/c mice against multiple disparate Cryptococcus serotypes. We observed significantly increased survival rates and significantly decreased pulmonary fungal burden in H99γ immunized mice challenged with Cryptococcus serotypes A, B, or D compared to heat-killed H99γ (HKH99γ) immunized mice. Results indicated that prolonged protection against Cryptococcus serotypes B or D in H99γ immunized mice was CD4+ T cell dependent and associated with the induction of predominantly Th1-type cytokine responses. Interestingly, immunization with H99γ did not elicit greater protection against challenge with the Cryptococcus serotype C tested either due to low overall virulence of this strain or enhanced capacity of this strain to evade host immunity. Altogether, these studies provide “proof-of-concept” for the development of a cryptococcal vaccine that provides cross-protection against multiple disparate serotypes of Cryptococcus. PMID:29163469

  12. TNF-dependent regulation and activation of innate immune cells are essential for host protection against cerebral tuberculosis.

    PubMed

    Francisco, Ngiambudulu M; Hsu, Nai-Jen; Keeton, Roanne; Randall, Philippa; Sebesho, Boipelo; Allie, Nasiema; Govender, Dhirendra; Quesniaux, Valerie; Ryffel, Bernhard; Kellaway, Lauriston; Jacobs, Muazzam

    2015-06-26

    Tuberculosis (TB) affects one third of the global population, and TB of the central nervous system (CNS-TB) is the most severe form of tuberculosis which often associates with high mortality. The pro-inflammatory cytokine tumour necrosis factor (TNF) plays a critical role in the initial and long-term host immune protection against Mycobacterium tuberculosis (M. tuberculosis) which involves the activation of innate immune cells and structure maintenance of granulomas. However, the contribution of TNF, in particular neuron-derived TNF, in the control of cerebral M. tuberculosis infection and its protective immune responses in the CNS were not clear. We generated neuron-specific TNF-deficient (NsTNF(-/-)) mice and compared outcomes of disease against TNF(f/f) control and global TNF(-/-) mice. Mycobacterial burden in brains, lungs and spleens were compared, and cerebral pathology and cellular contributions analysed by microscopy and flow cytometry after M. tuberculosis infection. Activation of innate immune cells was measured by flow cytometry and cell function assessed by cytokine and chemokine quantification using enzyme-linked immunosorbent assay (ELISA). Intracerebral M. tuberculosis infection of TNF(-/-) mice rendered animals highly susceptible, accompanied by uncontrolled bacilli replication and eventual mortality. In contrast, NsTNF(-/-) mice were resistant to infection and presented with a phenotype similar to that in TNF(f/f) control mice. Impaired immunity in TNF(-/-) mice was associated with altered cytokine and chemokine synthesis in the brain and characterised by a reduced number of activated innate immune cells. Brain pathology reflected enhanced inflammation dominated by neutrophil influx. Our data show that neuron-derived TNF has a limited role in immune responses, but overall TNF production is necessary for protective immunity against CNS-TB.

  13. Protective effect of a lipid-based preparation from Mycobacterium smegmatis in a murine model of progressive pulmonary tuberculosis.

    PubMed

    García, Maria de los Angeles; Borrero, Reinier; Lanio, Maria E; Tirado, Yanely; Alvarez, Nadine; Puig, Alina; Aguilar, Alicia; Canet, Liem; Mata Espinoza, Dulce; Barrios Payán, Jorge; Sarmiento, María Elena; Hernández-Pando, Rogelio; Norazmi, Mohd-Nor; Acosta, Armando

    2014-01-01

    A more effective vaccine against tuberculosis (TB) is urgently needed. Based on its high genetic homology with Mycobacterium tuberculosis (Mtb), the nonpathogenic mycobacteria, Mycobacterium smegmatis (Ms), could be an attractive source of potential antigens to be included in such a vaccine. We evaluated the capability of lipid-based preparations obtained from Ms to provide a protective response in Balb/c mice after challenge with Mtb H37Rv strain. The intratracheal model of progressive pulmonary TB was used to assess the level of protection in terms of bacterial load as well as the pathological changes in the lungs of immunized Balb/c mice following challenge with Mtb. Mice immunized with the lipid-based preparation from Ms either adjuvanted with Alum (LMs-AL) or nonadjuvanted (LMs) showed significant reductions in bacterial load (P < 0.01) compared to the negative control group (animals immunized with phosphate buffered saline (PBS)). Both lipid formulations showed the same level of protection as Bacille Calmette and Guerin (BCG). Regarding the pathologic changes in the lungs, mice immunized with both lipid formulations showed less pneumonic area when compared with the PBS group (P < 0.01) and showed similar results compared with the BCG group. These findings suggest the potential of LMs as a promising vaccine candidate against TB.

  14. Immune memory: the basics and how to trigger an efficient long-term immune memory.

    PubMed

    Beverley, P C L

    2010-01-01

    Immunological memory consists of expanded clones of T and B lymphocytes that show an increased rate of cell division and shortened telomeres compared with naïve cells. However, exhaustion of clones is delayed by kinetic heterogeneity within clones and altered survival and up-regulation of telomerase. Prolonged maintenance of protective B-cell immunity is T-cell dependent and requires a balance between plasma cells and memory B cells. Protective T-cell immunity also requires correct quality of T cells and that they are located appropriately. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. Clostridium perfringens beta toxin DNA prime-protein boost elicits enhanced protective immune response in mice.

    PubMed

    Solanki, Amit Kumar; Bhatia, Bharati; Kaushik, Himani; Deshmukh, Sachin K; Dixit, Aparna; Garg, Lalit C

    2017-07-01

    Clostridium perfringens beta toxin (CPB) is the primary pathogenic factor responsible for necrotic enteritis in sheep, cattle and humans. Owing to rapid progression of the disease, vaccination is the only possible recourse to avoid high mortality in animal farms and huge economic losses. The present study reports evaluation of a cpb gene-based DNA vaccine encoding the beta toxin of C. perfringens with homologous as well as heterologous booster strategy. Immunization strategy employing heterologous booster with heat-inactivated rCPB mounted stronger immune response when compared to that generated by homologous booster. Antibody isotyping and cytokine ELISA demonstrated the immune response to be Th1-biased mixed immune response. While moderate protection of immunized BALB/c and C57BL/6 mice against rCPB challenge was observed with homologous booster strategy, heterologous booster strategy led to complete protection. Thus, beta toxin-based DNA vaccine using the heterologous prime-boosting strategy was able to generate better immune response and conferred greater degree of protection against high of dose rCPB challenge than homologous booster regimen, making it an effective vaccination approach against C. perfringens beta toxin.

  16. Roads to the development of improved pertussis vaccines paved by immunology

    PubMed Central

    Brummelman, Jolanda; Wilk, Mieszko M.; Han, Wanda G.H.; van Els, Cécile A.C.M.; Mills, Kingston H.G.

    2015-01-01

    Current acellular pertussis vaccines have various shortcomings, which may contribute to their suboptimal efficacy and waning immunity in vaccinated populations. This calls for the development of new pertussis vaccines capable of inducing long-lived protective immunity. Immunization with whole cell pertussis vaccines and natural infection with Bordetella pertussis induce distinct and more protective immune responses when compared with immunization with acellular pertussis vaccines. Therefore, the immune responses induced with whole cell vaccine or after infection can be used as a benchmark for the development of third-generation vaccines against pertussis. Here, we review the literature on the immunology of B. pertussis infection and vaccination and discuss the lessons learned that will help in the design of improved pertussis vaccines. PMID:26347400

  17. DNA immunization against experimental genital herpes simplex virus infection.

    PubMed

    Bourne, N; Stanberry, L R; Bernstein, D I; Lew, D

    1996-04-01

    A nucleic acid vaccine, expressing the gene encoding herpes simplex virus (HSV) type 2 glycoprotein D (gD2) under control of the cytomegalovirus immediate-early gene promoter, was used to immunize guinea pigs against genital HSV-2 infection. The vaccine elicited humoral immune responses comparable to those seen after HSV-2 infection. Immunized animals exhibited protection from primary genital HSV-2 disease with little or no development of vesicular skin lesions and significantly reduced HSV-2 replication in the genital tract. After recovery from primary infection, immunized guinea pigs experienced significantly fewer recurrences and had significantly less HSV-2 genomic DNA detected in the sacral dorsal root ganglia compared with control animals. Thus, immunization reduced the burden of latent infection resulting from intravaginal HSV-2 challenge, and a nucleic acid vaccine expressing the HSV-2 gD2 antigen protected guinea pigs against genital herpes, limiting primary infection and reducing the magnitude of latent infection and the frequency of recurrent disease.

  18. A Burkholderia pseudomallei Outer Membrane Vesicle Vaccine Provides Cross Protection against Inhalational Glanders in Mice and Non-Human Primates.

    PubMed

    Baker, Sarah M; Davitt, Christopher J H; Motyka, Natalya; Kikendall, Nicole L; Russell-Lodrigue, Kasi; Roy, Chad J; Morici, Lisa A

    2017-12-09

    Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei . We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei . Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei- specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei -specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens.

  19. A Burkholderia pseudomallei Outer Membrane Vesicle Vaccine Provides Cross Protection against Inhalational Glanders in Mice and Non-Human Primates

    PubMed Central

    Davitt, Christopher J. H.; Motyka, Natalya; Kikendall, Nicole L.; Roy, Chad J.

    2017-01-01

    Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei. We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei. Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei-specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei-specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens. PMID:29232837

  20. Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

    PubMed Central

    Ascough, Stephanie; Paterson, Suzanna; Chiu, Christopher

    2018-01-01

    Respiratory syncytial virus (RSV) and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies) that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell generation and functionality. Here, we discuss the differences in clinical outcome and immune response following influenza and RSV. Specifically, we focus on differences in their recognition by innate immunity; the strategies used by each virus to evade these early immune responses; and effects across the innate-adaptive interface that may prevent long-lived memory generation. Thus, by comparing these globally important pathogens, we highlight mechanisms by which optimal antiviral immunity may be better induced and discuss the potential for these insights to inform novel vaccines. PMID:29552008

  1. Polyanhydride nanovaccine against swine influenza virus in pigs.

    PubMed

    Dhakal, Santosh; Goodman, Jonathan; Bondra, Kathryn; Lakshmanappa, Yashavanth S; Hiremath, Jagadish; Shyu, Duan-Liang; Ouyang, Kang; Kang, Kyung-Il; Krakowka, Steven; Wannemuehler, Michael J; Won Lee, Chang; Narasimhan, Balaji; Renukaradhya, Gourapura J

    2017-02-22

    We have recently demonstrated the effectiveness of an influenza A virus (IAV) subunit vaccine based on biodegradable polyanhydride nanoparticles delivery in mice. In the present study, we evaluated the efficacy of ∼200nm polyanhydride nanoparticles encapsulating inactivated swine influenza A virus (SwIAV) as a vaccine to induce protective immunity against a heterologous IAV challenge in pigs. Nursery pigs were vaccinated intranasally twice with inactivated SwIAV H1N2 (KAg) or polyanhydride nanoparticle-encapsulated KAg (KAg nanovaccine), and efficacy was evaluated against a heterologous zoonotic virulent SwIAV H1N1 challenge. Pigs were monitored for fever daily. Local and systemic antibody responses, antigen-specific proliferation of peripheral blood mononuclear cells, gross and microscopic lung lesions, and virus load in the respiratory tract were compared among the groups of animals. Our pre-challenge results indicated that KAg nanovaccine induced virus-specific lymphocyte proliferation and increased the frequency of CD4 + CD8αα + T helper and CD8 + cytotoxic T cells in peripheral blood mononuclear cells. KAg nanovaccine-immunized pigs were protected from fever following SwIAV challenge. In addition, pigs immunized with the KAg nanovaccine presented with lower viral antigens in lung sections and had 6 to 8-fold reduction in nasal shedding of SwIAV four days post-challenge compared to control animals. Immunologically, increased IFN-γ secreting T lymphocyte populations against both the vaccine and challenge viruses were detected in KAg nanovaccine-immunized pigs compared to the animals immunized with KAg alone. However, in the KAg nanovaccine-immunized pigs, hemagglutination inhibition, IgG and IgA antibody responses, and virus neutralization titers were comparable to that in the animals immunized with KAg alone. Overall, our data indicated that intranasal delivery of polyanhydride-based SwIAV nanovaccine augmented antigen-specific cellular immune response in pigs, with promise to induce cross-protective immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins

    PubMed Central

    2018-01-01

    ABSTRACT African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia virus boost. The responses in immunized pigs to these individual antigens were compared to identify the most immunogenic. Lethal challenge of pigs immunized with a pool of antigens resulted in reduced levels of virus in blood and lymph tissues compared to those in pigs immunized with control vectors. Novel immunogenic ASFV proteins have been identified for further testing as vaccine candidates. PMID:29386289

  3. Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins.

    PubMed

    Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K

    2018-04-15

    African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia virus boost. The responses in immunized pigs to these individual antigens were compared to identify the most immunogenic. Lethal challenge of pigs immunized with a pool of antigens resulted in reduced levels of virus in blood and lymph tissues compared to those in pigs immunized with control vectors. Novel immunogenic ASFV proteins have been identified for further testing as vaccine candidates. Copyright © 2018 Jancovich et al.

  4. Active immunity induced by passive IgG post-exposure protection against ricin.

    PubMed

    Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W; Hu, Wei-Gang

    2014-01-21

    Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab')2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab')2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab')2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab')2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection.

  5. Active Immunity Induced by Passive IgG Post-Exposure Protection against Ricin

    PubMed Central

    Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W.; Hu, Wei-Gang

    2014-01-01

    Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab’)2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab’)2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab’)2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab’)2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection. PMID:24451844

  6. The Immunomodulatory Role of Adjuvants in Vaccines Formulated with the Recombinant Antigens Ov-103 and Ov-RAL-2 against Onchocerca volvulus in Mice.

    PubMed

    Hess, Jessica A; Zhan, Bin; Torigian, April R; Patton, John B; Petrovsky, Nikolai; Zhan, Tingting; Bottazzi, Maria Elena; Hotez, Peter J; Klei, Thomas R; Lustigman, Sara; Abraham, David

    2016-07-01

    In some regions in Africa, elimination of onchocerciasis may be possible with mass drug administration, although there is concern based on several factors that onchocerciasis cannot be eliminated solely through this approach. A vaccine against Onchocerca volvulus would provide a critical tool for the ultimate elimination of this infection. Previous studies have demonstrated that immunization of mice with Ov-103 and Ov-RAL-2, when formulated with alum, induced protective immunity. It was hypothesized that the levels of protective immunity induced with the two recombinant antigens formulated with alum would be improved by formulation with other adjuvants known to enhance different types of antigen-specific immune responses. Immunizing mice with Ov-103 and Ov-RAL-2 in conjunction with alum, Advax 2 and MF59 induced significant levels of larval killing and host protection. The immune response was biased towards Th2 with all three of the adjuvants, with IgG1 the dominant antibody. Improved larval killing and host protection was observed in mice immunized with co-administered Ov-103 and Ov-RAL-2 in conjunction with each of the three adjuvants as compared to single immunizations. Antigen-specific antibody titers were significantly increased in mice immunized concurrently with the two antigens. Based on chemokine levels, it appears that neutrophils and eosinophils participate in the protective immune response induced by Ov-103, and macrophages and neutrophils participate in immunity induced by Ov-RAL-2. The mechanism of protective immunity induced by Ov-103 and Ov-RAL-2, with the adjuvants alum, Advax 2 and MF59, appears to be multifactorial with roles for cytokines, chemokines, antibody and specific effector cells. The vaccines developed in this study have the potential of reducing the morbidity associated with onchocerciasis in humans.

  7. Protective immunity against nervous necrosis virus in convict grouper Epinephelus septemfasciatus following vaccination with virus-like particles produced in yeast Saccharomyces cerevisiae.

    PubMed

    Wi, Ga Ram; Hwang, Jee Youn; Kwon, Mun-Gyeong; Kim, Hyoung Jin; Kang, Hyun Ah; Kim, Hong-Jin

    2015-05-15

    Infection with nervous necrosis virus (NNV) causes viral nervous necrosis, which inflicts serious economic losses in marine fish cultivation. Virus-like particles (VLPs) are protein complexes consisting of recombinant virus capsid proteins, whose shapes are similar to native virions. VLPs are considered a novel vaccine platform because they are not infectious and have the ability to induce neutralizing antibodies efficiently. However, there have been few studies of protective immune responses employing virus challenge following immunization with NNV VLPs, and this is important for evaluating the utility of the vaccine. In the present study, we produced red-spotted grouper (Epinephelus akaara) NNV (RGNNV) VLPs in Saccharomyces cerevisiae and investigated protective immune responses in convict grouper (Epinephelus septemfasciatus) following intraperitoneal injection and oral immunization with the RGNNV VLPs. The parenterally administered VLPs elicited neutralizing antibody with high efficacy, and provided the fish with full protection against RGNNV challenge: 100% of the immunized fish survived compared with only 37% of the control fish receiving phosphate-buffered saline. RGNNV VLPs administered orally provoked neutralizing antibody systemically and conferred protective immunity against virus challenge: however only 57% of the fish survived. Our results demonstrate that RGNNV VLP produced in yeast has great potential as vaccine in fish. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Analysis of immune responses in genital tracts of mice immunised with purified ribosomal fractions of Neisseria gonorrhoeae.

    PubMed Central

    Kita, E; Kashiba, S

    1984-01-01

    Immunisation of ddY mice with the purified ribosomal fraction of Neisseria gonorrhoeae was found to protect against intravaginal challenge with homologous organisms. This protection correlated with the presence of bactericidal antibody to purified ribosomal fraction in serum as well as in vaginal secretions. Analysis of the vaginal fluids from control mice and those immunised with purified ribosomal fraction showed that the enhanced elimination of gonococci in immune mice might be because of an early response of leucocytes generated by the reaction mediated by antibody and complement. Absorption studies showed that there was at least one major protective antigen in purified ribosomal fraction, other than cell surface substances such as lipopolysaccharide, outer membrane proteins, and pili. Bactericidal assays mediated by antibody and complement showed that matched samples of serum and vaginal fluid from immune mice had comparable gonococcidal activity, which was augmented by the effect of progesterone. Although delayed hypersensitivity was produced in immune mice that were resistant to N gonorrhoeae, the exact role of cellular immunity could not be clarified in this study. These results suggest that antibody to purified ribosomal fraction plays a major part in protection against gonococcal infection in the genital tract, and that such protection may entail both cellular immunity and hormonal changes. PMID:6430462

  9. Incorporation of a recombinant Eimeria maxima IMP1 antigen into nanoparticles confers protective immunity against E. Maxima challenge infection.

    PubMed

    Jenkins, Mark C; Stevens, Laura; O'Brien, Celia; Parker, Carolyn; Miska, Katrzyna; Konjufca, Vjollca

    2018-02-14

    The purpose of this study was to determine if conjugating a recombinant Eimeria maxima protein, namely EmaxIMP1, into 20 nm polystyrene nanoparticles (NP) could improve the level of protective immunity against E. maxima challenge infection. Recombinant EmaxIMP1 was expressed in Escherichia coli as a poly-His fusion protein, purified by NiNTA chromatography, and conjugated to 20 nm polystyrene NP (NP-EmaxIMP1). NP-EMaxIMP1 or control non-recombinant (NP-NR) protein were delivered per os to newly-hatched broiler chicks with subsequent booster immunizations at 3 and 21 days of age. In battery cage studies (n = 4), chickens immunized with NP-EMaxIMP1 displayed complete protection as measured by weight gain (WG) against E. maxima challenge compared to chickens immunized with NP-NR. WG in the NP-EMaxIMP1-immunized groups was identical to WG in chickens that were not infected with E. maxima infected chickens. In floor pen studies (n = 2), chickens immunized with NP-EMaxIMP1 displayed partial protection as measured by WG against E. maxima challenge compared to chickens immunized with NP-NR. In order to understand the basis for immune stimulation, newly-hatched chicks were inoculated per os with NP-EMaxIMP1 or NP-NR protein, and the small intestine, bursa, and spleen, were examined for NP localization at 1 h and 6 h post-inoculation. Within 1 h, both NP-EMaxIMP1 and NP-NR were observed in all 3 tissues. An increase was observed in the level of NP-EmaxIMP1 and NP-NR in all tissues at 6 h post-inoculation. These data indicate that 20 nm NP-EmaxIMP1 or NP-NR reached deeper tissues within hours of oral inoculation and elicited complete to partial immunity against E. maxima challenge infection. Published by Elsevier Ltd.

  10. Immunogenic and protective efficacy of recombinant protein GtxA-N against Gallibacterium anatis challenge in chickens.

    PubMed

    Pedersen, Ida J; Pors, Susanne E; Bager Skjerning, Ragnhild J; Nielsen, Søren S; Bojesen, Anders M

    2015-10-01

    Gallibacterium anatis is a major cause of reproductive tract infections in chickens. Here, we aimed to evaluate the efficacy of the recombinant protein GtxA-N at protecting hens, by addressing three objectives; (i) evaluating the antibody response following immunization (ii) scoring and comparing lesions, following challenge with G. anatis, in immunized and non-immunized hens and (iii) investigating if the anti-GtxA-N antibody titre in individual hens correlated with the observed lesions. Two consecutive experiments were performed in hens. In the first experiment hens were immunized with GtxA-N on day 0 and day 14, infected with G. anatis on day 28 and euthanized on day 56. The GtxA-N antibody response was assessed in pooled serum samples throughout the experiment, using an indirect enzyme-linked immunosorbent assay (ELISA). In the second experiment the GtxA-N antibody titres were assessed in individual hens before and after immunization. Subsequently, the hens were inoculated with G. anatis and finally all hens where euthanized and submitted for post mortem examination 48 h after inoculation. Immunization elicited strong antibody responses that lasted at least 8 weeks (P < .0001). The individual antibody titres observed in response to immunization varied considerably among hens (range: 174,100-281,500). Lesion scores following G. anatis infection were significantly lower in immunized hens compared to non-immunized hens (P = .004). Within the immunized group, no correlation was found between the individual antibody titres and the lesion scores. This study clearly demonstrated GtxA-N as a vaccine antigen able of inducing protective immunity against G. anatis.

  11. Immunity to tetanus and diphtheria in the UK in 2009.

    PubMed

    Wagner, Karen S; White, Joanne M; Andrews, Nick J; Borrow, Ray; Stanford, Elaine; Newton, Emma; Pebody, Richard G

    2012-11-19

    This study aimed to estimate the immunity of the UK population to tetanus and diphtheria, including the potential impact of new glycoconjugatate vaccines, and the addition of diphtheria to the school leaver booster in 1994. Residual sera (n=2697) collected in England in 2009/10 were selected from 18 age groups and tested for tetanus and diphtheria antibody. Results were standardised by testing a panel of sera (n=150) to enable comparison with a previously (1996) published serosurvey. Data were then standardised to the UK population. In 2009, 83% of the UK population were protected (≥0.1 IU/mL) against tetanus compared to 76% in 1996 (p=0.079), and 75% had at least basic protection against diphtheria (≥0.01 IU/mL) in 2009 compared to 60% in 1996 (p<0.001). Higher antibody levels were observed in those aged 1-3 years in 2009 compared to 1996 for both tetanus and diphtheria. Higher diphtheria immunity was observed in those aged 16-34 years in 2009 compared to 1996 (geometric mean concentration [GMC] 0.15 IU/mL vs. 0.03 IU/mL, p<0.001). Age groups with the largest proportion of susceptible individuals to both tetanus and diphtheria in 2009 were <1 year old (>29% susceptible), 45-69 years (>20% susceptible) and 70+ years (>32% susceptible). Low immunity was observed in those aged 10-11 years (>19% susceptible), between the scheduled preschool and school leaver booster administration. The current schedule appears to induce protective levels; increases in the proportions protected/GMCs were observed for the ages receiving vaccinations according to UK policy. Glycoconjugate vaccines appear to have increased immunity, in particular for diphtheria, in preschool age groups. Diphtheria immunity in teenagers and young adults has increased as a result of the addition of diphtheria to the school leaver booster. However, currently older adults remain susceptible, without any further opportunities for immunisations planned according to the present schedule. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. [Effect of immune modulation on immunogenic and protective activity of a live plague vaccine].

    PubMed

    Karal'nik, B V; Ponomareva, T S; Deriabin, P N; Denisova, T G; Mel'nikova, N N; Tugambaev, T I; Atshabar, B B; Zakarian, S B

    2014-01-01

    Comparative evaluation of the effect of polyoxidonium and betaleukin on immunogenic and protective activity of a live plague vaccine in model animal experiments. Plague vaccine EV, polyoxidonium, betaleukin, erythrocytic antigenic diagnosticum for determination of F1 antibodies and immune reagents for detection of lymphocytes with F1 receptors (LFR) in adhesive test developed by the authors were used. The experiments were carried out in 12 rabbits and 169 guinea pigs. Immune modulation accelerated the appearance and disappearance of LFR (early phase) and ensured a more rapid and intensive antibody formation (effector phase). Activation by betaleukin is more pronounced than by polyoxidonium. The more rapid and intensive was the development of early phase, the more effective was antibody response to the vaccine. Immune modulation in the experiment with guinea pigs significantly increased protective activity of the vaccine. The use of immune modulators increased immunogenic (in both early and effector phases of antigen-specific response) and protective activity of the EV vaccine. A connection between the acceleration of the first phase of antigen-specific response and general intensity of effector phase of immune response to the EV vaccine was detected. ,

  13. Immune signatures of protective spleen memory CD8 T cells.

    PubMed

    Brinza, Lilia; Djebali, Sophia; Tomkowiak, Martine; Mafille, Julien; Loiseau, Céline; Jouve, Pierre-Emmanuel; de Bernard, Simon; Buffat, Laurent; Lina, Bruno; Ottmann, Michèle; Rosa-Calatrava, Manuel; Schicklin, Stéphane; Bonnefoy, Nathalie; Lauvau, Grégoire; Grau, Morgan; Wencker, Mélanie; Arpin, Christophe; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline

    2016-11-24

    Memory CD8 T lymphocyte populations are remarkably heterogeneous and differ in their ability to protect the host. In order to identify the whole range of qualities uniquely associated with protective memory cells we compared the gene expression signatures of two qualities of memory CD8 T cells sharing the same antigenic-specificity: protective (Influenza-induced, Flu-TM) and non-protective (peptide-induced, TIM) spleen memory CD8 T cells. Although Flu-TM and TIM express classical phenotypic memory markers and are polyfunctional, only Flu-TM protects against a lethal viral challenge. Protective memory CD8 T cells express a unique set of genes involved in migration and survival that correlate with their unique capacity to rapidly migrate within the infected lung parenchyma in response to influenza infection. We also enlighten a new set of poised genes expressed by protective cells that is strongly enriched in cytokines and chemokines such as Ccl1, Ccl9 and Gm-csf. CCL1 and GM-CSF genes are also poised in human memory CD8 T cells. These immune signatures are also induced by two other pathogens (vaccinia virus and Listeria monocytogenes). The immune signatures associated with immune protection were identified on circulating cells, i.e. those that are easily accessible for immuno-monitoring and could help predict vaccines efficacy.

  14. Francisella tularensis Live Vaccine Strain deficient in capB and overexpressing the fusion protein of IglA, IglB, and IglC from the bfr promoter induces improved protection against F. tularensis respiratory challenge.

    PubMed

    Jia, Qingmei; Bowen, Richard; Lee, Bai-Yu; Dillon, Barbara Jane; Masleša-Galić, Saša; Horwitz, Marcus A

    2016-09-22

    A safer and more effective vaccine than the unlicensed Francisella tularensis Live Vaccine Strain (LVS) is needed to protect against the biowarfare agent F. tularensis. Previously, we developed an LVS ΔcapB mutant that is significantly safer than LVS and provides potent protective immunity against F. tularensis respiratory challenge when administered intranasally but limited protection when administered intradermally unless as part of a prime-boost vaccination strategy. To improve the immunogenicity and efficacy of LVS ΔcapB, we developed recombinant LVS ΔcapB (rLVS ΔcapB) strains overexpressing various F. tularensis Francisella Pathogenicity Island (FPI) proteins - IglA, IglB and IglC, and a fusion protein (IglABC) comprising immunodominant epitopes of IglA, IglB, and IglC downstream of different Francisella promoters, including the bacterioferritin (bfr) promoter. We show that rLVS ΔcapB/bfr-iglA, iglB, iglC, and iglABC express more IglA, IglB, IglC or IglABC than parental LVS ΔcapB in broth and in human macrophages, and stably express FPI proteins in macrophages and mice absent antibiotic selection. In response to IglC and heat-inactivated LVS, spleen cells from mice immunized intradermally with rLVS ΔcapB/bfr-iglC or bfr-iglABC secrete greater amounts of interferon-gamma and/or interleukin-17 than those from mice immunized with LVS ΔcapB, comparable to those from LVS-immunized mice. Mice immunized with rLVS ΔcapB/bfr-iglA, iglB, iglC or iglABC produce serum antibodies at levels similar to LVS-immunized mice. Mice immunized intradermally with rLVS ΔcapB/bfr-iglABC and challenged intranasally with virulent F. tularensis Schu S4 survive longer than sham- and LVS ΔcapB-immunized mice. Mice immunized intranasally with rLVS ΔcapB/bfr-iglABC - but not with LVS - just before or after respiratory challenge with F. tularensis Schu S4 are partially protected; protection is correlated with induction of a strong innate immune response. Thus, rLVS ΔcapB/bfr-iglABC shows improved immunogenicity and protective efficacy compared with parental LVS ΔcapB and, in contrast to LVS, has partial efficacy as immediate pre- and post-exposure prophylaxis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Oral immunization with hepatitis B surface antigen expressed in transgenic plants

    PubMed Central

    Kong, Qingxian; Richter, Liz; Yang, Yu Fang; Arntzen, Charles J.; Mason, Hugh S.; Thanavala, Yasmin

    2001-01-01

    Oral immunogenicity of recombinant hepatitis B surface antigen (HBsAg) derived from yeast (purified product) or in transgenic potatoes (uncooked unprocessed sample) was compared. An oral adjuvant, cholera toxin, was used to increase immune responses. Transgenic plant material containing HBsAg was the superior means of both inducing a primary immune response and priming the mice to respond to a subsequent parenteral injection of HBsAg. Electron microscopy of transgenic plant samples revealed evidence that the HBsAg accumulated intracellularly; we conclude that natural bioencapsulation of the antigen may provide protection from degradation in the digestive tract until plant cell degradation occurs near an immune effector site in the gut. The correlate of protection from hepatitis B virus infection is serum antibody titers induced by vaccination; the protective level in humans is 10 milliunits/ml or greater. Mice fed HBsAg-transgenic potatoes produced HBsAg-specific serum antibodies that exceeded the protective level and, on parenteral boosting, generated a strong long-lasting secondary antibody response. We have also shown the effectiveness of oral delivery by using a parenteral prime-oral boost immunization schedule. The demonstrated success of oral immunization for hepatitis B virus with an “edible vaccine” provides a strategy for contributing a means to achieve global immunization for hepatitis B prevention and eradication. PMID:11553782

  16. Characterization and storage of malaria antigens: Localization and chemical characterization of Plasmodium knowlesi schizont antigens

    PubMed Central

    Deans, J. A.; Cohen, S.

    1979-01-01

    The identification of malarial antigens that induce protective immunity could provide a rational basis for developing an effective antimalarial vaccine as well as specific serodiagnostic tests indicative of clinical immune status. Since protective immunity is probably induced by stage-dependent rather than stage-independent antigens, the antigenic composition of different stages of Plasmodium knowlesi has been compared, and a limited chemical characterization undertaken. This information should provide some insight into the types of preparative procedure appropriate for the purification of functionally important malarial antigens. PMID:120777

  17. Immunization with M2e-Displaying T7 Bacteriophage Nanoparticles Protects against Influenza A Virus Challenge

    PubMed Central

    Hashemi, Hamidreza; Pouyanfard, Somayeh; Bandehpour, Mojgan; Noroozbabaei, Zahra; Kazemi, Bahram; Saelens, Xavier; Mokhtari-Azad, Talat

    2012-01-01

    Considering the emergence of highly pathogenic influenza viruses and threat of worldwide pandemics, there is an urgent need to develop broadly-protective influenza vaccines. In this study, we demonstrate the potential of T7 bacteriophage-based nanoparticles with genetically fused ectodomain of influenza A virus M2 protein (T7-M2e) as a candidate universal flu vaccine. Immunization of mice with non-adjuvanted T7-M2e elicited M2e-specific serum antibody responses that were similar in magnitude to those elicited by M2e peptide administered in Freund’s adjuvant. Comparable IgG responses directed against T7 phage capsomers were induced following vaccination with wild type T7 or T7-M2e. T7-M2e immunization induced balanced amounts of IgG1 and IgG2a antibodies and these antibodies specifically recognized native M2 on the surface of influenza A virus-infected mammalian cells. The frequency of IFN-γ-secreting T cells induced by T7-M2e nanoparticles was comparable to those elicited by M2e peptide emulsified in Freund’s adjuvant. Emulsification of T7-M2e nanoparticles in Freund’s adjuvant, however, induced a significantly stronger T cell response. Furthermore, T7-M2e-immunized mice were protected against lethal challenge with an H1N1 or an H3N2 virus, implying the induction of hetero-subtypic immunity in our mouse model. T7-M2e-immunized mice displayed considerable weight loss and had significantly reduced viral load in their lungs compared to controls. We conclude that display of M2e on the surface of T7 phage nanoparticles offers an efficient and economical opportunity to induce cross-protective M2e-based immunity against influenza A. PMID:23029232

  18. Development of recombinant vaccine candidate molecule against Shigella infection.

    PubMed

    Chitradevi, S T S; Kaur, G; Sivaramakrishna, U; Singh, D; Bansal, A

    2016-10-17

    Shigellosis is an acute bacillary diarrheal disease caused by the gram negative bacillus Shigella. The existence of multiple Shigella serotypes and their growing resistance to antibiotics stress the urgent need for the development of vaccine that is protective across all serotypes. Shigella's IpaB antigen is involved in translocon pore formation, promotes bacterial invasion and induces apoptosis in macrophages. S. Typhi GroEL (Hsp 60) is the immunodominant antigen inducing both arms of immunity and has been explored as adjuvant in this study. The present study evaluates the immunogenicity and protective efficacy of recombinant IpaB domain-GroEL fusion protein in mice against lethal Shigella infection. The IpaB domain and GroEL genes were fused using overlap extension PCR and cloned in pRSETA expression vector. Fused gene was expressed in Escherichia coli BL-21 cells and the resulting 90 KDa fusion protein was purified by affinity chromatography. Intranasal (i.n.) immunization of mice with fusion protein increased the IgG and IgA antibody titers as compared to the group immunized with IpaB and GroEL and control PBS immunized group. Also IgG1 and IgG2a antibodies induced in fusion protein immunized mice were higher than co-immunized group. Significant increase in lymphocyte proliferation and cytokine levels (IFN-γ, IL-4 and IL-10), indicates induction of both Th1 and Th2 immune responses in both immunized groups. Immunization with fusion protein protected 90-95% of mice whereas 80-85% survivability was observed in co-immunized group against lethal challenge with S. flexneri, S. boydii and S. sonnei. Passive immunization conferred 60-70% protection in mice against all these Shigella species. Organ burden and histopathology studies also revealed significant decrease in lung infection as compared to the co-immunized group. Since IpaB is the conserved dominant molecule in all Shigella species, this study will lead to an ideal platform for the development of safe, efficacious and cost-effective recombinant vaccine against Shigella serotypes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Host Immune Response to Histophilus somni.

    PubMed

    Corbeil, Lynette B

    2016-01-01

    Histophilus somni is known to cause several overlapping syndromes or to be found in genital or upper respiratory carrier states in ruminants. Vaccines have been used for decades, yet efficacy is controversial and mechanisms of protective immunity are not well understood. Since H. somni survives phagocytosis, it has sometimes been considered to be a facultative intercellular parasite, implying that cell-mediated immunity would be critical in protection. However, H. somni not only inhibits phagocyte function, but also is cytotoxic for macrophages. Therefore, it does not live for long periods in healthy phagocytes. Protection of calves against H. somni pneumonia by passive immunization is also evidence that H. somni is more like an extracellular pathogen than an intracellular pathogen. Several studies showed that bovine IgG2 antibodies are more protective than IgG1 antibodies. Even the IgG2 allotypes tend to vary in protection. Of course, antigenic specificity also determines protection. So far, there is most evidence for protection by a 40 K outer membrane protein and by Immunoglobulin binding protein A fibrils. Serology and immunohistochemistry have both been used for immunodiagnosis. Many evasive mechanisms by H. somni have been defined, including decreased phagocyte function, antibodies bound by shed antigens, decreased immune stimulation, and antigenic variation. Interaction of H. somni with other bovine respiratory disease organisms is another layer of pathogenesis. Studies of bovine respiratory syncytial virus (BRSV) and H. somni in calfhood pneumonia revealed an increase in IgE antibodies to H. somni, which were associated with more severe disease of longer duration than with either agent alone. Innate immune mechanisms at the epithelial cell level are also affected by dual infection by BRSV and H. somni as compared to either pathogen alone. Although much more work needs to be done, the complex mechanisms of H. somni immunity are becoming clearer.

  20. A comparison of immunogenicity and protective immunity against experimental plague by intranasal and/or combined with oral immunization of mice with attenuated Salmonella serovar Typhimurium expressing secreted Yersinia pestis F1 and V antigen

    PubMed Central

    Liu, Wen-Tssann; Hsu, Hui-Ling; Liang, Chung-Chih; Chuang, Chuan-Chang; Lin, Huang-Chi; Liu, Yu-Tien

    2007-01-01

    We investigated the relative immunogenicity and protective efficacy of recombinant X85MF1 and X85V strains of ΔcyaΔcrpΔasd-attenuated Salmonella Typhimurium expressing, respectively, secreted Yersinia pestis F1 and V antigens, following intranasal (i.n.) or i.n. combined with oral immunization for a mouse model. A single i.n. dose of 108 CFU of X85MF1 or X85V induced appreciable serum F1- or V-specific IgG titres, although oral immunization did not. Mice i.n. immunized three times (i.n. × 3) with Salmonella achieved the most substantial F1/V-specific IgG titres, as compared with corresponding titres for an oral-primed, i.n.-boosted (twice; oral-i.n. × 2) immunization regimen. The level of V-specific IgG was significantly greater than that of F1-specific IgG (P<0.001). Analysis of the IgG antibodies subclasses revealed comparable levels of V-specific Th-2-type IgG1 and Th-1-type IgG2a, and a predominance of F1-specific Th-1-type IgG2a antibodies. In mice immunized intranasally, X85V stimulated a greater IL-10-secreting-cell response in the lungs than did X85MF1, but impaired the induction of gamma-interferon-secreting cells. A program of i.n. × 3 and/or oral-i.n. × 2 immunization with X85V provided levels of protection against a subsequent lethal challenge with Y. pestis, of, respectively, 60% and 20%, whereas 80% protection was provided following the same immunization but with X85MF1. PMID:17640293

  1. An Unmutated IgM Response to the Vi Polysaccharide of Salmonella Typhi Contributes to Protective Immunity in a Murine Model of Typhoid.

    PubMed

    Pandya, Kalgi D; Palomo-Caturla, Isabel; Walker, Justin A; K Sandilya, Vijay; Zhong, Zhijiu; Alugupalli, Kishore R

    2018-06-15

    T cell-dependent B cell responses typically develop in germinal centers. Abs generated during such responses are isotype switched and have a high affinity to the Ag because of somatic hypermutation of Ab genes. B cell responses to purified polysaccharides are T cell independent and do not result in the formation of bona fide germinal centers, and the dominant Ab isotype produced during such responses is IgM with very few or no somatic mutations. Activation-induced cytidine deaminase (AID) is required for both somatic hypermutation and Ig isotype switching in humans and mice. To test the extent to which unmutated polysaccharide-specific IgM confers protective immunity, we immunized wildtype and AID -/- mice with either heat-killed Salmonella enterica serovar Typhi ( S. Typhi) or purified Vi polysaccharide (ViPS). We found that wildtype and AID -/- mice immunized with heat-killed S. Typhi generated similar anti-ViPS IgM responses. As expected, wildtype, but not AID -/- mice generated ViPS-specific IgG. However, the differences in the Ab-dependent killing of S. Typhi mediated by the classical pathway of complement activation were not statistically significant. In ViPS-immunized wildtype and AID -/- mice, the ViPS-specific IgM levels and S. Typhi bactericidal Ab titers at 7 but not at 28 d postimmunization were also comparable. To test the protective immunity conferred by these immunizations, mice were challenged with a chimeric S. Typhimurium strain expressing ViPS. Compared with their naive counterparts, immunized wildtype and AID -/- mice exhibited significantly reduced bacterial burden regardless of the route of infection. These data indicate that an unmutated IgM response to ViPS contributes to protective immunity to S. Typhi. Copyright © 2018 by The American Association of Immunologists, Inc.

  2. DNA Vaccines - A Modern Gimmick or a Boon to Vaccinology?

    PubMed

    Manickan, Elanchezhiyan; Karem, Kevin L; Rouse, Barry T

    2017-01-01

    The reports in 1993 that naked DNA encoding viral genes conferred protective immunity came as a surprise to most vaccinologists. This review analyses the expanding number of examples where plasmid DNA induces immune responses. Issues such as the type of immunity induced, mechanisms of immune protection, and how DNA vaccines compare with other approaches are emphasized. Additional issues discussed include the likely means by which DNA vaccines induce CTL, how the potency and type of immunity induced can be modified, and whether DNA vaccines represent a practical means of manipulating unwanted immune response occurring during immunoinflammatory diseases. It seems doubtful if DNA vaccines will replace currently effective vaccines, but they may prove useful for prophylactic use against some agents that at present lack an effective vaccine. DNA vaccines promise to be valuable to manipulate the immune response in situations where responses to agents are inappropriate or ineffective.

  3. A prime-boost immunization regimen based on a simian adenovirus 36 vectored multi-stage malaria vaccine induces protective immunity in mice.

    PubMed

    Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

    2017-05-31

    Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Organism-Level Analysis of Vaccination Reveals Networks of Protection across Tissues.

    PubMed

    Kadoki, Motohiko; Patil, Ashwini; Thaiss, Cornelius C; Brooks, Donald J; Pandey, Surya; Deep, Deeksha; Alvarez, David; von Andrian, Ulrich H; Wagers, Amy J; Nakai, Kenta; Mikkelsen, Tarjei S; Soumillon, Magali; Chevrier, Nicolas

    2017-10-05

    A fundamental challenge in immunology is to decipher the principles governing immune responses at the whole-organism scale. Here, using a comparative infection model, we observe immune signal propagation within and between organs to obtain a dynamic map of immune processes at the organism level. We uncover two inter-organ mechanisms of protective immunity mediated by soluble and cellular factors. First, analyzing ligand-receptor connectivity across tissues reveals that type I IFNs trigger a whole-body antiviral state, protecting the host within hours after skin vaccination. Second, combining parabiosis, single-cell analyses, and gene knockouts, we uncover a multi-organ web of tissue-resident memory T cells that functionally adapt to their environment to stop viral spread across the organism. These results have implications for manipulating tissue-resident memory T cells through vaccination and open up new lines of inquiry for the analysis of immune responses at the organism level. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Recombinant vaccine displaying the loop-neutralizing determinant from protective antigen completely protects rabbits from experimental inhalation anthrax.

    PubMed

    Oscherwitz, Jon; Yu, Fen; Jacobs, Jana L; Cease, Kemp B

    2013-03-01

    We previously showed that a multiple antigenic peptide (MAP) vaccine displaying amino acids (aa) 304 to 319 from the 2β2-2β3 loop of protective antigen was capable of protecting rabbits from an aerosolized spore challenge with Bacillus anthracis Ames strain. Antibodies to this sequence, referred to as the loop-neutralizing determinant (LND), are highly potent at neutralizing lethal toxin yet are virtually absent in rabbit and human protective antigen (PA) antiserum. While the MAP vaccine was protective against anthrax, it contains a single heterologous helper T cell epitope which may be suboptimal for stimulating an outbred human population. We therefore engineered a recombinant vaccine (Rec-LND) containing two tandemly repeated copies of the LND fused to maltose binding protein, with enhanced immunogenicity resulting from the p38/P4 helper T cell epitope from Schistosoma mansoni. Rec-LND was found to be highly immunogenic in four major histocompatibility complex (MHC)-diverse strains of mice. All (7/7) rabbits immunized with Rec-LND developed high-titer antibody, 6 out of 7 developed neutralizing antibody, and all rabbits were protected from an aerosolized spore challenge of 193 50% lethal doses (LD(50)) of the B. anthracis Ames strain. Survivor serum from Rec-LND-immunized rabbits revealed significantly increased neutralization titers and specific activity compared to prechallenge levels yet lacked PA or lethal factor (LF) antigenemia. Control rabbits immunized with PA, which were also completely protected, appeared sterilely immune, exhibiting significant declines in neutralization titer and specific activity compared to prechallenge levels. We conclude that Rec-LND may represent a prototype anthrax vaccine for use alone or potentially combined with PA-containing vaccines.

  6. Immunization with Salmonella Enteritidis secreting mucosal adjuvant labile toxin confers protection against wild type challenge via augmentation of CD3+CD4+ T-cell proliferation and enhancement of IFN-γ, IL-6 and IL-10 expressions in chicken.

    PubMed

    Lalsiamthara, Jonathan; Lee, John Hwa

    2017-02-01

    The protective efficacy and immunological profiles of chickens immunized with an attenuated Salmonella Enteritidis (SE) constitutively secreting double mutant heat labile enterotoxin (dmLT) were investigated. The dmLT is a detoxified variant of Escherichia coli heat labile toxin and is a potent mucosal adjuvant capable of inducing both humoral and cell-mediated immunity. In this study, four-week-old chickens were inoculated with SE-dmLT strain JOL1641, parental SE strain JOL1087 or phosphate buffered saline control. Peripheral blood mononuclear cells of SE-dmLT inoculated birds showed significant proliferation upon stimulation with SE antigens as compared to the control and JOL1087 groups (P⩽0.05). One week post-challenge, the ratio of CD3 + CD4 + to CD3 + CD8 + T-cells showed a significant increase in the immunized groups. Significant increases in IFN-γ levels were observed in JOL1641 birds immunized via oral and intramuscular routes. While immunizations with the JOL1087 strain via the intramuscular route also induced significant increases in IFN-γ, immunization via the oral route did not trigger significant changes. Pro-inflammatory cytokine IL-6 was also elevated significantly in immunized birds; a significant elevation of IL-10 was observed only in oral immunization with JOL1641 (P⩽0.05). JOL1641 immunized birds showed significant reduction of challenge bacterial-organ recovery as compared to JOL1087 and non-immunized birds. Collectively, our results revealed that immunization with the adjuvant-secreting S. Enteritidis confers protection against wild type SE challenge via induction of strong cell proliferative response, augmentation of CD3 + CD4 + : CD3 + CD8 + T-cells ratio and enhancement of IFN-γ, IL-6 and IL-10 cytokine secretion. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Saccharomyces cerevisiae expressing Gp43 protects mice against Paracoccidioides brasiliensis infection.

    PubMed

    Assis-Marques, Mariana Aprigio; Oliveira, Aline Ferreira; Ruas, Luciana Pereira; dos Reis, Thaila Fernanda; Roque-Barreira, Maria Cristina; Coelho, Paulo Sergio Rodrigues

    2015-01-01

    The dimorphic fungus Paracoccidioides brasiliensis is the etiological agent of paracoccidioidomycosis (PCM). It is believed that approximately 10 million people are infected with the fungus and approximately 2% will eventually develop the disease. Unlike viral and bacterial diseases, fungal diseases are the ones against which there is no commercially available vaccine. Saccharomyces cerevisiae may be a suitable vehicle for immunization against fungal infections, as they require the stimulation of different arms of the immune response. Here we evaluated the efficacy of immunizing mice against PCM by using S. cerevisiae yeast expressing gp43. When challenged by inoculation of P. brasiliensis yeasts, immunized animals showed a protective profile in three different assays. Their lung parenchyma was significantly preserved, exhibiting fewer granulomas with fewer fungal cells than found in non-immunized mice. Fungal burden was reduced in the lung and spleen of immunized mice, and both organs contained higher levels of IL-12 and IFN-γ compared to those of non-vaccinated mice, a finding that suggests the occurrence of Th1 immunity. Taken together, our results indicate that the recombinant yeast vaccine represents a new strategy to confer protection against PCM.

  8. Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C

    PubMed Central

    Rezvan, H; Rees, R; Ali, SA

    2011-01-01

    Background Leishmaniasis is a worldwide disease prevalent in tropical and sub tropical countries. Many attempts have been made and different strategies have been approached to develop a potent vaccine against Leishmania. DNA immunisation is a method, which is shown to be effective in Leishmania vaccination. Leishmania Soluble Antigen (SLA) has also recently been used Leishmania vaccination. Methods The immunity generated by SLA and L. mexicana gp63 cDNA was compared in groups of 6 mice, which were statistically analysed by student t- test with the P-value of 0.05. SLA was administered by two different methods; intramuscular injection and injection of dendritic cells (DCs) loaded with SLA. L. mexicana gp63 cDNA was administered by the gene gun. Results Immunisation of BALB/c mice with L. mexicana gp63 resulted in high levels of Th1-type immune response and cytotoxic T lymphocytes (CTL) activity, which were accompanied with protection induced by the immunisation against L. mexicana infection. In contrast, administration of SLA, produced a mixed Th1/Th2-type immune responses as well as a high level of CTL activity but did not protect mice from the infection. Conclusion The results indicate higher protection by DNA immunisation using L. mexicana gp63 cDNA compared to SLA, which is accompanied by a high level of Th1 immune response. However, the CTL activity does not necessarily correlate with the protection induced by the vaccine. Also, gene gun immunisation is a potential approach in Leishmania vaccination. These findings would be helpful in opening new windows in Leishmania vaccine research. PMID:22347315

  9. Protective role of adenylate cyclase in the context of a live pertussis vaccine candidate.

    PubMed

    Lim, Annabelle; Ng, Jowin K W; Locht, Camille; Alonso, Sylvie

    2014-01-01

    Despite high vaccination coverage, pertussis remains an important respiratory infectious disease and the least-controlled vaccine-preventable infectious disease in children. Natural infection with Bordetella pertussis is known to induce strong and long-lasting immunity that wanes later than vaccine-mediated immunity. Therefore, a live attenuated B. pertussis vaccine, named BPZE1, has been developed and has recently completed a phase I clinical trial in adult human volunteers. In this study, we investigated the contribution of adenylate cyclase (CyaA) in BPZE1-mediated protection against pertussis. A CyaA-deficient BPZE1 mutant was thus constructed. Absence of CyaA did not compromise the adherence properties of the bacteria onto mammalian cells. However, the CyaA-deficient mutant displayed a slight impairment in the ability to survive within macrophages compared to the parental BPZE1 strain. In vivo, whereas the protective efficacy of the CyaA-deficient mutant was comparable to the parental strain at a vaccine dose of 5 × 10(5) colony forming units (CFU), it was significantly impaired at a vaccine dose of 5 × 10(3) CFU. This impairment correlated with impaired lung colonization ability, and impaired IFN-γ production in the animal immunized with the CyaA-deficient BPZE1 mutant while the pertussis-specific antibody profile and Th17 response were comparable to those observed in BPZE1-immunized mice. Our findings thus support a role of CyaA in BPZE1-mediated protection through induction of cellular mediated immunity. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Induction of Protective Immunity against Eimeria tenella, Eimeria maxima, and Eimeria acervulina Infections Using Dendritic Cell-Derived Exosomes

    PubMed Central

    Gallego, Margarita; Lee, Sung Hyen; Lillehoj, Hyun Soon; Quilez, Joaquin; Lillehoj, Erik P.; Sánchez-Acedo, Caridad

    2012-01-01

    This study describes a novel immunization strategy against avian coccidiosis using exosomes derived from Eimeria parasite antigen (Ag)-loaded dendritic cells (DCs). Chicken intestinal DCs were isolated and pulsed in vitro with a mixture of sporozoite-extracted Ags from Eimeria tenella, E. maxima, and E. acervulina, and the cell-derived exosomes were isolated. Chickens were nonimmunized or immunized intramuscularly with exosomes and subsequently noninfected or coinfected with E. tenella, E. maxima, and E. acervulina oocysts. Immune parameters compared among the nonimmunized/noninfected, nonimmunized/infected, and immunized/infected groups were the numbers of cells secreting Th1 cytokines, Th2 cytokines, interleukin-16 (IL-16), and Ag-reactive antibodies in vitro and in vivo readouts of protective immunity against Eimeria infection. Cecal tonsils, Peyer's patches, and spleens of immunized and infected chickens had increased numbers of cells secreting the IL-16 and the Th1 cytokines IL-2 and gamma interferon, greater Ag-stimulated proliferative responses, and higher numbers of Ag-reactive IgG- and IgA-producing cells following in vitro stimulation with the sporozoite Ags compared with the nonimmunized/noninfected and nonimmunized/infected controls. In contrast, the numbers of cells secreting the Th2 cytokines IL-4 and IL-10 were diminished in immunized and infected chickens compared with the nonimmunized/noninfected and the nonimmunized/infected controls. Chickens immunized with Ag-loaded exosomes and infected in vivo with Eimeria oocysts had increased body weight gains, reduced feed conversion ratios, diminished fecal oocyst shedding, lessened intestinal lesion scores, and reduced mortality compared with the nonimmunized/infected controls. These results suggest that successful field vaccination against avian coccidiosis using exosomes derived from DCs incubated with Ags isolated from Eimeria species may be possible. PMID:22354026

  11. Extracellular Superoxide Dismutase Inhibits Innate Immune Responses and Clearance of an Intracellular Bacterial Infection

    PubMed Central

    Break, Timothy J.; Jun, Sujung; Indramohan, Mohanalaxmi; Carr, Karen D.; Sieve, Amy N.; Dory, Ladislav; Berg, Rance E.

    2012-01-01

    Reactive oxygen and nitrogen species (ROS/RNS) play important roles during immune responses to bacterial pathogens. Extracellular superoxide dismutase (ecSOD) regulates extracellular concentrations of ROS/RNS and contributes to tissue protection during inflammatory insults. The participation of ecSOD in immune responses seems therefore intuitive, yet is poorly understood. In the present study, we utilized mice with varying levels of ecSOD activity to investigate the involvement of this enzyme in immune responses against Listeria monocytogenes. Surprisingly, our data demonstrate that, despite enhanced neutrophil recruitment to the liver, ecSOD activity negatively impacted host survival and bacterial clearance. Increased ecSOD activity was accompanied by decreased co-localization of neutrophils with bacteria, as well as increased neutrophil apoptosis, which reduced overall and neutrophil-specific TNF-α production. Liver leukocytes from mice lacking ecSOD produced equivalent nitric oxide (NO·) when compared to mice expressing ecSOD. However, during infection, there were higher levels of peroxynitrite (NO3·−) in livers from mice lacking ecSOD compared to mice expressing ecSOD. Neutrophil depletion studies revealed that high levels of ecSOD activity resulted in neutrophils with limited protective capacity, whereas neutrophils from mice lacking ecSOD provided superior protection compared to neutrophils from wild-type mice. Taken together, our data demonstrate that ecSOD activity reduces innate immune responses during bacterial infection and provides a potential target for therapeutic intervention. PMID:22393157

  12. Salmonella enterica Serovar Enteritidis Ghosts Carrying the Escherichia coli Heat-Labile Enterotoxin B Subunit Are Capable of Inducing Enhanced Protective Immune Responses

    PubMed Central

    Jawale, Chetan V.

    2014-01-01

    The Escherichia coli heat-labile enterotoxin B subunit (LTB) is a potent vaccine adjuvant. Salmonella enterica serovar Enteritidis ghosts carrying LTB (S. Enteritidis-LTB ghosts) were genetically constructed using a novel plasmid, pJHL187-LTB, designed for the coexpression of the LTB and E lysis proteins. S. Enteritidis-LTB ghosts were characterized using scanning electron microscopy to visualize their transmembrane tunnel structures. The expression of LTB in S. Enteritidis-LTB ghost preparations was confirmed by immunoblot and enzyme-linked immunosorbent assays. The parenteral adjuvant activity of LTB was demonstrated by immunizing chickens with either S. Enteritidis-LTB ghosts or S. Enteritidis ghosts. Chickens were intramuscularly primed at 5 weeks of age and subsequently boosted at 8 weeks of age. In total, 60 chickens were equally divided into three groups (n = 20 for each): group A, nonvaccinated control; group B, immunized with S. Enteritidis-LTB ghosts; and group C, immunized with S. Enteritidis ghosts. Compared with the nonimmunized chickens (group A), the immunized chickens (groups B and C) exhibited increased titers of plasma IgG and intestinal secretory IgA antibodies. The CD3+ CD4+ subpopulation of T cells was also significantly increased in both immunized groups. Among the immunized chickens, those in group B exhibited significantly increased titers of specific plasma IgG and intestinal secretory IgA (sIgA) antibodies compared with those in group C, indicating the immunomodulatory effects of the LTB adjuvant. Furthermore, both immunized groups exhibited decreased bacterial loads in their feces and internal organs. These results indicate that parenteral immunization with S. Enteritidis-LTB ghosts can stimulate superior induction of systemic and mucosal immune responses compared to immunization with S. Enteritidis ghosts alone, thus conferring efficient protection against salmonellosis. PMID:24671556

  13. Cellular and humoral immune responses to a tetanus toxoid booster in perinatally HIV-1-infected children and adolescents receiving highly active antiretroviral therapy (HAART).

    PubMed

    Ching, Natascha; Deville, Jaime G; Nielsen, Karin A; Ank, Bonnie; Wei, Lian S; Sim, Myung Shin; Wolinsky, Steven M; Bryson, Yvonne J

    2007-01-01

    Human immunodeficiency virus type 1 (HIV-1) infected children treated with highly active antiretroviral therapy (HAART) may develop a significant reduction of plasma viremia associated with an increase in CD4+ T-cell counts. Functional capacity of this reconstituted immune system in response to recall antigens is important to maintain protective immunity to vaccine-preventable diseases. We therefore determined cellular and humoral immune responses to tetanus toxoid (TT) booster in perinatally HIV-1-infected children and adolescents receiving HAART. Immune responses were prospectively evaluated pre- and post-tetanus booster using lymphocyte proliferation assay (LPA) stimulation index (SI > or = 3.0) and tetanus antibody (TAb > or = 0.15) in 15 patients. The median interval from primary tetanus immunization series was 6 years (range 2-12 years). We compared patients by their virological response to HAART (complete responders, CR, n=7; incomplete responders, ICR, n=8). There were no significant differences in median age 12.6 years (CR: 12.9; ICR: 10.6) or median CD4 T-cell pre-booster (CR: 35%/819; ICR: 26%/429) between groups. Tetanus LPA responses were observed in one patient prior to booster and in seven patients post-booster. In contrast, 38% of patients had protective TAb pre-booster, but 92% developed protective TAb post-booster. All of the CR and 5/6 ICR patients developed protective TAb. HIV-1-infected children and adolescents had modest LPA responses to tetanus following booster, similar to HIV-1-infected adults. However, the majority of patients developed protective TAb levels after booster and maintained the response. Shorter intervals may need to be considered for TT immunization boosters in HIV-1-infected pediatric patients, as only 38% had protective TAb at baseline.

  14. The novel Lyme borreliosis vaccine VLA15 shows broad protection against Borrelia species expressing six different OspA serotypes.

    PubMed

    Comstedt, Pär; Schüler, Wolfgang; Meinke, Andreas; Lundberg, Urban

    2017-01-01

    We have previously shown that the Outer surface protein A (OspA) based Lyme borreliosis vaccine VLA15 induces protective immunity in mice. Herein, we report the induction of protective immunity by VLA15 with mouse models using ticks infected with B. burgdorferi (OspA serotype 1), B. afzelii (OspA serotype 2) and B. bavariensis (OspA serotype 4) or with in vitro grown B. garinii (OspA serotype 5 and 6) for challenge. For B. garinii (OspA serotype 3), we have developed a growth inhibition assay using chicken complement and functional antibodies targeting B. garinii (OspA serotype 3) could be demonstrated after immunization with VLA15. Furthermore, following three priming immunizations, a booster dose was administered five months later and the induction of immunological memory could be confirmed. Thus, the antibody titers after the booster dose were increased considerably compared to those after primary immunization. In addition, the half-lives of anti-OspA serotype specific antibodies after administration of the booster immunization were longer than after primary immunization. Taken together, we could show that VLA15 induced protection in mice against challenge with four different clinically relevant Borrelia species (B. burgdorferi, B. afzelii, B. garinii and B. bavariensis) expressing five of the six OspA serotypes included in the vaccine. The protection data is supported by functional assays showing efficacy against spirochetes expressing any of the six OspA serotypes (1 to 6). To our knowledge, this is the first time a Lyme borreliosis vaccine has been able to demonstrate such broad protection in preclinical studies. These new data provide further promise for the clinical development of VLA15 and supports our efforts to provide a new Lyme borreliosis vaccine available for global use.

  15. [The protective role of postvaccinal immunity in mumps in children].

    PubMed

    Zheleznikova, G F; Ivanova, V V; Bekhtereva, M K; Gnilevskaia, Z U; Monakhova, N E; Novozhilova, E V; Goleva, O V; Sizemov, A N

    2000-01-01

    The immunological study of children with infectious parotitis (IP) without complications and with such complications as pancreatitis, meningitis or orchitis in the glandular form was carried out. In accordance with the previously proposed principle, 4 types of immune response (IR) were established on the basis of differences in initial resistance and the IR profile: cell-mediated immunity (types I and III) and humoral immunity (types II and IV). The patients included nonvaccinated children, as well as children vaccinated on epidemic indications, 3-6, 7-9, 10 and more years before infection. The comparative analysis of the number of IP cases with and without complications in the groups of children, divided according to their immunization history and the type of IR, revealed that postvaccinal immunity in children vaccinated on epidemic indications (less than a month ago) or 3-6 years before infection had protective potential, sufficient for the prevention of complicated forms of IP. Immunity obtained 7-9 years ago was effective for the protection from IP complications only in cell-mediated, but not humoral IR. Postvaccinal immunity obtained more than 10 years ago did not ensure the decrease in the occurrence of complicated forms of IP (in comparison with that in nonvaccinated patients) in children with any type of IR.

  16. Enhanced protective immune response to PCV2 subunit vaccine by co-administration of recombinant porcine IFN-γ in mice.

    PubMed

    Wang, Yi-Ping; Liu, Dan; Guo, Long-Jun; Tang, Qing-Hai; Wei, Yan-Wu; Wu, Hong-Li; Liu, Jian-Bo; Li, Sheng-Bin; Huang, Li-Ping; Liu, Chang-Ming

    2013-01-21

    The capsid (Cap) protein of PCV2 is the major immunogenic protein that is crucial to induce PCV2-specific neutralizing antibodies and protective immunity; thus, it is a suitable target antigen for the research and development of genetically engineered vaccines against PCV2 infection. IFN-γ has exhibited potential efficacy as an immune adjuvant that enhances the immunogenicity of certain vaccines in experimental animal models. In this study, three recombinant proteins: PCV2-Cap protein, porcine IFN-γ (PoIFN-γ), and the fusion protein (Cap-PoIFN-γ) of PCV2-Cap protein and PoIFN-γ were respectively expressed in the baculovirus system, and analyzed by Western blot and indirect ELISA. Additionally, we evaluated the enhancement of the protective immune response to the Cap protein-based PCV2 subunit vaccine elicited by co-administration of PoIFN-γ in mice. Vaccination of mice with the PCV2-Cap+PoIFN-γ vaccine elicited significantly higher levels of PCV2-specific IPMA antibodies, neutralizing antibodies, and lymphocyte proliferative responses compared to the Cap-PoIFN-γ vaccine, the PCV2-Cap vaccine, and LG-strain. Following virulent PCV2 challenge, no viraemia was detected in all immunized groups, and the viral loads in lungs of the PCV2-Cap+PoIFN-γ group were significantly lower compared to the Cap-PoIFN-γ group, the LG-strain group, and the mock group, but slightly lower compared to the PCV2-Cap group. These findings suggested that PoIFN-γ substantially enhanced the protective immune response to the Cap protein-based PCV2 subunit vaccine, and that the PCV2-Cap+PoIFN-γ subunit vaccine potentially serves as an attractive candidate vaccine for the prevention and control of PCV2-associated diseases. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. rBCG30-Induced Immunity and Cross-Protection against Mycobacterium leprae Challenge Are Enhanced by Boosting with the Mycobacterium tuberculosis 30-Kilodalton Antigen 85B

    PubMed Central

    Gillis, Thomas P.; Tullius, Michael V.

    2014-01-01

    Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. PMID:25001602

  18. rBCG30-induced immunity and cross-protection against Mycobacterium leprae challenge are enhanced by boosting with the Mycobacterium tuberculosis 30-kilodalton antigen 85B.

    PubMed

    Gillis, Thomas P; Tullius, Michael V; Horwitz, Marcus A

    2014-09-01

    Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Pulmonary delivery of influenza vaccine formulations in cotton rats: site of deposition plays a minor role in the protective efficacy against clinical isolate of H1N1pdm virus.

    PubMed

    Bhide, Yoshita; Tomar, Jasmine; Dong, Wei; de Vries-Idema, Jacqueline; Frijlink, Henderik W; Huckriede, Anke; Hinrichs, Wouter L J

    2018-11-01

    Administration of influenza vaccines to the lungs could be an attractive alternative to conventional parenteral administration. In this study, we investigated the deposition site of pulmonary delivered liquid and powder influenza vaccine formulations and its relation to their immunogenicity and protective efficacy. In vivo deposition studies in cotton rats revealed that, the powder formulation was mainly deposited in the trachea ( ∼ 65%) whereas the liquid was homogenously distributed throughout the lungs ( ∼ 96%). In addition, only 60% of the antigen in the powder formulation was deposited in the respiratory tract with respect to the liquid formulation. Immunogenicity studies showed that pulmonary delivered liquid and powder influenza formulations induced robust systemic and mucosal immune responses (significantly higher by liquids than by powders). When challenged with a clinical isolate of homologous H1N1pdm virus, all animals pulmonary administered with placebo had detectable virus in their lungs one day post challenge. In contrast, none of the vaccinated animals had detectable lung virus titers, except for two out of eight animals from the powder immunized group. Also, pulmonary vaccinated animals showed no or little signs of infection like increase in breathing frequency or weight loss upon challenge as compared to animals from the negative control group. In conclusion, immune responses induced by liquid formulation were significantly higher than responses induced by powder formulation, but the overall protective efficacy of both formulations was comparable. Thus, pulmonary immunization is capable of inducing protective immunity and the site of antigen deposition seems to be of minor relevance in inducing protection.

  20. Attenuated PfSPZ Vaccine induces strain-transcending T cells and durable protection against heterologous controlled human malaria infection.

    PubMed

    Lyke, Kirsten E; Ishizuka, Andrew S; Berry, Andrea A; Chakravarty, Sumana; DeZure, Adam; Enama, Mary E; James, Eric R; Billingsley, Peter F; Gunasekera, Anusha; Manoj, Anita; Li, Minglin; Ruben, Adam J; Li, Tao; Eappen, Abraham G; Stafford, Richard E; Kc, Natasha; Murshedkar, Tooba; Mendoza, Floreliz H; Gordon, Ingelise J; Zephir, Kathryn L; Holman, LaSonji A; Plummer, Sarah H; Hendel, Cynthia S; Novik, Laura; Costner, Pamela J M; Saunders, Jamie G; Berkowitz, Nina M; Flynn, Barbara J; Nason, Martha C; Garver, Lindsay S; Laurens, Matthew B; Plowe, Christopher V; Richie, Thomas L; Graham, Barney S; Roederer, Mario; Sim, B Kim Lee; Ledgerwood, Julie E; Hoffman, Stephen L; Seder, Robert A

    2017-03-07

    A live-attenuated malaria vaccine, Plasmodium falciparum sporozoite vaccine (PfSPZ Vaccine), confers sterile protection against controlled human malaria infection (CHMI) with Plasmodium falciparum (Pf) parasites homologous to the vaccine strain up to 14 mo after final vaccination. No injectable malaria vaccine has demonstrated long-term protection against CHMI using Pf parasites heterologous to the vaccine strain. Here, we conducted an open-label trial with PfSPZ Vaccine at a dose of 9.0 × 10 5 PfSPZ administered i.v. three times at 8-wk intervals to 15 malaria-naive adults. After CHMI with homologous Pf parasites 19 wk after final immunization, nine (64%) of 14 (95% CI, 35-87%) vaccinated volunteers remained without parasitemia compared with none of six nonvaccinated controls ( P = 0.012). Of the nine nonparasitemic subjects, six underwent repeat CHMI with heterologous Pf7G8 parasites 33 wk after final immunization. Five (83%) of six (95% CI, 36-99%) remained without parasitemia compared with none of six nonvaccinated controls. PfSPZ-specific T-cell and antibody responses were detected in all vaccine recipients. Cytokine production by T cells from vaccinated subjects after in vitro stimulation with homologous (NF54) or heterologous (7G8) PfSPZ were highly correlated. Interestingly, PfSPZ-specific T-cell responses in the blood peaked after the first immunization and were not enhanced by subsequent immunizations. Collectively, these data suggest durable protection against homologous and heterologous Pf parasites can be achieved with PfSPZ Vaccine. Ongoing studies will determine whether protective efficacy can be enhanced by additional alterations in the vaccine dose and number of immunizations.

  1. Studies on Emblica officinalis Derived Tannins for Their Immunostimulatory and Protective Activities against Coccidiosis in Industrial Broiler Chickens

    PubMed Central

    Kaleem, Qari Muhammad; Akhtar, Masood; Awais, Mian Muhammad; Saleem, Muhammad; Zafar, Muddassar; Iqbal, Zafar; Muhammad, Faqir

    2014-01-01

    The present study reports the effect of Emblica officinalis (EO) derived tannins on humoral immune responses and their protective efficacy against Eimeria infection in chickens. Tannins were extracted from EO and characterized by HPLC. EO derived tannins (EOT) and commercial tannins (CT) were orally administered in broiler chicks in graded doses for three consecutive days, that is, 5th-7th days of age. On day 14 after administration of tannins, humoral immune response was detected against sheep red blood cells (SRBCs) by haemagglutination assay. Protective efficacy of tannins was measured against coccidial infection, induced by Eimeria species. Results revealed higher geomean titers against SRBCs in chickens administered with EOT as compared to those administered with CT and control group. Mean oocysts per gram of droppings were significantly lower (P < 0.05) in EOT administered chickens as compared to control group. Lesion scoring also showed the lowest caecal and intestinal lesion score of mild to moderate intensity in chickens administered with EOT. Further, significantly higher (P < 0.05) daily body weight gains and antibody titers were detected in EOT administered chickens as compared to those of CT administered and control groups. EOT showed the immunostimulatory properties in broilers and their administration in chickens boost the protective immunity against coccidiosis. PMID:24578631

  2. Studies on Emblica officinalis derived tannins for their immunostimulatory and protective activities against coccidiosis in industrial broiler chickens.

    PubMed

    Kaleem, Qari Muhammad; Akhtar, Masood; Awais, Mian Muhammad; Saleem, Muhammad; Zafar, Muddassar; Iqbal, Zafar; Muhammad, Faqir; Anwar, Muhammad Irfan

    2014-01-01

    The present study reports the effect of Emblica officinalis (EO) derived tannins on humoral immune responses and their protective efficacy against Eimeria infection in chickens. Tannins were extracted from EO and characterized by HPLC. EO derived tannins (EOT) and commercial tannins (CT) were orally administered in broiler chicks in graded doses for three consecutive days, that is, 5th-7th days of age. On day 14 after administration of tannins, humoral immune response was detected against sheep red blood cells (SRBCs) by haemagglutination assay. Protective efficacy of tannins was measured against coccidial infection, induced by Eimeria species. Results revealed higher geomean titers against SRBCs in chickens administered with EOT as compared to those administered with CT and control group. Mean oocysts per gram of droppings were significantly lower (P < 0.05) in EOT administered chickens as compared to control group. Lesion scoring also showed the lowest caecal and intestinal lesion score of mild to moderate intensity in chickens administered with EOT. Further, significantly higher (P < 0.05) daily body weight gains and antibody titers were detected in EOT administered chickens as compared to those of CT administered and control groups. EOT showed the immunostimulatory properties in broilers and their administration in chickens boost the protective immunity against coccidiosis.

  3. Endothelial cells in the eyes of an immunologist.

    PubMed

    Young, M Rita

    2012-10-01

    Endothelial cell activation in the process of tumor angiogenesis and in various aspects of vascular biology has been extensively studied. However, endothelial cells also function in other capacities, including in immune regulation. Compared to the more traditional immune regulatory populations (Th1, Th2, Treg, etc.), endothelial cells have received far less credit as being immune regulators. Their regulatory capacity is multifaceted. They are critical in both limiting and facilitating the trafficking of various immune cell populations, including T cells and dendritic cells, out of the vasculature and into tissue. They also can be induced to stimulate immune reactivity or to be immune inhibitory. In each of these parameters (trafficking, immune stimulation and immune inhibition), their role can be physiological, whereby they have an active role in maintaining health. Alternatively, their role can be pathological, whereby they contribute to disease. In theory, endothelial cells are in an ideal location to recruit cells that can mediate immune reactivity to tumor tissue. Furthermore, they can activate the immune cells as they transmigrate across the endothelium into the tumor. However, what is seen is the absence of these protective effects of endothelial cells and, instead, the endothelial cells succumb to the defense mechanisms of the tumor, resulting in their acquisition of a tumor-protective role. To understand the immune regulatory potential of endothelial cells in protecting the host versus the tumor, it is useful to better understand the other circumstances in which endothelial cells modulate immune reactivities. Which of the multitude of immune regulatory roles that endothelial cells can take on seems to rely on the type of stimulus that they are encountering. It also depends on the extent to which they can be manipulated by potential dangers to succumb and contribute toward attack on the host. This review will explore the physiological and pathological roles of endothelial cells as they regulate immune trafficking, immune stimulation and immune inhibition in a variety of conditions and will then apply this information to their role in the tumor environment. Strategies to harness the immune regulatory potential of endothelial cells are starting to emerge in the non-tumor setting. Results from such efforts are expected to be applicable to being able to skew endothelial cells from having a tumor-protective role to a host-protective role.

  4. Comparative opsonic and protective activities of Staphylococcus aureus conjugate vaccines containing native or deacetylated Staphylococcal Poly-N-acetyl-beta-(1-6)-glucosamine.

    PubMed

    Maira-Litrán, Tomás; Kropec, Andrea; Goldmann, Donald A; Pier, Gerald B

    2005-10-01

    Staphylococcus aureus and Staphylococcus epidermidis both synthesize the surface polysaccharide poly-N-acetyl-beta-(1-6)-glucosamine (PNAG), which is produced in vitro with a high level (>90%) of the amino groups substituted by acetate. Here, we examined the role of the acetate substituents of PNAG in generating opsonic and protective antibodies. PNAG and a deacetylated form of the antigen (dPNAG; 15% acetylation) were conjugated to the carrier protein diphtheria toxoid (DT) and used to immunize animals. Mice responded in a dose-dependent fashion to both conjugate vaccines, with maximum antibody titers observed at the highest dose and 4 weeks after the last of three weekly immunizations. PNAG-DT and dPNAG-DT vaccines were also very immunogenic in rabbits. Antibodies raised to the conjugate vaccines in rabbits mediated the opsonic killing of various staphylococcal strains, but the specificity of the opsonic killing was primarily to dPNAG, as this antigen inhibited the killing of S. aureus strains by both PNAG- and dPNAG-specific antibodies. Passive immunization of mice with anti-dPNAG-DT rabbit sera showed significant levels of clearance of S. aureus from the blood (54 to 91%) compared to control mice immunized with normal rabbit sera, whereas PNAG-specific antibodies were ineffective at clearing S. aureus. Passive immunization of mice with a goat antiserum raised to the dPNAG-DT vaccine protected against a lethal dose of three different S. aureus strains. Overall, these data show that immunization of animals with a conjugate vaccine of dPNAG elicit antibodies that mediated opsonic killing and protected against S. aureus infection, including capsular polysaccharide types 5 and 8 and an untypable strain.

  5. IL-4Rα-Associated Antigen Processing by B Cells Promotes Immunity in Nippostrongylus brasiliensis Infection

    PubMed Central

    Hoving, Jennifer C.; Nieuwenhuizen, Natalie; McSorley, Henry J.; Ndlovu, Hlumani; Bobat, Saeeda; Kimberg, Matti; Kirstein, Frank; Cutler, Anthony J.; DeWals, Benjamin; Cunningham, Adam F.; Brombacher, Frank

    2013-01-01

    In this study, B cell function in protective TH2 immunity against N. brasiliensis infection was investigated. Protection against secondary infection depended on IL-4Rα and IL-13; but not IL-4. Protection did not associate with parasite specific antibody responses. Re-infection of B cell-specific IL-4Rα−/− mice resulted in increased worm burdens compared to control mice, despite their equivalent capacity to control primary infection. Impaired protection correlated with reduced lymphocyte IL-13 production and B cell MHC class II and CD86 surface expression. Adoptive transfer of in vivo N. brasiliensis primed IL-4Rα expressing B cells into naïve BALB/c mice, but not IL-4Rα or IL-13 deficient B cells, conferred protection against primary N. brasiliensis infection. This protection required MHC class II compatibility on B cells suggesting cognate interactions by B cells with CD4+ T cells were important to co-ordinate immunity. Furthermore, the rapid nature of these protective effects by B cells suggested non-BCR mediated mechanisms, such as via Toll Like Receptors, was involved, and this was supported by transfer experiments using antigen pulsed Myd88−/− B cells. These data suggest TLR dependent antigen processing by IL-4Rα-responsive B cells producing IL-13 contribute significantly to CD4+ T cell-mediated protective immunity against N. brasiliensis infection. PMID:24204255

  6. Practical review of immunizations in adult patients with cancer

    PubMed Central

    Ariza-Heredia, Ella J; Chemaly, Roy F

    2015-01-01

    Compared with the general population, patients with cancer in general are more susceptible to vaccine-preventable infections, either by an increased risk due to the malignancy itself or immunosuppressive treatment. The goal of immunizations in these patients is therefore to provide protection against these infections, and to decrease the number of vulnerable patients who can disseminate these organisms. The proper timing of immunization with cancer treatment is key to achieving better vaccine protection. As the oncology field continues to advance, leading to better quality of life and longer survival, immunization and other aspects of preventive medicine ought to move to the frontline in the care of these patients. Herein, we review the vaccines most clinically relevant to patients with cancer, as well as special cases including vaccines after splenectomy, travel immunization and recommendations for family members. PMID:26110220

  7. Practical review of immunizations in adult patients with cancer.

    PubMed

    Ariza-Heredia, Ella J; Chemaly, Roy F

    2015-01-01

    Compared with the general population, patients with cancer in general are more susceptible to vaccine-preventable infections, either by an increased risk due to the malignancy itself or immunosuppressive treatment. The goal of immunizations in these patients is therefore to provide protection against these infections, and to decrease the number of vulnerable patients who can disseminate these organisms. The proper timing of immunization with cancer treatment is key to achieving better vaccine protection. As the oncology field continues to advance, leading to better quality of life and longer survival, immunization and other aspects of preventive medicine ought to move to the frontline in the care of these patients. Herein, we review the vaccines most clinically relevant to patients with cancer, as well as special cases including vaccines after splenectomy, travel immunization and recommendations for family members.

  8. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    PubMed

    Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

    2012-01-01

    Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  9. Protection of Broiler Chicks Housed with Immunized Cohorts Against Infection with Eimeria maxima and E. acervulina.

    PubMed

    Fetterer, Raymond H; Barfield, Ruth C; Jenkins, Mark C

    2015-03-01

    The use of live oocyst vaccines is becoming increasingly important in the control of avian coccidiosis in broilers. Knowledge of the mechanisms employed when chicks uptake oocysts and become immune is important for optimizing delivery of live vaccines. The current study tests the hypothesis that chicks not initially immunized may ingest oocysts by contact with litter containing oocysts shed by immunized cohorts. In Experiment 1, day-old broiler chicks were housed in pens containing clean litter. In Trial 1, 100% of chicks in some pens were immunized with 2.5 X 10(3) Eimeria acervulina oocysts while in other pens only 75% of chicks were immunized and remaining cohorts within the pens were not immunized. Other pens contained chicks that served as nonimmunized nonchallenged controls or nonimmunized challenged controls (NIC). On day 21, birds were given a homologous challenge of 6 X 10(5) oocysts. A second identical trial was conducted, except birds were immunized with 500 Eimeria maxima oocysts and were challenged with 3 X 10(3) E. maxima oocysts. In Experiment 2, 100% of chicks in some pens were immunized with 500 E. acervulina oocysts while in other pens either 75% or 50% of the birds were immunized. On day 14, birds were challenged with 1 X 10(6) oocysts. Trial 2 was identical to Trial 1 except that birds were immunized with 100 E. maxima oocysts and challenged with 1 X 10(6) oocysts. For all experiments weight gain, feed conversion ratio (FCR), plasma carotenoids, and litter oocyst counts were measured. In Experiment 1, the level of protection in groups containing 25% nonimmunized cohorts, as measured by weight gain, carotenoid level, FCR, and oocyst litter counts, was identical to groups containing 100% immunized chicks. In Experiment 2, pens where 50% or 75% of birds were immunized with either E. maxima or E. acervulina were not well protected from decreases in weight gain and plasma carotenoids nor from increases in litter oocyst counts following a challenge infection administered on day 14 relative to NIC. In addition, pens of birds where 100% of chicks were immunized were not well protected compared to NIC, and resistance to coccidiosis infection in immunized chicks was less than resistance in chicks challenged at 21 days. These results in total suggest that, when birds are challenged after 21 days, cohorts are protected from detrimental effects of challenge infection. However, when challenge infection is given at 14 days, cohorts are not well protected. The results support a conclusion that protection to coccidiosis is conveyed to cohorts by contact with oocysts shed into the litter by immunized chicks, but this resistance may take 14 days to develop.

  10. Immunological correlates for protection against intranasal challenge of Bacillus anthracis spores conferred by a protective antigen-based vaccine in rabbits.

    PubMed

    Weiss, Shay; Kobiler, David; Levy, Haim; Marcus, Hadar; Pass, Avi; Rothschild, Nili; Altboum, Zeev

    2006-01-01

    Correlates between immunological parameters and protection against Bacillus anthracis infection in animals vaccinated with protective antigen (PA)-based vaccines could provide surrogate markers to evaluate the putative protective efficiency of immunization in humans. In previous studies we demonstrated that neutralizing antibody levels serve as correlates for protection in guinea pigs (S. Reuveny et al., Infect. Immun. 69:2888-2893, 2001; H. Marcus et al., Infect. Immun. 72:3471-3477, 2004). In this study we evaluated similar correlates for protection by active and passive immunization of New Zealand White rabbits. Full immunization and partial immunization were achieved by single and multiple injections of standard and diluted doses of a PA-based vaccine. Passive immunization was carried out by injection of immune sera from rabbits vaccinated with PA-based vaccine prior to challenge with B. anthracis spores. Immunized rabbits were challenged by intranasal spore instillation with one of two virulent strains (strains Vollum and ATCC 6605). The immune competence was estimated by measuring the level of total anti-PA antibodies, the neutralizing antibody titers, and the conferred protective immunity. The results indicate that total anti-PA antibody titers greater than 1 x 10(5) conferred protection, whereas lower titers (between 10(4) and 10(5)) provided partial protection but failed to predict protection. Neutralizing antibody titers between 500 and 800 provided partial protection, while titers higher than 1,000 conferred protection. In conclusion, this study emphasizes that regardless of the immunization regimen or the time of challenge, neutralizing antibody titers are better predictors of protection than total anti-PA titers.

  11. Brucella lipopolysaccharide reinforced Salmonella delivering Brucella immunogens protects mice against virulent challenge.

    PubMed

    Lalsiamthara, Jonathan; Lee, John Hwa

    2017-06-01

    Intracellular pathogen Salmonella exhibits natural infection broadly analogous to Brucella, this phenomenon makes Salmonella a pragmatic choice for an anti-Brucella vaccine delivery platform. In this study we developed and formulated a combination of four attenuated Salmonella Typhimurium live vector strains delivering heterologous Brucella antigens (rBs), namely lumazine synthase, proline racemase subunit A, lipoprotein outer membrane protein-19, and Cu-Zn superoxide dismutase. With an aim to develop a cross-protecting vaccine, Brucella pan-species conserved rBs were selected. The present study compared the efficacy of smooth and rough variants of Salmonella delivery vector and also evaluated the inclusion of purified Brucella lipopolysaccharide (LPS) in the formulation. Immunization of SPF-BALB/c mice with the vaccine combinations significantly (P≤0.05) reduced splenic wild-type Brucella abortus 544 colonization as compared to non-immunized mice as well as Salmonella only immunized mice. Increased induction of Brucella specific-IgG, sIgA production, and antigen-specific splenocyte proliferative responses were observed in the mice immunized with the formulations as compared to naïve or vector only immunized mice. Modulatory effects of rB and LPS on production of interleukin (IL)-4, IL-12, and interferon-γ were detected in splenocytes of mice immunized with the formulation. Rough Salmonella variant in combination with LPS could further enhance the efficacy of the delivery when applied intraperitoneally. Taken together, it is compelling that Brucella LPS-augmented Salmonella vector delivering immunogenic Brucella proteins may be more suitable than the current non-ideal live Brucella abortus vaccine. The vaccine system also provides a basis for the development of cross-protecting vaccine capable of preventing multispecies brucellosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Protective Immunity Against a Lethal Respiratory Yersinia pestis Challenge Induced by V Antigen or the F1 Capsular Antigen Incorporated into Adenovirus Capsid

    PubMed Central

    Boyer, Julie L.; Sofer-Podesta, Carolina; Ang, John; Hackett, Neil R.; Chiuchiolo, Maria J.; Senina, Svetlana; Perlin, David

    2010-01-01

    Abstract The aerosol form of the bacterium Yersinia pestis causes pneumonic plague, a rapidly fatal disease that is a biothreat if deliberately released. At present, no plague vaccines are available for use in the United States, but subunit vaccines based on the Y. pestis V antigen and F1 capsular protein show promise when administered with adjuvants. In the context that adenovirus (Ad) gene transfer vectors have a strong adjuvant potential related to the ability to directly infect dendritic cells, we hypothesized that modification of the Ad5 capsid to display either the Y. pestis V antigen or the F1 capsular antigen on the virion surface would elicit high V antigen- or F1-specific antibody titers, permit boosting with the same Ad serotype, and provide better protection against a lethal Y. pestis challenge than immunization with equivalent amounts of V or F1 recombinant protein plus conventional adjuvant. We constructed AdYFP-pIX/V and AdLacZ-pIX/F1, E1–, E3– serotype 5 Ad gene transfer vectors containing a fusion of the sequence for either the Y. pestis V antigen or the F1 capsular antigen to the carboxy-terminal sequence of pIX, a capsid protein that can accommodate the entire V antigen (37 kDa) or F1 protein (15 kDa) without disturbing Ad function. Immunization with AdYFP-pIX/V followed by a single repeat administration of the same vector at the same dose resulted in significantly better protection of immunized animals compared with immunization with a molar equivalent amount of purified recombinant V antigen plus Alhydrogel adjuvant. Similarly, immunization with AdLacZ-pIX/F1 in a prime–boost regimen resulted in significantly enhanced protection of immunized animals compared with immunization with a molar-equivalent amount of purified recombinant F1 protein plus adjuvant. These observations demonstrate that Ad vaccine vectors containing pathogen-specific antigens fused to the pIX capsid protein have strong adjuvant properties and stimulate more robust protective immune responses than equivalent recombinant protein-based subunit vaccines administered with conventional adjuvant, suggesting that F1-and/or V-modified capsid Ad-based recombinant vaccines should be considered for development as anti-plague vaccines. PMID:20180652

  13. Immunizing Adult Female Mice with a TcpA-A2-CTB Chimera Provides a High Level of Protection for Their Pups in the Infant Mouse Model of Cholera

    PubMed Central

    Price, Gregory A.; Holmes, Randall K.

    2014-01-01

    Vibrio cholerae expresses two primary virulence factors, cholera toxin (CT) and the toxin-coregulated pilus (TCP). CT causes profuse watery diarrhea, and TCP (composed of repeating copies of the major pilin TcpA) is required for intestinal colonization by V. cholerae. Antibodies to CT or TcpA can protect against cholera in animal models. We developed a TcpA holotoxin-like chimera (TcpA-A2-CTB) to elicit both anti-TcpA and anti-CTB antibodies and evaluated its immunogenicity and protective efficacy in the infant mouse model of cholera. Adult female CD-1 mice were immunized intraperitoneally three times with the TcpA-A2-CTB chimera and compared with similar groups immunized with a TcpA+CTB mixture, TcpA alone, TcpA with Salmonella typhimurium flagellin subunit FliC as adjuvant, or CTB alone. Blood and fecal samples were analyzed for antigen-specific IgG or IgA, respectively, using quantitative ELISA. Immunized females were mated; their reared offspring were challenged orogastrically with 10 or 20 LD50 of V. cholerae El Tor N16961; and vaccine efficacy was assessed by survival of the challenged pups at 48 hrs. All pups from dams immunized with the TcpA-A2-CTB chimera or the TcpA+CTB mixture survived at both challenge doses. In contrast, no pups from dams immunized with TcpA+FliC or CTB alone survived at the 20 LD50 challenge dose, although the anti-TcpA or anti-CTB antibody level elicited by these immunizations was comparable to the corresponding antibody level achieved by immunization with TcpA-A2-CTB or TcpA+CTB. Taken together, these findings comprise strong preliminary evidence for synergistic action between anti-TcpA and anti-CTB antibodies in protecting mice against cholera. Weight loss analysis showed that only immunization of dams with TcpA-A2-CTB chimera or TcpA+CTB mixture protected their pups against excess weight loss from severe diarrhea. These data support the concept of including both TcpA and CTB as immunogens in development of an effective multivalent subunit vaccine against V. cholerae. PMID:25474636

  14. Construction of a Salmonella Gallinarum ghost as a novel inactivated vaccine candidate and its protective efficacy against fowl typhoid in chickens

    PubMed Central

    2012-01-01

    In order to develop a novel, safe and immunogenic fowl typhoid (FT) vaccine candidate, a Salmonella Gallinarum ghost with controlled expression of the bacteriophage PhiX174 lysis gene E was constructed using pMMP99 plasmid in this study. The formation of the Salmonella Gallinarum ghost with tunnel formation and loss of cytoplasmic contents was observed by scanning electron microscopy and transmission electron microscopy. No viable cells were detectable 24 h after the induction of gene E expression by an increase in temperature from 37 °C to 42 °C. The safety and protective efficacy of the Salmonella Gallinarum ghost vaccine was tested in chickens that were divided into four groups: group A (non-immunized control), group B (orally immunized), group C (subcutaneously immunized) and group D (intramuscularly immunized). The birds were immunized at day 7 of age. None of the immunized animals showed any adverse reactions such as abnormal behavior, mortality, or signs of FT such as anorexia, depression, or diarrhea. These birds were subsequently challenged with a virulent Salmonella Gallinarum strain at 3 weeks post-immunization (wpi). Significant protection against the virulent challenge was observed in all immunized groups based on mortality and post-mortem lesions compared to the non-immunized control group. In addition, immunization with the Salmonella Gallinarum ghosts induced significantly high systemic IgG response in all immunized groups. Among the groups, orally-vaccinated group B showed significantly higher levels of secreted IgA. A potent antigen-specific lymphocyte activation response along with significantly increased percentages of CD4+ and CD8+ T lymphocytes found in all immunized groups clearly indicate the induction of cellular immune responses. Overall, these findings suggest that the newly constructed Salmonella Gallinarum ghost appears to be a safe, highly immunogenic, and efficient non-living bacterial vaccine candidate that protects against FT. PMID:22620989

  15. Vaccine-Induced Immunogenicity and Protection Against Pneumocystis Pneumonia in a Nonhuman Primate Model of HIV and Pneumocystis Coinfection

    PubMed Central

    Kling, Heather M.; Norris, Karen A.

    2016-01-01

    Background. The ubiquitous opportunistic pathogen Pneumocystis jirovecii causes pneumonia in immunocompromised individuals, including human immunodeficiency virus (HIV)–infected individuals, and pulmonary colonization with P. jirovecii is believed to be a cofactor in the development of chronic obstructive pulmonary disease. There is no vaccine for P. jirovecii; however, most adults are seropositive, indicating natural immune priming to this pathogen. We have shown that humoral response to a recombinant subunit of the P. jirovecii protease kexin (KEX1) correlates with protection from P. jirovecii colonization and pneumonia. Methods. Here we evaluated the immunogenicity and protective capacity of the recombinant KEX1 peptide vaccine in a preclinical, nonhuman primate model of HIV-induced immunosuppression and Pneumocystis coinfection. Results. Immunization with KEX1 induced a robust humoral response remained at protective levels despite chronic simian immunodeficiency virus/HIV–induced immunosuppression. KEX1-immunized macaques were protected from Pneumocystis pneumonia, compared with mock-immunized animals (P = .047), following immunosuppression and subsequent natural, airborne exposure to Pneumocystis. Conclusions. These data support the concept that stimulation of preexisting immunological memory to Pneumocystis with a recombinant KEX1 vaccine prior to immunosuppression induces durable memory responses and protection in the context of chronic, complex immunosuppression. PMID:26823337

  16. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  17. Antibody responses to tetanus toxoid and Haemophilus influenzae type b conjugate vaccines following autologous peripheral blood stem cell transplantation (PBSCT).

    PubMed

    Chan, C Y; Molrine, D C; Antin, J H; Wheeler, C; Guinan, E C; Weinstein, H J; Phillips, N R; McGarigle, C; Harvey, S; Schnipper, C; Ambrosino, D M

    1997-07-01

    Accelerated granulocyte and platelet recovery following peripheral blood stem cell transplantation (PBSCT) are well documented. We hypothesize that functional immunity may also be enhanced in PBSCT and performed a phase II trial of immunizations in patients with lymphoma undergoing autologous transplantation with peripheral blood stem cells or bone marrow. Seventeen BMT and 10 PBSCT recipients were immunized at 3, 6, 12, and 24-months post-transplantation with Haemophilus influenzae type b (HIB)-conjugate and tetanus toxoid (TT) vaccines. IgG anti-HIB and anti-TT antibody concentrations were measured and compared between the two groups. Geometric mean IgG anti-HIB antibody concentrations were significantly higher for PBSCT recipients compared to BMT recipients at 24 months post-transplantation (11.3 micrograms/ml vs 0.93 microgram/ml, P = 0.051) and following the 24 month immunization (66.2 micrograms/ml vs 1.30 micrograms/ml, P = 0.006). Similar results were noted for IgG anti-TT antibody with significantly higher geometric mean antibody concentrations in the PBSCT group at 24 months post-transplantation (182 micrograms/ml vs 21.6 micrograms/ml, P = 0.039). Protective levels of total anti-HIB antibody were achieved earlier in PBSCT recipients compared with those of BMT recipients. PBSCT recipients had higher antigen-specific antibody concentrations following HIB and TT immunizations. These results suggest enhanced recovery of humoral immunity in PBSCT recipients and earlier protection against HIB with immunization.

  18. Agglutination by anti-capsular polysaccharide antibody is associated with protection against experimental human pneumococcal carriage

    PubMed Central

    Reiné, J; Zangari, T; Owugha, JT; Pennington, SH; Gritzfeld, JF; Wright, AD; Collins, AM; van Selm, S; de Jonge, MI; Gordon, SB; Weiser, JN; Ferreira, DM

    2016-01-01

    The ability of pneumococcal conjugate vaccine (PCV) to decrease transmission by blocking the acquisition of colonization has been attributed to herd immunity. We describe the role of mucosal IgG to capsular polysaccharide (CPS) in mediating protection from carriage, translating our findings from a murine model to humans. We used a flow-cytometric assay to quantify antibody-mediated agglutination demonstrating that hyperimmune sera generated against an unencapsulated mutant was poorly agglutinating. Passive immunization with this antiserum was ineffective to block acquisition of colonization compared to agglutinating antisera raised against the encapsulated parent strain. In the human challenge model samples were collected from PCV and control vaccinated adults. In PCV-vaccinated subjects IgG levels to CPS were increased in serum and nasal wash (NW). IgG to the inoculated strain CPS dropped in NW samples after inoculation suggesting its sequestration by colonizing pneumococci. In post-vaccination NW samples pneumococci were heavily agglutinated compared to pre-vaccination samples in subjects protected against carriage. Our results indicate that pneumococcal agglutination mediated by CPS specific antibodies is a key mechanism of protection against acquisition of carriage. Capsule may be the only vaccine target that can elicit strong agglutinating antibody responses, leading to protection against carriage acquisition and generation of herd immunity. PMID:27579859

  19. Characterization of a Novel Fusion Protein from IpaB and IpaD of Shigella spp. and Its Potential as a Pan-Shigella Vaccine

    PubMed Central

    Martinez-Becerra, Francisco J.; Chen, Xiaotong; Dickenson, Nicholas E.; Choudhari, Shyamal P.; Harrison, Kelly; Clements, John D.; Picking, William D.; Van De Verg, Lillian L.; Walker, Richard I.

    2013-01-01

    Shigellosis is an important disease in the developing world, where about 90 million people become infected with Shigella spp. each year. We previously demonstrated that the type three secretion apparatus (T3SA) proteins IpaB and IpaD are protective antigens in the mouse lethal pulmonary model. In order to simplify vaccine formulation and process development, we have evaluated a vaccine design that incorporates both of these previously tested Shigella antigens into a single polypeptide chain. To determine if this fusion protein (DB fusion) retains the antigenic and protective capacities of IpaB and IpaD, we immunized mice with the DB fusion and compared the immune response to that elicited by the IpaB/IpaD combination vaccine. Purification of the DB fusion required coexpression with IpgC, the IpaB chaperone, and after purification it maintained the highly α-helical characteristics of IpaB and IpaD. The DB fusion also induced comparable immune responses and retained the ability to protect mice against Shigella flexneri and S. sonnei in the lethal pulmonary challenge. It also offered limited protection against S. dysenteriae challenge. Our results show the feasibility of generating a protective Shigella vaccine comprised of the DB fusion. PMID:24060976

  20. Immunogenicity and protection in small-animal models with controlled-release tetanus toxoid microparticles as a single-dose vaccine.

    PubMed Central

    Singh, M; Li, X M; Wang, H; McGee, J P; Zamb, T; Koff, W; Wang, C Y; O'Hagan, D T

    1997-01-01

    Tetanus toxoid (TT) was encapsulated in microparticles prepared from polylactide-co-glycolide polymers by a solvent-evaporation technique. Combinations of small- and large-sized microparticles with controlled-release characteristics were used to immunize Sprague-Dawley rats, and the antibody responses were monitored for 1 year. For comparison, control groups of rats were immunized at 0, 1, and 2 months with TT adsorbed to alum. The antibody responses generated by the TT entrapped in microparticles were comparable to those generated by TT adsorbed to alum in control groups from 32 weeks onwards. Microparticles with a single entrapped antigen (TT) induced better antibody responses than microparticles with two antigens (TT and diphtheria toxoid) entrapped simultaneously. A combination vaccine consisting of TT adsorbed to alum and also entrapped in microparticles gave the best antibody responses. In an inhibition assay designed to determine the relative levels of binding of antisera to the antigens, the sera from the microparticle- and the alum-immunized animals showed comparable levels of binding. In addition, in a passive-challenge study with mice, TT adsorbed to alum and TT entrapped in microparticles provided equal levels of protection against a lethal challenge with tetanus toxin. An intradermal-challenge study was also performed with rabbits, which showed similar levels of protection in sera from alum- and microparticle-immunized animals at 4, 12, and 32 weeks after immunization. PMID:9125552

  1. Strain-specific protective immunity following vaccination against experimental Trypanosoma cruzi infection.

    PubMed

    Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M

    2009-09-18

    Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.

  2. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus.

    PubMed

    Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu

    2016-04-21

    Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses.

  3. Intranasal Immunization with Influenza Virus-Like Particles Containing Membrane-Anchored Cholera Toxin B or Ricin Toxin B Enhances Adaptive Immune Responses and Protection against an Antigenically Distinct Virus

    PubMed Central

    Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu

    2016-01-01

    Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses. PMID:27110810

  4. Protective Efficacy of an Inactive Vaccine Based on the LY02 Isolate against Acute Haemophilus parasuis Infection in Piglets.

    PubMed

    Li, Xiao-Hua; Zhao, Guo-Zhen; Qiu, Long-Xin; Dai, Ai-Ling; Wu, Wang-Wei; Yang, Xiao-Yan

    2015-01-01

    Haemophilus parasuis can cause Glässer's disease characterized by fibrinous polyserositis, polyarthritis, and meningitis. The current prevention of Glässer's disease is mainly based on the inactive vaccines; however, the protective efficacy usually fails in heterogeneous or homologous challenges. Here, the predominant lineage of H. parasuis (LY02 strain) in Fujian province, China, characterized as serovar 5, was used to evaluate the protective immunity against acute H. parasuis infection in piglets after inactivation. Following challenging with H. parasuis, only mild lesions in the pigs immunized with the killed vaccine were observed, whereas the typical symptoms of Glässer's disease presented in the nonimmunized piglets. A strong IgG immune response was induced by the inactive vaccine. CD4(+) and CD8(+) T lymphocyte levels were increased, indicating the potent cellular immune responses were elicited. The significantly high levels of IL-2, IL-4, TGF-β, and IFN-γ in sera from pigs immunized with this killed vaccine suggested that the mixed Th1 and Th2 immune responses were induced, associated with the high protection against H. parasuis infection compared to the nonimmunized animals. This study indicated that the inactivated LY02 strain of H. parasuis could serve as a potential vaccine candidate to prevent the prevalence of H. parasuis in Fujian province, China.

  5. The relative contribution of antibody and CD8+ T cells to vaccine immunity against West Nile encephalitis virus.

    PubMed

    Shrestha, Bimmi; Ng, Terry; Chu, Hsien-Jue; Noll, Michelle; Diamond, Michael S

    2008-04-07

    West Nile virus (WNV) is a mosquito borne, neurotropic flavivirus that causes a severe central nervous system (CNS) infection in humans and animals. Although commercial vaccines are available for horses, none is currently approved for human use. In this study, we evaluated the efficacy and mechanism of immune protection of two candidate WNV vaccines in mice. A formalin-inactivated WNV vaccine induced higher levels of specific and neutralizing antibodies compared to a DNA plasmid vaccine that produces virus-like particles. Accordingly, partial and almost complete protection against a highly stringent lethal intracranial WNV challenge were observed in mice 60 days after single dose immunization with the DNA plasmid and inactivated virus vaccines, respectively. In mice immunized with a single dose of DNA plasmid or inactivated vaccine, antigen-specific CD8(+) T cells were induced and contributed to protective immunity as acquired or genetic deficiencies of CD8(+) T cells lowered the survival rates. In contrast, in boosted animals, WNV-specific antibody titers were higher, survival rates after challenge were greater, and an absence of CD8(+) T cells did not appreciably affect mortality. Overall, our experiments suggest that in mice, both inactivated WNV and DNA plasmid vaccines are protective after two doses, and the specific contribution of antibody and CD8(+) T cells to vaccine immunity against WNV is modulated by the prime-boost strategy.

  6. Immunoliposomes containing Soluble Leishmania Antigens (SLA) as a novel antigen delivery system in murine model of leishmaniasis.

    PubMed

    Eskandari, Faeze; Talesh, Ghazal Alipour; Parooie, Maryam; Jaafari, Mahmoud Reza; Khamesipour, Ali; Saberi, Zahra; Abbasi, Azam; Badiee, Ali

    2014-11-01

    Development of new generation of vaccines against leishmaniasis requires adjuvants to elicit the type and intensity of immune response needed for protection. The coupling of target-specific antibodies to the liposomal surface to create immunoliposomes has appeared as a promising way in achieving a liposome active targeting. In this study, immunoliposomes were prepared by grafting non-immune mouse IgG onto the liposomal surface. The influence of active targeted immunoliposomes on the type and intensity of generated immune response against Leishmania was then investigated and compared with that of liposomes and control groups which received either SLA or HEPES buffer alone. All formulations contained SLA and were used to immunize the mice in the left hind footpad three times in 3-week intervals. Evaluation of lesion development and parasite burden in the foot and spleen after challenge with Leishmania major, evaluation of Th1 cytokine (IFN-γ), and titration of IgG isotypes were carried out to assess the type of generated immune response and the extent of protection. The results indicated that liposomes might be effective adjuvant systems to induce protection against L. major challenge in BALB/c mice, but stronger cell mediated immune responses were induced when immunoliposomes were utilized. Thus, immune modulation using immunoliposomes might be a practical approach to improve the immunization against L. major. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. A DNA vaccine for Crimean-Congo hemorrhagic fever protects against disease and death in two lethal mouse models

    PubMed Central

    Fitzpatrick, Collin J.; Suschak, John J.; Richards, Michelle J.; Badger, Catherine V.; Six, Carolyn M.; Martin, Jacqueline D.; Hannaman, Drew; Zivcec, Marko; Bergeron, Eric; Koehler, Jeffrey W.; Schmaljohn, Connie S.

    2017-01-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-borne virus capable of causing a severe hemorrhagic fever disease in humans. There are currently no licensed vaccines to prevent CCHFV-associated disease. We developed a DNA vaccine expressing the M-segment glycoprotein precursor gene of CCHFV and assessed its immunogenicity and protective efficacy in two lethal mouse models of disease: type I interferon receptor knockout (IFNAR-/-) mice; and a novel transiently immune suppressed (IS) mouse model. Vaccination of mice by muscle electroporation of the M-segment DNA vaccine elicited strong antigen-specific humoral immune responses with neutralizing titers after three vaccinations in both IFNAR-/- and IS mouse models. To compare the protective efficacy of the vaccine in the two models, groups of vaccinated mice (7–10 per group) were intraperitoneally (IP) challenged with a lethal dose of CCHFV strain IbAr 10200. Weight loss was markedly reduced in CCHFV DNA-vaccinated mice as compared to controls. Furthermore, whereas all vector-control vaccinated mice succumbed to disease by day 5, the DNA vaccine protected >60% of the animals from lethal disease. Mice from both models developed comparable levels of antibodies, but the IS mice had a more balanced Th1/Th2 response to vaccination. There were no statistical differences in the protective efficacies of the vaccine in the two models. Our results provide the first comparison of these two mouse models for assessing a vaccine against CCHFV and offer supportive data indicating that a DNA vaccine expressing the glycoprotein genes of CCHFV elicits protective immunity against CCHFV. PMID:28922426

  8. A DNA vaccine for Crimean-Congo hemorrhagic fever protects against disease and death in two lethal mouse models.

    PubMed

    Garrison, Aura R; Shoemaker, Charles J; Golden, Joseph W; Fitzpatrick, Collin J; Suschak, John J; Richards, Michelle J; Badger, Catherine V; Six, Carolyn M; Martin, Jacqueline D; Hannaman, Drew; Zivcec, Marko; Bergeron, Eric; Koehler, Jeffrey W; Schmaljohn, Connie S

    2017-09-01

    Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-borne virus capable of causing a severe hemorrhagic fever disease in humans. There are currently no licensed vaccines to prevent CCHFV-associated disease. We developed a DNA vaccine expressing the M-segment glycoprotein precursor gene of CCHFV and assessed its immunogenicity and protective efficacy in two lethal mouse models of disease: type I interferon receptor knockout (IFNAR-/-) mice; and a novel transiently immune suppressed (IS) mouse model. Vaccination of mice by muscle electroporation of the M-segment DNA vaccine elicited strong antigen-specific humoral immune responses with neutralizing titers after three vaccinations in both IFNAR-/- and IS mouse models. To compare the protective efficacy of the vaccine in the two models, groups of vaccinated mice (7-10 per group) were intraperitoneally (IP) challenged with a lethal dose of CCHFV strain IbAr 10200. Weight loss was markedly reduced in CCHFV DNA-vaccinated mice as compared to controls. Furthermore, whereas all vector-control vaccinated mice succumbed to disease by day 5, the DNA vaccine protected >60% of the animals from lethal disease. Mice from both models developed comparable levels of antibodies, but the IS mice had a more balanced Th1/Th2 response to vaccination. There were no statistical differences in the protective efficacies of the vaccine in the two models. Our results provide the first comparison of these two mouse models for assessing a vaccine against CCHFV and offer supportive data indicating that a DNA vaccine expressing the glycoprotein genes of CCHFV elicits protective immunity against CCHFV.

  9. The recombinant fusion protein CFP10-ESAT6-dIFN has protective effect against tuberculosis in guinea pigs.

    PubMed

    Permyakova, Natalya V; Belavin, Pavel A; Pirozhkova, Dariya S; Ufimtseva, Elena G; Rozov, Sergey M; Mursalimov, Sergey R; Sidorchuk, Yuriy V; Uvarova, Elena A; Zagorskaya, Alla A; Marenkova, Tatiana V; Bannikova, Svetlana V; Demidov, Evgeniy A; Starostin, Konstantin V; Kravchenko, Marionella A; Vakhrusheva, Diana V; Berdnikov, Roman B; Eremeeva, Natalya I; Skornyakov, Sergey N; Peltek, Sergey E; Deineko, Elena V

    2018-03-01

    Development of effective vaccine candidates against tuberculosis (TB) is currently the most important challenge in the prevention of this disease since the BCG vaccine fails to guarantee a lifelong protection, while any other approved vaccine with better efficiency is still absent. The protective effect of the recombinant fusion protein CFP10-ESAT6-dIFN produced in a prokaryotic expression system (Escherichia coli) has been assessed in a guinea pig model of acute TB. The tested antigen comprises the Mycobacterium tuberculosis (Mtb) proteins ESAT6 and CFP10 as well as modified human γ-interferon (dIFN) for boosting the immune response. Double intradermal immunization of guinea pigs with the tested fusion protein (2 × 0.5 µg) induces a protective effect against subsequent Mtb infection. The immunized guinea pigs do not develop the symptoms of acute TB and their body weight gain was five times more as compared with the non-immunized infected guinea pigs. The animal group immunized with this dose of antigen displays the minimum morphological changes in the internal organs and insignificant inflammatory lesions in the liver tissue, which complies with a decrease in the bacterial load in the spleen and average Mtb counts in macrophages.

  10. Comparison of selected canine vaccines for their ability to induce protective immunity against canine parvovirus infection.

    PubMed

    Larson, L J; Schultz, R D

    1997-04-01

    To compare the ability of 6 commercially available multicomponent canine vaccines to stimulate antibody production in pups with variable amounts of maternally derived canine parvovirus (CPV) antibody and to induce protective immunity against challenge exposure. Sixty-three 5- to 6-week-old Beagle pups with passively acquired CPV antibody titer between 1: 20 and 1:320. 9 pups were assigned to each of 6 vaccine groups and 1 control group. Eight pups in each group were inoculated with vaccine or saline solution twice, with 3 weeks between administrations. The ninth pup served as an uninoculated contact control. Serum samples were obtained weekly and tested for CPV antibody by hemagglutination-inhibition assay. All pups were challenge exposed with virulent CPV-2a and CPV-2b at 14 to 15 weeks of age. 3 of the vaccines failed to provide protective immunity against challenge exposure because all pups in these groups became infected and most died. A fourth vaccine protected against death, but not infection and disease. Two of the 6 vaccines induced an immune response that was protective against infection and disease. Substantial differences existed among commercial vaccines available in 1994 in their ability to immunize pups with maternally derived CPV antibody. These differences caused many vaccinated pups to be susceptible to CPV disease for variable periods because some vaccines failed to immunize. Importantly, all 4 of the vaccines that performed poorly have recently been replaced by more effective products so that the 6 vaccines now perform similarly.

  11. Co-expression of Interleukin-15 Enhances the Protective Immune Responses Induced by Immunization with a Murine Malaria MVA-Based Vaccine Encoding the Circumsporozoite Protein.

    PubMed

    Parra, Marcela; Liu, Xia; Derrick, Steven C; Yang, Amy; Molina-Cruz, Alvaro; Barillas-Mury, Carolina; Zheng, Hong; Thao Pham, Phuong; Sedegah, Martha; Belmonte, Arnel; Litilit, Dianne D; Waldmann, Thomas A; Kumar, Sanjai; Morris, Sheldon L; Perera, Liyanage P

    2015-01-01

    Malaria remains a major global public health problem with an estimated 200 million cases detected in 2012. Although the most advanced candidate malaria vaccine (RTS,S) has shown promise in clinical trials, its modest efficacy and durability have created uncertainty about the impact of RTS,S immunization (when used alone) on global malaria transmission. Here we describe the development and characterization of a novel modified vaccinia virus Ankara (MVA)-based malaria vaccine which co-expresses the Plasmodium yoelii circumsporozoite protein (CSP) and IL-15. Vaccination/challenge studies showed that C57BL/6 mice immunized with the MVA-CSP/IL15 vaccine were protected significantly better against a P. yoelii 17XNL sporozoite challenge than either mice immunized with an MVA vaccine expressing only CSP or naïve controls. Importantly, the levels of total anti-CSP IgG were elevated about 100-fold for the MVA-CSP/IL15 immunized group compared to mice immunized with the MVA-CSP construct that does not express IL-15. Among the IgG subtypes, the IL-15 expressing MVA-CSP vaccine induced levels of IgG1 (8 fold) and IgG2b (80 fold) higher than the MVA-CSP construct. The significantly enhanced humoral responses and protection detected after immunization with the MVA-CSP/IL15 vaccine suggest that this IL-15 expressing MVA construct could be considered in the development of future malaria immunization strategies.

  12. Inactivated HSV-2 in MPL/alum adjuvant provides nearly complete protection against genital infection and shedding following long term challenge and rechallenge.

    PubMed

    Morello, Christopher S; Kraynyak, Kimberly A; Levinson, Michael S; Chen, Zhijiang; Lee, Kuo-Fen; Spector, Deborah H

    2012-10-12

    Herpes Simplex Virus Type 2 (HSV-2) infection can result in life-long recurrent genital disease, asymptomatic virus shedding, and transmission. No vaccine to date has shown significant protection clinically. Here, we used a mouse model of genital HSV-2 infection to test the efficacy of a vaccine consisting of whole, formalin-inactivated HSV-2 (FI-HSV2) formulated with monophosphoryl lipid A (MPL) and alum adjuvants. Vaccine components were administered alone or as a prime-boost immunization together with DNA vaccines encoding a truncated glycoprotein D2 (gD2t) and two conserved HSV-2 genes necessary for virus replication, UL5 (DNA helicase) and UL30 (DNA polymerase). Our results show: (1) compared with mock immunized controls, mice immunized with FI-HSV2 plus MPL/alum consistently showed protection against disease burden and total viral shedding while the mice immunized with gD2t protein with MPL/alum did not; (2) protection against genital disease and viral replication correlated with the type of boost in a prime-boost immunization with little advantage afforded by a DNA prime; (3) intramuscular (i.m.) immunization with FI-HSV2 in MPL/Alhydrogel adjuvant provided nearly complete protection against vaginal HSV-2 shedding after a lethal intravaginal (i.vag.) short-term challenge and long-term rechallenge; (4) single formulation immunization with DNA vaccines, FI-HSV2, and MPL in an aluminum phosphate (Adju-Phos) adjuvant did not increase protection relative to FI-HSV2/MPL/Adju-Phos alone; and (5) addition of MPL/alum to the FI-HSV2 was required for optimal protection against disease, viral replication, and latent virus load in the dorsal root ganglia (DRG). Most notably, an optimized vaccine formulation of FI-HSV2 MPL/Alhydrogel given i.m. completely protected against detectable vaginal HSV-2 shedding in the majority of animals and HSV-2 latent DNA in the DRG of all animals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Durable protection of rhesus macaques immunized with a replicating adenovirus-SIV multigene prime/protein boost vaccine regimen against a second SIVmac251 rectal challenge: role of SIV-specific CD8+ T cell responses.

    PubMed

    Malkevitch, Nina V; Patterson, L Jean; Aldrich, M Kristine; Wu, Yichen; Venzon, David; Florese, Ruth H; Kalyanaraman, V S; Pal, Ranajit; Lee, Eun Mi; Zhao, Jun; Cristillo, Anthony; Robert-Guroff, Marjorie

    2006-09-15

    Previously, priming with replication-competent adenovirus-SIV multigenic vaccines and boosting with envelope subunits strongly protected 39% of rhesus macaques against rectal SIV(mac251) challenge. To evaluate protection durability, eleven of the protected and two SIV-infected unimmunized macaques that controlled viremia were re-challenged rectally with SIV(mac251). Strong protection was observed in 8/11 vaccinees, including two exhibiting <50 SIV RNA copies. Decreased viremia compared to naïve controls was observed in the other three. The SIV-infected unimmunized macaques modestly controlled viremia but exhibited CD4 counts < or =200, unlike the protected macaques. Durable protection was associated with significantly increased SIV-specific ELISPOT responses and lymphoproliferative responses to p27 at re-challenge. After CD8 depletion, 2 of 8 re-challenged, protected vaccinees maintained <50 SIV RNA copies; SIV RNA emerged in 6. Re-appearance of CD8 cells and restoration of SIV-specific cellular immunity coincided with viremia suppression. Overall, cellular immunity induced by vaccination and/or low-level, inapparent viremia post-first SIV(mac251) challenge, was associated with durable protection against re-challenge.

  14. Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models.

    PubMed

    Askarian, Fatemeh; Lapek, John D; Dongre, Mitesh; Tsai, Chih-Ming; Kumaraswamy, Monika; Kousha, Armin; Valderrama, J Andrés; Ludviksen, Judith A; Cavanagh, Jorunn P; Uchiyama, Satoshi; Mollnes, Tom E; Gonzalez, David J; Wai, Sun N; Nizet, Victor; Johannessen, Mona

    2018-01-01

    Staphylococcus aureus produces membrane-derived vesicles (MVs), which share functional properties to outer membrane vesicles. Atomic force microscopy revealed that S. aureus -derived MVs are associated with the bacterial surface or released into the surrounding environment depending on bacterial growth conditions. By using a comparative proteomic approach, a total of 131 and 617 proteins were identified in MVs isolated from S. aureus grown in Luria-Bertani and brain-heart infusion broth, respectively. Purified S. aureus MVs derived from the bacteria grown in either media induced comparable levels of cytotoxicity and neutrophil-activation. Administration of exogenous MVs increased the resistance of S. aureus to killing by whole blood or purified human neutrophils ex vivo and increased S. aureus survival in vivo . Finally, immunization of mice with S. aureus -derived MVs induced production of IgM, total IgG, IgG1, IgG2a, and IgG2b resulting in protection against subcutaneous and systemic S. aureus infection. Collectively, our results suggest S. aureus MVs can influence bacterial-host interactions during systemic infections and provide protective immunity in murine models of infection.

  15. Enhancement of Th1-biased protective immunity against avian influenza H9N2 virus via oral co-administration of attenuated Salmonella enterica serovar Typhimurium expressing chicken interferon-α and interleukin-18 along with an inactivated vaccine

    PubMed Central

    2012-01-01

    Background Control of currently circulating re-assorted low-pathogenicity avian influenza (LPAI) H9N2 is a major concern for both animal and human health. Thus, an improved LPAI H9N2 vaccination strategy is needed to induce complete immunity in chickens against LPAI H9N2 virus strains. Cytokines play a crucial role in mounting both the type and extent of an immune response generated following infection with a pathogen or after vaccination. To improve the efficacy of inactivated LPAI H9N2 vaccine, attenuated Salmonella enterica serovar Typhimurium was used for oral co-administration of chicken interferon-α (chIFN-α) and chicken interleukin-18 (chIL-18) as natural immunomodulators. Results Oral co-administration of S. enterica serovar Typhimurium expressing chIFN-α and chIL-18, prior to vaccination with inactivated AI H9N2 vaccine, modulated the immune response of chickens against the vaccine antigen through enhanced humoral and Th1-biased cell-mediated immunity, compared to chickens that received single administration of S. enterica serovar Typhimurium expressing either chIFN-α or chIL-18. To further test the protective efficacy of this improved vaccination regimen, immunized chickens were intra-tracheally challenged with a high dose of LPAI H9N2 virus. Combined administration of S. enterica serovar Typhimurium expressing chIFN-α and chIL-18 showed markedly enhanced protection compared to single administration of the construct, as determined by mortality, clinical severity, and feed and water intake. This enhancement of protective immunity was further confirmed by reduced rectal shedding and replication of AIV H9N2 in different tissues of challenged chickens. Conclusions Our results indicate the value of combined administration of chIFN-α and chIL-18 using a Salmonella vaccine strain to generate an effective immunization strategy in chickens against LPAI H9N2. PMID:22776696

  16. Characterization of immune response to Eimeria tenella antigens in a natural immunity model with hosts which differ serologically at the B locus of the major histocompatibility complex.

    PubMed Central

    Brake, D A; Fedor, C H; Werner, B W; Miller, T J; Taylor, R L; Clare, R A

    1997-01-01

    A model to simulate natural immunity to Eimeria tenella was developed in three chicken lines which differ at the B locus of the major histocompatibility complex. Homozygous, 1-day-old chicks of the B19B19, B24B24, or B30B30 genotype were trickle immunized by being orally fed a small infectious dose of E. tenella oocysts for 5 consecutive days. These naturally exposed birds were then challenged at different times between 5 and 24 days after the final dose, and the level of protection was assessed 6 days after challenge, using body weight gain and intestinal lesion scores. The duration of immunity in naturally exposed birds differed among the major histocompatibility complex lines. Trickle immunization of the B19B19 haplotype afforded the longest and strongest level of protection compared to the other two haplotypes tested. In addition, in vitro splenic and peripheral blood lymphocyte proliferative responses in trickle-immunized birds were measured against sporozoite, merozoite, and tissue culture-derived E. tenella parasite antigens isolated from the recently described SB-CEV-1/F7 established cell line. The lymphocytes obtained from B19B19 birds trickle immunized responded in vitro to the E. tenella-infected SB-CEV-1/F7 tissue culture-derived parasite antigen. Furthermore, antigen-specific immune responses appeared earlier in immune, challenged B19B19 birds than in their naive, challenged counterparts. The development of a model simulating natural immunization will serve as a foundation to further characterize both humoral and cell-mediated responses to E. tenella tissue culture-derived parasite antigens and to better understand host protective immune responses to avian coccidiosis. PMID:9119452

  17. [Experimental study on the chitosan-DNA vaccines against campylobacter jejuni invasion].

    PubMed

    Zheng, Hui; Cai, Fang-cheng; Zhong, Min; Deng, Bing; Li, Xin; Zhang, Xiao-ping

    2007-09-01

    The immunogenicity and protective efficacy of an experimental Campylobacter jejuni (C. jejuni) chitosan-DNA vaccines were evaluated in mice. The chitosan-DNA vaccines were prepared by embedding pcDNA3.1(+)-cadF and pcDNA3.1(+)-peblA with chitosan respectively. BALB/c mice were intranasally immunized in a four-dose primary series (7 d intervals) at doses of 60 microg chitosan-DNA vaccines each time. The comparative immunogenicities of nine formulations were assessed on the basis of the generation of antigen-specific antibodies in serum and intestinal secretions. Mice were attacked repeatedly through intragastric administration of C. jejuni HS:19 at the 8th week after the immunization and protective efficacy was determined by detecting the degrees of protection afforded against C. jejuni invaded. The mice immunized with chitosan-DNA vaccines have generated high levels of IgA and IgG from the sera and IgA from the intestinal secretions and the P/N value went up to 20.58, 30.13 and 6.87 respectively. Meanwhile, the expression of intestinal SIgA increased correspondingly. Moreover the chitosan-DNA vaccines induced strongest level of protection in BALB/c mice against challenge with C. jejuni HS:19 strain and the protective efficacies was 93.70. The results of this study indicate that the chitosan-DNA vaccines could induce significant protective immunity against C. jejuni challenge in the mice model.

  18. Vaccine-Induced Immunogenicity and Protection Against Pneumocystis Pneumonia in a Nonhuman Primate Model of HIV and Pneumocystis Coinfection.

    PubMed

    Kling, Heather M; Norris, Karen A

    2016-05-15

    The ubiquitous opportunistic pathogen Pneumocystis jirovecii causes pneumonia in immunocompromised individuals, including human immunodeficiency virus (HIV)-infected individuals, and pulmonary colonization with P. jirovecii is believed to be a cofactor in the development of chronic obstructive pulmonary disease. There is no vaccine for P. jirovecii; however, most adults are seropositive, indicating natural immune priming to this pathogen. We have shown that humoral response to a recombinant subunit of the P. jirovecii protease kexin (KEX1) correlates with protection from P. jirovecii colonization and pneumonia. Here we evaluated the immunogenicity and protective capacity of the recombinant KEX1 peptide vaccine in a preclinical, nonhuman primate model of HIV-induced immunosuppression and Pneumocystis coinfection. Immunization with KEX1 induced a robust humoral response remained at protective levels despite chronic simian immunodeficiency virus/HIV-induced immunosuppression. KEX1-immunized macaques were protected from Pneumocystis pneumonia, compared with mock-immunized animals (P= .047), following immunosuppression and subsequent natural, airborne exposure to Pneumocystis These data support the concept that stimulation of preexisting immunological memory to Pneumocystis with a recombinant KEX1 vaccine prior to immunosuppression induces durable memory responses and protection in the context of chronic, complex immunosuppression. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  19. Intranasal adenovirus-vectored vaccine for induction of long-lasting humoral immunity-mediated broad protection against influenza in mice.

    PubMed

    Kim, Eun Hye; Park, Hae-Jung; Han, Gye-Yeong; Song, Man-Ki; Pereboev, Alexander; Hong, Jeong S; Chang, Jun; Byun, Young-Ho; Seong, Baik Lin; Nguyen, Huan H

    2014-09-01

    Influenza vaccines aimed at inducing antibody (Ab) responses against viral surface hemagglutinin (HA) and neuraminidase (NA) provide sterile immunity to infection with the same subtypes. Vaccines targeting viral conserved determinants shared by the influenza A viruses (IAV) offer heterosubtypic immunity (HSI), a broad protection against different subtypes. We proposed that vaccines targeting both HA and the conserved ectodomain of matrix protein 2 (M2e) would provide protection against infection with the same subtype and also HSI against other subtypes. We report here that single intranasal immunization with a recombinant adenovirus (rAd) vector encoding both HA of H5 virus and M2e (rAdH5/M2e) induced significant HA- and M2e-specific Ab responses, along with protection against heterosubtypic challenge in mice. The protection is superior compared to that induced by rAd vector encoding either HA (rAdH5), or M2e (rAdM2e). While protection against homotypic H5 virus is primarily mediated by virus-neutralizing Abs, the cross-protection is associated with Abs directed to conserved stalk HA and M2e that seem to have an additive effect. Consistently, adoptive transfer of antisera induced by rAdH5/M2e provided the best protection against heterosubtypic challenge compared to that provided by antisera derived from mice immunized with rAdH5 or rAdM2e. These results support the development of rAd-vectored vaccines encoding both H5 and M2e as universal vaccines against different IAV subtypes. Current licensed influenza vaccines provide protection limited to the infection with same virus strains; therefore, the composition of influenza vaccines has to be revised every year. We have developed a new universal influenza vaccine that is highly efficient in induction of long-lasting cross-protection against different influenza virus strains. The cross-protection is associated with a high level of vaccine-induced antibodies against the conserved stalk domain of influenza virus hemagglutinin and the ectodomain of matrix protein. The vaccine could be used to stimulate cross-protective antibodies for the prevention and treatment of influenza with immediate effect for individuals who fail to respond to or receive the vaccine in due time. The vaccine offers a new tool to control influenza outbreaks, including pandemics. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Native flagellin does not protect mice against an experimental Proteus mirabilis ascending urinary tract infection and neutralizes the protective effect of MrpA fimbrial protein.

    PubMed

    Scavone, Paola; Umpiérrez, Ana; Rial, Analía; Chabalgoity, José A; Zunino, Pablo

    2014-06-01

    Proteus mirabilis expresses several virulence factors including MR/P fimbriae and flagella. Bacterial flagellin has frequently shown interesting adjuvant and protective properties in vaccine formulations. However, native P. mirabilis flagellin has not been analyzed so far. Native P. mirabilis flagellin was evaluated as a protective antigen and as an adjuvant in co-immunizations with MrpA (structural subunit of MR/P fimbriae) using an ascending UTI model in the mouse. Four groups of mice were intranasally treated with either MrpA, native flagellin, both proteins and PBS. Urine and blood samples were collected before and after immunization for specific antibodies determination. Cytokine production was assessed in immunized mice splenocytes cultures. Mice were challenged with P. mirabilis, and bacteria quantified in kidneys and bladders. MrpA immunization induced serum and urine specific anti-MrpA antibodies while MrpA coadministered with native flagellin did not. None of the animals developed significant anti-flagellin antibodies. Only MrpA-immunized mice showed a significant decrease of P. mirabilis in bladders and kidneys. Instead, infection levels in MrpA-flagellin or flagellin-treated mice showed no significant differences with the control group. IL-10 was significantly induced in splenocytes of mice that received native flagellin or MrpA-flagellin. Native P. mirabilis flagellin did not protect mice against an ascending UTI. Moreover, it showed an immunomodulatory effect, neutralizing the protective role of MrpA. P. mirabilis flagellin exhibits particular immunological properties compared to other bacterial flagellins.

  1. Skin-draining lymph node priming is sufficient to induce sterile immunity against pre-erythrocytic malaria

    PubMed Central

    Obeid, Michel; Franetich, Jean-François; Lorthiois, Audrey; Gego, Audrey; Grüner, Anne Charlotte; Tefit, Maurel; Boucheix, Claude; Snounou, Georges; Mazier, Dominique

    2013-01-01

    The Plasmodium-infected hepatocyte has been considered necessary to prime the immune responses leading to sterile protection after vaccination with attenuated sporozoites. However, it has recently been demonstrated that priming also occurs in the skin. We wished to establish if sterile protection could be obtained in the absence of priming by infected hepatocytes. To this end, we developed a subcutaneous (s.c.) immunization protocol where few, possibly none, of the immunizing irradiated Plasmodium yoelii sporozoites infect hepatocytes, and also used CD81-deficient mice non-permissive to productive hepatocyte infections. We then compared and contrasted the patterns of priming with those obtained by intradermal immunization, where priming occurs in the liver. Using sterile immunity as a primary read-out, we exploited an inhibitor of T-cell migration, transgenic mice with conditional depletion of dendritic cells and adoptive transfers of draining lymph node-derived T cells, to provide evidence that responses leading to sterile immunity can be primed in the skin-draining lymph nodes with little, if any, contribution from the infected hepatocyte. PMID:23255300

  2. Deletion of Braun lipoprotein and plasminogen-activating protease-encoding genes attenuates Yersinia pestis in mouse models of bubonic and pneumonic plague.

    PubMed

    van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K

    2014-06-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.

  3. Deletion of Braun Lipoprotein and Plasminogen-Activating Protease-Encoding Genes Attenuates Yersinia pestis in Mouse Models of Bubonic and Pneumonic Plague

    PubMed Central

    van Lier, Christina J.; Sha, Jian; Kirtley, Michelle L.; Cao, Anthony; Tiner, Bethany L.; Erova, Tatiana E.; Cong, Yingzi; Kozlova, Elena V.; Popov, Vsevolod L.; Baze, Wallace B.

    2014-01-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4+ and CD8+ T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection. PMID:24686064

  4. Adjuvant composition and delivery route shape immune response quality and protective efficacy of a recombinant vaccine for Entamoeba histolytica.

    PubMed

    Abhyankar, Mayuresh M; Orr, Mark T; Lin, Susan; Suraju, Mohammed O; Simpson, Adrian; Blust, Molly; Pham, Tiep; Guderian, Jeffrey A; Tomai, Mark A; Elvecrog, James; Pedersen, Karl; Petri, William A; Fox, Christopher B

    2018-01-01

    Amebiasis caused by Entamoeba histolytic a is the third leading cause of parasitic mortality globally, with some 100,000 deaths annually, primarily among young children. Protective immunity to amebiasis is associated with fecal IgA and IFN-γ in humans; however, no vaccine exists. We have previously identified recombinant LecA as a potential protective vaccine antigen. Here we describe the development of a stable, manufacturable PEGylated liposomal adjuvant formulation containing two synthetic Toll-like receptor (TLR) ligands: GLA (TLR4) and 3M-052 (TLR7/8). The liposomes stimulated production of monocyte/macrophage chemoattractants MCP-1 and Mip-1β, and Th1-associated cytokines IL-12p70 and IFN-γ from human whole blood dependent on TLR ligand composition and dose. The liposomes also demonstrated acceptable physicochemical compatibility with the recombinant LecA antigen. Whereas mice immunized with LecA and GLA-liposomes demonstrated enhanced antigen-specific fecal IgA titers, mice immunized with LecA and 3M-052-liposomes showed a stronger Th1 immune profile. Liposomes containing GLA and 3M-052 together elicited both LecA-specific fecal IgA and Th1 immune responses. Furthermore, the quality of the immune response could be modulated with modifications to the liposomal formulation based on PEG length. Compared to subcutaneous administration, the optimized liposome adjuvant composition with LecA antigen administered intranasally resulted in significantly enhanced fecal IgA, serum IgG2a, as well as systemic IFN-γ and IL-17A levels in mice. The optimized intranasal regimen provided greater than 80% protection from disease as measured by parasite antigen in the colon. This work demonstrates the physicochemical and immunological characterization of an optimized mucosal adjuvant system containing a combination of TLR ligands with complementary activities and illustrates the importance of adjuvant composition and route of delivery to enhance a multifaceted and protective immune response to amebiasis.

  5. Seasonal Trivalent Inactivated Influenza Vaccine Protects against 1918 Spanish Influenza Virus Infection in Ferrets

    PubMed Central

    Pearce, Melissa B.; Belser, Jessica A.; Gustin, Kortney M.; Pappas, Claudia; Houser, Katherine V.; Sun, Xiangjie; Maines, Taronna R.; Pantin-Jackwood, Mary J.; Katz, Jacqueline M.

    2012-01-01

    The influenza virus H1N1 pandemic of 1918 was one of the worst medical catastrophes in human history. Recent studies have demonstrated that the hemagglutinin (HA) protein of the 1918 virus and 2009 H1N1 pandemic virus [A(H1N1)pdm09], the latter now a component of the seasonal trivalent inactivated influenza vaccine (TIV), share cross-reactive antigenic determinants. In this study, we demonstrate that immunization with the 2010-2011 seasonal TIV induces neutralizing antibodies that cross-react with the reconstructed 1918 pandemic virus in ferrets. TIV-immunized ferrets subsequently challenged with the 1918 virus displayed significant reductions in fever, weight loss, and virus shedding compared to these parameters in nonimmune control ferrets. Seasonal TIV was also effective in protecting against the lung infection and severe lung pathology associated with 1918 virus infection. Our data demonstrate that prior immunization with contemporary TIV provides cross-protection against the 1918 virus in ferrets. These findings suggest that exposure to A(H1N1)pdm09 through immunization may provide protection against the reconstructed 1918 virus which, as a select agent, is considered to pose both biosafety and biosecurity threats. PMID:22553323

  6. Immune responses to modified live virus vaccines developed from classical or highly pathogenic PRRSV following challenge with a highly pathogenic PRRSV strain.

    PubMed

    Wang, Gang; Yu, Ying; Zhang, Chong; Tu, Yabin; Tong, Jie; Liu, Yonggang; Chang, Yafei; Jiang, Chenggang; Wang, Shujie; Zhou, En-Min; Cai, Xuehui

    2016-09-01

    Modified live virus vaccines (MLVs) are used on swine farms to control porcine reproductive and respiratory syndrome virus (PRRSV). MLVs from classical PRRSV (C-PRRSV) provide some protection against emergent highly pathogenic PRRSV (HP-PRRSV). This study characterized the protective efficacy and immune response to MLVs from C-PRRSV (CH-1R) or HP-PRRSV (HuN4-F112) in a challenge using HP-PRRSV (HuN4). The outcomes were clinical signs of disease, pathological changes in the thymus and lungs, viremia, and humoral and cellular immune responses. CH-1R provided some protection against challenge with HuN4, while HuN4-F112 was protective in the HuN4 challenge. Compared to unvaccinated piglets, the vaccinated piglets had milder symptoms and fewer pathological changes in the lung and thymus. Piglets vaccinated with HuN4-F112 had higher antibody titers and lower viral loads than piglets vaccinated with CH-1R post challenge. The differences in outcome between the MLVs suggested that underlying differences in the immune responses might warrant further study. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Hydrodynamic immunization leads to poor CD8 T-cell expansion, low frequency of memory CTLs and ineffective antiviral protection.

    PubMed

    Obeng-Adjei, N; Choo, D K; Weiner, D B

    2013-10-01

    Hepatotropic pathogens, such as hepatitis B (HBV) and hepatitis C (HCV), often escape cellular immune clearance resulting in chronic infection. As HBV and HCV infections are the most common causes of hepatocellular carcinoma (HCC), prevention of these infections is believed to be key to the prevention of HCC. It is believed that an effective immune therapy must induce strong cytotonic T lymphocytes (CTLs) that can migrate into the liver, where they can clear infected hepatocytes. Here, we compared the induction of CD8 T cells by two different DNA immunization methods for T-cell differentiation, function, memory programming and their distribution within relevant tissues in a highly controlled fashion. We used hydrodynamic tail vein injection of plasmid to establish liver-specific LCMV-gp antigen (Ag) transient expression, and studied CD8 T cells induced using the P14 transgenic mouse model. CD8 T cells from this group exhibited unique and limited expansion, memory differentiation, polyfunctionality and cytotoxicity compared with T cells generated in intramuscularly immunized mice. This difference in liver-generated expansion resulted in lower memory CD8 T-cell frequency, leading to reduced protection against lethal viral challenge. These data show an unusual induction of naive CD8 T cells contributed to the lower frequency of Ag-specific CTLs observed after immunization in the liver, suggesting that limited priming in liver compared with peripheral tissues is responsible for this outcome.

  8. A novel alphavirus replicon-vectored vaccine delivered by adenovirus induces sterile immunity against classical swine fever.

    PubMed

    Sun, Yuan; Li, Hong-Yu; Tian, Da-Yong; Han, Qiu-Ying; Zhang, Xin; Li, Na; Qiu, Hua-Ji

    2011-10-26

    Low efficacy of gene-based vaccines due to inefficient gene delivery and expression has been major bottleneck of their applications. Efforts have been made to improve the efficacy, such as gene gun and electroporation, but the strategies are difficult to put into practical use. In this study, we developed and evaluated an adenovirus-delivered, alphavirus replicon-vectored vaccine (chimeric vector-based vaccine) expressing the E2 gene of classical swine fever virus (CSFV) (rAdV-SFV-E2). Rabbits immunized with rAdV-SFV-E2 developed CSFV-specific antibodies as early as 9 days and as long as 189 days and completely protected from challenge with C-strain. Pigs immunized with rAdV-SFV-E2 (n=5) developed robust humoral and cell-mediated responses to CSFV and were completely protected from subsequent lethal CSFV infection clinically and virologically. The level of immunity and protection induced by rAdV-SFV-E2 was comparable to that provided by the currently used live attenuated vaccine, C-strain. In contrast, both the conventional alphavirus replicon-vectored vaccine pSFV1CS-E2 and conventional adenovirus-vectored vaccine rAdV-E2 provided incomplete protection. The chimeric vector-based vaccine represents the first gene-based vaccine that is able to confer sterile immunity and complete protection against CSFV. The new-concept vaccination strategy may also be valuable in vaccine development against other pathogens. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Mucosal priming of newborn mice with S. Typhi Ty21a expressing anthrax protective antigen (PA) followed by parenteral PA-boost induces B and T cell-mediated immunity that protects against infection bypassing maternal antibodies

    PubMed Central

    Ramirez, Karina; Ditamo, Yanina; Galen, James E.; Baillie, Les W. J.; Pasetti, Marcela F.

    2010-01-01

    The currently licensed anthrax vaccine has several limitations and its efficacy has been proven only in adults. Effective immunization of newborns and infants requires adequate stimulation of their immune system, which is competent but not fully activated. We explored the use of the licensed live attenuated S. Typhi vaccine strain Ty21a expressing Bacillus anthracis protective antigen [Ty21a(PA)] followed PA-alum as a strategy for immunizing the pediatric population. Newborn mice primed with a single dose of Ty21a(PA) exhibited high frequencies of mucosal IgA-secreting B cells and IFN-γ-secreting T cells during the neonatal period, none of which was detected in newborns immunized with a single dose of PA-alum. Priming with Ty21a(PA) followed by PA-boost resulted in high levels of PA-specific IgG, toxin-neutralizing and opsonophagocytic antibodies and increased frequency of bone marrow IgG plasma cells and memory B cells compared with repeated immunization with PA-alum alone. Robust B and T cell responses developed even in the presence of maternal antibodies. The prime-boost protected against systemic and respiratory infection. Mucosal priming with a safe and effective S. Typhi-based anthrax vaccine followed by PA-boost could serve as a practical and effective prophylactic approach to prevent anthrax early in life. PMID:20619377

  10. Immune protection of microneme 7 (EmMIC7) against Eimeria maxima challenge in chickens.

    PubMed

    Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-10-01

    In the present study, the immune protective effects of recombinant microneme protein 7 of Eimeria maxima (rEmMIC7) and a DNA vaccine encoding this antigen (pVAX1-EmMIC7) on experimental challenge were evaluated. Two-week-old chickens were randomly divided into five groups. Experimental groups of chickens were immunized with 100 μg DNA vaccine pVAX1-MIC7 or 200 μg rEmMIC7, while control groups of chickens were injected with pVAX1 plasmid or sterile phosphate buffered saline (PBS). The results showed that the anti-EmMIC7 antibody titres in chickens of both rEmMIC7 and pVAX1-MIC7 groups were significantly higher as compared to PBS and pVAX1 control (P < .05). The splenocytes from both vaccinated groups of chickens displayed significantly greater proliferation response compared with the controls (P < .05). Serum from chickens immunized with pVAX1-MIC7 and rEmMIC7 displayed significantly high levels of interleukin-2, interferon-γ, IL-10, IL-17, tumour growth factor-β and IL-4 (P < .05) compared to those of negative controls. The challenge experiment results showed that both the recombinant antigen and the DNA vaccine could obviously alleviate jejunum lesions, body weight loss and enhance oocyst decrease ratio. The anti-coccidial index (ACI) of the pVAX1-MIC7 group was 167.84, higher than that of the recombinant MIC7 protein group, 167.10. Our data suggested that immunization with EmMIC7 was effective in imparting partial protection against E. maxima challenge in chickens and it could be an effective antigen candidate for the development of new vaccines against E. maxima.

  11. Vaccination with Eimeria tenella elongation factor-1α recombinant protein induces protective immunity against E. tenella and E. maxima infections.

    PubMed

    Lin, Rui-Qing; Lillehoj, Hyun S; Lee, Seung Kyoo; Oh, Sungtaek; Panebra, Alfredo; Lillehoj, Erik P

    2017-08-30

    Avian coccidiosis is caused by multiple species of the apicomplexan protozoan, Eimeria, and is one of the most economically devastating enteric diseases for the poultry industry worldwide. Host immunity to Eimeria infection, however, is relatively species-specific. The ability to immunize chickens against different species of Eimeria using a single vaccine will have a major beneficial impact on commercial poultry production. In this paper, we describe the molecular cloning, purification, and vaccination efficacy of a novel Eimeria vaccine candidate, elongation factor-1α (EF-1α). One day-old broiler chickens were given two subcutaneous immunizations one week apart with E. coli-expressed E. tenella recombinant (r)EF-1α protein and evaluated for protection against challenge infection with E. tenella or E. maxima. rEF-1α-vaccinated chickens exhibited increased body weight gains, decreased fecal oocyst output, and greater serum anti-EF-1α antibody levels following challenge infection with either E. tenella or E. maxima compared with unimmunized controls. Vaccination with EF-1α may represent a new approach to inducing cross-protective immunity against avian coccidiosis in the field. Published by Elsevier B.V.

  12. Factors that deregulate the protective immune response in tuberculosis.

    PubMed

    Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana

    2009-01-01

    Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.

  13. Protective Vaccine Efficacy of the Complete Form of PPE39 Protein from Mycobacterium tuberculosis Beijing/K Strain in Mice.

    PubMed

    Kim, Ahreum; Hur, Yun-Gyoung; Gu, Sunwha; Cho, Sang-Nae

    2017-11-01

    The aim of this study was to evaluate the protective efficacy of MTBK_24820, a complete form of PPE39 protein derived from a predominant Beijing/K strain of Mycobacterium tuberculosis in South Korea. Mice were immunized with MTKB_24820, M. bovis Bacilli Calmette-Guérin (BCG), or adjuvant prior to a high-dosed Beijing/K strain aerosol infection. After 4 and 9 weeks, bacterial loads were determined and histopathologic and immunologic features in the lungs and spleens of the M. tuberculosis -infected mice were analyzed. Putative immunogenic T-cell epitopes were examined using synthetic overlapping peptides. Successful immunization of MTBK_24820 in mice was confirmed by increased IgG responses ( P < 0.05) and recalled gamma interferon (IFN-γ), interleukin-2 (IL-2), IL-6, and IL-17 responses ( P < 0.05 or P < 0.01) to MTBK_24820. After challenge with the Beijing/K strain, an approximately 0.5 to 1.0 log 10 reduction in CFU in lungs and fewer lung inflammation lesions were observed in MTBK_24820-immunized mice compared to those for control mice. Moreover, MTBK_24820 immunization elicited significantly higher numbers of CD4 + T cells producing protective cytokines, such as IFN-γ and IL-17, in lungs and spleens ( P < 0.01) and CD4 + multifunctional T cells producing IFN-γ, tumor necrosis factor alpha (TNF-α), and/or IL-17 ( P < 0.01) than in control mice, suggesting protection comparable to that of BCG against the hypervirulent Beijing/K strain. The dominant immunogenic T-cell epitopes that induced IFN-γ production were at the N terminus (amino acids 85 to 102 and 217 to 234). Its vaccine potential, along with protective immune responses in vivo , may be informative for vaccine development, particularly in regions where the M. tuberculosis Beijing/K-strain is frequently isolated from TB patients. Copyright © 2017 American Society for Microbiology.

  14. Percutaneous Vaccination as an Effective Method of Delivery of MVA and MVA-Vectored Vaccines.

    PubMed

    Meseda, Clement A; Atukorale, Vajini; Kuhn, Jordan; Schmeisser, Falko; Weir, Jerry P

    2016-01-01

    The robustness of immune responses to an antigen could be dictated by the route of vaccine inoculation. Traditional smallpox vaccines, essentially vaccinia virus strains, that were used in the eradication of smallpox were administered by percutaneous inoculation (skin scarification). The modified vaccinia virus Ankara is licensed as a smallpox vaccine in Europe and Canada and currently undergoing clinical development in the United States. MVA is also being investigated as a vector for the delivery of heterologous genes for prophylactic or therapeutic immunization. Since MVA is replication-deficient, MVA and MVA-vectored vaccines are often inoculated through the intramuscular, intradermal or subcutaneous routes. Vaccine inoculation via the intramuscular, intradermal or subcutaneous routes requires the use of injection needles, and an estimated 10 to 20% of the population of the United States has needle phobia. Following an observation in our laboratory that a replication-deficient recombinant vaccinia virus derived from the New York City Board of Health strain elicited protective immune responses in a mouse model upon inoculation by tail scarification, we investigated whether MVA and MVA recombinants can elicit protective responses following percutaneous administration in mouse models. Our data suggest that MVA administered by percutaneous inoculation, elicited vaccinia-specific antibody responses, and protected mice from lethal vaccinia virus challenge, at levels comparable to or better than subcutaneous or intramuscular inoculation. High titers of specific neutralizing antibodies were elicited in mice inoculated with a recombinant MVA expressing the herpes simplex type 2 glycoprotein D after scarification. Similarly, a recombinant MVA expressing the hemagglutinin of attenuated influenza virus rgA/Viet Nam/1203/2004 (H5N1) elicited protective immune responses when administered at low doses by scarification. Taken together, our data suggest that MVA and MVA-vectored vaccines inoculated by scarification can elicit protective immune responses that are comparable to subcutaneous vaccination, and may allow for antigen sparing when vaccine supply is limited.

  15. THE EFFECT OF HEMOPHILUS INFLUENZAE SUIS VACCINES ON SWINE INFLUENZA

    PubMed Central

    Shope, Richard E.

    1937-01-01

    Either living or heat-killed H. influenzae suis vaccines, given intramuscularly to swine, elicit an immune response capable of modifying the course of a later swine influenza infection. The protection afforded is only partial and is in no way comparable to the complete immunity afforded by swine influenza virus vaccines. PMID:19870654

  16. Cross protective immune responses in nursing piglets infected with a US spike-insertion deletion porcine epidemic diarrhea virus strain and challenged with an original US PEDV strain.

    PubMed

    Annamalai, Thavamathi; Lin, Chun-Ming; Gao, Xiang; Liu, Xinsheng; Lu, Zhongyan; Saif, Linda J; Wang, Qiuhong

    2017-10-06

    We investigated cross-protective immunity of a US spike-insertion deletion porcine epidemic diarrhea virus (PEDV) Iowa106 (S-INDEL) strain against the original US PEDV (PC21A) strain in nursing piglets. Piglets were inoculated orally with S-INDEL, PC21A or mock. At 20-29 days post-inoculation (dpi), all pigs were challenged with the PC21A strain. The S-INDEL-inoculated pigs had lower ileal IgA antibody secreting cells, serum IgA and neutralizing antibody titers compared with PC21A-inoculated pigs. No pigs in the PC21A-group developed diarrhea, whereas 81 and 100% of pigs in the S-INDEL and mock-groups had diarrhea post challenge, respectively. S-INDEL induced partial protective immunity against the original US PEDV strain.

  17. Roles of CD4+ T Cells and Gamma Interferon in Protective Immunity against Babesia microti Infection in Mice

    PubMed Central

    Igarashi, Ikuo; Suzuki, Reiko; Waki, Seiji; Tagawa, Yoh-Ichi; Seng, Seyha; Tum, Sothyra; Omata, Yoshitaka; Saito, Atsushi; Nagasawa, Hideyuki; Iwakura, Yohichiro; Suzuki, Naoyoshi; Mikami, Takeshi; Toyoda, Yutaka

    1999-01-01

    Babesia microti produces a self-limiting infection in mice, and recovered mice are resistant to reinfection. In the present study, the role of T cells in protective immunity against challenge infection was examined. BALB/c mice which recovered from primary infection showed strong protective immunity against challenge infection. In contrast, nude mice which failed to control the primary infection and were cured with an antibabesial drug did not show protection against challenge infection. Treatment of immune mice with anti-CD4 monoclonal antibody (MAb) diminished the protective immunity against challenge infection, but treatment with anti-CD8 MAb had no effect on the protection. Transfer of CD4+ T-cell-depleted spleen cells resulted in higher parasitemia than transfer of CD8+ T-cell-depleted spleen cells. A high level of gamma interferon (IFN-γ), which was produced by CD4+ T cells, was observed for the culture supernatant of spleen cells from immune mice, and treatment of immune mice with anti-IFN-γ MAb partially reduced the protection. Moreover, no protection against challenge infection was found in IFN-γ-deficient mice. On the other hand, treatment of immune mice with MAbs against interleukin-2 (IL-2), IL-4, or tumor necrosis factor alpha did not affect protective immunity. These results suggest essential requirements for CD4+ T cells and IFN-γ in protective immunity against challenge infection with B. microti. PMID:10417185

  18. Latently and uninfected healthcare workers exposed to TB make protective antibodies against Mycobacterium tuberculosis.

    PubMed

    Li, Hao; Wang, Xing-Xing; Wang, Bin; Fu, Lei; Liu, Guan; Lu, Yu; Cao, Min; Huang, Hairong; Javid, Babak

    2017-05-09

    The role of Igs in natural protection against infection by Mycobacterium tuberculosis (Mtb), the causative agent of TB, is controversial. Although passive immunization with mAbs generated against mycobacterial antigens has shown protective efficacy in murine models of infection, studies in B cell-depleted animals only showed modest phenotypes. We do not know if humans make protective antibody responses. Here, we investigated whether healthcare workers in a Beijing TB hospital-who, although exposed to suprainfectious doses of pathogenic Mtb, remain healthy-make antibody responses that are effective in protecting against infection by Mtb. We tested antibodies isolated from 48 healthcare workers and compared these with 12 patients with active TB. We found that antibodies from 7 of 48 healthcare workers but none from active TB patients showed moderate protection against Mtb in an aerosol mouse challenge model. Intriguingly, three of seven healthcare workers who made protective antibody responses had no evidence of prior TB infection by IFN-γ release assay. There was also good correlation between protection observed in vivo and neutralization of Mtb in an in vitro human whole-blood assay. Antibodies mediating protection were directed against the surface of Mtb and depended on both immune complexes and CD4+ T cells for efficacy. Our results indicate that certain individuals make protective antibodies against Mtb and challenge paradigms about the nature of an effective immune response to TB.

  19. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  20. Systems analysis of protective immune responses to RTS,S malaria vaccination in humans

    PubMed Central

    Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali

    2017-01-01

    RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898

  1. Comparability of ELISA and toxin neutralization to measure immunogenicity of Protective Antigen in mice, as part of a potency test for anthrax vaccines.

    PubMed

    Parreiras, P M; Sirota, L A; Wagner, L D; Menzies, S L; Arciniega, J L

    2009-07-16

    Complexities of lethal challenge models have prompted the investigation of immunogenicity assays as potency tests of anthrax vaccines. An ELISA and a lethal toxin neutralization assay (TNA) were used to measure antibody response to Protective Antigen (PA) in mice immunized once with either a commercial or a recombinant PA (rPA) vaccine formulated in-house. Even though ELISA and TNA results showed correlation, ELISA results may not be able to accurately predict TNA results in this single immunization model.

  2. Development of live attenuated Streptococcus agalactiae vaccine for tilapia via continuous passage in vitro.

    PubMed

    Li, L P; Wang, R; Liang, W W; Huang, T; Huang, Y; Luo, F G; Lei, A Y; Chen, M; Gan, X

    2015-08-01

    Fish Streptococcus agalactiae (S. agalactiae) seriously harms the world's aquaculture industry and causes huge economic losses. This study aimed to develop a potential live attenuated vaccine of S. agalactiae. Pre-screened vaccine candidate strain S. agalactiae HN016 was used as starting material to generate an attenuated strain S. agalactiae YM001 by continuous passage in vitro. The biological characteristics, virulence, and stability of YM001 were detected, and the protective efficacy of YM001 immunization in tilapia was also determined. Our results indicated that the growth, staining, characteristics of pulsed-field gel electrophoresis (PFGE) genotype, and virulence of YM001 were changed significantly as compared to the parental strain HN016. High doses of YM001 by intraperitoneal (IP) injection (1.0 × 10(9) CFU/fish) and oral gavage (1.0 × 10(10) CFU/fish) respectively did not cause any mortality and morbidity in tilapia. The relative percent survivals (RPSs) of fishes immunized with YM001 (1.0 × 10(8) CFU/fish, one time) via injection, immersion, and oral administration were 96.88, 67.22, and 71.81%, respectively, at 15 days, and 93.61, 60.56, and 53.16%, respectively, at 30 days. In all tests with 1-3 times of immunization in tilapia, the dosages at 1 × 10(8) and 1 × 10(9) CFU/fish displayed the similar best results, whereas the immunoprotection of the dosages at 1 × 10(6) and 1 × 10(7) CFU/fish declined significantly (P < 0.01), and 1 × 10(5) CFU/fish hardly displayed any protective effect. In addition, the efficacy of 2-3 times of immunization was significantly higher than that of single immunization (P < 0.01) while no significant difference in the efficacy between twice and thrice of immunization was seen (P > 0.05). The level of protective antibody elicited by oral immunization was significantly higher compared to that of the control group (P < 0.01), and the antibody reached their maximum levels 14-21 days after the immunization but decreased significantly after 28 days of vaccination. YM001 bacteria were isolated from the brain, liver, kidney, and spleen tissues of fish after oral immunization and the bacteria existed for the longest time in the spleen (up to 15 days). Taken together, this study obtained a safe, stable, and highly immunogenic attenuated S. agalactiae strain YM001; oral immunization of tilapia with this strain produced a good immune protection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Tetanus vaccination with a dissolving microneedle patch confers protective immune responses in pregnancy.

    PubMed

    Esser, E Stein; Romanyuk, AndreyA; Vassilieva, Elena V; Jacob, Joshy; Prausnitz, Mark R; Compans, Richard W; Skountzou, Ioanna

    2016-08-28

    Maternal and neonatal tetanus claim tens of thousands lives every year in developing countries, but could be prevented by hygienic practices and improved immunization of pregnant women. This study tested the hypothesis that skin vaccination can overcome the immunologically transformed state of pregnancy and enhance protective immunity to tetanus in mothers and their newborns. To achieve this goal, we developed microneedle patches (MNPs) that efficiently delivered unadjuvanted tetanus toxoid to skin of pregnant mice and demonstrated that this route induced superior immune responses in female mice conferring 100% survival to tetanus toxin challenge when compared to intramuscular vaccination. Mice born to MNP-vaccinated mothers showed detectable tetanus-specific IgG antibodies up to 12weeks of age and complete protection to tetanus toxin challenge up at 6weeks of age. In contrast, none of the 6-week old mice born to intramuscularly vaccinated mothers survived challenge. Although pregnant mice vaccinated with unadjuvanted tetanus toxoid had 30% lower IgG and IgG1 titers than mice vaccinated intramuscularly with Alum®-adjuvanted tetanus toxoid vaccine, IgG2a titers and antibody affinity maturation were similar between these groups. We conclude that skin immunization with MNPs containing unadjuvanted tetanus toxoid can confer potent protective efficacy to mothers and their offspring using a delivery method well suited for expanding vaccination coverage in developing countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Total Leishmania antigens with Poly(I:C) induce Th1 protective response.

    PubMed

    Sanchez, M V; Eliçabe, R J; Di Genaro, M S; Germanó, M J; Gea, S; García Bustos, M F; Salomón, M C; Scodeller, E A; Cargnelutti, D E

    2017-11-01

    Our proposal was to develop a vaccine based on total Leishmania antigens (TLA) adjuvanted with polyinosinic-polycytidylic acid [Poly(I:C)] able to induce a Th1 response which can provide protection against Leishmania infection. Mice were vaccinated with two doses of TLA-Poly(I:C) administered by subcutaneous route at 3-week interval. Humoral and cellular immune responses induced by the immunization were measured. The protective efficacy of the vaccine was evaluated by challenging mice with infective promastigotes of Leishmania (Leishmania) amazonensis into the footpad. Mice vaccinated with TLA-Poly(I:C) showed a high anti-Leishmania IgG titre, as well as increased IgG1 and IgG2a subclass titres compared with mice vaccinated with the TLA alone. The high IgG2a indicated a Th1 bias response induced by the TLA-Poly(I:C) immunization. Accordingly, the cellular immune response elicited by the formulation was characterized by an increased production of IFN-γ and no significant production of IL-4. The TLA-Poly(I:C) immunization elicited good protection, which was associated with decreased footpad swelling, a lower parasite load and a reduced histopathological alteration in the footpad. Our findings demonstrate a promising vaccine against cutaneous leishmaniasis that is relatively economic and easy to develop and which should be taken into account for preventing leishmaniasis in developing countries. © 2017 John Wiley & Sons Ltd.

  5. Immunity Elicited by an Experimental Vaccine Based on Recombinant Flagellin-Porcine Circovirus Type 2 Cap Fusion Protein in Piglets

    PubMed Central

    Wang, Jing; Wei, Li; Quan, Rong; Yang, Jiayu; Yan, Xu; Li, Zixuan; She, Ruiping; Hu, Fengjiao; Liu, Jue

    2016-01-01

    In a recent study, we reported that a recombinant protein from fusion expression of flagellin to porcine circovirus type 2 (PCV2) Cap induced robust humoral and cell-mediated immunity that afforded full protection for PCV2 infection using BALB/c mice. Here, we further evaluated the immunogenicity and protection of the recombinant protein using specific pathogen free (SPF) pigs. Twenty-five 3-week-old piglets without passively acquired immunity were divided into 5 groups. All piglets except negative controls were challenged with a virulent PCV2 at 21 days after booster vaccination and necropsied at 21 days post-challenge. Vaccination of piglets with the recombinant protein without adjuvant induced strong humoral and cellular immune responses as observed by high levels of PCV2-specific IgG antibodies and neutralizing antibodies, as well as frequencies of PCV2-specific IFN-γ-secreting cells that conferred good protection against PCV2 challenge, with significant reduced PCV2 viremia, mild lesions, low PCV2 antigen-positive cells, as well as improved body weight gain, comparable to piglets vaccinated with a commercial PCV2 subunit vaccine. These results further demonstrated that the recombinant flagellin-Cap fusion protein is capable of inducing solid protective humoral and cellular immunity when administered to pigs, thereby becoming an effective PCV2 vaccine candidate for control of PCV2 infection. PMID:26848967

  6. Infection with non-lethal West Nile virus Eg101 strain induces immunity that protects mice against the lethal West Nile virus NY99 strain.

    PubMed

    Kumar, Mukesh; O'Connell, Maile; Namekar, Madhuri; Nerurkar, Vivek R

    2014-06-06

    Herein we demonstrate that infection of mice with West Nile virus (WNV) Eg101 provides protective immunity against lethal challenge with WNV NY99. Our data demonstrated that WNV Eg101 is largely non-virulent in adult mice when compared to WNV NY99. By day 6 after infection, WNV-specific IgM and IgG antibodies, and neutralizing antibodies were detected in the serum of all WNV Eg101 infected mice. Plaque reduction neutralization test data demonstrated that serum from WNV Eg101 infected mice neutralized WNV Eg101 and WNV NY99 strains with similar efficiency. Three weeks after infection, WNV Eg101 immunized mice were challenged subcutaneously or intracranially with lethal dose of WNV NY99 and observed for additional three weeks. All the challenged mice were protected against disease and no morbidity and mortality was observed in any mice. In conclusion, our data for the first time demonstrate that infection of mice with WNV Eg101 induced high titers of WNV specific IgM and IgG antibodies, and cross-reactive neutralizing antibodies, and the resulting immunity protected all immunized animals from both subcutaneous and intracranial challenge with WNV NY99. These observations suggest that WNV Eg101 may be a suitable strain for the development of a vaccine in humans against virulent strains of WNV.

  7. TLR4 and TLR9 signals stimulate protective immunity against blood-stage Plasmodium yoelii infection in mice.

    PubMed

    Zhang, Yanjun; Zhu, Xiaotong; Feng, Yonghui; Pang, Wei; Qi, Zanmei; Cui, Liwang; Cao, Yaming

    2016-11-01

    The mechanisms regulating the induction of protective immunity against blood-stage malaria remain unclear. Resistant DBA/2 mouse develops a higher Th1 response compared with a susceptible BALB/c strain during Plasmodium yoelii (Py) infection. It is known that the T helper cell response is initiated and polarized by dendritic cells (DCs) of the innate immune system, during which TLR4 and TLR9 are important receptors for the innate recognition of the malaria parasite and its products. We hypothesized that TLR4/9 may play critical roles in the induction of protective immunity against Py infection. We used TLR4/9 antagonists and agonists to study their effects on mouse resistance to Py infection. We found that the administration of an antagonist prior to infection aggravated disease outcomes, impaired DC functions and suppressed the pro-inflammatory response to Py infection in resistant DBA/2 mice. Treatment with the TLR4 agonist lipopolysaccharide (LPS) but not TLR9 agonist significantly improved the survival rate of susceptible Py-infected BALB/c mice. LPS administration promoted the activation and expansion of DCs and drove a Th1-biased response. Our data demonstrate the important roles of TLR4/9 signals in inducing resistance to malaria parasites and provide evidence for the rational use of TLR agonists to potentiate protective immunity against Plasmodium infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Immune response to second vaccination series of hepatitis B virus among booster dose non-responders.

    PubMed

    Salama, Iman I; Sami, Samia M; Salama, Somaia I; Rabah, Thanaa Mahmoud; El Etreby, Lobna Ahmed; Abdel Hamid, Amany T; Elmosalami, Dalia; El Hariri, Hazem; Said, Zeinab N

    2016-04-07

    To evaluate the response to second vaccination series among post-booster sero-negative children who had previously received compulsory HBV vaccination. After given a booster dose to 1070 children, 103 of them failed to generate anamnestic response (anti-HBs <10 IU/L). Only 91/103 children received additional two doses of recombinant HBV vaccine (i.e. 2(nd) vaccination series) after 1 and 6 months post-booster. Blood sample was withdrawn aseptically one month later for quantitative assessment of anti-HBs to detect development of protective immune response (≥10 IU/L). Immunological vaccination failure was assigned to children who did not develop protective immune response after 2(nd) vaccination series. Protective immune response was detected among 84/91 children (92.3%). While 7/91 (7.7%) whose age were ≥10 years did not respond and had post-booster undetectable anti-HBs. About 80% of children with post-booster detectable anti-HBs showed significant protective immune response (anti-HBs ≥100 IU/L) and higher GMT (299.1 ± 3.6 IU/L) compared to those with undetectable 60% and 106.2 ± 12.9 IU/L respectively (P<0.05). No significant difference was detected as regards gender or residence, P>0.05. All children with history of rheumatic fever (7 children) or diabetes mellitus (1 child) developed immune response after 2(nd) vaccination series. A booster dose of HB vaccine may be unable to induce sufficient immunological response in children who had undetectable anti-HBs titers. Revaccination for non-responders is an important procedure to increase HBV protection rate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A CpG-Ficoll Nanoparticle Adjuvant for Anthrax Protective Antigen Enhances Immunogenicity and Provides Single-Immunization Protection against Inhaled Anthrax in Monkeys.

    PubMed

    Kachura, Melissa A; Hickle, Colin; Kell, Sariah A; Sathe, Atul; Calacsan, Carlo; Kiwan, Radwan; Hall, Brian; Milley, Robert; Ott, Gary; Coffman, Robert L; Kanzler, Holger; Campbell, John D

    2016-01-01

    Nanoparticulate delivery systems for vaccine adjuvants, designed to enhance targeting of secondary lymphoid organs and activation of APCs, have shown substantial promise for enhanced immunopotentiation. We investigated the adjuvant activity of synthetic oligonucleotides containing CpG-rich motifs linked to the sucrose polymer Ficoll, forming soluble 50-nm particles (DV230-Ficoll), each containing >100 molecules of the TLR9 ligand, DV230. DV230-Ficoll was evaluated as an adjuvant for a candidate vaccine for anthrax using recombinant protective Ag (rPA) from Bacillus anthracis. A single immunization with rPA plus DV230-Ficoll induced 10-fold higher titers of toxin-neutralizing Abs in cynomolgus monkeys at 2 wk compared with animals immunized with equivalent amounts of monomeric DV230. Monkeys immunized either once or twice with rPA plus DV230-Ficoll were completely protected from challenge with 200 LD50 aerosolized anthrax spores. In mice, DV230-Ficoll was more potent than DV230 for the induction of innate immune responses at the injection site and draining lymph nodes. DV230-Ficoll was preferentially colocalized with rPA in key APC populations and induced greater maturation marker expression (CD69 and CD86) on these cells and stronger germinal center B and T cell responses, relative to DV230. DV230-Ficoll was also preferentially retained at the injection site and draining lymph nodes and produced fewer systemic inflammatory responses. These findings support the development of DV230-Ficoll as an adjuvant platform, particularly for vaccines such as for anthrax, for which rapid induction of protective immunity and memory with a single injection is very important. Copyright © 2015 by The American Association of Immunologists, Inc.

  10. Fusion of antigen to a dendritic cell targeting chemokine combined with adjuvant yields a malaria DNA vaccine with enhanced protective capabilities.

    PubMed

    Luo, Kun; Zhang, Hong; Zavala, Fidel; Biragyn, Arya; Espinosa, Diego A; Markham, Richard B

    2014-01-01

    Although sterilizing immunity to malaria can be elicited by irradiated sporozoite vaccination, no clinically practical subunit vaccine has been shown to be capable of preventing the approximately 600,000 annual deaths attributed to this infection. DNA vaccines offer several potential advantages for a disease that primarily affects the developing world, but new approaches are needed to improve the immunogenicity of these vaccines. By using a novel, lipid-based adjuvant, Vaxfectin, to attract immune cells to the immunization site, in combination with an antigen-chemokine DNA construct designed to target antigen to immature dendritic cells, we elicited a humoral immune response that provided sterilizing immunity to malaria challenge in a mouse model system. The chemokine, MIP3αCCL20, did not significantly enhance the cellular infiltrate or levels of cytokine or chemokine expression at the immunization site but acted with Vaxfectin to reduce liver stage malaria infection by orders of magnitude compared to vaccine constructs lacking the chemokine component. The levels of protection achieved were equivalent to those observed with irradiated sporozoites, a candidate vaccine undergoing development for further large scale clinical trial. Only vaccination with the combined regimen of adjuvant and chemokine provided 80-100% protection against the development of bloodstream infection. Treating the immunization process as requiring the independent steps of 1) attracting antigen-presenting cells to the site of immunization and 2) specifically directing vaccine antigen to the immature dendritic cells that initiate the adaptive immune response may provide a rational strategy for the development of a clinically applicable malaria DNA vaccine.

  11. Maternal Immunization with Chimpanzee Adenovirus Expressing RSV Fusion Protein Protects Against Neonatal RSV Pulmonary Infection

    PubMed Central

    Sharma, Anurag; Wendland, Rebecca; Sung, Biin; Wu, Wendy; Grunwald, Thomas; Worgall, Stefan

    2014-01-01

    Respiratory syncytial virus (RSV) is a leading cause of lower respiratory tract disease with high morbidity and mortality in young infants and children. Despite numerous efforts, a licensed vaccine against RSV remains elusive. Since young infants form the primary target group of RSV disease, maternal immunization to boost the protection in neonates is an attractive strategy. In this study we tested the efficacy of maternal immunization with a chimpanzee adenovirus expressing codon-optimized RSV fusion protein (AdC7-Fsyn) to protect infants against RSV infection. Single intranasal immunization of mice by AdC7-Fsyn induced robust anti-RSV systemic and mucosal immunity that protected against RSV without causing vaccine-enhanced RSV disease. RSV humoral immunity was transferred to pups born to immunized mothers that provided protection against RSV. Immunization with AdC7-Fsyn was effective even in the presence of Ad5 preimmunity. The maternally derived immunity was durable with the half-life of 14.63 days that reduced the viral replication up to 15 weeks of age. Notably, the passively immunized mice could be actively re-immunized with AdC7-Fsyn to boost and extend the protection. This substantiates maternal immunization with an AdC7-based vaccine expressing RSV F as feasible approach to protect against RSV early in life. PMID:25171847

  12. Galectin-1-Driven Tolerogenic Programs Aggravate Yersinia enterocolitica Infection by Repressing Antibacterial Immunity.

    PubMed

    Davicino, Roberto C; Méndez-Huergo, Santiago P; Eliçabe, Ricardo J; Stupirski, Juan C; Autenrieth, Ingo; Di Genaro, María S; Rabinovich, Gabriel A

    2017-08-15

    Yersinia enterocolitica is an enteropathogenic bacterium that causes gastrointestinal disorders, as well as extraintestinal manifestations. To subvert the host's immune response, Y. enterocolitica uses a type III secretion system consisting of an injectisome and effector proteins, called Yersinia outer proteins (Yops), that modulate activation, signaling, and survival of immune cells. In this article, we show that galectin-1 (Gal-1), an immunoregulatory lectin widely expressed in mucosal tissues, contributes to Y. enterocolitica pathogenicity by undermining protective antibacterial responses. We found higher expression of Gal-1 in the spleen and Peyer's patches of mice infected orogastrically with Y. enterocolitica serotype O:8 compared with noninfected hosts. This effect was prevented when mice were infected with Y. enterocolitica lacking YopP or YopH, two critical effectors involved in bacterial immune evasion. Consistent with a regulatory role for this lectin during Y. enterocolitica pathogenesis, mice lacking Gal-1 showed increased weight and survival, lower bacterial load, and attenuated intestinal pathology compared with wild-type mice. These protective effects involved modulation of NF-κB activation, TNF production, and NO synthesis in mucosal tissue and macrophages, as well as systemic dysregulation of IL-17 and IFN-γ responses. In vivo neutralization of these proinflammatory cytokines impaired bacterial clearance and eliminated host protection conferred by Gal-1 deficiency. Finally, supplementation of recombinant Gal-1 in mice lacking Gal-1 or treatment of wild-type mice with a neutralizing anti-Gal-1 mAb confirmed the immune inhibitory role of this endogenous lectin during Y. enterocolitica infection. Thus, targeting Gal-1-glycan interactions may contribute to reinforce antibacterial responses by reprogramming innate and adaptive immune mechanisms. Copyright © 2017 by The American Association of Immunologists, Inc.

  13. Protective Effect of Immunization with Heat-Labile Enterotoxin in Gnotobiotic Rats Monocontaminated with Enterotoxigenic Escherichia coli

    PubMed Central

    Klipstein, Frederick A.; Engert, Richard F.; Short, Helen B.

    1980-01-01

    The protective effect of active immunization with a purified preparation of the polymyxin-release form of Escherichia coli heat-labile enterotoxin (LT), administered using a parenteral prime and peroral boosts given after ablation of gastric secretion by means of cimetidine, was assessed in gnotobiotic rats which were challenged by monocontamination with enterotoxigenic strains of E. coli. Water transport was evaluated by the in vivo marker perfusion technique at weekly intervals over a 3-week period after contamination. Water transport in unimmunized control rats was consistently in absorption in those contaminated by a nontoxigenic strain, in secretion during only week 2 in those contaminated by an LT+/− strain, in secretion during weeks 2 and 3 in those contaminated by an LT+/ST+ (heat-stable enterotoxin) strain, and consistently in absorption in those contaminated by an −/ST+ strain. Rats immunized with a booster dosage of 250 μg had a significant increase (P < 0.001) in net water absorption as compared to unimmunized rats, with values in the borderline range of absorption, when challenged with either the LT+/− or LT+/ST+ strains. Rats immunized with a 10-fold-higher boosting dosage had a significant increase (P < 0.001) in net water absorption as compared to those boosted at the lower dosage; water absorption was within the normal range. There was no difference between the ileal bacterial counts of unimmunized and immunized rats challenged by the various strains. These observations indicate that this immunization program provides complete protection in an animal model against challenge by intestinal contamination with enterotoxigenic strains of E. coli which produce LT, either alone or in combination with ST. PMID:6991436

  14. Amino acid residues 196-225 of LcrV represent a plague protective epitope.

    PubMed

    Quenee, Lauriane E; Berube, Bryan J; Segal, Joshua; Elli, Derek; Ciletti, Nancy A; Anderson, Deborah; Schneewind, Olaf

    2010-02-17

    LcrV, a protein that resides at the tip of the type III secretion needles of Yersinia pestis, is the single most important plague protective antigen. Earlier work reported monoclonal antibody MAb 7.3, which binds a conformational epitope of LcrV and protects experimental animals against lethal plague challenge. By screening monoclonal antibodies directed against LcrV for their ability to protect immunized mice against bubonic plague challenge, we examined here the possibility of additional protective epitopes. MAb BA5 protected animals against plague, neutralized the Y. pestis type III secretion pathway and promoted opsonophagocytic clearance of bacteria in blood. LcrV residues 196-225 were necessary and sufficient for MAb BA5 binding. Compared to full-length LcrV, a variant lacking its residues 196-225 retained the ability of eliciting plague protection. These results identify LcrV residues 196-225 as a linear epitope that is recognized by the murine immune system to confer plague protection. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  15. Amino acid residues 196–225 of LcrV represent a plague protective epitope

    PubMed Central

    Quenee, Lauriane E.; Berube, Bryan J.; Segal, Joshua; Elli, Derek; Ciletti, Nancy A.; Anderson, Deborah; Schneewind, Olaf

    2010-01-01

    LcrV, a protein that resides at the tip of the type III secretion needles of Yersinia pestis, is the single most important plague protective antigen. Earlier work reported monoclonal antibody MAb 7.3, which binds a conformational epitope of LcrV and protects experimental animals against lethal plague challenge. By screening monoclonal antibodies directed against LcrV for their ability to protect immunized mice against bubonic plague challenge, we examined here the possibility of additional protective epitopes. MAb BA5 protected animals against plague, neutralized the Y. pestis type III secretion pathway and promoted opsonophagocytic clearance of bacteria in blood. LcrV residues 196–225 were necessary and sufficient for MAb-BA5 binding. Compared to full length LcrV, a variant lacking its residues 196–225 retained the ability of eliciting plague protection. These results identify LcrV residues 196–225 as a linear epitope that is recognized by the murine immune system to confer plague protection. PMID:20005318

  16. Active Immunization with Pneumolysin versus 23-Valent Polysaccharide Vaccine for Streptococcus pneumoniae Keratitis

    PubMed Central

    Norcross, Erin W.; Sanders, Melissa E.; Moore, Quincy C.; Taylor, Sidney D.; Tullos, Nathan A.; Caston, Rhonda R.; Dixon, Sherrina N.; Nahm, Moon H.; Burton, Robert L.; Thompson, Hilary; McDaniel, Larry S.

    2011-01-01

    Purpose. The purpose of this study was to determine whether active immunization against pneumolysin (PLY), or polysaccharide capsule, protects against the corneal damage associated with Streptococcus pneumoniae keratitis. Methods. New Zealand White rabbits were actively immunized with Freund's adjuvant mixed with pneumolysin toxoid (ψPLY), Pneumovax 23 (PPSV23; Merck, Whitehouse Station, NJ), or phosphate-buffered saline (PBS), before corneal infection with 105 colony-forming units (CFU) of S. pneumoniae. Serotype-specific rabbit polyclonal antisera or mock antisera were passively administered to rabbits before either intravenous infection with 1011 CFU S. pneumoniae or corneal infection with 105 CFU of S. pneumoniae. Results. After active immunization, clinical scores of corneas of the rabbits immunized with ψPLY and Freund's adjuvant were significantly lower than scores of the rabbits that were mock immunized with PBS and Freund's adjuvant or with PPSV23 and Freund's adjuvant at 48 hours after infection (P ≤ 0.0010), whereas rabbits immunized with PPSV23 and Freund's adjuvant failed to show differences in clinical scores compared with those in mock-immunized rabbits (P = 1.00) at 24 and 48 hours after infection. Antisera from rabbits actively immunized with PPSV23 and Freund's adjuvant were nonopsonizing. Bacterial loads recovered from infected corneas were higher for the ψPLY- and PPSV23-immunized rabbits after infection with WU2, when compared with the mock-immunized rabbits (P ≤ 0.007). Conversely, after infection with K1443, the ψPLY-immunized rabbits had lower bacterial loads than the control rabbits (P = 0.0008). Quantitation of IgG, IgA, and IgM in the sera of ψPLY-immunized rabbits showed high concentrations of PLY-specific IgG. Furthermore, anti-PLY IgG purified from ψPLY-immunized rabbits neutralized the cytolytic effects of PLY on human corneal epithelial cells. Passive administration of serotype-specific antisera capable of opsonizing and killing S. pneumoniae protected against pneumococcal bacteremia (P ≤ 0.05), but not against keratitis (P ≥ 0.476). Conclusions. Active immunization with pneumococcal capsular polysaccharide and Freund's adjuvant fails to produce opsonizing antibodies, and passive administration of serotype specific opsonizing antibodies offers no protection against pneumococcal keratitis in the rabbit, whereas active immunization with the conserved protein virulence factor PLY and Freund's adjuvant is able to reduce corneal inflammation associated with pneumococcal keratitis, but has variable effects on bacterial loads in the cornea. PMID:22039231

  17. Comparison of the immunogenicity and protection against bovine tuberculosis following immunization by BCG-priming and boosting with adenovirus or protein based vaccines.

    PubMed

    Dean, G; Whelan, A; Clifford, D; Salguero, F J; Xing, Z; Gilbert, S; McShane, H; Hewinson, R G; Vordermeier, M; Villarreal-Ramos, B

    2014-03-05

    There is a requirement for vaccines or vaccination strategies that confer better protection against TB than the current live attenuated Mycobacterium bovis Bacillus Calmette-Guerin (BCG) vaccine for use in cattle. Boosting with recombinant viral vectors expressing mycobacterial proteins, such as Ag85A, has shown a degree of promise as a strategy for improving on the protection afforded by BCG. Experiments in small animal models have indicated that broadening the immune response to include mycobacterial antigens other than Ag85A, such as Rv0288, induced by boosting with Ad5 constructs has a direct effect on the protection afforded against TB. Here, we compared the immunogenicity and protection against challenge with M. bovis afforded by boosting BCG-vaccinated cattle with a human type 5 (Ad5)-based vaccine expressing the mycobacterial antigens Ag85A (Ad5-85A); or Ag85A, Rv0251, Rv0287 and Rv0288 (Ad5-TBF); or with protein TBF emulsified in adjuvant (Adj-TBF). Boosting with TBF broaden the immune response. The kinetics of Ad5-TBF and Adj-TBF were shown to be different, with effector T cell responses from the latter developing more slowly but being more durable than those induced by Ad5-TBF. No increase in protection compared to BCG alone was afforded by Ad5-TBF or Adj-TBF by gross pathology or bacteriology. Using histopathology, as a novel parameter of protection, we show that boosting BCG vaccinated cattle with Ad5-85A induced significantly better protection than BCG alone. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  18. Influence of Route of Administration on Immediate and Extended Protection in Rats Immunized with Escherichia coli Heat-Labile Enterotoxin

    PubMed Central

    Klipstein, Frederick A.; Engert, Richard F.

    1980-01-01

    The effect of route of administration, dosage, and number of boosts employed during immunization with the polymyxin-release form of Escherichia coli heat-labile (LT) enterotoxin on the degree and duration of protection afforded was evaluated in rats which were challenged by the ligated loop technique. Increasing the boosting dosage by fivefold from 50 to 250 μg resulted in a marked increase in protection against challenge with toxin in rats immunized either just by the parenteral route (i.p./i.p.) or by a parenteral prime, followed by peroral boosts (i.p./p.o.) in rats pretreated with cimetidine to ablate gastric secretions; such was not the case, however, even with a 50-fold increase in dosage in rats immunized just by the peroral route (p.o./p.o.). Four weekly peroral boosts were required to achieve the strongest degree of protection. Increasing the boosting dosage also increased the degree of protection against challenge with viable LT+/ST− and LT+/ST+ strains (ST indicates heat-stable enterotoxin) in rats immunized by the i.p./p.o., but not by the i.p./i.p., route; no protection was evident against an LT−/ST+ strain. Protection was lost within 3 weeks after immunization in rats immunized by the i.p./i.p. route. In contrast, protection was extended over the 3-month observation period in those immunized by the i.p./p.o. route; the degree of protection was enhanced in rats which received an additional boost at 2 months. These observations establish the fact that immunization with LT is similar to that with cholera toxin in that arousal of the local immune intestinal response by means of peroral immunization provides maximal extended protection. PMID:6987180

  19. First insights into the protective effects of a recombinant swinepox virus expressing truncated MRP of Streptococcus suis type 2 in mice.

    PubMed

    Huang, Dongyan; Zhu, Haodan; Lin, Huixing; Xu, Jiarong; Lu, Chengping

    2012-01-01

    To explore the potential of the swinepox virus (SPV) as vector for Streptococcus suis vaccines, a vector system was developed for the construction of a recombinant SPV carrying bacterial genes. Using this system, a recombinant virus expressing truncated muramidase-released protein (MRP) of S. suis type 2 (SS2), designated rSPV-MRP, was produced and identified by PCR, western blotting and immunofluorescence assays. The rSPV-MRP was found to be only slightly attenuated in PK-15 cells, when compared with the wild-type virus. After immunization intramuscularly with rSPV-MRP, SS2 inactive vaccine (positive control), wild-type SPV (negative control) and PBS (blank control) respectively, all CD1 mice were challenged with a lethal dose or a sublethal dose of SS2 highly virulent strain ZY05719. While SS2 inactive vaccine protected all mice, immunization with rSPV-MRP resulted in 60% survival and protected mice against a lethal dose of the highly virulent SS2 strain, compared with the negative control (P < 0.05). Our data indicate that animals immunized with rSPV-MRP had a significantly reduced bacterial burden in all organs examined, compared to negative controls and blank controls (P <0.05). Antibody titers of the rSPV-MRP-vaccinated group were significantly higher (P <0.001), when compared to negative controls and blank controls. Antibody titers were also significantly higher in the vaccinated group at all time points post-vaccination (P <0.001), compared with the positive controls. These initial results demonstrated that the rSPV-MRP provided mice with protection from systemic SS2 infection. If SPV recombinants have the potential as S. suis vaccines for the use in pigs has to be evaluated in further studies.

  20. Evaluation of immune responses to combined hepatitis A and B vaccine in HIV-infected children and children on immunosuppressive medication.

    PubMed

    Belderok, Sanne-Meike; Sonder, Gerard J B; van Rossum, Marion; van Dijk-Hummelman, Annette; Hartwig, Nico; Scherpbier, Henriette; Geelen, Sibyl; Speksnijder, Arjen G C L; Baaten, Gijs; van den Hoek, Anneke

    2013-08-28

    A phase IV interventional study with a combined hepatitis A and B vaccine was conducted in HIV-infected children and children receiving immunosuppressive medication for treatment of rheumatic diseases to evaluate immune responses. Both groups (1-16 years of age) received combined (inactivated) HAV and (rDNA) HBV vaccine Ambirix(®) at months 0 and 6. Serum samples were taken at four time points and tested for anti-HAV and anti-HBs antibodies. Anti-HAV concentrations ≥20 mIU/mL or anti-HBs concentrations ≥10 mIU/mL were considered protective. Seropositivity percentages were calculated and geometric mean concentrations (GMCs) were compared by nonparametric Mann-Whitney U-test or Kruskal-Wallis one-way-analysis-of-variance. Of 80 HIV-infected children who completed the study, 67 were HAV-susceptible and 68 HBV-susceptible at enrolment. Of 80 children with rheumatic diseases who completed the study, 65 were HAV-susceptible and 74 HBV-susceptible at enrolment. Immune responses to HAV after first dose of vaccine in both study groups were low: 71% and 55% respectively, whereas immune responses after the second dose were 99% and 100% respectively. Immune response to HBV after first dose of vaccine in both groups was also low: 27% and 17% respectively. Immune responses after the second dose were 97% and 93%, respectively. A larger proportion of children on combination antiretroviral therapy (cART) and of children with viral load <50 copies/mL responded to HBV, and also showed a significantly higher GMC. Although immune response after full series of combined HAV and HBV vaccine in both groups was excellent and comparable to healthy children, a substantial proportion of both groups was not protected for HAV after first dose of vaccine. This protection gap is especially important for HAV in travel health and postexposure prophylactic treatment: both groups of children should be serologically tested for anti-HAV prior to travel to ensure protection if there is no time to await second dose of vaccine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Construction of recombinant Mip-FlaA dominant epitope vaccine against Legionella pneumophila and evaluation of the immunogenicity and protective immunity.

    PubMed

    He, Jinlei; Zhang, Junrong; He, Yanxia; Huang, Fan; Li, Jiao; Chen, Qiwei; Chen, Dali; Chen, Jianping

    2016-02-01

    Legionnaires' disease, a kind of systemic disease with pneumonia as the main manifestation, is caused by Legionella pneumophila (L. pneumophila). In order to prevent the disease, we optimized Mip and FlaA, the virulence factors of L. pneumophila, to design recombinant Mip-FlaA dominant epitope vaccine against the pathogen. Firstly, the coding sequences of mip and flaA were optimized by DNAStar software and Expasy protein analysis system, and then, the tertiary structure and function of recombinant Mip-FlaA were predicted by PHYRE2 Protein Fold Recognition Server. After that, the optimized mip, flaA and mip-flaA were cloned, expressed and purified, and the proteins were used as dominant epitope vaccines to immunize BABL/c mice. Moreover, the IgG titers, histological changes in lung and the level of TNF-α, IFN-γ, IL-6 and IL-1β were detected to reflect the immunogenicity and protective immunity of the vaccines. The results of SDS-PAGE and Western blot proved the recombinant Mip-FlaA was successfully expressed. ELISA results of IgG titers and these cytokines showed Mip-FlaA group was capable to induce the strongest immune response, compared to PBS, Mip and FlaA groups. In addition, histopathology analysis demonstrated the mice immunized with Mip-FlaA showed better immune protection. Therefore, the work indicated that the above-described biological tools were useful in optimization of epitope vaccine. Antigenic characterization and immune protection of recombinant Mip-FlaA would be of great value in understanding the immunopathogenesis of the disease and in developing possible vaccine against the pathogen.

  2. Effect of size and temperature at vaccination on immunization and protection conferred by a live attenuated Francisella noatunensis immersion vaccine in red hybrid tilapia.

    PubMed

    Soto, Esteban; Brown, Nicholas; Gardenfors, Zackarias O; Yount, Shaun; Revan, Floyd; Francis, Stewart; Kearney, Michael T; Camus, Alvin

    2014-12-01

    Francisella noatunensis subsp. orientalis (Fno) is a pleomorphic, facultative intracellular, Gram-negative, emerging bacterial pathogen of marine and fresh water fish with worldwide distribution. In this study, the efficacy of an attenuated Fno intracellular growth locus C (iglC) mutant was evaluated for use as a live immersion vaccine, when administered to hybrid tilapia at two different stages of growth (5 g fry and 10 g fingerlings) and at two temperatures (25 °C and 30 °C). To determine vaccine efficacy, mortality, days to first death, and Fno genome equivalents (GE) in the spleens of survivors, as well as serum and mucus antibody levels, were evaluated after 30 d in fish challenged with a wild type virulent strain. Both size and temperature at vaccination played an important role in immunization and protection. Fry vaccinated at 25 °C were not protected when compared to non-vaccinated fry at 25 °C (p = 0.870). In contrast, 5 g fry vaccinated at 30 °C were significantly protected compared to non-vaccinated fry at 30 °C (p = 0.038). Although lower mortalities occurred, 10 g fingerlings vaccinated at 25 °C were not protected, compared to non-vaccinated fingerlings at 25 °C (p = 0.328), while, 10 g fingerlings vaccinated at 30 °C were significantly protected, compared to non-vaccinated fingerlings at 30 °C (p = 0.038). Additionally, overall mortality of 5 g fish was significantly higher than in 10 g fish. Mortality was also significantly higher in fish subjected to a 30 to 25 °C temperature change one week prior to challenge, than in fish maintained at the same temperature during vaccination and challenge. This information demonstrates that both temperature and size at vaccination are important factors when implementing immunization prophylaxis in cultured tilapia.

  3. Modelling the effects of booster dose vaccination schedules and recommendations for public health immunization programs: the case of Haemophilus influenzae serotype b.

    PubMed

    Charania, Nadia A; Moghadas, Seyed M

    2017-09-13

    Haemophilus influenzae serotype b (Hib) has yet to be eliminated despite the implementation of routine infant immunization programs. There is no consensus regarding the number of primary vaccine doses and an optimal schedule for the booster dose. We sought to evaluate the effect of a booster dose after receiving the primary series on the long-term disease incidence. A stochastic model of Hib transmission dynamics was constructed to compare the long-term impact of a booster vaccination and different booster schedules after receiving the primary series on the incidence of carriage and symptomatic disease. We parameterized the model with available estimates for the efficacy of Hib conjugate vaccine and durations of both vaccine-induced and naturally acquired immunity. We found that administering a booster dose substantially reduced the population burden of Hib disease compared to the scenario of only receiving the primary series. Comparing the schedules, the incidence of carriage for a 2-year delay (on average) in booster vaccination was comparable or lower than that observed for the scenario of booster dose within 1 year after primary series. The temporal reduction of symptomatic disease was similar in the two booster schedules, suggesting no superiority of one schedule over the other in terms of reducing the incidence of symptomatic disease. The findings underscore the importance of a booster vaccination for continued decline of Hib incidence. When the primary series provides a high level of protection temporarily, delaying the booster dose (still within the average duration of protection conferred by the primary series) may be beneficial to maintain longer-term protection levels and decelerate the decline of herd immunity in the population.

  4. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    PubMed

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  5. Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88.

    PubMed

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; Benmohamed, Lbachir

    2012-11-01

    Targeting of the mucosal immune system of the genital tract with subunit vaccines has failed to induce potent and durable local CD8(+) T cell immunity, which is crucial for protection against many sexually transmitted viral pathogens, including HSV type 2 (HSV-2), which causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8(+) T cell immunity to protect the female genital tract from herpes. The lipopeptide vaccine and the rAdv5 vaccine express the immunodominant HSV-2 CD8(+) T cell epitope (gB(498-505)), and both were delivered intravaginally in the progesterone-induced B6 mouse model of genital herpes. Compared with mice immunized with the homologous lipopeptide/lipopeptide (Lipo/Lipo) vaccine, the Lipo/rAdv5 prime/boost immunized mice 1) developed potent and sustained HSV-specific CD8(+) T cells, detected in both the genital tract draining nodes and in the vaginal mucosa; 2) had significantly lower virus titers; 3) had decreased overt signs of genital herpes disease; and 4) did not succumb to lethal infection (p < 0.005) after intravaginal HSV-2 challenge. Polyfunctional CD8(+) T cells, producing IFN-γ, TNF-α, and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8(+) T cell response was significantly compromised in the absence of the adapter MyD88 (p = 0.0001). Taken together, these findings indicate that targeting of the vaginal mucosa with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8(+) T cell protective immunity against sexually transmitted herpes infection and disease.

  6. Towards development of novel immunization strategies against leishmaniasis using PLGA nanoparticles loaded with kinetoplastid membrane protein-11.

    PubMed

    Santos, Diego M; Carneiro, Marcia W; de Moura, Tatiana R; Fukutani, Kiyoshi; Clarencio, Jorge; Soto, Manuel; Espuelas, Socorro; Brodskyn, Claudia; Barral, Aldina; Barral-Netto, Manoel; de Oliveira, Camila I

    2012-01-01

    Vaccine development has been a priority in the fight against leishmaniases, which are vector-borne diseases caused by Leishmania protozoa. Among the different immunization strategies employed to date is inoculation of plasmid DNA coding for parasite antigens, which has a demonstrated ability to induce humoral and cellular immune responses. In this sense, inoculation of plasmid DNA encoding Leishmania kinetoplasmid membrane protein-11 (KMP-11) was able to confer protection against visceral leishmaniasis. However, recently the use of antigen delivery systems such as poly(lactic-co-glycolic acid) (PLGA) nanoparticles has also proven effective for eliciting protective immune responses. In the present work, we tested two immunization strategies with the goal of obtaining protection, in terms of lesion development and parasite load, against cutaneous leishmaniasis caused by L. braziliensis. One strategy involved immunization with plasmid DNA encoding L. infantum chagasi KMP-11. Alternatively, mice were primed with PLGA nanoparticles loaded with the recombinant plasmid DNA and boosted using PLGA nanoparticles loaded with recombinant KMP-11. Both immunization strategies elicited detectable cellular immune responses with the presence of both proinflammatory and anti-inflammatory cytokines; mice receiving the recombinant PLGA nanoparticle formulations also demonstrated anti-KMP-11 IgG1 and IgG2a. Mice were then challenged with L. braziliensis, in the presence of sand fly saliva. Lesion development was not inhibited following either immunization strategy. However, immunization with PLGA nanoparticles resulted in a more prominent reduction in parasite load at the infection site when compared with immunization using plasmid DNA alone. This effect was associated with a local increase in interferon-gamma and in tumor necrosis factor-alpha. Both immunization strategies also resulted in a lower parasite load in the draining lymph nodes, albeit not significantly. Our results encourage the pursuit of immunization strategies employing nanobased delivery systems for vaccine development against cutaneous leishmaniasis caused by L. braziliensis infection.

  7. A single immunization with a dry powder anthrax vaccine protects rabbits against lethal aerosol challenge

    PubMed Central

    Klas, S.D.; Petrie, C.R.; Warwood, S.J.; Williams, M.S.; Olds, C.L.; Stenz, J.P.; Cheff, A.M.; Hinchcliffe, M.; Richardson, C.; Wimer, S.

    2009-01-01

    Here we confirm that intranasal (IN) dry powder anthrax vaccine formulations are able to protect rabbits against aerosol challenge 9 weeks after a single immunization. The optimum dose of rPA in our dry powder anthrax vaccine formulation in rabbits was experimentally determined to be 150 μg and therefore was chosen as the target dose for all subsequent experiments. Rabbits received a single dose of either 150 μg rPA, 150 μg rPA + 150 μg of a conjugated 10-mer peptide representing the B. anthracis capsule (conj), or 150 μg of conj alone. All dry powder formulations contained MPL and chitosan (ChiSys®). Significant anti-rPA titers and anthrax lethal toxin neutralizing antibody (TNA) levels were seen with both rPA containing vaccines, although rPA-specific IgG and TNA levels were reduced in rabbits immunized with rPA plus conj. Nine weeks after immunization, rabbits were exposed to a mean aerosol challenge dose of 278 LD50 of Ames spores. Groups immunized with rPA or with rPA + conj had significant increases in survivor proportions compared to the negative control group by Logrank test (p = 0.0001 and 0.003, respectively), and survival was not statistically different for the rPA and rPA + conj immunized groups (p = 0.63). These data demonstrate that a single immunization with our dry powder anthrax vaccine can protect against a lethal aerosol spore challenge 9 weeks later. PMID:18703110

  8. A single immunization with a dry powder anthrax vaccine protects rabbits against lethal aerosol challenge.

    PubMed

    Klas, S D; Petrie, C R; Warwood, S J; Williams, M S; Olds, C L; Stenz, J P; Cheff, A M; Hinchcliffe, M; Richardson, C; Wimer, S

    2008-10-09

    Here we confirm that intranasal (IN) dry powder anthrax vaccine formulations are able to protect rabbits against aerosol challenge 9 weeks after a single immunization. The optimum dose of rPA in our dry powder anthrax vaccine formulation in rabbits was experimentally determined to be 150microg and therefore was chosen as the target dose for all subsequent experiments. Rabbits received a single dose of either 150microg rPA, 150microg rPA+150microg of a conjugated 10-mer peptide representing the Bacillus anthracis capsule (conj), or 150microg of conj alone. All dry powder formulations contained MPL and chitosan (ChiSys). Significant anti-rPA titers and anthrax lethal toxin neutralizing antibody (TNA) levels were seen with both rPA containing vaccines, although rPA-specific IgG and TNA levels were reduced in rabbits immunized with rPA plus conj. Nine weeks after immunization, rabbits were exposed to a mean aerosol challenge dose of 278 LD50 of Ames spores. Groups immunized with rPA or with rPA+conj had significant increases in survivor proportions compared to the negative control group by Logrank test (p=0.0001 and 0.003, respectively), and survival was not statistically different for the rPA and rPA+conj immunized groups (p=0.63). These data demonstrate that a single immunization with our dry powder anthrax vaccine can protect against a lethal aerosol spore challenge 9 weeks later.

  9. Effect of oral booster vaccination of rainbow trout against Yersinia ruckeri depends on type of primary immunization.

    PubMed

    Jaafar, Rzgar M; Al-Jubury, Azmi; Dalsgaard, Inger; MohammadKarami, Asma; Kania, Per W; Buchmann, Kurt

    2017-10-31

    Vaccination of rainbow trout against Enteric Redmouth Disease (ERM) caused by Yersinia ruckeri can be successfully performed by administering vaccine (a bacterin consisting of formalin killed bacteria) by immersion, bath or injection. Booster immunization is known to increase the protection of fish already primed by one of these vaccination methods. Oral vaccination of trout (administering vaccine in feed) is an even more convenient way of presenting antigen to the fish but the effect of an oral booster has not previously been described in detail. The present work describes to what extent protection may be enhanced by oral boostering following priming with different administration methods. The study confirms that vaccination by 30 s dip into a bacterin (diluted 1:10) may confer a significant protection compared to non-vaccinated fish. The immunity may be optimized by booster immunization either provided as dip (most effective), bath (less effective) or orally (least effective). Oral immunization may be used as booster after dip but applied as a single oral application it induced merely a slight and statistically non-significant response. It is noteworthy that primary oral immunization followed by an oral booster vaccination showed a trend for an even weaker response. It should be investigated if continued exposure to a low antigen concentration - as performed by two oral immunizations - may induce tolerance to the pathogen and thereby leave the fish more vulnerable. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Unique IL-13Rα2-based HIV-1 vaccine strategy to enhance mucosal immunity, CD8(+) T-cell avidity and protective immunity.

    PubMed

    Ranasinghe, C; Trivedi, S; Stambas, J; Jackson, R J

    2013-11-01

    We have established that mucosal immunization can generate high-avidity human immunodeficiency virus (HIV)-specific CD8(+) T cells compared with systemic immunization, and interleukin (IL)-13 is detrimental to the functional avidity of these T cells. We have now constructed two unique recombinant HIV-1 vaccines that co-express soluble or membrane-bound forms of the IL-13 receptor α2 (IL-13Rα2), which can "transiently" block IL-13 activity at the vaccination site causing wild-type animals to behave similar to an IL-13 KO animal. Following intranasal/intramuscular prime-boost immunization, these IL-13Rα2-adjuvanted vaccines have shown to induce (i) enhanced HIV-specific CD8(+) T cells with higher functional avidity, with broader cytokine/chemokine profiles and greater protective immunity using a surrogate mucosal HIV-1 challenge, and also (ii) excellent multifunctional mucosal CD8(+) T-cell responses, in the lung, genito-rectal nodes (GN), and Peyer's patch (PP). Data revealed that intranasal delivery of these IL-13Rα2-adjuvanted HIV vaccines recruited large numbers of unique antigen-presenting cell subsets to the lung mucosae, ultimately promoting the induction of high-avidity CD8(+) T cells. We believe our novel IL-13R cytokine trap vaccine strategy offers great promise for not only HIV-1, but also as a platform technology against range of chronic infections that require strong sustained high-avidity mucosal/systemic immunity for protection.

  11. Feasibilty of in utero DNA vaccination following naked gene transfer into pig fetal muscle: transgene expression, immunity and safety.

    PubMed

    Rinaldi, Monica; Signori, Emanuela; Rosati, Paolo; Cannelli, Giorgio; Parrella, Paola; Iannace, Enrico; Monego, Giovanni; Ciafrè, Silvia Anna; Farace, Maria Giulia; Iurescia, Sandra; Fioretti, Daniela; Rasi, Guido; Fazio, Vito Michele

    2006-05-22

    The high toll of death among first-week infants is due to infections occurring at the end of pregnancy, during birth or by breastfeeding. This problem significantly concerns industrialized countries also. To prevent the typical "first-week infections", a vaccine would be protective as early as at the birth. In utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. We have already published results of a 2-year follow-up showing long-term safety, protective antibody titers at birth and long-term immune memory, following intramuscular in utero anti-HBV DNA immunization in 90-days pig fetuses. We have now analyzed further parameters of short-term safety. Two different reporter genes were injected in the thigh muscles of 90-days fetuses. At 8 days following DNA injection, we found high-level of transgenes expression in all injected fetuses. A step gradient of expression from the area of injection was observed with both reporter genes. CMV promoter/enhancer produced higher levels of expression compared to SV40 promoter/enhancer. Moreover, no evidence of local or systemic flogistic alterations or fetal malformations, mortality or haemorrhage following intramuscular injection were observed. A single anti-HBV s-antigen DNA immunization in 90-days fetuses supported protective antibody levels in all immunized newborns, lasting at least up to 4 months after birth. Our report further sustains safety and efficacy of intramuscular in utero naked gene transfer and immunization. This approach may support therapeutic or prophylactic procedure in many early life-threatening pathologic conditions.

  12. The magnitude of local immunity in the lungs of mice induced by live attenuated influenza vaccines is determined by local viral replication and induction of cytokines.

    PubMed

    Lau, Yuk-Fai; Santos, Celia; Torres-Vélez, Fernando J; Subbarao, Kanta

    2011-01-01

    While live attenuated influenza vaccines (LAIVs) have been shown to be efficacious and have been licensed for human use, the surface glycoproteins hemagglutinin (HA) and neuraminidase (NA) have to be updated for optimal protective efficacy. Little is known about the effect of different HA and NA proteins on the immunogenicity of LAIVs developed using the same backbone. A panel of LAIVs that share the internal protein genes, with unique HA and NA gene segments from different influenza subtypes, was rescued by reverse genetics, and a comparative study of immune responses induced by these vaccines was conducted in mice. The results suggest that the magnitude of lung immunity, including pulmonary IgA antibody and memory CD8(+) T lymphocytes, induced by the vaccines depends on the replication efficiency of the LAIVs, as well as the induction of cytokines/chemokines in the lungs. However, these factors are not important in determining systemic immunity such as serum antibody titers and memory CD8(+) T cells in the spleen. A qualitative analysis of immune responses induced by a single dose of an H5N1 LAIV revealed that the vaccine induced robust systemic and mucosal immunity in mice. In addition, antibodies and memory lymphocytes established in the lungs following vaccination were required for protection against lethal challenge with homologous and heterologous H5N1 viruses. Our results highlight the different requirements for inducing systemic and lung immunity that can be explored for the development of pulmonary immunity for protection against respiratory pathogens.

  13. Friends and foes of tuberculosis: modulation of protective immunity.

    PubMed

    Brighenti, Susanna; Joosten, Simone A

    2018-05-27

    Protective immunity in tuberculosis (TB) is subject of debate in the TB research community, as this is key to fully understand TB pathogenesis and to develop new promising tools for TB diagnosis and prognosis as well as a more efficient TB vaccine. IFN-γ producing CD4 + T cells are key in TB control, but may not be sufficient to provide protection. Additional subsets have been identified that contribute to protection such as multifunctional and cytolytic T cell subsets, including classical and non-classical T cells as well as novel innate immune cell subsets resulting from trained immunity. However, to define protective immune responses against TB, the complexity of balancing TB immunity also has to be considered. In this review, insights in effector cell immunity and how this is modulated by regulatory cells, associated comorbidities and the host microbiome is discussed. We systematically map how different suppressive immune cell subsets may affect effector cell responses at the local site of infection. We also dissect how common co-morbidities such as HIV, helminthes and diabetes may bias protective TB immunity towards pathogenic and regulatory responses. Finally, also the composition and diversity of the microbiome in the lung and gut could affect host TB immunity. Understanding these various aspects of the immunological balance in the human host is fundamental to prevent TB infection and disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  14. Immunization with antigenic extracts of Leishmania associated with Montanide ISA 763 adjuvant induces partial protection in BALB/c mice against Leishmania (Leishmania) amazonensis infection.

    PubMed

    Cargnelutti, Diego Esteban; Salomón, María Cristina; Celedon, Verónica; García Bustos, María Fernanda; Morea, Gastón; Cuello-Carrión, Fernando Darío; Scodeller, Eduardo Alberto

    2016-02-01

    A proper adjuvant has a relevant role in vaccine formulations to generate an effective immune response. In this study, total Leishmania antigen (TLA) formulated with Montanide ISA 763 or R848 as adjuvants were evaluated as a first generation Leishmania vaccine in a murine model. Immunization protocols were tested in BALB/c mice with a subcutaneous prime/boost regimen with an interval of 3 weeks. Mice immunized with unadjuvanted TLA and phosphate-buffered saline (PBS) served as control groups. On Day 21 and Day 36 of the protocol, we evaluated the humoral immune response induced by each formulation. Fifteen days after the boost, the immunized mice were challenged with 1 × 10(5) promastigotes of Leishmania (Leishmania) amazonensis in the right footpad (RFP). The progress of the infection was followed for 10 weeks; at the end of this period, histopathological studies were performed in the RFP. Vaccines formulated with Montanide ISA 763 generated an increase in the production of immunoglobulin G (IgG; p < 0.05) compared with the control group. There were no statistically significant differences in IgG1 production between the study groups. However, immunization with TLA-Montanide ISA 763 resulted in an increase in IgG2a compared to the unadjuvanted control (p < 0.001). Also noteworthy was the fact that a significant reduction in swelling and histopathological damage of the RFP was recorded with the Montanide ISA 763 formulation. We conclude that the immunization of BALB/c mice with a vaccine formulated with TLA and Montanide ISA 763 generated a protective immune response against L. (L.) amazonensis, characterized by an intense production of IgG2a. Copyright © 2014. Published by Elsevier B.V.

  15. Orally administered adenoviral-based vaccine induces respiratory mucosal memory and protection against RSV infection in cotton rats.

    PubMed

    Joyce, Christina; Scallan, Ciaran D; Mateo, Roberto; Belshe, Robert B; Tucker, Sean N; Moore, Anne C

    2018-06-09

    A vaccine against Respiratory Syncytial Virus (RSV) is a major unmet need to prevent the significant morbidity and mortality that it causes in society. In addition to efficacy, such a vaccine must not induce adverse events, as previously occurred with a formalin-inactivated vaccine (FI-RSV). In this study, the safety, immunogenicity and efficacy of a molecularly adjuvanted adenovirus serotype 5 based RSV vaccine encoding the fusion (F) protein (Ad-RSVF) is demonstrated in cotton rats. Protective immunity to RSV was induced by Ad-RSVF when administered by an oral route as well as by intranasal and intramuscular routes. Compared to FI-RSV, the Ad-RSVF vaccine induced significantly greater neutralizing antibody responses and protection against RSV infection. Significantly, oral or intranasal immunization each induced protective multi-functional effector and memory B cell responses in the respiratory tract. This study uniquely demonstrates the capacity of an orally administered adenovirus vaccine to induce protective immunity in the respiratory tract against RSV in a pre-clinical model and supports further clinical development of this oral Ad-RSVF vaccine strategy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Immunization of Mice with Anthrax Protective Antigen Limits Cardiotoxicity but Not Hepatotoxicity Following Lethal Toxin Challenge.

    PubMed

    Devera, T Scott; Prusator, Dawn K; Joshi, Sunil K; Ballard, Jimmy D; Lang, Mark L

    2015-06-25

    Protective immunity against anthrax is inferred from measurement of vaccine antigen-specific neutralizing antibody titers in serum samples. In animal models, in vivo challenges with toxin and/or spores can also be performed. However, neither of these approaches considers toxin-induced damage to specific organ systems. It is therefore important to determine to what extent anthrax vaccines and existing or candidate adjuvants can provide organ-specific protection against intoxication. We therefore compared the ability of Alum, CpG DNA and the CD1d ligand α-galactosylceramide (αGC) to enhance protective antigen-specific antibody titers, to protect mice against challenge with lethal toxin, and to block cardiotoxicity and hepatotoxicity. By measurement of serum cardiac Troponin I (cTnI), and hepatic alanine aminotransferase (ALT), and aspartate aminotransferase (AST), it was apparent that neither vaccine modality prevented hepatic intoxication, despite high Ab titers and ultimate survival of the subject. In contrast, cardiotoxicity was greatly diminished by prior immunization. This shows that a vaccine that confers survival following toxin exposure may still have an associated morbidity. We propose that organ-specific intoxication should be monitored routinely during research into new vaccine modalities.

  17. Establishing a small animal model for evaluating protective immunity against mumps virus.

    PubMed

    Pickar, Adrian; Xu, Pei; Elson, Andrew; Zengel, James; Sauder, Christian; Rubin, Steve; He, Biao

    2017-01-01

    Although mumps vaccines have been used for several decades, protective immune correlates have not been defined. Recently, mumps outbreaks have occurred in vaccinated populations. To better understand the causes of the outbreaks and to develop means to control outbreaks in mumps vaccine immunized populations, defining protective immune correlates will be critical. Unfortunately, no small animal model for assessing mumps immunity exists. In this study, we evaluated use of type I interferon (IFN) alpha/beta receptor knockout mice (IFN-α/βR-/-) for such a model. We found these mice to be susceptible to mumps virus administered intranasally and intracranially. Passive transfer of purified IgG from immunized mice protected naïve mice from mumps virus infection, confirming the role of antibody in protection and demonstrating the potential for this model to evaluate mumps immunity.

  18. Induction of protective neutralizing antibody responses against botulinum neurotoxin serotype C using plasmid carried by PLGA nanoparticles.

    PubMed

    Ruwona, Tinashe B; Xu, Haiyue; Li, Junwei; Diaz-Arévalo, Diana; Kumar, Amit; Zeng, Mingtao; Cui, Zhengrong

    2016-05-03

    Botulinum neurotoxin (BoNT) is a lethal neurotoxin, for which there is currently not an approved vaccine. Recent efforts in developing vaccine candidates against botulism have been directed at the heavy chain fragment of BoNT, because antibodies against this region have been shown to prevent BoNT from binding to its receptor and thus to nerve cell surface, offering protection against BoNT intoxication. In the present study, it was shown that immunization with plasmid DNA that encodes the 50 KDa C-terminal fragment of the heavy chain of BoNT serotype C (i.e., BoNT/C-Hc50) and is carried by cationic poly (lactic-co-glycolic) acid (PLGA) nanoparticles induces stronger BoNT/C-specific antibody responses, as compared to immunization with the plasmid alone. Importantly, the antibodies have BoNT/C-neutralizing activity, protecting the immunized mice from a lethal dose of BoNT/C challenge. A plasmid DNA vaccine encoding the Hc50 fragments of BoNT serotypes that cause human botulism may represent a viable vaccine candidate for protecting against botulinum neurotoxin intoxication.

  19. Microneedle delivery of an M2e-TLR5 ligand fusion protein to skin confers broadly cross-protective influenza immunity.

    PubMed

    Wang, Bao-Zhong; Gill, Harvinder S; He, Cheng; Ou, Changbo; Wang, Li; Wang, Ying-Chun; Feng, Hao; Zhang, Han; Prausnitz, Mark R; Compans, Richard W

    2014-03-28

    Influenza vaccines with broad cross-protection are urgently needed to prevent an emerging influenza pandemic. A fusion protein of the Toll-like receptor (TLR) 5-agonist domains from flagellin and multiple repeats of the conserved extracellular domain of the influenza matrix protein 2 (M2e) was constructed, purified and evaluated as such a vaccine. A painless vaccination method suitable for possible self-administration using coated microneedle arrays was investigated for skin-targeted delivery of the fusion protein in a mouse model. The results demonstrate that microneedle immunization induced strong humoral as well as mucosal antibody responses and conferred complete protection against homo- and heterosubtypic lethal virus challenges. Protective efficacy with microneedles was found to be significantly better than that seen with conventional intramuscular injection, and comparable to that observed with intranasal immunization. Because of its advantages for administration, safety and storage, microneedle delivery of M2e-flagellin fusion protein is a promising approach for an easy-to-administer universal influenza vaccine. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Immunization against leishmaniasis by PLGA nanospheres encapsulated with autoclaved Leishmania major (ALM) and CpG-ODN.

    PubMed

    Tafaghodi, Mohsen; Khamesipour, Ali; Jaafari, Mahmoud R

    2011-05-01

    Various adjuvants and delivery systems have been evaluated for increasing the protective immune responses against leishmaniasis and mostly have been shown not to be effective enough. In this study, poly(D,L-lactide-co-glycolide) (PLGA) nanospheres as an antigen delivery system and CpG-ODN as an immunoadjuvant have been used for the first time to enhance the immune response against autoclaved Leishmania major (ALM). PLGA nanospheres were prepared by a double-emulsion (W/O/W) technique. Particulate characteristics were studied by scanning electron microscopy and particle size analysis. Mean diameter of ALM + CpG-ODN-loaded nanospheres was 300 ± 128 nm. BALB/c mice were immunized three times in 3-week intervals using ALM plus CpG-ODN-loaded nanospheres [(ALM + CpG-ODN)(PLGA)], ALM encapsulated PLGA nanospheres [(ALM)(PLGA)], (ALM)(PLGA) + CpG, ALM + CpG, ALM alone, or phosphate buffer solution (PBS). The intensity of infection induced by L. major challenge was assessed by measuring size of footpad swelling. The strongest protection, showed by significantly (P<0.05) smaller footpad, was observed in mice immunized with (ALM + CpG-ODN)(PLGA). The (ALM)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG were also showed a significantly (P<0.05) smaller footpad swelling compared to the groups received either PBS or ALM alone. The mice immunized with (ALM + CpG-ODN)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG showed the highest IgG2a/IgG1 ratio, interferon-γ production, and lowest interleukin-4 production compared to the other groups. It is concluded that when both PLGA nanospheres and CpG-ODN adjuvants were used simultaneously, it induce stronger immune response and enhance protection rate against Leishmania infection.

  1. Oral immunization with a novel attenuated Salmonella Typhimurium encoding influenza HA, M2e and NA antigens protects chickens against H7N9 infection.

    PubMed

    Kim, Je Hyoung; Hajam, Irshad Ahmed; Lee, John Hwa

    2018-02-01

    Attenuated Salmonella strains constitute a promising technology for the development of efficient protein-based influenza vaccines. H7N9, a low pathogenic avian influenza (LPAI) virus, is a major public health concern and currently there are no effective vaccines against this subtype. Herein, we constructed a novel attenuated Salmonella Typhimurium strain for the delivery and expression of H7N9 hemagglutinin (HA), neuraminidase (NA) or the conserved extracellular domain of the matrix protein 2 (M2e). We demonstrated that the constructed Salmonella strains exhibited efficient HA, NA and M2e expressions, respectively, and the constructs were safe and immunogenic in chickens. Our results showed that chickens immunized once orally with Salmonella (Sal) mutants encoding HA (Sal-HA), M2e (Sal-M2e) or NA (Sal-NA), administered either alone or in combination, induced both antigen-specific humoral and cell mediated immune (CMI) responses, and protected chickens against the lethal H7N9 challenge. However, chickens immunized with Sal-HA+Sal-M2e+Sal-NA vaccine constructs exhibited efficient mucosal and CMI responses compared to the chickens that received only Sal-HA, Sal-M2e or Sal-M2e+Sal-NA vaccine. Further, chickens immunized with Sal-HA+Sal-M2e+Sal-NA constructs cleared H7N9 infection at a faster rate compared to the chickens that were vaccinated with Sal-HA, Sal-M2e or Sal-M2e+Sal-NA, as indicated by the reduced viral shedding in cloacal swabs of the immunized chickens. We conclude that this vaccination strategy, based on HA, M2e and NA, stimulated efficient induction of immune protection against the lethal H7N9 LPAI virus and, therefore, further studies are warranted to develop this approach as a potential prophylaxis against LPAI viruses affecting poultry birds.

  2. Pertussis Maternal Immunization: Narrowing the Knowledge Gaps on the Duration of Transferred Protective Immunity and on Vaccination Frequency

    PubMed Central

    Gaillard, María Emilia; Bottero, Daniela; Zurita, María Eugenia; Carriquiriborde, Francisco; Martin Aispuro, Pablo; Bartel, Erika; Sabater-Martínez, David; Bravo, María Sol; Castuma, Celina; Hozbor, Daniela Flavia

    2017-01-01

    Maternal safety through pertussis vaccination and subsequent maternal–fetal-antibody transfer are well documented, but information on infant protection from pertussis by such antibodies and by subsequent vaccinations is scarce. Since mice are used extensively for maternal-vaccination studies, we adopted that model to narrow those gaps in our understanding of maternal pertussis immunization. Accordingly, we vaccinated female mice with commercial acellular pertussis (aP) vaccine and measured offspring protection against Bordetella pertussis challenge and specific-antibody levels with or without revaccination. Maternal immunization protected the offspring against pertussis, with that immune protection transferred to the offspring lasting for several weeks, as evidenced by a reduction (4–5 logs, p < 0.001) in the colony-forming-units recovered from the lungs of 16-week-old offspring. Moreover, maternal-vaccination-acquired immunity from the first pregnancy still conferred protection to offspring up to the fourth pregnancy. Under the conditions of our experimental protocol, protection to offspring from the aP-induced immunity is transferred both transplacentally and through breastfeeding. Adoptive-transfer experiments demonstrated that transferred antibodies were more responsible for the protection detected in offspring than transferred whole spleen cells. In contrast to reported findings, the protection transferred was not lost after the vaccination of infant mice with the same or other vaccine preparations, and conversely, the immunity transferred from mothers did not interfere with the protection conferred by infant vaccination with the same or different vaccines. These results indicated that aP-vaccine immunization of pregnant female mice conferred protective immunity that is transferred both transplacentally and via offspring breastfeeding without compromising the protection boostered by subsequent infant vaccination. These results—though admittedly not necessarily immediately extrapolatable to humans—nevertheless enabled us to test hypotheses under controlled conditions through detailed sampling and data collection. These findings will hopefully refine hypotheses that can then be validated in subsequent human studies. PMID:28932228

  3. BVDV vaccination in North America: risks versus benefits.

    PubMed

    Griebel, Philip J

    2015-06-01

    The control and prevention of bovine viral diarrhea virus (BVDV) infections has provided substantial challenges. Viral genetic variation, persistent infections, and viral tropism for immune cells have complicated disease control strategies. Vaccination has, however, provided an effective tool to prevent acute systemic infections and increase reproductive efficiency through fetal protection. There has been substantial controversy about the safety and efficacy of BVDV vaccines, especially when comparing killed versus modified-live viral (MLV) vaccines. Furthermore, numerous vaccination protocols have been proposed to protect the fetus and ensure maternal antibody transfer to the calf. These issues have been further complicated by reports of immune suppression during natural infections and following vaccination. While killed BVDV vaccines provide the greatest safety, their limited immunogenicity makes multiple vaccinations necessary. In contrast, MLV BVDV vaccines induce a broader range of immune responses with a longer duration of immunity, but require strategic vaccination to minimize potential risks. Vaccination strategies for breeding females and young calves, in the face of maternal antibody, are discussed. With intranasal vaccination of young calves it is possible to avoid maternal antibody interference and induce immune memory that persists for 6-8 months. Thus, with an integrated vaccination protocol for both breeding cows and calves it is possible to maximize disease protection while minimizing vaccine risks.

  4. Effects of Postchallenge Administration of ST-246 on Dissemination of IHD-J-Luc Vaccinia Virus in Normal Mice and in Immune-Deficient Mice Reconstituted with T Cells

    PubMed Central

    Shotwell, Elisabeth; Scott, John; Cruz, Stephanie; King, Lisa R.; Manischewitz, Jody; Diaz, Claudia G.; Jordan, Robert A.; Grosenbach, Douglas W.; Golding, Hana

    2013-01-01

    Whole-body bioimaging was used to study dissemination of vaccinia virus (VACV) in normal and in immune deficient (nu−/nu−) mice protected from lethality by postchallenge administration of ST-246. Total fluxes were recorded in the liver, spleen, lungs, and nasal cavities of live mice after intranasal infection with a recombinant IHD-J-Luc VACV expressing luciferase. Areas under the flux curve were calculated for individual mice to assess viral loads. Treatment for 2 to 5 days of normal BALB/c mice with ST-246 at 100 mg/kg starting 24 h postchallenge conferred 100% protection and reduced viral loads in four organs compared to control mice. Mice also survived after 5 days of treatment with ST-246 at 30 mg/kg, and yet the viral loads and poxes were higher in these mice compared to 100-mg/kg treatment group. Nude mice were not protected by ST-246 alone or by 10 million adoptively transferred T cells. In contrast, nude mice that received T cells and 7-day treatment with ST-246 survived infection and exhibited reduced viral loads compared to nonreconstituted and ST-246-treated mice after ST-246 was stopped. Similar protection of nude mice was achieved using adoptively transferred 1.0 and 0.1 million, but not 0.01 million, purified T cells or CD4+ or CD8+ T cells in conjunction with ST-246 treatment. These data suggest that ST-246 protects immunocompetent mice from lethality and reduces viral dissemination in internal organs and poxvirus lesions. Furthermore, immune-deficient animals with partial T cell reconstitution can control virus replication after a course of ST-246 and survive lethal vaccinia virus challenge. PMID:23468500

  5. Blocking herpes simplex virus 2 glycoprotein E immune evasion as an approach to enhance efficacy of a trivalent subunit antigen vaccine for genital herpes.

    PubMed

    Awasthi, Sita; Huang, Jialing; Shaw, Carolyn; Friedman, Harvey M

    2014-08-01

    Herpes simplex virus 2 (HSV-2) subunit antigen vaccines targeting virus entry molecules have failed to prevent genital herpes in human trials. Our approach is to include a virus entry molecule and add antigens that block HSV-2 immune evasion. HSV-2 glycoprotein C (gC2) is an immune evasion molecule that inhibits complement. We previously reported that adding gC2 to gD2 improved vaccine efficacy compared to the efficacy of either antigen alone in mice and guinea pigs. Here we demonstrate that HSV-2 glycoprotein E (gE2) functions as an immune evasion molecule by binding the IgG Fc domain. HSV-2 gE2 is synergistic with gC2 in protecting the virus from antibody and complement neutralization. Antibodies produced by immunization with gE2 blocked gE2-mediated IgG Fc binding and cell-to-cell spread. Mice immunized with gE2 were only partially protected against HSV-2 vaginal challenge in mice; however, when gE2 was added to gC2/gD2 to form a trivalent vaccine, neutralizing antibody titers with and without complement were significantly higher than those produced by gD2 alone. Importantly, the trivalent vaccine protected the dorsal root ganglia (DRG) of 32/33 (97%) mice between days 2 and 7 postchallenge, compared with 27/33 (82%) in the gD2 group. The HSV-2 DNA copy number was significantly lower in mice immunized with the trivalent vaccine than in those immunized with gD2 alone. The extent of DRG protection using the trivalent vaccine was better than what we previously reported for gC2/gD2 immunization. Therefore, gE2 is a candidate antigen for inclusion in a multivalent subunit vaccine that attempts to block HSV-2 immune evasion. Herpes simplex virus is the most common cause of genital ulcer disease worldwide. Infection results in emotional distress for infected individuals and their partners, is life threatening for infants exposed to herpes during childbirth, and greatly increases the risk of individuals acquiring and transmitting HIV infection. A vaccine that prevents genital herpes infection will have major public health benefits. Our vaccine approach includes strategies to prevent the virus from evading immune attack. Mice were immunized with a trivalent vaccine containing an antigen that induces antibodies to block virus entry and two antigens that induce antibodies that block immune evasion from antibody and complement. Immunized mice demonstrated no genital disease, and 32/33 (97%) animals had no evidence of infection of dorsal root ganglia, suggesting that the vaccine may prevent the establishment of latency and recurrent infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Independent and interactive effects of immune activation and larval diet on adult immune function, growth and development in the greater wax moth (Galleria mellonella).

    PubMed

    Kangassalo, Katariina; Valtonen, Terhi M; Sorvari, Jouni; Kecko, Sanita; Pölkki, Mari; Krams, Indrikis; Krama, Tatjana; Rantala, Markus J

    2018-06-29

    Organisms in the wild are likely to face multiple immune challenges as well as additional ecological stressors, yet their interactive effects on immune function are poorly understood. Insects are found to respond to cues of increased infection risk by enhancing their immune capacity. However, such adaptive plasticity in immune function may be limited by physiological and environmental constraints. Here, we investigated the effects of two environmental stressors - poor larval diet and an artificial parasite-like immune challenge at the pupal stage - on adult immune function, growth and development in the greater wax moth (Galleria mellonella). Males whose immune system was activated with an artificial parasite-like immune challenge had weaker immune response - measured as strength of encapsulation response - as adults compared to the control groups, but only when raised in high-nutrition larval diet. Immune activation did not negatively affect adult immune response in males reared in low-nutrition larval diet, indicating that poor larval diet improved the capacity of the insects to respond to repeated immune challenges. Low-nutrition larval diet also had a positive independent effect on immune capacity in females, yet it negatively affected development time and adult body mass in both sexes. As in the nature immune challenges are rarely isolated, and adverse nutritional environment may indicate an elevated risk of infection, resilience to repeated immune challenges as a response to poor nutritional environment could provide a significant fitness advantage. The present study highlights the importance of considering environmental context when investigating effects of immune activation in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. Co-administration of rIpaB domain of Shigella with rGroEL of S. Typhi enhances the immune responses and protective efficacy against Shigella infection.

    PubMed

    Chitradevi, Sekar Tamil Selvi; Kaur, Gurpreet; Uppalapati, Sivaramakrishna; Yadav, Anandprakash; Singh, Dependrapratap; Bansal, Anju

    2015-11-01

    Shigella species cause severe bacillary dysentery in humans and are associated with high morbidity and mortality. The Invasion plasmid antigen (IpaB) protein, which is conserved across all Shigella spp., induces macrophage cell death and is required to invade host cells. The present study evaluates the immunogenicity and protective efficacy of the recombinant (r) domain region of IpaB (rIpaB) of S. flexneri. rIpaB was administered either alone or was co-administered with the rGroEL (heat shock protein 60) protein from S. Typhi as an adjuvant in a mouse model of intranasal immunization. The IpaB domain region (37 kDa) of S. flexneri was amplified from an invasion plasmid, cloned, expressed in BL21 Escherichia coli cells and purified. Immunization with the rIpaB domain alone stimulated both humoral and cell-mediated immune responses. Furthermore, robust antibody (IgG, IgA) and T-cell responses were induced when the rIpaB domain was co-administered with rGroEL. Antibody isotyping revealed higher IgG1 and IgG2a antibody titers and increased interferon-gamma (IFN-γ) secretion in the co-administered group. Immunization of mice with the rIpaB domain alone protected 60%-70% of the mice from lethal infection by S. flexneri, S. boydii and S. sonnei, whereas co-administration with rGroEL increased the protective efficacy to 80%-85%. Organ burden and histopathological studies also revealed a significant reduction in lung infection in the co-immunized mice compared with mice immunized with the rIpaB domain alone. This study emphasizes that the co-administration of the rIpaB domain and rGroEL protein improves immune responses in mice and increases protective efficacy against Shigella infection. This is also the first report to evaluate the potential of the GroEL (Hsp 60) protein of S. Typhi as an adjuvant molecule, thereby overcoming the need for commercial adjuvants.

  8. Temperature fluctuations during deep temperature cryopreservation reduce PBMC recovery, viability and T-cell function.

    PubMed

    Germann, Anja; Oh, Young-Joo; Schmidt, Tomm; Schön, Uwe; Zimmermann, Heiko; von Briesen, Hagen

    2013-10-01

    The ability to analyze cryopreserved peripheral blood mononuclear cell (PBMC) from biobanks for antigen-specific immunity is necessary to evaluate response to immune-based therapies. To ensure comparable assay results, collaborative research in multicenter trials needs reliable and reproducible cryopreservation that maintains cell viability and functionality. A standardized cryopreservation procedure is comprised of not only sample collection, preparation and freezing but also low temperature storage in liquid nitrogen without any temperature fluctuations, to avoid cell damage. Therefore, we have developed a storage approach to minimize suboptimal storage conditions in order to maximize cell viability, recovery and T-cell functionality. We compared the influence of repeated temperature fluctuations on cell health from sample storage, sample sorting and removal in comparison to sample storage without temperature rises. We found that cyclical temperature shifts during low temperature storage reduce cell viability, recovery and immune response against specific-antigens. We showed that samples handled under a protective hood system, to avoid or minimize such repeated temperature rises, have comparable cell viability and cell recovery rates to samples stored without any temperature fluctuations. Also T-cell functionality could be considerably increased with the use of the protective hood system compared to sample handling without such a protection system. This data suggests that the impact of temperature fluctuation on cell integrity should be carefully considered in future clinical vaccine trials and consideration should be given to optimal sample storage conditions. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Cross-Protective Efficacy of Recombinant Transferrin-Binding Protein A of Haemophilus parasuis in Guinea Pigs

    PubMed Central

    Huang, Xiaohui; Li, Yu; Fu, Yuguang; Ji, Yanhong; Lian, Kaiqi; Zheng, Haixue; Wei, Jianzhong; Cai, Xuepeng

    2013-01-01

    The causative agent of Glasser's disease in swine is Haemophilus parasuis. Commercial bacterins are widely used for protection of the swine population. However, cross protection is limited because H. parasuis has more than 15 serovars. Transferrin-binding protein A has shown potential as a broad-spectrum vaccine candidate against homologous and heterologous strains. Here we amplified the full-length tbpA gene from an H. parasuis serovar 13 isolate and cloned it into a pET-SUMO expression vector. We then expressed and purified the TbpA protein by Ni affinity chromatography. First, the immunogenicity and protective efficacy of the protein were evaluated in guinea pigs by two subcutaneous immunizations with different doses of Montanide IMS 206 VG adjuvant. The immunized guinea pigs were, respectively, challenged on week 3 after a booster immunization with homologous strain LJ3 (serovar 13) and heterologous strain FX1 (serovar 4), and vaccine-inoculated groups were compared with nonvaccinated controls. All immunized groups showed serum antibody titers higher than those of negative-control groups. Furthermore, the cytokine and chemokine levels were evaluated at the transcriptional level by the real-time PCR analysis of six cytokines and chemokines. Gamma interferon and interleukin-5 in groups immunized with 100 μg were elevated more than 15-fold over those in negative-control groups. The protection rates were 80 and 60% after a challenge with strains LJ3 and FX1, respectively, in the groups vaccinated with 100 μg of recombinant TbpA protein. Subsequently, the data showed that guinea pigs immunized with a single dose (100 μg) were protected at levels of 80, 80, and 60% against LJ3, FX1, and another heterologous strain, SZ (serovar 14), respectively. The results indicate for the first time that TbpA protein cross protects guinea pigs against serovars 13, 4, and 14 of H. parasuis. Taken together, these results suggest that the recombinant TbpA protein is a promising vaccine candidate that needs to be confirmed in a swine population. PMID:23616407

  10. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  11. Community Immunity: How Vaccines Protect Us All

    MedlinePlus

    ... Issues Subscribe October 2011 Print this issue Community Immunity How Vaccines Protect Us All Send us your ... This type of protection is known as “community immunity” or “herd immunity.” When enough of the community ...

  12. Comparison of the PRNT and an immune fluorescence assay in yellow fever vaccinees receiving immunosuppressive medication.

    PubMed

    Wieten, Rosanne W; Jonker, Emile F F; Pieren, Daan K J; Hodiamont, Caspar J; van Thiel, Pieter P A M; van Gorp, Eric C M; de Visser, Adriëtte W; Grobusch, Martin P; Visser, Leo G; Goorhuis, Abraham

    2016-03-04

    The 17D-yellow fever (YF) vaccination is considered contraindicated in immune-compromised patients; however, accidental vaccination occurs. In this population, measuring the immune response is useful in clinical practice. In this study we compare two antibody tests (the Immune Fluorescence Assay and the Plaque Reduction Neutralization Test) in a group of Dutch immune-compromised travellers with a median of 33 days (IQR [28-49]) after primary YF vaccination. We collected samples of 15 immune-compromised vaccinees vaccinated with the 17D yellow fever vaccine between 2004 and 2012. All samples measured in the plaque reduction neutralization test yielded positive results (>80% virus neutralization with a 1:10 serum dilution). Immune Fluorescence Assay sensitivity was 28% (95% CI [0.12-0.49]). No adverse events were reported. All immune-compromised patients mounted an adequate response with protective levels of virus neutralizing antibodies to the 17-D YF vaccine. No adverse effects were reported. Compared to the plaque reduction neutralization test, the sensitivity of the Immune Fluorescence Assay test was low. Further research is needed to ascertain that 17D vaccination in immune-compromised patients is safe. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    PubMed

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  14. Comparative Estimates of Crude and Effective Coverage of Measles Immunization in Low-Resource Settings: Findings from Salud Mesoamérica 2015.

    PubMed

    Colson, K Ellicott; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Conde-Glez, Carlos J; Gagnier, Marielle C; Palmisano, Erin; Ranganathan, Dharani; Usmanova, Gulnoza; Salvatierra, Benito; Nazar, Austreberta; Tristao, Ignez; Sanchez Monin, Emmanuelle; Anderson, Brent W; Haakenstad, Annie; Murphy, Tasha; Lim, Stephen; Hernandez, Bernardo; Lozano, Rafael; Iriarte, Emma; Mokdad, Ali H

    2015-01-01

    Timely and accurate measurement of population protection against measles is critical for decision-making and prevention of outbreaks. However, little is known about how survey-based estimates of immunization (crude coverage) compare to the seroprevalence of antibodies (effective coverage), particularly in low-resource settings. In poor areas of Mexico and Nicaragua, we used household surveys to gather information on measles immunization from child health cards and caregiver recall. We also collected dried blood spots (DBS) from children aged 12 to 23 months to compare crude and effective coverage of measles immunization. We used survey-weighted logistic regression to identify individual, maternal, household, community, and health facility characteristics that predict gaps between crude coverage and effective coverage. We found that crude coverage was significantly higher than effective coverage (83% versus 68% in Mexico; 85% versus 50% in Nicaragua). A large proportion of children (19% in Mexico; 43% in Nicaragua) had health card documentation of measles immunization but lacked antibodies. These discrepancies varied from 0% to 100% across municipalities in each country. In multivariate analyses, card-positive children in Mexico were more likely to lack antibodies if they resided in urban areas or the jurisdiction of De Los Llanos. In contrast, card-positive children in Nicaragua were more likely to lack antibodies if they resided in rural areas or the North Atlantic region, had low weight-for-age, or attended health facilities with a greater number of refrigerators. Findings highlight that reliance on child health cards to measure population protection against measles is unwise. We call for the evaluation of immunization programs using serological methods, especially in poor areas where the cold chain is likely to be compromised. Identification of within-country variation in effective coverage of measles immunization will allow researchers and public health professionals to address challenges in current immunization programs.

  15. Comparative Estimates of Crude and Effective Coverage of Measles Immunization in Low-Resource Settings: Findings from Salud Mesoamérica 2015

    PubMed Central

    Colson, K. Ellicott; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Conde-Glez, Carlos J.; Gagnier, Marielle C.; Palmisano, Erin; Ranganathan, Dharani; Usmanova, Gulnoza; Salvatierra, Benito; Nazar, Austreberta; Tristao, Ignez; Sanchez Monin, Emmanuelle; Anderson, Brent W.; Haakenstad, Annie; Murphy, Tasha; Lim, Stephen; Hernandez, Bernardo; Lozano, Rafael

    2015-01-01

    Timely and accurate measurement of population protection against measles is critical for decision-making and prevention of outbreaks. However, little is known about how survey-based estimates of immunization (crude coverage) compare to the seroprevalence of antibodies (effective coverage), particularly in low-resource settings. In poor areas of Mexico and Nicaragua, we used household surveys to gather information on measles immunization from child health cards and caregiver recall. We also collected dried blood spots (DBS) from children aged 12 to 23 months to compare crude and effective coverage of measles immunization. We used survey-weighted logistic regression to identify individual, maternal, household, community, and health facility characteristics that predict gaps between crude coverage and effective coverage. We found that crude coverage was significantly higher than effective coverage (83% versus 68% in Mexico; 85% versus 50% in Nicaragua). A large proportion of children (19% in Mexico; 43% in Nicaragua) had health card documentation of measles immunization but lacked antibodies. These discrepancies varied from 0% to 100% across municipalities in each country. In multivariate analyses, card-positive children in Mexico were more likely to lack antibodies if they resided in urban areas or the jurisdiction of De Los Llanos. In contrast, card-positive children in Nicaragua were more likely to lack antibodies if they resided in rural areas or the North Atlantic region, had low weight-for-age, or attended health facilities with a greater number of refrigerators. Findings highlight that reliance on child health cards to measure population protection against measles is unwise. We call for the evaluation of immunization programs using serological methods, especially in poor areas where the cold chain is likely to be compromised. Identification of within-country variation in effective coverage of measles immunization will allow researchers and public health professionals to address challenges in current immunization programs. PMID:26136239

  16. Effectiveness analyses may underestimate protection of infants after group C meningococcal immunization.

    PubMed

    Vu, David M; Kelly, Dominic; Heath, Paul T; McCarthy, Noel D; Pollard, Andrew J; Granoff, Dan M

    2006-07-15

    Group C meningococcal conjugate-vaccine effectiveness in the United Kingdom declines from ~90% in the first year to 0% between 1 and 4 years after immunization in infants immunized at 2, 3, and 4 months of age and to 61% in toddlers given a single dose. Confidence intervals are wide, and the extent of protection is uncertain. Serum samples were obtained from children 3-5 years of age who were participants in a preschool booster-vaccine trial. Serum bactericidal activity was measured with human complement. Group C anticapsular antibody concentrations were measured by a radioantigen binding assay. Passive protection was analyzed in an infant rat bacteremia model. Serum samples from UK children who had been immunized 2-3 years earlier as infants or toddlers had higher levels of radioantigen binding, bactericidal activity, and passive protection than did historical control serum samples from unimmunized children (P<.05). A higher proportion of children immunized as infants had serum bactericidal activity titers > or =1 : 4 (considered to be protective) than those immunized as toddlers (61% vs. 24%; P<.01), but there were no significant differences in the proportion of serum samples conferring passive protection (50% and 41%, respectively; P=.4). We found no evidence of lower immunity in children immunized as infants than as toddlers. On the basis of serum bactericidal activity and/or passive protection, 40%-50% of both age groups are protected at 2-3 years after immunization, which was significantly greater than in unimmunized historical controls (<5%).

  17. Attenuated Escherichia coli strains expressing the colonization factor antigen I (CFA/I) and a detoxified heat-labile enterotoxin (LThK63) enhance clearance of ETEC from the lungs of mice and protect mice from intestinal ETEC colonization and LT-induced fluid accumulation.

    PubMed

    Byrd, Wyatt; Boedeker, Edgar C

    2013-03-15

    Although enterotoxigenic Escherichia coli (ETEC) infections are important causes of infantile and traveler's diarrhea there is no licensed vaccine available for those at-risk. Our goal is to develop a safe, live attenuated ETEC vaccine. We used an attenuated E. coli strain (O157:H7, Δ-intimin, Stx1-neg, Stx2-neg) as a vector (ZCR533) to prepare two vaccine strains, one strain expressing colonization factor antigen I (ZCR533-CFA/I) and one strain expressing CFA/I and a detoxified heat-labile enterotoxin (ZCR533-CFA/I+LThK63) to deliver ETEC antigens to mucosal sites in BALB/c mice. Following intranasal and intragastric immunization with the vaccine strains, serum IgG and IgA antibodies were measured to the CFA/I antigen, however, only serum IgG antibodies were detected to the heat-labile enterotoxin. Intranasal administration of the vaccine strains induced respiratory and intestinal antibody responses to the CFA/I and LT antigens, while intragastric administration induced only intestinal antibody responses with no respiratory antibodies detected to the CFA/I and LT antigens. Mice immunized intranasally with the vaccine strains showed enhanced clearance of wild-type (wt) ETEC bacteria from the lungs. Mice immunized intranasally and intragastrically with the vaccine strains were protected from intestinal colonization following oral challenge with ETEC wt bacteria. Mice immunized intragastrically with the ZCR533-CFA/I+LThK63 vaccine strain had less fluid accumulate in their intestine following challenge with ETEC wt bacteria or with purified LT as compared to the sham mice indicating that the immunized mice were protected from LT-induced intestinal fluid accumulation. Thus, mice intragastrically immunized with the ZCR533-CFA/I+LThK63 vaccine strain were able to effectively neutralize the activity of the LT enterotoxin. However, no difference in intestinal fluid accumulation was detected in the mice immunized intranasally with the vaccine strain as compared to the sham mice as the immunized mice induced insufficient intestinal anti-LT antibody to neutralize the activity of the enterotoxin. These results show that our ETEC vaccine induced serum and mucosal antibody responses to CFA/I and LT after mucosal administration which then acted to protect the immunized mice against lung and intestinal colonization, as well as, intestinal fluid accumulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Protective immunity to Japanese encephalitis virus associated with anti-NS1 antibodies in a mouse model.

    PubMed

    Li, Yize; Counor, Dorian; Lu, Peng; Duong, Veasna; Yu, Yongxin; Deubel, Vincent

    2012-07-24

    Japanese encephalitis virus (JEV) is a major mosquito-borne pathogen that causes viral encephalitis throughout Asia. Vaccination with an inactive JEV particle or attenuated virus is an efficient preventative measure for controlling infection. Flavivirus NS1 protein is a glycoprotein secreted during viral replication that plays multiple roles in the viral life cycle and pathogenesis. Utilizing JEV NS1 as an antigen in viral vectors induces a limited protective immune response against infection. Previous studies using E. coli-expressed JEV NS1 to immunize mice induced protection against lethal challenge; however, the protection mechanism through cellular and humoral immune responses was not described. JEV NS1 was expressed in and purified from Drosophila S2 cells in a native glycosylated multimeric form, which induced T-cell and antibody responses in immunized C3H/HeN mice. Mice vaccinated with 1 μg NS1 with or without water-in-oil adjuvant were partially protected against viral challenge and higher protection was observed in mice with higher antibody titers. IgG1 was preferentially elicited by an adjuvanted NS1 protein, whereas a larger load of IFN-γ was produced in splenocytes from mice immunized with aqueous NS1. Mice that passively received anti-NS1 mouse polyclonal immune sera were protected, and this phenomenon was dose-dependent, whereas protection was low or delayed after the passive transfer of anti-NS1 MAbs. The purified NS1 subunit induced protective immunity in relation with anti-NS1 IgG1 antibodies. NS1 protein efficiently stimulated Th1-cell proliferation and IFN-γ production. Protection against lethal challenge was elicited by passive transfer of anti-NS1 antisera, suggesting that anti-NS1 antibodies play a substantial role in anti-viral immunity.

  19. Mycobacterium indicus pranii as a booster vaccine enhances BCG induced immunity and confers higher protection in animal models of tuberculosis.

    PubMed

    Saqib, Mohd; Khatri, Rahul; Singh, Bindu; Gupta, Ananya; Kumar, Arvind; Bhaskar, Sangeeta

    2016-12-01

    BCG, the only approved vaccine protects against severe form of childhood tuberculosis but its protective efficacy wanes in adolescence. BCG has reduced the incidence of infant TB considerably in endemic areas; therefore prime-boost strategy is the most realistic measure for control of tuberculosis in near future. Mycobacterium indicus pranii (MIP) shares significant antigenic repertoire with Mtb and BCG and has been shown to impart significant protection in animal models of tuberculosis. In this study, MIP was given as a booster to BCG vaccine which enhanced the BCG mediated immune response, resulting in higher protection. MIP booster via aerosol route was found to be more effective in protection than subcutaneous route of booster immunization. Pro-inflammatory cytokines like IFN-γ, IL-12 and IL-17 were induced at higher level in infected lungs of 'BCG-MIP' group both at mRNA expression level and in secretory form when compared with 'only BCG' group. BCG-MIP groups had increased frequency of multifunctional T cells with high MFI for IFN-γ and TNF-α in Mtb infected mice. Our data demonstrate for the first time, potential application of MIP as a booster to BCG vaccine for efficient protection against tuberculosis. This could be very cost effective strategy for efficient control of tuberculosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Engineered Mesenchymal Cells Improve Passive Immune Protection Against Lethal Venezuelan Equine Encephalitis Virus Exposure

    PubMed Central

    Braid, Lorena R.; Davies, John E.; Nagata, Les P.

    2016-01-01

    Mesenchymal stromal cells (MSCs) are being exploited as gene delivery vectors for various disease and injury therapies. We provide proof-of-concept that engineered MSCs can provide a useful, effective platform for protection against infectious disease. Venezuelan equine encephalitis virus (VEEV) is a mosquito-borne pathogen affecting humans and equines and can be used in bio-warfare. No licensed vaccine or antiviral agent currently exists to combat VEEV infection in humans. Direct antibody administration (passive immunity) is an effective, but short-lived, method of providing immediate protection against a pathogen. We compared the protective efficacy of human umbilical cord perivascular cells (HUCPVCs; a rich source of MSCs), engineered with a transgene encoding a humanized VEEV-neutralizing antibody (anti-VEEV), to the purified antibody. In athymic mice, the anti-VEEV antibody had a half-life of 3.7 days, limiting protection to 2 or 3 days after administration. In contrast, engineered HUCPVCs generated protective anti-VEEV serum titers for 21–38 days after a single intramuscular injection. At 109 days after transplantation, 10% of the mice still had circulating anti-VEEV antibody. The mice were protected against exposure to a lethal dose of VEEV by an intramuscular pretreatment injection with engineered HUCPVCs 24 hours or 10 days before exposure, demonstrating both rapid and prolonged immune protection. The present study is the first to describe engineered MSCs as gene delivery vehicles for passive immunity and supports their utility as antibody delivery vehicles for improved, single-dose prophylaxis against endemic and intentionally disseminated pathogens. Significance Direct injection of monoclonal antibodies (mAbs) is an important strategy to immediately protect the recipient from a pathogen. This strategy is critical during natural outbreaks or after the intentional release of bio-weapons. Vaccines require weeks to become effective, which is not practical for first responders immediately deployed to an infected region. However, mAb recipients often require booster shots to maintain protection, which is expensive and impractical once the first responders have been deployed. The present study has shown, for the first time, that mesenchymal stromal cells are effective gene delivery vehicles that can significantly improve mAb-mediated immune protection in a single, intramuscular dose of engineered cells. Such a cell-based delivery system can provide extended life-saving protection in the event of exposure to biological threats using a more practical, single-dose regimen. PMID:27334491

  1. The immune response against Chlamydia suis genital tract infection partially protects against re-infection.

    PubMed

    De Clercq, Evelien; Devriendt, Bert; Yin, Lizi; Chiers, Koen; Cox, Eric; Vanrompay, Daisy

    2014-09-25

    The aim of the present study was to reveal the characteristic features of genital Chlamydia suis infection and re-infection in female pigs by studying the immune response, pathological changes, replication of chlamydial bacteria in the genital tract and excretion of viable bacteria. Pigs were intravaginally infected and re-infected with C. suis strain S45, the type strain of this species. We demonstrated that S45 is pathogenic for the female urogenital tract. Chlamydia replication occurred throughout the urogenital tract, causing inflammation and pathology. Furthermore, genital infection elicited both cellular and humoral immune responses. Compared to the primo-infection of pigs with C. suis, re-infection was characterized by less severe macroscopic lesions and less chlamydial elementary bodies and inclusions in the urogenital tract. This indicates the development of a certain level of protection following the initial infection. Protective immunity against re-infection coincided with higher Chlamydia-specific IgG and IgA antibody titers in sera and vaginal secretions, higher proliferative responses of peripheral blood mononuclear cells (PBMC), higher percentages of blood B lymphocytes, monocytes and CD8⁺ T cells and upregulated production of IFN-γ and IL-10 by PBMC.

  2. Species-Specific Immunity Induced by Infection with Entamoeba histolytica and Entamoeba moshkovskii in Mice

    PubMed Central

    Shimokawa, Chikako; Culleton, Richard; Imai, Takashi; Suzue, Kazutomo; Hirai, Makoto; Taniguchi, Tomoyo; Kobayashi, Seiki; Hisaeda, Hajime; Hamano, Shinjiro

    2013-01-01

    Entamoeba histolytica, the parasitic amoeba responsible for amoebiasis, causes approximately 100,000 deaths every year. There is currently no vaccine against this parasite. We have previously shown that intracecal inoculation of E. histolytica trophozoites leads to chronic and non-healing cecitis in mice. Entamoeba moshkovskii, a closely related amoeba, also causes diarrhea and other intestinal disorders in this model. Here, we investigated the effect of infection followed by drug-cure of these species on the induction of immunity against homologous or heterologous species challenge. Mice were infected with E. histolytica or E. moshkovskii and treated with metronidazole 14 days later. Re-challenge with E. histolytica or E. moshkovskii was conducted seven or 28 days following confirmation of the clearance of amoebae, and the degree of protection compared to non-exposed control mice was evaluated. We show that primary infection with these amoebae induces a species-specific immune response which protects against challenge with the homologous, but not a heterologous species. These findings pave the way, therefore, for the identification of novel amoebae antigens that may become the targets of vaccines and provide a useful platform to investigate host protective immunity to Entamoeba infections. PMID:24312397

  3. Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection

    PubMed Central

    Duan, Susu; Thomas, Paul G.

    2016-01-01

    Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022

  4. Nanoparticle formulation enhanced protective immunity provoked by PYGPI8p-transamidase related protein (PyTAM) DNA vaccine in Plasmodium yoelii malaria model.

    PubMed

    Cherif, Mahamoud Sama; Shuaibu, Mohammed Nasir; Kodama, Yukinobu; Kurosaki, Tomoaki; Helegbe, Gideon Kofi; Kikuchi, Mihoko; Ichinose, Akitoyo; Yanagi, Tetsuo; Sasaki, Hitoshi; Yui, Katsuyuki; Tien, Nguyen Huy; Karbwang, Juntra; Hirayama, Kenji

    2014-04-07

    We have previously reported the new formulation of polyethylimine (PEI) with gamma polyglutamic acid (γ-PGA) nanoparticle (NP) to have provided Plasmodium yoelii merozoite surface protein-1 (PyMSP-1) plasmid DNA vaccine with enhanced protective cellular and humoral immunity in the lethal mouse malaria model. PyGPI8p-transamidase-related protein (PyTAM) was selected as a possible candidate vaccine antigen by using DNA vaccination screening from 29 GPI anchor and signal sequence motif positive genes picked up using web-based bioinformatics tools; though the observed protection was not complete. Here, we observed augmented protective effect of PyTAM DNA vaccine by using PEI and γ-PGA complex as delivery system. NP-coated PyTAM plasmid DNA immunized mice showed a significant survival rate from lethal P. yoelii challenge infection compared with naked PyTAM plasmid or with NP-coated empty plasmid DNA group. Antigen-specific IgG1 and IgG2b subclass antibody levels, proportion of CD4 and CD8T cells producing IFN-γ in the splenocytes and IL-4, IFN-γ, IL-12 and TNF-α levels in the sera and in the supernatants from ex vivo splenocytes culture were all enhanced by the NP-coated PyTAM DNA vaccine. These data indicates that NP augments PyTAM protective immune response, and this enhancement was associated with increased DC activation and concomitant IL-12 production. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. MAPK phosphotase 5 deficiency contributes to protection against blood-stage Plasmodium yoelii 17XL infection in mice.

    PubMed

    Cheng, Qianqian; Zhang, Qingfeng; Xu, Xindong; Yin, Lan; Sun, Lin; Lin, Xin; Dong, Chen; Pan, Weiqing

    2014-04-15

    Cell-mediated immunity plays a crucial role in the development of host resistance to asexual blood-stage malaria infection. However, little is known of the regulatory factors involved in this process. In this study, we investigated the impact of MAPK phosphotase 5 (MKP5) on protective immunity against a lethal Plasmodium yoelii 17XL blood-stage infection using MKP5 knockout C57BL/6 mice. Compared with wild-type control mice, MKP5 knockout mice developed significantly lower parasite burdens with prolonged survival times. We found that this phenomenon correlated with a rapid and strong IFN-γ-dependent cellular immune response during the acute phase of infection. Inactivation of IFN-γ by the administration of a neutralizing Ab significantly reduced the protective effects in MKP5 knockout mice. By analyzing IFN-γ production in innate and adaptive lymphocyte subsets, we observed that MKP5 deficiency specifically enhanced the IFN-γ response mediated by CD4+ T cells, which was attributable to the increased stimulatory capacity of splenic CD11c+ dendritic cells. Furthermore, following vaccination with whole blood-stage soluble plasmodial Ag, MKP5 knockout mice acquired strongly enhanced Ag-specific immune responses and a higher level of protection against subsequent P. yoelii 17XL challenge. Finally, we found the enhanced response mediated by MKP5 deficiency resulted in a lethal consequence in mice when infected with nonlethal P. yoelii 17XNL. Thus, our data indicate that MKP5 is a potential regulator of immune resistance against Plasmodium infection in mice, and that an understanding of the role of MKP5 in manipulating anti-malaria immunity may provide valuable information on the development of better control strategies for human malaria.

  6. Subcomponent vaccine based on CTA1-DD adjuvant with incorporated UreB class II peptides stimulates protective Helicobacter pylori immunity.

    PubMed

    Nedrud, John G; Bagheri, Nayer; Schön, Karin; Xin, Wei; Bergroth, Hilda; Eliasson, Dubravka Grdic; Lycke, Nils Y

    2013-01-01

    A mucosal vaccine against Helicobacter pylori infection could help prevent gastric cancers and peptic ulcers. While previous attempts to develop such a vaccine have largely failed because of the requirement for safe and effective adjuvants or large amounts of well defined antigens, we have taken a unique approach to combining our strong mucosal CTA1-DD adjuvant with selected peptides from urease B (UreB). The protective efficacy of the selected peptides together with cholera toxin (CT) was first confirmed. However, CT is a strong adjuvant that unfortunately is precluded from clinical use because of its toxicity. To circumvent this problem we have developed a derivative of CT, the CTA1-DD adjuvant, that has been found safe in non-human primates and equally effective compared to CT when used intranasally. We genetically fused the selected peptides into the CTA1-DD plasmid and found after intranasal immunizations of Balb/c mice using purified CTA1-DD with 3 copies of an H. pylori urease T cell epitope (CTA1-UreB3T-DD) that significant protection was stimulated against a live challenge infection. Protection was, however, weaker than with the gold standard, bacterial lysate+CT, but considering that we only used a single epitope in nanomolar amounts the results convey optimism. Protection was associated with enhanced Th1 and Th17 immunity, but immunizations in IL-17A-deficient mice revealed that IL-17 may not be essential for protection. Taken together, we have provided evidence for the rational design of an effective mucosal subcomponent vaccine against H. pylori infection based on well selected protective epitopes from relevant antigens incorporated into the CTA1-DD adjuvant platform.

  7. Subcomponent Vaccine Based on CTA1-DD Adjuvant with Incorporated UreB Class II Peptides Stimulates Protective Helicobacter pylori Immunity

    PubMed Central

    Nedrud, John G.; Bagheri, Nayer; Schön, Karin; Xin, Wei; Bergroth, Hilda; Eliasson, Dubravka Grdic; Lycke, Nils Y.

    2013-01-01

    A mucosal vaccine against Helicobacter pylori infection could help prevent gastric cancers and peptic ulcers. While previous attempts to develop such a vaccine have largely failed because of the requirement for safe and effective adjuvants or large amounts of well defined antigens, we have taken a unique approach to combining our strong mucosal CTA1-DD adjuvant with selected peptides from urease B (UreB). The protective efficacy of the selected peptides together with cholera toxin (CT) was first confirmed. However, CT is a strong adjuvant that unfortunately is precluded from clinical use because of its toxicity. To circumvent this problem we have developed a derivative of CT, the CTA1-DD adjuvant, that has been found safe in non-human primates and equally effective compared to CT when used intranasally. We genetically fused the selected peptides into the CTA1-DD plasmid and found after intranasal immunizations of Balb/c mice using purified CTA1-DD with 3 copies of an H. pylori urease T cell epitope (CTA1-UreB3T-DD) that significant protection was stimulated against a live challenge infection. Protection was, however, weaker than with the gold standard, bacterial lysate+CT, but considering that we only used a single epitope in nanomolar amounts the results convey optimism. Protection was associated with enhanced Th1 and Th17 immunity, but immunizations in IL-17A-deficient mice revealed that IL-17 may not be essential for protection. Taken together, we have provided evidence for the rational design of an effective mucosal subcomponent vaccine against H. pylori infection based on well selected protective epitopes from relevant antigens incorporated into the CTA1-DD adjuvant platform. PMID:24391754

  8. Evaluation of the immunoprophylactic potential of a killed vaccine candidate in combination with different adjuvants against murine visceral leishmaniasis.

    PubMed

    Thakur, Ankita; Kaur, Harpreet; Kaur, Sukhbir

    2015-02-01

    Despite a large number of field trials, till date no prophylactic antileishmanial vaccine exists for human use. Killed antigen formulations offer the advantage of being safe but they have limited immunogenicity. Recent research has documented that efforts to develop effective Leishmania vaccine have been limited due to the lack of an appropriate adjuvant. Addition of adjuvants to vaccines boosts and directs the immunogenicity of antigens. So, the present study was done to evaluate the effectiveness of four adjuvants i.e. alum, saponin, cationic liposomes and monophosphoryl lipid-A in combination with Autoclaved Leishmania donovani (ALD) antigen against murine visceral leishmaniasis (VL). BALB/c mice were immunized thrice with respective vaccine formulation. Two weeks after last booster, challenge infection was given. Mice were sacrificed 15 days after last immunization and on 30, 60 and 90 post infection/challenge days. A considerable protective efficacy was shown by all vaccine formulations. It was evident from significant reduction in parasite load, profound delayed type hypersensitivity responses (DTH), increased IgG2a titres and high levels of Th1 cytokines (IFN-γ, IL-12) as compared to the infected controls. However, level of protection varied with the type of adjuvant used. Maximum protection was achieved with the use of liposome encapsulated ALD antigen and it was closely followed by group immunized with ALD+MPL-A. Significant results were also obtained with ALD+saponin, ALD+alum and ALD antigen (alone) but the protective efficacy was reduced as compared to other immunized groups. The present study reveals greater efficacy of two vaccine formulations i.e. ALD+liposome and ALD+MPL-A against murine VL. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Protective immunity induced by an intranasal multivalent vaccine comprising 10 Lactococcus lactis strains expressing highly prevalent M-protein antigens derived from Group A Streptococcus.

    PubMed

    Wozniak, Aniela; Scioscia, Natalia; García, Patricia C; Dale, James B; Paillavil, Braulio A; Legarraga, Paulette; Salazar-Echegarai, Francisco J; Bueno, Susan M; Kalergis, Alexis M

    2018-04-28

    Streptococcus pyogenes (group A Streptococcus) causes diseases ranging from mild pharyngitis to severe invasive infections. The N-terminal fragment of Streptococcal M protein elicits protective antibodies and is an attractive vaccine target. However, this N- terminal fragment is hypervariable and there are more than 200 different M types. We are developing an intranasal live bacterial vaccine comprised of 10 strains of Lactococcus lactis, each expressing one N-terminal fagment of M protein. Live bacterial-vectored vaccines have lower associated costs because of its less complex manufacturing processes compared to protein subunit vaccines. Moreover, intranasal administration does not require syringe or specilized personnel. The evaluation of individual vaccine types (M1, M2, M3, M4, M6, M9, M12, M22, M28 and M77) showed that most of them protected mice against challenge with virulent S. pyogenes. All of the 10 strains combined in a 10-valent vaccine (Mx10) induced serum and bronchoalveolar lavages IgG titers that ranged from 3 to 10-fold those of unimmunized mice. Survival of Mx10-immunized mice after intranasal challenge with M28 streptococci is significantly higher than unimmunized mice. In contrast, when mice were challenged with M75 streptococci, survival of Mx10-immunized mice was not significantly different from unimmunized mice. Mx-10 immunized mice were significantly less colonized with S. pyogenes in oropharyngeal washes and developed less severe disease symptoms after challenge compared to unimmunized mice. Our L. lactis-based vaccine may provide an alternative solution to the development of broadly protective group A streptococcal vaccines. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

  10. Protective efficacy of a novel alpha hemolysin subunit vaccine (AT62) against Staphylococcus aureus skin and soft tissue infections.

    PubMed

    Adhikari, Rajan P; Thompson, Christopher D; Aman, M Javad; Lee, Jean C

    2016-12-07

    Alpha hemolysin (Hla) is a pore-forming toxin produced by most Staphylococcus aureus isolates. Hla is reported to play a key role in the pathogenesis of staphylococcal infections, such as skin and soft tissue infection, pneumonia, and lethal peritonitis. This study makes use of a novel recombinant subunit vaccine candidate (AT62) that was rationally designed based on the Hla heptameric crystal structure. AT62 comprises a critical structural domain at the N terminus of Hla, and it has no inherent toxic properties. We evaluated the efficacy of AT62 in protection against surgical wound infection and skin and soft tissue infection. Mice were vaccinated on days 0, 14, and 28 with 20μg AT62 or bovine serum albumin (BSA) mixed with Sigma adjuvant system®. Mice immunized with AT62 produced a robust antibody response against native Hla. In the surgical wound infection model, mice immunized with AT62 and challenged with a USA300 S. aureus strain showed a significantly reduced bacterial burden in the infected tissue compared to animals given BSA. Similarly, mice passively immunized with rabbit IgG to AT62 showed reduced wound infection and tissue damage. Subcutaneous abscess formation was not prevented by immunization with AT62. However, in a skin necrosis infection model, immunization with the AT62 vaccine resulted in smaller lesions and reduced mouse weight loss compared to controls. Although AT62 immunization reduced tissue necrosis, it did not reduce the bacterial burdens in the lesions compared to controls. Our data indicate that AT62 may be a valuable component of a multivalent vaccine against S. aureus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Evaluation of Montanide™ ISA 71 VG Adjuvant during Profilin Vaccination against Experimental Coccidiosis

    PubMed Central

    Lillehoj, Hyun S.; Lee, Sung Hyen; Lee, Kyung Woo; Bertrand, François; Dupuis, Laurent; Deville, Sébastien; Ben Arous, Juliette; Lillehoj, Erik P.

    2013-01-01

    Chickens were immunized subcutaneously with an Eimeria recombinant profilin protein plus Montanide™ ISA 70 VG (ISA 70) or Montanide™ ISA 71 VG (ISA 71) water-in-oil adjuvants, or with profilin alone, and comparative RNA microarray hybridizations were performed to ascertain global transcriptome changes induced by profilin/ISA 70 vs. profilin alone and by profilin/ISA 71 vs. profilin alone. While immunization with profilin/ISA 70 vs. profilin alone altered the levels of more total transcripts compared with profilin/ISA 71 vs. profilin alone (509 vs. 296), the latter was associated with a greater number of unique biological functions, and a larger number of genes within these functions, compared with the former. Further, canonical pathway analysis identified 10 pathways that were associated with genes encoding the altered transcripts in animals immunized with profilin/ISA 71 vs. profilin alone, compared with only 2 pathways in profilin/ISA 70 vs. profilin alone. Therefore, ISA 71 was selected as a candidate adjuvant in conjunction with profilin vaccination for in vivo disease protection studies. Vaccination with profilin/ISA 71 was associated with greater body weight gain following E. acervulina infection, and decreased parasite fecal shedding after E. maxima infection, compared with profilin alone. Anti-profilin antibody levels were higher in sera of E. maxima- and E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. Finally, the levels of transcripts encoding interferon-γ, interleukin (IL)-2, IL-10, and IL-17A were increased in intestinal lymphocytes from E. acervulina-, E. maxima-, and/or E. tenella-infected chickens vaccinated with profilin/ISA 71 compared with profilin alone. None of these effects were seen in chickens injected with ISA 71 alone indicating that the adjuvant was not conferring non-specific immune stimulation. These results suggest that profilin plus ISA 71 augments protective immunity against selective Eimeria species in chickens. PMID:23593150

  12. Protective Effect of Active Immunization with Purified Escherichia coli Heat-Labile Enterotoxin in Rats

    PubMed Central

    Klipstein, Frederick A.; Engert, Richard F.

    1979-01-01

    The protective effect of active immunization by different routes with a purified preparation of the polymyxin-release form of Escherichia coli heat-labile toxin was evaluated in rats. Immunized animals were challenged by placing toxin into ligated ileal loops at dosages which produced either 50% or the maximum secretory response in unimmunized rats. Immunization exclusively by the parenteral route yielded significant protection. Rats were also protected when parenteral priming was followed by boosting given either directly into the duodenum or perorally 2 h after intragastric cimetidine, but not when the peroral boosts were given with bicarbonate. Immunization administered entirely by the peroral route with cimetidine yielded protection but only when the immunizing dosage was fivefold greater than that found effective in the parenteral-peroral approach. Rats immunized exclusively by the parenteral route and those boosted perorally with cimetidine were also tested, and found to be protected, against challenge with viable organisms of strains that produce either heat-labile toxin alone or both heat-labile and heat-stable toxin, but they were not protected against a strain which produces just heat-stable toxin. Geometric mean serum antibody titers were increased by 16-fold or more over control values in those groups of rats in which protection was achieved, with the exception of those immunized exclusively by the peroral route. These observations demonstrate that (i) active immunization with purified E. coli heat-labile toxin results in significant protection against both this toxin as well as viable organisms which produce it, but not against viable strains which produce heat-stable toxin only, and (ii) concomitant ablation of gastric secretion by the use of cimetidine renders the peroral route of immunization effective. They suggest that prophylactic immunization against diarrheal disease caused by heat-labile toxin-producing strains of E. coli may be feasible in humans. PMID:378831

  13. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    PubMed

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  14. Immunologic memory response induced by a meningococcal serogroup C conjugate vaccine using the P64k recombinant protein as carrier.

    PubMed

    Guirola, María; Urquiza, Dioslaida; Alvarez, Anabel; Cannan-Haden, Leonardo; Caballero, Evelin; Guillén, Gerardo

    2006-03-01

    In this study, we used an adoptive lymphocyte transfer experiment to evaluate the ability of the P64k recombinant protein to recruit T-helper activity and induce immunologic memory response to the polysaccharide moiety in a meningococcal serogroup C conjugate vaccine. Adoptive transfer of splenocytes from mice immunized with the glycoconjugate conferred antipolysaccharide immunologic memory to naive recipient mice. The observed anamnestic immune response was characterized by more rapid kinetics, isotype switching from IgM to IgG and higher antipolysaccharide antibody titers compared with those reached in groups transferred with splenocytes from plain polysaccharide or phosphate-immunized mice. The memory response generated was also long lasting. Sera from mice transferred with cells from conjugate-immunized mice were the only protective in the infant rat passive protection assay, and also showed higher bactericidal titers. We demonstrated that priming the mice immune system with the glycoconjugate using the P64k protein as carrier induced a memory response to the polysaccharide, promoting a switch of the T-cell-independent response to a T-cell dependent one.

  15. Immunoprotection of recombinant Eg.P29 against Echinococcus granulosus in sheep.

    PubMed

    Wang, Hao; Li, Zihua; Gao, Fu; Zhao, Jiaqing; Zhu, Mingxing; He, Xin; Niu, Nan; Zhao, Wei

    2016-06-01

    This study aims to investigate the immunoprotection of recombinant Eg.P29 (rEg.P29) vaccine and analyze the underlying mechanism in sheep. Three groups of male sheep were immunized subcutaneously with rEg.P29 and PBS, Freund's complete adjuvant as controls, respectively. After prime-boost vaccination, the sheep were challenged with encapsulated Echinococcus granulosus eggs. The percentage of protection in sheep was determined 36 weeks after the infection. Humoral immune response was analyzed for specific IgG, IgG1, IgG2, IgM and IgE levels. Moreover, cytokines including interferon (IFN)-γ, interleukin (IL)-2, IL-4,and IL-10 were also evaluated. Immunization with rEg.P29 induced protective immune responses up to 94.5 %, compared with immunoadjuvant group. The levels of specific IgG, IgG1, IgG2, and IgE as well as IFN-γ, IL-2, and IL-4 significantly increased after two immunizations (P < 0.05); however, the levels of IgM and IL-10 did not show difference. rEg.P29 showed Immunoprotection and induced Th1 and Th2 immune responses; hence, rEg.P29 is a potential vaccine for E. granulosus infection.

  16. Leukemia cell-rhabdovirus vaccine: personalized immunotherapy for acute lymphoblastic leukemia.

    PubMed

    Conrad, David P; Tsang, Jovian; Maclean, Meaghan; Diallo, Jean-Simon; Le Boeuf, Fabrice; Lemay, Chantal G; Falls, Theresa J; Parato, Kelley A; Bell, John C; Atkins, Harold L

    2013-07-15

    Acute lymphoblastic leukemia (ALL) remains incurable in most adults. It has been difficult to provide effective immunotherapy to improve outcomes for the majority of patients. Rhabdoviruses induce strong antiviral immune responses. We hypothesized that mice administered ex vivo rhabdovirus-infected ALL cells [immunotherapy by leukemia-oncotropic virus (iLOV)] would develop robust antileukemic immune responses capable of controlling ALL. Viral protein production, replication, and cytopathy were measured in human and murine ALL cells exposed to attenuated rhabdovirus. Survival following injection of graded amounts of ALL cells was compared between cohorts of mice administered γ-irradiated rhabdovirus-infected ALL cells (iLOV) or multiple control vaccines to determine key immunotherapeutic components and characteristics. Host immune requirements were assessed in immunodeficient and bone marrow-transplanted mice or by adoptive splenocyte transfer from immunized donors. Antileukemic immune memory was ascertained by second leukemic challenge in long-term survivors. Human and murine ALL cells were infected and killed by rhabdovirus; this produced a potent antileukemia vaccine. iLOV protected mice from otherwise lethal ALL by developing durable leukemia-specific immune-mediated responses (P < 0.0001), which required an intact CTL compartment. Preexisting antiviral immunity augmented iLOV potency. Splenocytes from iLOV-vaccinated donors protected 60% of naïve recipients from ALL challenge (P = 0.0001). Injecting leukemia cells activated by, or concurrent with, multiple Toll-like receptor agonists could not reproduce the protective effect of iLOV. Similarly, injecting uninfected irradiated viable, apoptotic, or necrotic leukemia cells with/without concurrent rhabdovirus administration was ineffective. Rhabdovirus-infected leukemia cells can be used to produce a vaccine that induces robust specific immunity against aggressive leukemia.

  17. Whole-Killed Blood-Stage Vaccine-Induced Immunity Suppresses the Development of Malaria Parasites in Mosquitoes.

    PubMed

    Zhu, Feng; Liu, Taiping; Zhao, Chenhao; Lu, Xiao; Zhang, Jian; Xu, Wenyue

    2017-01-01

    As a malaria transmission-blocking vaccine alone does not confer a direct benefit to the recipient, it is necessary to develop a vaccine that not only blocks malaria transmission but also protects vaccinated individuals. In this study we observed that a whole-killed blood-stage vaccine (WKV) not only conferred protection against the blood-stage challenge but also markedly inhibited the transmission of different strains of the malaria parasite. Although the parasitemia is much lower in WKV-immunized mice challenged with malaria parasites, the gametocytemia is comparable between control and immunized mice during the early stages of infection. The depletion of CD4 + T cells prior to the adoptive transfer of parasites into WKV-immunized mice has no effect on the development of the malaria parasite in the mosquito, but the adoptive transfer of the serum from the immunized mice into the parasite-inoculated mice remarkably suppresses the development of malaria parasites in mosquitoes. Furthermore, immunized mice challenged with the malaria parasite generate higher levels of parasite-specific Abs and the inflammatory cytokines MCP-1 and IFN-γ. However, the adoptive transfer of parasite-specific IgG or the depletion of MCP-1, but not IFN-γ, to some extent is closely associated with the suppression of malaria parasite development in mosquitoes. These data strongly suggest that WKV-induced immune responses confer protection against the mosquito stage, which is largely dependent on malaria parasite-specific Abs and MCP-1. This finding sheds new light on blocking malaria transmission through the immunization of individuals with the WKV. Copyright © 2016 by The American Association of Immunologists, Inc.

  18. Influence of tumors on protective anti-tumor immunity and the effects of irradiation

    PubMed Central

    Foulds, Gemma A.; Radons, Jürgen; Kreuzer, Mira; Multhoff, Gabriele; Pockley, Alan G.

    2012-01-01

    Innate and adaptive immunity plays important roles in the development and progression of cancer and it is becoming apparent that tumors can influence the induction of potentially protective responses in a number of ways. The prevalence of immunoregulatory T cell populations in the circulation and tumors of patients with cancer is increased and the presence of these cells appears to present a major barrier to the induction of tumor immunity. One aspect of tumor-mediated immunoregulation which has received comparatively little attention is that which is directed toward natural killer (NK) cells, although evidence that the phenotype and function of NK cell populations are modified in patients with cancer is accumulating. Although the precise mechanisms underlying these localized and systemic immunoregulatory effects remain unclear, tumor-derived factors appear, in part at least, to be involved. The effects could be manifested by an altered function and/or via an influence on the migratory properties of individual cell subsets. A better insight into endogenous immunoregulatory mechanisms and the capacity of tumors to modify the phenotype and function of innate and adaptive immune cells might assist the development of new immunotherapeutic approaches and improve the management of patients with cancer. This article reviews current knowledge relating to the influence of tumors on protective anti-tumor immunity and considers the potential influence that radiation-induced effects might have on the prevalence, phenotype, and function of innate and adaptive immune cells in patients with cancer. PMID:23378947

  19. Novel 6xHis tagged foot-and-mouth disease virus vaccine bound to nanolipoprotein adjuvant via metal ions provides antigenic distinction and effective protective immunity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rai, Devendra K.; Segundo, Fayna Diaz-San; Department of Pathobiology and Veterinary Science, CANR, University of Connecticut, Storrs, CT 06269

    Here, we engineered two FMD viruses with histidine residues inserted into or fused to the FMDV capsid. Both 6xHis viruses exhibited growth kinetics, plaque morphologies and antigenic characteristics similar to wild-type virus. The 6xHis tag allowed one-step purification of the mutant virions by Co{sup 2+} affinity columns. Electron microscopy and biochemical assays showed that the 6xHis FMDVs readily assembled into antigen: adjuvant complexes in solution, by conjugating with Ni{sup 2+}-chelated nanolipoprotein and monophosphoryl lipid A adjuvant (MPLA:NiNLP). Animals Immunized with the inactivated 6xHis-FMDV:MPLA:NiNLP vaccine acquired enhanced protective immunity against FMDV challenge compared to virions alone. Induction of anti-6xHis and anti-FMDVmore » neutralizing antibodies in the immunized animals could be exploited in the differentiation of vaccinated from infected animals needed for the improvement of FMD control measures. The novel marker vaccine/nanolipid technology described here has broad applications for the development of distinctive and effective immune responses to other pathogens of importance. - Highlights: • 6xHis-tags in A{sub 24} FMDV enable purification and biding to adjuvants via metal ions. • 6xHis A{sub 24} FMDV:MPLA:NiNLP vaccine enhanced protective immunity against FMDV. • Surface exposed capsid tags allow distinction of infected from vaccinated animals.« less

  20. Passive Immune-Protection of Litopenaeus vannamei against Vibrio harveyi and Vibrio parahaemolyticus Infections with Anti-Vibrio Egg Yolk (IgY)-Encapsulated Feed

    PubMed Central

    Gao, Xiaojian; Zhang, Xiaojun; Lin, Li; Yao, Dongrui; Sun, Jingjing; Du, Xuedi; Li, Xiumei; Zhang, Yue

    2016-01-01

    Vibrio spp. are major causes of mortality in white shrimp (Litopenaeus vannamei) which is lacking adaptive immunity. Passive immunization with a specific egg yolk antibody (IgY) is a potential method for the protection of shrimp against vibriosis. In this study, immune effects of the specific egg yolk powders (IgY) against both V. harveyi and V. parahaemolyticus on white shrimp were evaluated. The egg yolk powders against V. harveyi and V. parahaemolyticus for passive immunization of white shrimp were prepared, while a tube agglutination assay and an indirect enzyme-linked immunosorbent assay (ELISA) were used for detection of IgY titer. Anti-Vibrio egg yolk was encapsulated by β-cyclodextrin, which could keep the activity of the antibody in the gastrointestinal tract of shrimp. The results showed that the anti-Vibrio egg powders had an inhibiting effect on V. harveyi and V. parahaemolyticus in vitro. Lower mortality of infected zoeae, mysis, and postlarva was observed in groups fed with anti-Vibrio egg powders, compared with those fed with normal egg powders. The bacterial load in postlarva fed with specific egg powders in seeding ponds was significantly lower than those fed with normal egg powders in seeding ponds. These results show that passive immunization by oral administration with specific egg yolk powders (IgY) may provide a valuable protection of vibrio infections in white shrimp. PMID:27196895

  1. Preparation for emergence of an Eastern European porcine reproductive and respiratory syndrome virus (PRRSV) strain in Western Europe: Immunization with modified live virus vaccines or a field strain confers partial protection.

    PubMed

    Renson, P; Fablet, C; Le Dimna, M; Mahé, S; Touzain, F; Blanchard, Y; Paboeuf, F; Rose, N; Bourry, O

    2017-05-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes huge economic losses for the swine industry worldwide. In the past several years, highly pathogenic strains that lead to even greater losses have emerged. For the Western European swine industry, one threat is the possible introduction of Eastern European PRRSV strains (example Lena genotype 1.3) which were shown to be more virulent than common Western resident strains under experimental conditions. To prepare for the possible emergence of this strain in Western Europe, we immunized piglets with a Western European PRRSV field strain (Finistere: Fini, genotype 1.1), a new genotype 1 commercial modified live virus (MLV) vaccine (MLV1) or a genotype 2 commercial MLV vaccine (MLV2) to evaluate and compare the level of protection that these strains conferred upon challenge with the Lena strain 4 weeks later. Results show that immunization with Fini, MLV1 or MLV2 strains shortened the Lena-induced hyperthermia. In the Fini group, a positive effect was also demonstrated in growth performance. The level of Lena viremia was reduced for all immunized groups (significantly so for Fini and MLV2). This reduction in Lena viremia was correlated with the level of Lena-specific IFNγ-secreting cells. In conclusion, we showed that a commercial MLV vaccine of genotype 1 or 2, as well as a field strain of genotype 1.1 may provide partial clinical and virological protection upon challenge with the Lena strain. The cross-protection induced by these immunizing strains was not related with the level of genetic similarity to the Lena strain. The slightly higher level of protection established with the field strain is attributed to a better cell-mediated immune response. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): A promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination.

    PubMed

    Cui, Li-Chun; Guan, Xue-Ting; Liu, Zhong-Mei; Tian, Chang-Yong; Xu, Yi-Gang

    2015-06-17

    Spring viremia of carp virus (SVCV) and koi herpesvirus (KHV) are highly contagious and pathogenic to cyprinid fish, causing enormous economic losses in aquaculture. Although DNA vaccines reported in recent years could induce protective immune responses in carps against these viruses via injection, there are a number of consequences and uncertainties related to DNA vaccination. Therefore, more effective and practical method to induce protective immunity such as oral administration would be highly desirable. In this study, we investigated the utilities of a genetically engineered Lactobacillus plantarum (L. plantarum) coexpressing glycoprotein (G) of SVCV and ORF81 protein of KHV as oral vaccine to induce protective immunity in carps via oral vaccination. The surface-displayed recombinant plasmid pYG-G-ORF81 was electroporated into L. plantarum, giving rise to LP/pYG-G-ORF81, where expression and localization of G-ORF81 fusion protein from the LP/pYG-G-ORF81 was identified by SDS-PAGE, Western blotting and immunofluorescence assay. Bait feed particles containing the LP/pYG-G-ORF81 were used as vaccine to immunize carps via gastrointestinal route. Compared to control groups, the carps orally immunized with the LP/pYG-G-ORF81 were induced significant levels of immunoglobulin M (IgM), and its immunogenicity was confirmed by viral loads reduction detected by PCR assay after virus challenge followed by an effective protection rate 71% in vaccinated carps and 53% in vaccinated koi until at days 65 post challenge, respectively. Our study here demonstrates, for the first time, the ability of recombinant L. plantarum as oral vaccine against SVCV and KHV infection in carps, suggesting a practical multivalent strategy for the control of spring viremia of carp and koi herpesvirus disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Targeting the Genital Tract Mucosa with a Lipopeptide/Recombinant Adenovirus Prime/Boost Vaccine Induces Potent and Long-Lasting CD8+ T Cell Immunity Against Herpes: Importance of Myeloid Differentiation Factor 881

    PubMed Central

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; BenMohamed, Lbachir

    2012-01-01

    Targeting the mucosal immune system of the genital tract (GT) with subunit vaccines failed to induce potent and durable local CD8+ T cell immunity, crucial for protection against many sexually transmitted viral (STV) pathogens, including herpes simplex virus type 2 (HSV-2) that causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8+ T cell immunity to protect the female genital tract from herpes. The lipopeptide and the rAdv5 vaccine express the immunodominant HSV-2 CD8+ T cell epitope (gB498-505) and both were delivered intravaginally (IVAG) in the progesterone-induced B6 mouse model of genital herpes. Compared to its homologous lipopeptide/lipopeptide (Lipo/Lipo); the Lipo/rAdv5 prime/boost immunized mice: (i) developed potent and sustained HSV-specific CD8+ T cells, detected in both the GT draining nodes (GT-DLN) and in the vaginal mucosa (VM); (ii) had significantly lower virus titers; (iii) had decreased overt signs of genital herpes disease; and (iv) did not succumb to lethal infection (p < 0.005), following intravaginal HSV-2 challenge. Polyfunctional CD8+ T cells, producing IFN-γ, TNF-α and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8+ T cell response was significantly compromised in the absence of the adaptor myeloid differentiation factor 88 (MyD88) (p = 0.0001). Taken together, these findings indicate that targeting the VM with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8+ T cell protective immunity against sexually transmitted herpes infection and disease. PMID:23018456

  4. Development of Novel Prime-Boost Strategies Based on a Tri-Gene Fusion Recombinant L. tarentolae Vaccine against Experimental Murine Visceral Leishmaniasis

    PubMed Central

    Saljoughian, Noushin; Taheri, Tahereh; Zahedifard, Farnaz; Taslimi, Yasaman; Doustdari, Fatemeh; Bolhassani, Azam; Doroud, Delaram; Azizi, Hiva; Heidari, Kazem; Vasei, Mohammad; Namvar Asl, Nabiollah; Papadopoulou, Barbara; Rafati, Sima

    2013-01-01

    Visceral leishmaniasis (VL) is a vector-borne disease affecting humans and domestic animals that constitutes a serious public health problem in many countries. Although many antigens have been examined so far as protein- or DNA-based vaccines, none of them conferred complete long-term protection. The use of the lizard non-pathogenic to humans Leishmania (L.) tarentolae species as a live vaccine vector to deliver specific Leishmania antigens is a recent approach that needs to be explored further. In this study, we evaluated the effectiveness of live vaccination in protecting BALB/c mice against L. infantum infection using prime-boost regimens, namely Live/Live and DNA/Live. As a live vaccine, we used recombinant L. tarentolae expressing the L. donovani A2 antigen along with cysteine proteinases (CPA and CPB without its unusual C-terminal extension (CPB-CTE)) as a tri-fusion gene. For DNA priming, the tri-fusion gene was encoded in pcDNA formulated with cationic solid lipid nanoparticles (cSLN) acting as an adjuvant. At different time points post-challenge, parasite burden and histopathological changes as well as humoral and cellular immune responses were assessed. Our results showed that immunization with both prime-boost A2-CPA-CPB-CTE-recombinant L. tarentolae protects BALB/c mice against L. infantum challenge. This protective immunity is associated with a Th1-type immune response due to high levels of IFN-γ production prior and after challenge and with lower levels of IL-10 production after challenge, leading to a significantly higher IFN-γ/IL-10 ratio compared to the control groups. Moreover, this immunization elicited high IgG1 and IgG2a humoral immune responses. Protection in mice was also correlated with a high nitric oxide production and low parasite burden. Altogether, these results indicate the promise of the A2-CPA-CPB-CTE-recombinant L. tarentolae as a safe live vaccine candidate against VL. PMID:23638195

  5. Onset of immunity in kittens after vaccination with a non-adjuvanted vaccine against feline panleucopenia, feline calicivirus and feline herpesvirus.

    PubMed

    Jas, D; Aeberlé, C; Lacombe, V; Guiot, A L; Poulet, H

    2009-10-01

    The induction of a quick onset of immunity against feline parvovirus (FPV), feline herpesvirus (FHV) and feline calicivirus (FCV) is critical both in young kittens after the decline of maternal antibodies and in cats at high risk of exposure. The onset of immunity for the core components was evaluated in 8-9 week old specific pathogen free kittens by challenge 1 week after vaccination with a combined modified live (FPV, FHV) and inactivated (FCV) vaccine. The protection obtained 1 week after vaccination was compared to that obtained when the challenge was performed 3-4 weeks after vaccination. The protocol consisted of a single injection for vaccination against FPV and two injections 4 weeks apart for FHV and FCV. At 1 week after vaccination, the kittens showed no FPV-induced clinical signs or leukopenia following challenge, and after FCV and FHV challenges the clinical score was significantly lower in vaccinated animals than in controls. Interestingly, the relative efficacy of the vaccination was comparable whether the animals were challenged 1 week or 3-4 weeks after vaccination, indicating that the onset of protection occurred within 7 days of vaccination. Following the 1-week challenge, excretion of FPV, FHV and FCV was significantly reduced in vaccinated cats compared to control kittens, confirming the onset of immunity within 7 days of vaccination.

  6. HIV neuropathogenesis: a tight rope walk of innate immunity.

    PubMed

    Yao, Honghong; Bethel-Brown, Crystal; Li, Cicy Zidong; Buch, Shilpa J

    2010-12-01

    During the course of HIV-1 disease, virus neuroinvasion occurs as an early event, within weeks following infection. Intriguingly, subsequent central nervous system (CNS) complications manifest only decades after the initial virus exposure. Although CNS is commonly regarded as an immune-privileged site, emerging evidence indicates that innate immunity elicited by the CNS glial cells is a critical determinant for the establishment of protective immunity. Sustained expression of these protective immune responses, however, can be a double-edged sword. As protective immune mediators, cytokines have the ability to function in networks and co-operate with other host/viral mediators to tip the balance from a protective to toxic state in the CNS. Herein, we present an overview of some of the essential elements of the cerebral innate immunity in HIV neuropathogenesis including the key immune cell types of the CNS with their respective soluble immune mediators: (1) cooperative interaction of IFN-γ with the host/virus factor (platelet-derived host factor (PDGF)/viral Tat) in the induction of neurotoxic chemokine CXCL10 by macrophages, (2) response of astrocytes to viral infection, and (3) protective role of PDGF and MCP-1 in neuronal survival against HIV Tat toxicity. These components of the cerebral innate immunity do not act separately from each other but form a functional immunity network. The ultimate outcome of HIV infection in the CNS will thus be dependent on the regulation of the net balance of cell-specific protective versus detrimental responses.

  7. Vaccination with leptospiral outer membrane lipoprotein LipL32 reduces kidney invasion of Leptospira interrogans serovar canicola in hamsters.

    PubMed

    Humphryes, P C; Weeks, M E; AbuOun, M; Thomson, G; Núñez, A; Coldham, N G

    2014-04-01

    The Leptospira interrogans vaccines currently available are serovar specific and require regular booster immunizations to maintain protection of the host. In addition, a hamster challenge batch potency test is necessary to evaluate these vaccines prior to market release, requiring the use of a large number of animals, which is ethically and financially undesirable. Our previous work showed that the N terminus of the outer membrane protein LipL32 was altered in Leptospira interrogans serovar Canicola vaccines that fail the hamster challenge test, suggesting that it may be involved in the protective immune response. The aim of this study was to determine if vaccination with LipL32 protein alone could provide a protective response against challenge with L. interrogans serovar Canicola to hamsters. Recombinant LipL32, purified from an Escherichia coli expression system, was assessed for protective immunity in five groups of hamsters (n = 5) following a challenge with the virulent L. interrogans serovar Canicola strain Kito as a challenge strain. However, no significant survival against the L. interrogans serovar Canicola challenge was observed compared to that of unvaccinated negative controls. Subsequent histological analysis revealed reduced amounts of L. interrogans in the kidneys from the hamsters vaccinated with recombinant LipL32 protein prior to challenge; however, no significant survival against the L. interrogans serovar Canicola challenge was observed compared to that of unvaccinated negative controls. This finding corresponded to a noticeably reduced severity of renal lesions. This study provides evidence that LipL32 is involved in the protective response against L. interrogans serovar Canicola in hamsters and is the first reported link to LipL32-induced protection against kidney invasion.

  8. Mucosal parainfluenza virus-vectored vaccine against Ebola virus replicates in the respiratory tract of vector-immune monkeys and is immunogenic.

    PubMed

    Bukreyev, Alexander A; Dinapoli, Joshua M; Yang, Lijuan; Murphy, Brian R; Collins, Peter L

    2010-04-10

    We previously used human parainfluenza virus type 3 (HPIV3) as a vector to express the Ebola virus (EBOV) GP glycoprotein. The resulting HPIV3/EboGP vaccine was immunogenic and protective against EBOV challenge in a non-human primate model. However, it remained unclear whether the vaccine would be effective in adults due to preexisting immunity to HPIV3. Here, the immunogenicity of HPIV3/EboGP was compared in HPIV3-naive and HPIV3-immune Rhesus monkeys. After a single dose of HPIV3/EboGP, the titers of EBOV-specific serum ELISA or neutralization antibodies were substantially less in HPIV3-immune animals compared to HPIV3-naive animals. However, after two doses, which were previously determined to be required for complete protection against EBOV challenge, the antibody titers were indistinguishable between the two groups. The vaccine virus appeared to replicate, at a reduced level, in the respiratory tract despite the preexisting immunity. This may reflect the known ability of HPIV3 to re-infect and may also reflect the presence of EBOV GP in the vector virion, which confers resistance to neutralization in vitro by HPIV3-specific antibodies. These data suggest that HPIV3/EboGP will be immunogenic in adults as well as children. Published by Elsevier Inc.

  9. Increased long-term immunity to Bacillus anthracis protective antigen in mice immunized with a CIA06B-adjuvanted anthrax vaccine.

    PubMed

    Wui, Seo Ri; Han, Ji Eun; Kim, Yeon Hee; Rhie, Gi-eun; Lee, Na Gyong

    2013-04-01

    Anthrax is an acute infectious disease caused by Bacillus anthracis. We previously reported that the adjuvant CIA06B, which consists of TLR4 agonist CIA05 and aluminum hydroxide (alum), enhanced the immune response to anthrax protective antigen (PA) in mice. This study was carried out to determine whether CIA06B can enhance long-term immune responses to PA in mice. BALB/c mice were immunized intramuscularly three times at 2-week intervals with recombinant PA alone or PA combined with alum or CIA06B. At 8 and 24 weeks post-immunization, the immunological responses including serum anti-PA IgG antibody titer, toxin-neutralizing antibody titer, splenic cytokine secretion and the frequency of PA-specific memory B cells were assessed. Compared with mice injected with PA alone or PA plus alum, mice injected with PA plus CIA06B had higher titers of serum anti-PA IgG antibodies, and higher frequencies of PA-specific memory B cells and interferon-γ secreting cells. Furthermore, anti-PA antibodies induced by CIA06B were more effective in neutralizing anthrax toxin. These results demonstrated that CIA06B is capable of providing long-term immunity when used as an adjuvant in a PA-based anthrax vaccine.

  10. Applying Convergent Immunity to Innovative Vaccines Targeting Staphylococcus aureus

    PubMed Central

    Yeaman, Michael R.; Filler, Scott G.; Schmidt, Clint S.; Ibrahim, Ashraf S.; Edwards, John E.; Hennessey, John P.

    2014-01-01

    Recent perspectives forecast a new paradigm for future “third generation” vaccines based on commonalities found in diverse pathogens or convergent immune defenses to such pathogens. For Staphylococcus aureus, recurring infections and a limited success of vaccines containing S. aureus antigens imply that native antigens induce immune responses insufficient for optimal efficacy. These perspectives exemplify the need to apply novel vaccine strategies to high-priority pathogens. One such approach can be termed convergent immunity, where antigens from non-target organisms that contain epitope homologs found in the target organism are applied in vaccines. This approach aims to evoke atypical immune defenses via synergistic processes that (1) afford protective efficacy; (2) target an epitope from one organism that contributes to protective immunity against another; (3) cross-protect against multiple pathogens occupying a common anatomic or immunological niche; and/or (4) overcome immune subversion or avoidance strategies of target pathogens. Thus, convergent immunity has a potential to promote protective efficacy not usually elicited by native antigens from a target pathogen. Variations of this concept have been mainstays in the history of viral and bacterial vaccine development. A more far-reaching example is the pre-clinical evidence that specific fungal antigens can induce cross-kingdom protection against bacterial pathogens. This trans-kingdom protection has been demonstrated in pre-clinical studies of the recombinant Candida albicans agglutinin-like sequence 3 protein (rAls3) where it was shown that a vaccine containing rAls3 provides homologous protection against C. albicans, heterologous protection against several other Candida species, and convergent protection against several strains of S. aureus. Convergent immunity reflects an intriguing new approach to designing and developing vaccine antigens and is considered here in the context of vaccines to target S. aureus. PMID:25309545

  11. Human Enterovirus 71 Protein Displayed on the Surface of Saccharomyces cerevisiae as an Oral Vaccine.

    PubMed

    Zhang, Congdang; Wang, Yi; Ma, Shuzhi; Li, Leike; Chen, Liyun; Yan, Huimin; Peng, Tao

    2016-06-01

    Human enterovirus 71 (EV-A71), a major agent of hand, foot, and mouth disease, has become an important public health issue in recent years. No effective antiviral or vaccines against EV-A71 infection are currently available. EV-A71 infection intrudes bodies through the gastric mucosal surface and it is necessary to enhance mucosal immune response to protect children from these pathogens. Recently, the majority of EV-A71 vaccine candidates have been developed for parenteral immunization. However, parenteral vaccine candidates often induce poor mucosal responses. On the other hand, oral vaccines could induce effective mucosal and systemic immunity, and could be easily and safely administered. Thus, proper oral vaccines have attached more interest compared with parenteral vaccine. In this study, the major immunogenic capsid protein of EV-A71 was displayed on the surface of Saccharomyces cerevisiae. Oral immunization of mice with surface-displayed VP1 S. cerevisiae induced systemic humoral and mucosal immune responses, including virus-neutralizing titers, VP1-specific antibody, and the induction of Th1 immune responses in the spleen. Furthermore, oral immunization of mother mice with surface-displayed VP1 S. cerevisiae conferred protection to neonatal mice against the lethal EV-A71 infection. Furthermore, we observed that multiple boost immunization as well as higher immunization dosage could induce higher EV-A71-specific immune response. Our results demonstrated that surface-displayed VP1 S. cerevisiae could be used as potential oral vaccine against EV-A71 infection.

  12. Genotype I of Japanese Encephalitis Virus Virus-like Particles Elicit Sterilizing Immunity against Genotype I and III Viral Challenge in Swine.

    PubMed

    Fan, Yi-Chin; Chen, Jo-Mei; Lin, Jen-Wei; Chen, Yi-Ying; Wu, Guan-Hong; Su, Kuan-Hsuan; Chiou, Ming-Tang; Wu, Shang-Rung; Yin, Ji-Hang; Liao, Jiunn-Wang; Chang, Gwong-Jen J; Chiou, Shyan-Song

    2018-05-10

    Swine are a critical amplifying host involved in human Japanese encephalitis (JE) outbreaks. Cross-genotypic immunogenicity and sterile protection are important for the current genotype III (GIII) virus-derived vaccines in swine, especially now that emerging genotype I (GI) JE virus (JEV) has replaced GIII virus as the dominant strain. Herein, we aimed to develop a system to generate GI JEV virus-like particles (VLPs) and evaluate the immunogenicity and protection of the GI vaccine candidate in mice and specific pathogen-free swine. A CHO-heparan sulfate-deficient (CHO-HS(-)) cell clone, named 51-10 clone, stably expressing GI-JEV VLP was selected and continually secreted GI VLPs without signs of cell fusion. 51-10 VLPs formed a homogeneously empty-particle morphology and exhibited similar antigenic activity as GI virus. GI VLP-immunized mice showed balanced cross-neutralizing antibody titers against GI to GIV viruses (50% focus-reduction micro-neutralization assay titers 71 to 240) as well as potent protection against GI or GIII virus infection. GI VLP-immunized swine challenged with GI or GIII viruses showed no fever, viremia, or viral RNA in tonsils, lymph nodes, and brains as compared with phosphate buffered saline-immunized swine. We thus conclude GI VLPs can provide sterile protection against GI and GIII viruses in swine.

  13. IgA is Important for Clearance and Critical for Protection from Rotavirus Infection

    PubMed Central

    Blutt, Sarah E; Miller, Amber D.; Salmon, Sharon L.; Metzger, Dennis W.; Conner, Margaret E

    2012-01-01

    Based on a lack of severe phenotype in human IgA deficiency syndromes, the role of IgA in controlling respiratory and gastrointestinal (GI) infections has not been clearly defined. C57BL/6 and BALB/c mice lacking IgA (IgA−/−) were developed and used to address this question. When exposed to a common GI virus, rotavirus, IgA−/− mice exhibited a substantial and significant delay in clearance of the initial infection compared to wild type mice. IgA−/− mice excreted rotavirus in stool up to three weeks after the initial exposure compared to ten days observed in wild type mice. Importantly, IgA−/− mice failed to develop protective immunity against multiple repeat exposures to the virus. All IgA−/− mice excreted virus in the stool upon re-exposure to rotavirus while wild type mice were completely protected against re-infection. These findings clearly indicate a critical role for IgA in the establishment of immunity against a GI viral pathogen. PMID:22739233

  14. Vaccination for protection of retinal ganglion cells against death from glutamate cytotoxicity and ocular hypertension: Implications for glaucoma

    NASA Astrophysics Data System (ADS)

    Schori, Hadas; Kipnis, Jonathan; Yoles, Eti; Woldemussie, Elizabeth; Ruiz, Guadalupe; Wheeler, Larry A.; Schwartz, Michal

    2001-03-01

    Our group recently demonstrated that autoimmune T cells directed against central nervous system-associated myelin antigens protect neurons from secondary degeneration. We further showed that the synthetic peptide copolymer 1 (Cop-1), known to suppress experimental autoimmune encephalomyelitis, can be safely substituted for the natural myelin antigen in both passive and active immunization for neuroprotection of the injured optic nerve. Here we attempted to determine whether similar immunizations are protective from retinal ganglion cell loss resulting from a direct biochemical insult caused, for example, by glutamate (a major mediator of degeneration in acute and chronic optic nerve insults) and in a rat model of ocular hypertension. Passive immunization with T cells reactive to myelin basic protein or active immunization with myelin oligodendrocyte glycoprotein-derived peptide, although neuroprotective after optic nerve injury, was ineffective against glutamate toxicity in mice and rats. In contrast, the number of surviving retinal ganglion cells per square millimeter in glutamate-injected retinas was significantly larger in mice immunized 10 days previously with Cop-1 emulsified in complete Freund's adjuvant than in mice injected with PBS in the same adjuvant (2,133 ± 270 and 1,329 ± 121, respectively, mean ± SEM; P < 0.02). A similar pattern was observed when mice were immunized on the day of glutamate injection (1,777 ± 101 compared with 1,414 ± 36; P <0.05), but not when they were immunized 48h later. These findings suggest that protection from glutamate toxicity requires reinforcement of the immune system by antigens that are different from those associated with myelin. The use of Cop-1 apparently circumvents this antigen specificity barrier. In the rat ocular hypertension model, which simulates glaucoma, immunization with Cop-1 significantly reduced the retinal ganglion cell loss from 27.8%±6.8% to 4.3%±1.6%, without affecting the intraocular pressure. This study may point the way to a therapy for glaucoma, a neurodegenerative disease of the optic nerve often associated with increased intraocular pressure, as well as for acute and chronic degenerative disorders in which glutamate is a prominent participant.

  15. Composition and Variation of Macronutrients, Immune Proteins, and Human Milk Oligosaccharides in Human Milk From Nonprofit and Commercial Milk Banks.

    PubMed

    Meredith-Dennis, Laura; Xu, Gege; Goonatilleke, Elisha; Lebrilla, Carlito B; Underwood, Mark A; Smilowitz, Jennifer T

    2018-02-01

    When human milk is unavailable, banked milk is recommended for feeding premature infants. Milk banks use processes to eliminate pathogens; however, variability among methods exists. Research aim: The aim of this study was to compare the macronutrient (protein, carbohydrate, fat, energy), immune-protective protein, and human milk oligosaccharide (HMO) content of human milk from three independent milk banks that use pasteurization (Holder vs. vat techniques) or retort sterilization. Randomly acquired human milk samples from three different milk banks ( n = 3 from each bank) were analyzed for macronutrient concentrations using a Fourier transform mid-infrared spectroscopy human milk analyzer. The concentrations of IgA, IgM, IgG, lactoferrin, lysozyme, α-lactalbumin, α antitrypsin, casein, and HMO were analyzed by mass spectrometry. The concentrations of protein and fat were significantly ( p < .05) less in the retort sterilized compared with the Holder and vat pasteurized samples, respectively. The concentrations of all immune-modulating proteins were significantly ( p < .05) less in the retort sterilized samples compared with vat and/or Holder pasteurized samples. The total HMO concentration and HMOs containing fucose, sialic acid, and nonfucosylated neutral sugars were significantly ( p < .05) less in retort sterilized compared with Holder pasteurized samples. Random milk samples that had undergone retort sterilization had significantly less immune-protective proteins and total and specific HMOs compared with samples that had undergone Holder and vat pasteurization. These data suggest that further analysis of the effect of retort sterilization on human milk components is needed prior to widespread adoption of this process.

  16. Immunization with Streptococcal Heme Binding Protein (Shp) Protects Mice Against Group A Streptococcus Infection.

    PubMed

    Zhang, Xiaolan; Song, Yingli; Li, Yuanmeng; Cai, Minghui; Meng, Yuan; Zhu, Hui

    2017-01-01

    Streptococcal heme binding protein (Shp) is a surface protein of the heme acquisition system that is an essential iron nutrient in Group A Streptococcus (GAS). Here, we tested whether Shp immunization protects mice from subcutaneous infection. Mice were immunized subcutaneously with recombinant Shp and then challenged with GAS. The protective effects against GAS challenge were evaluated two weeks after the last immunization. Immunization with Shp elicited a robust IgG response, resulting in high anti-Shp IgG titers in the serum. Immunized mice had a higher survival rate and smaller skin lesions than adjuvant control mice. Furthermore, immunized mice had lower GAS numbers at the skin lesions and in the liver, spleen and lung. Histological analysis with Gram staining showed that GAS invaded the surrounding area of the inoculation sites in the skin in control mice, but not in immunized mice. Thus, Shp immunization enhances GAS clearance and reduces GAS skin invasion and systemic dissemination. These findings indicate that Shp is a protective antigen.

  17. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  18. Complex Immune Correlates of Protection in HIV-1 Vaccine Efficacy Trials

    PubMed Central

    Tomaras, Georgia D.; Plotkin, Stanley A.

    2016-01-01

    Summary Development of an efficacious HIV-1 vaccine is a major priority for improving human health worldwide. Vaccine mediated protection against human pathogens can be achieved through elicitation of protective innate, humoral, and cellular responses. Identification of specific immune responses responsible for pathogen protection enables vaccine development and provides insights into host defenses against pathogens and the immunological mechanisms that most effectively fight infection. Defining immunological correlates of transmission risk in preclinical and clinical HIV-1 vaccine trials has moved the HIV-1 vaccine development field forward and directed new candidate vaccine development. Immune correlate studies are providing novel hypotheses about immunological mechanisms that may be responsible for preventing HIV-1 acquisition. Recent results from HIV-1 immune correlates work has demonstrated that there are multiple types of immune responses that together, comprise an immune correlate—thus implicating polyfunctional immune control of HIV-1 transmission. An in depth understanding of these complex immunological mechanisms of protection against HIV-1 will accelerate the development of an efficacious HIV-1 vaccine. PMID:28133811

  19. Rodent malaria: BCG-induced protection and immunosuppression. [Mice, gamma radiation, Plasmodium berghei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smrkovski, L.L.; Strickland, G.T.

    1978-10-01

    One dose of 10/sup 7/ viable units of Mycobacterium bovis, strain BCG, protected a significant number of Swiss mice from a primary challenge with 10/sup 4/ thoracic sporozoites of Plasmodium berghei. Immunization with irradiated sporozoites induced greater protection than that observed in BCG-treated animals. Mice treated with BCG and surviving a primary sporozoite challenge were not protected from rechallenge, whereas mice immunized with irradiated sporozoites and surviving initial challenge of sporozoites were solidly immune to further challenge. Immunizing mice with BCG and irradiated sporozoites simulataneously resulted in a synergistic effect of increased protection against a primary challenge of sporozoites onlymore » if the two immunogens were administered on the same day and if the mice were challenged 1 to 3 days later. Mice given BCG and irradiated sporozoites and surviving a primary challenge of sporozoites were unable to survive rechallenge. BCG given to mice previously immunized with irradiated sporozoites suppressed their protective immunity against sporozoite challenge.« less

  20. Relative Contribution of Th1 and Th17 Cells in Adaptive Immunity to Bordetella pertussis: Towards the Rational Design of an Improved Acellular Pertussis Vaccine

    PubMed Central

    Ross, Pádraig J.; Allen, Aideen C.; Walsh, Kevin; Misiak, Alicja; Lavelle, Ed C.; McLoughlin, Rachel M.; Mills, Kingston H. G.

    2013-01-01

    Whooping cough caused by Bordetella pertussis is a re-emerging infectious disease despite the introduction of safer acellular pertussis vaccines (Pa). One explanation for this is that Pa are less protective than the more reactogenic whole cell pertussis vaccines (Pw) that they replaced. Although Pa induce potent antibody responses, and protection has been found to be associated with high concentrations of circulating IgG against vaccine antigens, it has not been firmly established that host protection induced with this vaccine is mediated solely by humoral immunity. The aim of this study was to examine the relative contribution of Th1 and Th17 cells in host immunity to infection with B. pertussis and in immunity induced by immunization with Pw and Pa and to use this information to help rationally design a more effective Pa. Our findings demonstrate that Th1 and Th17 both function in protective immunity induced by infection with B. pertussis or immunization with Pw. In contrast, a current licensed Pa, administered with alum as the adjuvant, induced Th2 and Th17 cells, but weak Th1 responses. We found that IL-1 signalling played a central role in protective immunity induced with alum-adsorbed Pa and this was associated with the induction of Th17 cells. Pa generated strong antibody and Th2 responses, but was fully protective in IL-4-defective mice, suggesting that Th2 cells were dispensable. In contrast, Pa failed to confer protective immunity in IL-17A-defective mice. Bacterial clearance mediated by Pa-induced Th17 cells was associated with cell recruitment to the lungs after challenge. Finally, protective immunity induced by an experimental Pa could be enhanced by substituting alum with a TLR agonist that induces Th1 cells. Our findings demonstrate that alum promotes protective immunity through IL-1β-induced IL-17A production, but also reveal that optimum protection against B. pertussis requires induction of Th1, but not Th2 cells. PMID:23592988

  1. Adjuvanting a Simian Immunodeficiency Virus Vaccine with Toll-Like Receptor Ligands Encapsulated in Nanoparticles Induces Persistent Antibody Responses and Enhanced Protection in TRIM5α Restrictive Macaques.

    PubMed

    Kasturi, Sudhir Pai; Kozlowski, Pamela A; Nakaya, Helder I; Burger, Matheus C; Russo, Pedro; Pham, Mathew; Kovalenkov, Yevgeniy; Silveira, Eduardo L V; Havenar-Daughton, Colin; Burton, Samantha L; Kilgore, Katie M; Johnson, Mathew J; Nabi, Rafiq; Legere, Traci; Sher, Zarpheen Jinnah; Chen, Xuemin; Amara, Rama R; Hunter, Eric; Bosinger, Steven E; Spearman, Paul; Crotty, Shane; Villinger, Francois; Derdeyn, Cynthia A; Wrammert, Jens; Pulendran, Bali

    2017-02-15

    Our previous work has shown that antigens adjuvanted with ligands specific for Toll-like receptor 4 (TLR4) and TLR7/8 encapsulated in poly(lactic-co-glycolic) acid (PLGA)-based nanoparticles (NPs) induce robust and durable immune responses in mice and macaques. We investigated the efficacy of these NP adjuvants in inducing protective immunity against simian immunodeficiency virus (SIV). Rhesus macaques (RMs) were immunized with NPs containing TLR4 and TLR7/8 agonists mixed with soluble recombinant SIVmac239-derived envelope (Env) gp140 and Gag p55 (protein) or with virus-like particles (VLPs) containing SIVmac239 Env and Gag. NP-adjuvanted vaccines induced robust innate responses, antigen-specific antibody responses of a greater magnitude and persistence, and enhanced plasmablast responses compared to those achieved with alum-adjuvanted vaccines. NP-adjuvanted vaccines induced antigen-specific, long-lived plasma cells (LLPCs), which persisted in the bone marrow for several months after vaccination. NP-adjuvanted vaccines induced immune responses that were associated with enhanced protection against repeated low-dose, intravaginal challenges with heterologous SIVsmE660 in animals that carried TRIM5α restrictive alleles. The protection induced by immunization with protein-NP correlated with the prechallenge titers of Env-specific IgG antibodies in serum and vaginal secretions. However, no such correlate was apparent for immunization with VLP-NP or alum as the adjuvant. Transcriptional profiling of peripheral blood mononuclear cells isolated within the first few hours to days after primary vaccination revealed that NP-adjuvanted vaccines induced a molecular signature similar to that induced by the live attenuated yellow fever viral vaccine. This systems approach identified early blood transcriptional signatures that correlate with Env-specific antibody responses in vaginal secretions and protection against infection. These results demonstrate the adjuvanticity of the NP adjuvant in inducing persistent and protective antibody responses against SIV in RMs with implications for the design of vaccines against human immunodeficiency virus (HIV). The results of the RV144 HIV vaccine trial, which demonstrated a rapid waning of protective immunity with time, have underscored the need to develop strategies to enhance the durability of protective immune responses. Our recent work in mice has highlighted the capacity of nanoparticle-encapsulated TLR ligands (NP) to induce potent and durable antibody responses that last a lifetime in mice. In the present study, we evaluated the ability of these NP adjuvants to promote robust and durable protective immune responses against SIV in nonhuman primates. Our results demonstrate that immunization of rhesus macaques with NP adjuvants mixed with soluble SIV Env or a virus-like particle form of Env (VLP) induces potent and durable Env-specific antibody responses in the serum and in vaginal secretions. These responses were superior to those induced by alum adjuvant, and they resulted in enhanced protection against a low-dose intravaginal challenge with a heterologous strain of SIV in animals with TRIM5a restrictive alleles. These results highlight the potential for such NP TLR L adjuvants in promoting robust and durable antibody responses against HIV in the next generation of HIV immunogens currently being developed. Copyright © 2017 American Society for Microbiology.

  2. CD4+ T Cells Recognizing PE/PPE Antigens Directly or via Cross Reactivity Are Protective against Pulmonary Mycobacterium tuberculosis Infection

    PubMed Central

    Sayes, Fadel; Pawlik, Alexandre; Frigui, Wafa; Gröschel, Matthias I.; Crommelynck, Samuel; Fayolle, Catherine; Cia, Felipe; Bancroft, Gregory J.; Bottai, Daria; Leclerc, Claude; Brosch, Roland; Majlessi, Laleh

    2016-01-01

    Mycobacterium tuberculosis (Mtb), possesses at least three type VII secretion systems, ESX-1, -3 and -5 that are actively involved in pathogenesis and host-pathogen interaction. We recently showed that an attenuated Mtb vaccine candidate (Mtb Δppe25-pe19), which lacks the characteristic ESX-5-associated pe/ppe genes, but harbors all other components of the ESX-5 system, induces CD4+ T-cell immune responses against non-esx-5-associated PE/PPE protein homologs. These T cells strongly cross-recognize the missing esx-5-associated PE/PPE proteins. Here, we characterized the fine composition of the functional cross-reactive Th1 effector subsets specific to the shared PE/PPE epitopes in mice immunized with the Mtb Δppe25-pe19 vaccine candidate. We provide evidence that the Mtb Δppe25-pe19 strain, despite its significant attenuation, is comparable to the WT Mtb strain with regard to: (i) its antigenic repertoire related to the different ESX systems, (ii) the induced Th1 effector subset composition, (iii) the differentiation status of the Th1 cells induced, and (iv) its particular features at stimulating the innate immune response. Indeed, we found significant contribution of PE/PPE-specific Th1 effector cells in the protective immunity against pulmonary Mtb infection. These results offer detailed insights into the immune mechanisms underlying the remarkable protective efficacy of the live attenuated Mtb Δppe25-pe19 vaccine candidate, as well as the specific potential of PE/PPE proteins as protective immunogens. PMID:27467705

  3. Pneumonic plague pathogenesis and immunity in Brown Norway rats.

    PubMed

    Anderson, Deborah M; Ciletti, Nancy A; Lee-Lewis, Hanni; Elli, Derek; Segal, Joshua; DeBord, Kristin L; Overheim, Katie A; Tretiakova, Maria; Brubaker, Robert R; Schneewind, Olaf

    2009-03-01

    The Brown Norway rat was recently described as a bubonic plague model that closely mimics human disease. We therefore evaluated the Brown Norway rat as an alternative small animal model for pneumonic plague and characterized both the efficacy and potency of vaccine candidates. When infected by intranasal instillation, these rats rapidly developed fatal pneumonic plague within 2 to 4 days of infection. Plague disease was characterized by severe alveolar edema and vascular hemorrhage in the lung in addition to fulminant necrotizing pneumonia caused by massive bacterial replication and inflammation. Twenty-four hours before death, animals developed systemic disease with an apparent delayed inflammatory response. We evaluated the ability of the protective antigen, LcrV, and a mutant derivative, V10, to protect these rats from pneumonic plague. Both were highly effective vaccines because complete protection was observed at challenge doses of 7500 LD(50). Antibody analyses suggested stronger potency of V10 immune sera compared with LcrV in the passive transfer of immunity to bubonic plague, with multiple neutralizing epitopes in LcrV. Taken together, these data demonstrate the effectiveness of inhibiting type III secretion in the prevention of pneumonic plague in rats and reveal critical contributions from both the cellular and humoral immune systems. Thus, the Brown Norway rat is an appealing alternative small animal model for the study of pneumonic plague pathogenesis and immunity.

  4. Interferon regulatory factor 8-deficiency determines massive neutrophil recruitment but T cell defect in fast growing granulomas during tuberculosis.

    PubMed

    Rocca, Stefano; Schiavoni, Giovanna; Sali, Michela; Anfossi, Antonio Giovanni; Abalsamo, Laura; Palucci, Ivana; Mattei, Fabrizio; Sanchez, Massimo; Giagu, Anna; Antuofermo, Elisabetta; Fadda, Giovanni; Belardelli, Filippo; Delogu, Giovanni; Gabriele, Lucia

    2013-01-01

    Following Mycobacterium tuberculosis (Mtb) infection, immune cell recruitment in lungs is pivotal in establishing protective immunity through granuloma formation and neogenesis of lymphoid structures (LS). Interferon regulatory factor-8 (IRF-8) plays an important role in host defense against Mtb, although the mechanisms driving anti-mycobacterial immunity remain unclear. In this study, IRF-8 deficient mice (IRF-8⁻/⁻) were aerogenously infected with a low-dose Mtb Erdman virulent strain and the course of infection was compared with that induced in wild-type (WT-B6) counterparts. Tuberculosis (TB) progression was examined in both groups using pathological, microbiological and immunological parameters. Following Mtb exposure, the bacterial load in lungs and spleens progressed comparably in the two groups for two weeks, after which IRF-8⁻/⁻ mice developed a fatal acute TB whereas in WT-B6 the disease reached a chronic stage. In lungs of IRF-8⁻/⁻, uncontrolled growth of pulmonary granulomas and impaired development of LS were observed, associated with unbalanced homeostatic chemokines, progressive loss of infiltrating T lymphocytes and massive prevalence of neutrophils at late infection stages. Our data define IRF-8 as an essential factor for the maintenance of proper immune cell recruitment in granulomas and LS required to restrain Mtb infection. Moreover, IRF-8⁻/⁻ mice, relying on a common human and mouse genetic mutation linked to susceptibility/severity of mycobacterial diseases, represent a valuable model of acute TB for comparative studies with chronically-infected congenic WT-B6 for dissecting protective and pathological immune reactions.

  5. Interferon Regulatory Factor 8-Deficiency Determines Massive Neutrophil Recruitment but T Cell Defect in Fast Growing Granulomas during Tuberculosis

    PubMed Central

    Sali, Michela; Anfossi, Antonio Giovanni; Abalsamo, Laura; Palucci, Ivana; Mattei, Fabrizio; Sanchez, Massimo; Giagu, Anna; Antuofermo, Elisabetta; Fadda, Giovanni; Belardelli, Filippo; Delogu, Giovanni; Gabriele, Lucia

    2013-01-01

    Following Mycobacterium tuberculosis (Mtb) infection, immune cell recruitment in lungs is pivotal in establishing protective immunity through granuloma formation and neogenesis of lymphoid structures (LS). Interferon regulatory factor-8 (IRF-8) plays an important role in host defense against Mtb, although the mechanisms driving anti-mycobacterial immunity remain unclear. In this study, IRF-8 deficient mice (IRF-8−/−) were aerogenously infected with a low-dose Mtb Erdman virulent strain and the course of infection was compared with that induced in wild-type (WT-B6) counterparts. Tuberculosis (TB) progression was examined in both groups using pathological, microbiological and immunological parameters. Following Mtb exposure, the bacterial load in lungs and spleens progressed comparably in the two groups for two weeks, after which IRF-8−/− mice developed a fatal acute TB whereas in WT-B6 the disease reached a chronic stage. In lungs of IRF-8−/−, uncontrolled growth of pulmonary granulomas and impaired development of LS were observed, associated with unbalanced homeostatic chemokines, progressive loss of infiltrating T lymphocytes and massive prevalence of neutrophils at late infection stages. Our data define IRF-8 as an essential factor for the maintenance of proper immune cell recruitment in granulomas and LS required to restrain Mtb infection. Moreover, IRF-8−/− mice, relying on a common human and mouse genetic mutation linked to susceptibility/severity of mycobacterial diseases, represent a valuable model of acute TB for comparative studies with chronically-infected congenic WT-B6 for dissecting protective and pathological immune reactions. PMID:23717393

  6. Comparison of phage pVIII and KLH as vector in inducing the production of cytokines in C57BL/6J mice.

    PubMed

    Su, Quan-Ping; Wen, De-Zhong; Yang, Qiong; Zhang, Yan-Hui; Liu, Chong; Wang, Li

    2007-01-22

    We have demonstrated that phage display Candida albicans (C. albicans) LKVIRK epitope was protective in systemically infected C57BL/6J mice. The different development from precursor Ths, Th1 or Th2, will result in a protective or nonprotective immune response. To compare the types of cytokines induced by biologically and chemically synthesized vectors, C57BL/6J mice were immunized with hybrid phage displaying the epitope of LKVIRK and by synthesized peptide epitope LKVIRKNIVKKMIE conjugated through cysteine to keyhole limpet haemocyanin (KLH). The production of cytokines in spleens of immunized mice and in splenocytes culture supernatants stimulated by homologous immunogen in vitro was studied by RT-PCR and quantitative sandwich ELISA. The results showed that, compared to Tris-EDTA buffer (TE, 1 mM Tris, 0.1 mM EDTA, pH 8.0) injected mice, the expressions of Th1 type cytokine IFN-gamma, IL-2 and IL-12 were increased in hybrid phage, KLH-C, and wild phage immunized mice, and there were no differences between mice immunized with hybrid phage and KLH-C. While the expression of Th2 type cytokine IL-10 was similar in all mice, IL-4 was not detected. We obtained the same results in mRNA and protein level. These findings indicated that as carriers, phage and KLH were similar in inducing the Th1 type cytokines expression. Comparing to peptide synthesis couple with a carrier protein for injection, phage may be an inexpensive and simple route to the production of effective vaccines.

  7. Immunization with recombinant V10 protects cynomolgus macaques from lethal pneumonic plague.

    PubMed

    Cornelius, Claire A; Quenee, Lauriane E; Overheim, Katie A; Koster, Frederick; Brasel, Trevor L; Elli, Derek; Ciletti, Nancy A; Schneewind, Olaf

    2008-12-01

    Vaccine and therapeutic strategies that prevent infections with Yersinia pestis have been sought for over a century. Immunization with live attenuated (nonpigmented) strains and immunization with subunit vaccines containing recombinant low-calcium-response V antigen (rLcrV) and recombinant F1 (rF1) antigens are considered effective in animal models. Current antiplague subunit vaccines in development for utilization in humans contain both antigens, either as equal concentrations of the two components (rF1 plus rLcrV) or as a fusion protein (rF1-rLcrV). Here, we show that immunization with either purified rLcrV (a protein at the tip of type III needles) or a variant of this protein, recombinant V10 (rV10) (lacking amino acid residues 271 to 300), alone or in combination with rF1, prevented pneumonic lesions and disease pathogenesis. In addition, passive immunization studies showed that specific antibodies of macaques immunized with rLcrV, rV10, or rF1, either alone or in combination, conferred protection against bubonic plague challenge in mice. Finally, we found that when we compared the reactivities of anti-rLcrV and anti-rV10 immune sera from cynomolgus macaques, BALB/c mice, and brown Norway rats with LcrV-derived peptides, rV10, but not rLcrV immune sera, lacked antibodies recognizing linear LcrV oligopeptides.

  8. Biomarkers of Safety and Immune Protection for Genetically Modified Live Attenuated Leishmania Vaccines Against Visceral Leishmaniasis – Discovery and Implications

    PubMed Central

    Gannavaram, Sreenivas; Dey, Ranadhir; Avishek, Kumar; Selvapandiyan, Angamuthu; Salotra, Poonam; Nakhasi, Hira L.

    2014-01-01

    Despite intense efforts there is no safe and efficacious vaccine against visceral leishmaniasis, which is fatal and endemic in many tropical countries. A major shortcoming in the vaccine development against blood-borne parasitic agents such as Leishmania is the inadequate predictive power of the early immune responses mounted in the host against the experimental vaccines. Often immune correlates derived from in-bred animal models do not yield immune markers of protection that can be readily extrapolated to humans. The limited efficacy of vaccines based on DNA, subunit, heat killed parasites has led to the realization that acquisition of durable immunity against the protozoan parasites requires a controlled infection with a live attenuated organism. Recent success of irradiated malaria parasites as a vaccine candidate further strengthens this approach to vaccination. We developed several gene deletion mutants in Leishmania donovani as potential live attenuated vaccines and reported extensively on the immunogenicity of LdCentrin1 deleted mutant in mice, hamsters, and dogs. Additional limited studies using genetically modified live attenuated Leishmania parasites as vaccine candidates have been reported. However, for the live attenuated parasite vaccines, the primary barrier against widespread use remains the absence of clear biomarkers associated with protection and safety. Recent studies in evaluation of vaccines, e.g., influenza and yellow fever vaccines, using systems biology tools demonstrated the power of such strategies in understanding the immunological mechanisms that underpin a protective phenotype. Applying similar tools in isolated human tissues such as PBMCs from healthy individuals infected with live attenuated parasites such as LdCen−/− in vitro followed by human microarray hybridization experiments will enable us to understand how early vaccine-induced gene expression profiles and the associated immune responses are coordinately regulated in normal individuals. In addition, comparative analysis of biomarkers in PBMCs from asymptomatic or healed visceral leishmaniasis individuals in response to vaccine candidates including live attenuated parasites may provide clues about determinants of protective immunity and be helpful in shaping the final Leishmania vaccine formulation in the clinical trials. PMID:24904589

  9. Biomarkers of safety and immune protection for genetically modified live attenuated leishmania vaccines against visceral leishmaniasis - discovery and implications.

    PubMed

    Gannavaram, Sreenivas; Dey, Ranadhir; Avishek, Kumar; Selvapandiyan, Angamuthu; Salotra, Poonam; Nakhasi, Hira L

    2014-01-01

    Despite intense efforts there is no safe and efficacious vaccine against visceral leishmaniasis, which is fatal and endemic in many tropical countries. A major shortcoming in the vaccine development against blood-borne parasitic agents such as Leishmania is the inadequate predictive power of the early immune responses mounted in the host against the experimental vaccines. Often immune correlates derived from in-bred animal models do not yield immune markers of protection that can be readily extrapolated to humans. The limited efficacy of vaccines based on DNA, subunit, heat killed parasites has led to the realization that acquisition of durable immunity against the protozoan parasites requires a controlled infection with a live attenuated organism. Recent success of irradiated malaria parasites as a vaccine candidate further strengthens this approach to vaccination. We developed several gene deletion mutants in Leishmania donovani as potential live attenuated vaccines and reported extensively on the immunogenicity of LdCentrin1 deleted mutant in mice, hamsters, and dogs. Additional limited studies using genetically modified live attenuated Leishmania parasites as vaccine candidates have been reported. However, for the live attenuated parasite vaccines, the primary barrier against widespread use remains the absence of clear biomarkers associated with protection and safety. Recent studies in evaluation of vaccines, e.g., influenza and yellow fever vaccines, using systems biology tools demonstrated the power of such strategies in understanding the immunological mechanisms that underpin a protective phenotype. Applying similar tools in isolated human tissues such as PBMCs from healthy individuals infected with live attenuated parasites such as LdCen(-/-) in vitro followed by human microarray hybridization experiments will enable us to understand how early vaccine-induced gene expression profiles and the associated immune responses are coordinately regulated in normal individuals. In addition, comparative analysis of biomarkers in PBMCs from asymptomatic or healed visceral leishmaniasis individuals in response to vaccine candidates including live attenuated parasites may provide clues about determinants of protective immunity and be helpful in shaping the final Leishmania vaccine formulation in the clinical trials.

  10. Heterologous live infectious bronchitis virus vaccination in day-old commercial broiler chicks: clinical signs, ciliary health, immune responses and protection against variant infectious bronchitis viruses.

    PubMed

    Awad, Faez; Hutton, Sally; Forrester, Anne; Baylis, Matthew; Ganapathy, Kannan

    2016-01-01

    Groups of one-day-old broiler chicks were vaccinated via the oculo-nasal route with different live infectious bronchitis virus (IBV) vaccines: Massachusetts (Mass), 793B, D274 or Arkansas (Ark). Clinical signs and gross lesions were evaluated. Five chicks from each group were humanely killed at intervals and their tracheas collected for ciliary activity assessment and for the detection of CD4+, CD8+ and IgA-bearing B cells by immunohistochemistry (IHC). Blood samples were collected at intervals for the detection of anti-IBV antibodies. At 21 days post-vaccination (dpv), protection conferred by different vaccination regimes against virulent M41, QX and 793B was assessed. All vaccination programmes were able to induce high levels of CD4+, CD8+ and IgA-bearing B cells in the trachea. Significantly higher levels of CD4+ and CD8+ expression were observed in the Mass2 + 793B2-vaccinated group compared to the other groups (subscripts indicate different manufacturers). Protection studies showed that the group of chicks vaccinated with Mass2 + 793B2 produced 92% ciliary protection against QX challenge; compared to 53%, 68% and 73% ciliary protection against the same challenge virus by Mass1 + D274, Mass1 + 793B1 and Mass3 + Ark, respectively. All vaccination programmes produced more than 85% ciliary protection against M41 and 793B challenges. It appears that the variable levels of protection provided by different heterologous live IBV vaccinations are dependent on the levels of local tracheal immunity induced by the respective vaccine combination. The Mass2 + 793B2 group showed the worst clinical signs, higher mortality and severe lesions following vaccination, but had the highest tracheal immune responses and demonstrated the best protection against all three challenge viruses.

  11. Self-Adjuvanting Glycopeptide Conjugate Vaccine against Disseminated Candidiasis

    PubMed Central

    Xin, Hong; Cartmell, Jonathan; Bailey, Justin J.; Dziadek, Sebastian; Bundle, David R.; Cutler, Jim E.

    2012-01-01

    Our research on pathogenesis of disseminated candidiasis led to the discovery that antibodies specific for Candida albicans cell surface β-1, 2–mannotriose [β-(Man)3] protect mice. A 14 mer peptide Fba, which derived from the N-terminal portion of the C. albicans cytosolic/cell surface protein fructose-bisphosphate aldolase, was used as the glycan carrier and resulted in a novel synthetic glycopeptide vaccine β-(Man)3-Fba. By a dendritic cell-based immunization approach, this conjugate induced protective antibody responses against both the glycan and peptide parts of the vaccine. In this report, we modified the β-(Man)3-Fba conjugate by coupling it to tetanus toxoid (TT) in order to improve immunogenicity and allow for use of an adjuvant suitable for human use. By new immunization procedures entirely compatible with human use, the modified β-(Man)3-Fba-TT was administered either alone or as a mixture made with alum or monophosphoryl lipid A (MPL) adjuvants and given to mice by a subcutaneous (s.c.) route. Mice vaccinated with or, surprisingly, without adjuvant responded well by making robust antibody responses. The immunized groups showed a high degree of protection against a lethal challenge with C. albicans as evidenced by increased survival times and reduced kidney fungal burden as compared to control groups that received only adjuvant or DPBS buffer prior to challenge. To confirm that induced antibodies were protective, sera from mice immunized against the β-(Man)3-Fba-TT conjugate transferred protection against disseminated candidiasis to naïve mice, whereas C. albicans-absorbed immune sera did not. Similar antibody responses and protection induced by the β-(Man)3-Fba-TT vaccine was observed in inbred BALB/c and outbred Swiss Webster mice. We conclude that addition of TT to the glycopeptide conjugate results in a self-adjuvanting vaccine that promotes robust antibody responses without the need for additional adjuvant, which is novel and represents a major step forward in vaccine design against disseminated candidiasis. PMID:22563378

  12. Breastfeeding Behaviors and the Innate Immune System of Human Milk: Working Together to Protect Infants against Inflammation, HIV-1, and Other Infections.

    PubMed

    Henrick, Bethany M; Yao, Xiao-Dan; Nasser, Laila; Roozrogousheh, Ava; Rosenthal, Kenneth L

    2017-01-01

    The majority of infants' breastfeeding from their HIV-infected mothers do not acquire HIV-1 infection despite exposure to cell-free virus and cell-associated virus in HIV-infected breast milk. Paradoxically, exclusive breastfeeding regardless of the HIV status of the mother has led to a significant decrease in mother-to-child transmission (MTCT) compared with non-exclusive breastfeeding. Although it remains unclear how these HIV-exposed infants remain uninfected despite repeated and prolonged exposure to HIV-1, the low rate of transmission is suggestive of a multitude of protective, short-lived bioactive innate immune factors in breast milk. Indeed, recent studies of soluble factors in breast milk shed new light on mechanisms of neonatal HIV-1 protection. This review highlights the role and significance of innate immune factors in HIV-1 susceptibility and infection. Prevention of MTCT of HIV-1 is likely due to multiple factors, including innate immune factors such as lactoferrin and elafin among many others. In pursuing this field, our lab was the first to show that soluble toll-like receptor 2 (sTLR2) directly inhibits HIV infection, integration, and inflammation. More recently, we demonstrated that sTLR2 directly binds to selective HIV-1 proteins, including p17, gp41, and p24, leading to significantly reduced NFκB activation, interleukin-8 production, CCR5 expression, and HIV infection in a dose-dependent manner. Thus, a clearer understanding of soluble milk-derived innate factors with known antiviral functions may provide new therapeutic insights to reduce vertical HIV-1 transmission and will have important implications for protection against HIV-1 infection at other mucosal sites. Furthermore, innate bioactive factors identified in human milk may serve not only in protecting infants against infections and inflammation but also the elderly; thus, opening the door for novel innate immune therapeutics to protect newborns, infants, adults, and the elderly.

  13. Breastfeeding Behaviors and the Innate Immune System of Human Milk: Working Together to Protect Infants against Inflammation, HIV-1, and Other Infections

    PubMed Central

    Henrick, Bethany M.; Yao, Xiao-Dan; Nasser, Laila; Roozrogousheh, Ava; Rosenthal, Kenneth L.

    2017-01-01

    The majority of infants’ breastfeeding from their HIV-infected mothers do not acquire HIV-1 infection despite exposure to cell-free virus and cell-associated virus in HIV-infected breast milk. Paradoxically, exclusive breastfeeding regardless of the HIV status of the mother has led to a significant decrease in mother-to-child transmission (MTCT) compared with non-exclusive breastfeeding. Although it remains unclear how these HIV-exposed infants remain uninfected despite repeated and prolonged exposure to HIV-1, the low rate of transmission is suggestive of a multitude of protective, short-lived bioactive innate immune factors in breast milk. Indeed, recent studies of soluble factors in breast milk shed new light on mechanisms of neonatal HIV-1 protection. This review highlights the role and significance of innate immune factors in HIV-1 susceptibility and infection. Prevention of MTCT of HIV-1 is likely due to multiple factors, including innate immune factors such as lactoferrin and elafin among many others. In pursuing this field, our lab was the first to show that soluble toll-like receptor 2 (sTLR2) directly inhibits HIV infection, integration, and inflammation. More recently, we demonstrated that sTLR2 directly binds to selective HIV-1 proteins, including p17, gp41, and p24, leading to significantly reduced NFκB activation, interleukin-8 production, CCR5 expression, and HIV infection in a dose-dependent manner. Thus, a clearer understanding of soluble milk-derived innate factors with known antiviral functions may provide new therapeutic insights to reduce vertical HIV-1 transmission and will have important implications for protection against HIV-1 infection at other mucosal sites. Furthermore, innate bioactive factors identified in human milk may serve not only in protecting infants against infections and inflammation but also the elderly; thus, opening the door for novel innate immune therapeutics to protect newborns, infants, adults, and the elderly. PMID:29238342

  14. Induction of partial immunity in both males and females is sufficient to protect females against sexual transmission of Chlamydia.

    PubMed

    O'Meara, C P; Armitage, C W; Kollipara, A; Andrew, D W; Trim, L; Plenderleith, M B; Beagley, K W

    2016-07-01

    Sexually transmitted Chlamydia trachomatis causes infertility, and because almost 90% of infections are asymptomatic, a vaccine is required for its eradication. Mathematical modeling studies have indicated that a vaccine eliciting partial protection (non-sterilizing) may prevent Chlamydia infection transmission, if administered to both sexes before an infection. However, reducing chlamydial inoculum transmitted by males and increasing infection resistance in females through vaccination to elicit sterilizing immunity has yet to be investigated experimentally. Here we show that a partially protective vaccine (chlamydial major outer membrane protein (MOMP) and ISCOMATRIX (IMX) provided sterilizing immunity against sexual transmission between immunized mice. Immunizing male or female mice before an infection reduced chlamydial burden and disease development, but did not prevent infection. However, infection and inflammatory disease responsible for infertility were absent in 100% of immunized female mice challenged intravaginally with ejaculate collected from infected immunized males. In contrast to the sterilizing immunity generated following recovery from a previous chlamydial infection, protective immunity conferred by MOMP/IMX occurred independent of resident memory T cells. Our results demonstrate that vaccination of males or females can further protect the opposing sex, whereas vaccination of both sexes can synergize to elicit sterilizing immunity against Chlamydia sexual transmission.

  15. Strain-Specific Protective Effect of the Immunity Induced by Live Malarial Sporozoites under Chloroquine Cover

    PubMed Central

    Wijayalath, Wathsala; Cheesman, Sandra; Tanabe, Kazuyuki; Handunnetti, Shiroma; Carter, Richard; Pathirana, Sisira

    2012-01-01

    The efficacy of a whole-sporozoite malaria vaccine would partly be determined by the strain-specificity of the protective responses against malarial sporozoites and liver-stage parasites. Evidence from previous reports were inconsistent, where some studies have shown that the protective immunity induced by irradiated or live sporozoites in rodents or humans were cross-protective and in others strain-specific. In the present work, we have studied the strain-specificity of live sporozoite-induced immunity using two genetically and immunologically different strains of Plasmodium cynomolgi, Pc746 and PcCeylon, in toque monkeys. Two groups of monkeys were immunized against live sporozoites of either the Pc746 (n = 5), or the PcCeylon (n = 4) strain, by the bites of 2–4 sporozoite-infected Anopheles tessellates mosquitoes per monkey under concurrent treatments with chloroquine and primaquine to abrogate detectable blood infections. Subsequently, a group of non-immunized monkeys (n = 4), and the two groups of immunized monkeys were challenged with a mixture of sporozoites of the two strains by the bites of 2–5 infective mosquitoes from each strain per monkey. In order to determine the strain-specificity of the protective immunity, the proportions of parasites of the two strains in the challenge infections were quantified using an allele quantification assay, Pyrosequencing™, based on a single nucleotide polymorphism (SNP) in the parasites’ circumsporozoite protein gene. The Pyrosequencing™ data showed that a significant reduction of parasites of the immunizing strain in each group of strain-specifically immunized monkeys had occurred, indicating a stronger killing effect on parasites of the immunizing strain. Thus, the protective immunity developed following a single, live sporozoite/chloroquine immunization, acted specifically against the immunizing strain and was, therefore, strain-specific. As our experiment does not allow us to determine the parasite stage at which the strain-specific protective immunity is directed, it is possible that the target of this immunity could be either the pre-erythrocytic stage, or the blood-stage, or both. PMID:23029282

  16. Hydrogen-rich Water Exerting a Protective Effect on Ovarian Reserve Function in a Mouse Model of Immune Premature Ovarian Failure Induced by Zona Pellucida 3

    PubMed Central

    He, Xin; Wang, Shu-Yu; Yin, Cheng-Hong; Wang, Tong; Jia, Chan-Wei; Ma, Yan-Min

    2016-01-01

    Background: Premature ovarian failure (POF) is a disease that affects female fertility but has few effective treatments. Ovarian reserve function plays an important role in female fertility. Recent studies have reported that hydrogen can protect male fertility. Therefore, we explored the potential protective effect of hydrogen-rich water on ovarian reserve function through a mouse immune POF model. Methods: To set up immune POF model, fifty female BALB/c mice were randomly divided into four groups: Control (mice consumed normal water, n = 10), hydrogen (mice consumed hydrogen-rich water, n = 10), model (mice were immunized with zona pellucida glycoprotein 3 [ZP3] and consumed normal water, n = 15), and model-hydrogen (mice were immunized with ZP3 and consumed hydrogen-rich water, n = 15) groups. After 5 weeks, mice were sacrificed. Serum anti-Müllerian hormone (AMH) levels, granulosa cell (GC) apoptotic index (AI), B-cell leukemia/lymphoma 2 (Bcl-2), and BCL2-associated X protein (Bax) expression were examined. Analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA) software. Results: Immune POF model, model group exhibited markedly reduced serum AMH levels compared with those of the control group (5.41 ± 0.91 ng/ml vs. 16.23 ± 1.97 ng/ml, P = 0.033) and the hydrogen group (19.65 ± 7.82 ng/ml, P = 0.006). The model-hydrogen group displayed significantly higher AMH concentrations compared with that of the model group (15.03 ± 2.75 ng/ml vs. 5.41 ± 0.91 ng/ml, P = 0.021). The GC AI was significantly higher in the model group (21.30 ± 1.74%) than those in the control (7.06 ± 0.27%), hydrogen (5.17 ± 0.41%), and model-hydrogen groups (11.24 ± 0.58%) (all P < 0.001). The GC AI was significantly higher in the model-hydrogen group compared with that of the hydrogen group (11.24 ± 0.58% vs. 5.17 ± 0.41%, P = 0.021). Compared with those of the model group, ovarian tissue Bcl-2 levels increased (2.18 ± 0.30 vs. 3.01 ± 0.33, P = 0.045) and the Bax/Bcl-2 ratio decreased in the model-hydrogen group. Conclusions: Hydrogen-rich water may improve serum AMH levels and reduce ovarian GC apoptosis in a mouse immune POF model induced by ZP3. PMID:27647193

  17. Vaccination with liposomal leishmanial antigens adjuvanted with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) confers long-term protection against visceral leishmaniasis through a human administrable route.

    PubMed

    Ravindran, Rajesh; Maji, Mithun; Ali, Nahid

    2012-01-01

    The development of a long-term protective subunit vaccine against visceral leishmaniasis depends on antigens and adjuvants that can induce an appropriate immune response. The immunization of leishmanial antigens alone shows limited efficacy in the absence of an appropriate adjuvant. Earlier we demonstrated sustained protection against Leishmania donovani with leishmanial antigens entrapped in cationic liposomes through an intraperitoneal route. However, this route is not applicable for human administration. Herein, we therefore evaluated the immune response and protection induced by liposomal soluble leishmanial antigen (SLA) formulated with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) through a subcutaneous route. Subcutaneous immunization of BALB/c mice with SLA entrapped in liposomes or with MPL-TDM elicited partial protection against experimental visceral leishmaniasis. In contrast, liposomal SLA adjuvanted with MPL-TDM induced significantly higher levels of protection in liver and spleen in BALB/c mice challenged 10 days post-vaccination. Protection conferred by this formulation was sustained up to 12 weeks of immunization, and infection was controlled for at least 4 months of the challenge, similar to liposomal SLA immunization administered intraperitoneally. An analysis of cellular immune responses of liposomal SLA + MPL-TDM immunized mice demonstrated the induction of IFN-γ and IgG2a antibody production not only 10 days or 12 weeks post-vaccination but also 4 months after the challenge infection and a down regulation of IL-4 production after infection. Moreover, long-term immunity elicited by this formulation was associated with IFN-γ production also by CD8⁺ T cells. Taken together, our results suggest that liposomal SLA + MPL-TDM represent a good vaccine formulation for the induction of durable protection against L. donovani through a human administrable route.

  18. Yersinia pestis caf1 variants and the limits of plague vaccine protection.

    PubMed

    Quenee, Lauriane E; Cornelius, Claire A; Ciletti, Nancy A; Elli, Derek; Schneewind, Olaf

    2008-05-01

    Yersinia pestis, the highly virulent agent of plague, is a biological weapon. Strategies that prevent plague have been sought for centuries, and immunization with live, attenuated (nonpigmented) strains or subunit vaccines with F1 (Caf1) antigen is considered effective. We show here that immunization with live, attenuated strains generates plague-protective immunity and humoral immune responses against F1 pilus antigen and LcrV. Y. pestis variants lacking caf1 (F1 pili) are not only fully virulent in animal models of bubonic and pneumonic plague but also break through immune responses generated with live, attenuated strains or F1 subunit vaccines. In contrast, immunization with purified LcrV, a protein at the tip of type III needles, generates protective immunity against the wild-type and the fully virulent caf1 mutant strain, in agreement with the notion that LcrV can elicit vaccine protection against both types of virulent plague strains.

  19. Protection of Mice against Plasmodium yoelii Sporozoite Challenge with P. yoelii Merozoite Surface Protein 1 DNA Vaccines

    PubMed Central

    Becker, Sylvia I.; Wang, Ruobing; Hedstrom, Richard C.; Aguiar, Joao C.; Jones, Trevor R.; Hoffman, Stephen L.; Gardner, Malcolm J.

    1998-01-01

    Immunization of mice with DNA vaccines encoding the full-length form and C and N termini of Plasmodium yoelii merozoite surface protein 1 provided partial protection against sporozoite challenge and resulted in boosting of antibody titers after challenge. In C57BL/6 mice, two DNA vaccines provided protection comparable to that of recombinant protein consisting of the C terminus in Freund’s adjuvant. PMID:9632624

  20. Smallpox vaccines: targets of protective immunity

    PubMed Central

    Moss, Bernard

    2011-01-01

    Summary The eradication of smallpox, one of the great triumphs of medicine, was accomplished through the prophylactic administration of live vaccinia virus, a comparatively benign relative of variola virus, the causative agent of smallpox. Nevertheless, recent fears that variola virus may be used as a biological weapon together with the present susceptibility of unimmunized populations have spurred the development of new generation vaccines that are safer than the original and can be produced by modern methods. Predicting the efficacy of such vaccines in the absence of human smallpox, however, depends on understanding the correlates of protection. This review outlines the biology of poxviruses with particular relevance to vaccine development, describes protein targets of humoral and cellular immunity, compares animal models of orthopoxvirus disease with human smallpox, and considers the status of second and third generation smallpox vaccines. PMID:21198662

  1. Protective effect of enterovirus‑71 (EV71) virus‑like particle vaccine against lethal EV71 infection in a neonatal mouse model.

    PubMed

    Cao, Lei; Mao, Fengfeng; Pang, Zheng; Yi, Yao; Qiu, Feng; Tian, Ruiguang; Meng, Qingling; Jia, Zhiyuan; Bi, Shengli

    2015-08-01

    Enterovirus-71 (EV71) is a viral pathogen that causes severe cases of hand, foot and mouth disease (HFMD) among young children, with significant mortality. Effective vaccines against HFMD are urgently required. Several EV71 virus-like particle (VLP) vaccine candidates were found to be protective in the neonatal mouse EV71 challenge model. However, to what extent the VLP vaccine protects susceptible organs against EV71 infection in vivo has remained elusive. In the present study, the comprehensive immunogenicity of a potential EV71 vaccine candidate based on VLPs was evaluated in a neonatal mouse model. Despite lower levels of neutralizing antibodies to EV71 in the sera of VLP-immunized mice compared with those in mice vaccinated with inactivated EV71, the VLP-based vaccine was shown to be able to induce immunoglobulin (Ig)G and IgA memory-associated cellular immune responses to EV71. Of note, the EV71 VLP vaccine candidate was capable of inhibiting viral proliferation in cardiac muscle, skeletal muscle, lung and intestine of immunized mice and provided effective protection against the pathological damage caused by viral attack. In particular, the VLP vaccine was able to inhibit the transportation of EV71 from the central nervous system to the muscle tissue and greatly protected muscle tissue from infection, along with recovery from the viral infection. This led to nearly 100% immunoprotective efficacy, enabling neonatal mice delivered by VLP-immunized female adult mice to survive and grow with good health. The present study provided valuable additional knowledge of the specific protective efficacy of the EV71 VLP vaccine in vivo, which also indicated that it is a promising potential candidate for being developed into an EV71 vaccine.

  2. A Modified Surface Killing Assay (MSKA) as a Functional in vitro Assay for Identifying Protective Antibodies Against Pneumococcal Surface Protein A (PspA)

    PubMed Central

    Genschmer, Kristopher R.; Accavitti-Loper, Mary Ann; Briles, David E.

    2013-01-01

    Streptococcus pneumoniae causes otitis media, meningitis and pneumonia in patients worldwide; predominantly affecting young children, the elderly, and the immune compromised. Current vaccines against invasive pneumococcal disease are based on the polysaccharide capsules of the most clinically relevant serotypes. Due to serotype replacement, non-vaccine serotypes of S. pneumoniae have become more clinically relevant and as a result pneumococcal vaccines are becoming increasingly complex. These events emphasize the need to evaluate the potential for pneumococcal cross-reactive proteins to contribute to future vaccines. Antibody elicited by the immunization of humans with pneumococcal surface protein A (PspA) can passively protect mice from infection. However, robust in vitro functional assays for antibody to PspA are not available to predict the protective capacity of immune serum. For polysaccharide based vaccines, a standardized opsonophagocytosis killing assay (OPKA) is used. Antibody to PspA, however, does not work well in the standard OPKA. The present studies take advantage of past observations that phagocytosis is more efficient on tissue surfaces than in solution. In a modified surface killing assay (MSKA), monoclonal antibody to PspA, in the presence of complement, opsonized pneumococci for killing by phagocytes on an agar surface. Five monoclonal antibodies to PspA were tested; three demonstrated increased amounts of killing compared to the diluent control and protected mice by passive protection against type 3 pneumococci. The two antibodies that were not functional in the MSKA also failed to protect mice. Thus, an MSKA might be useful as a functional assay for immunity to PspA. PMID:24211169

  3. Immunogenicity of Sci-B-Vac (a Third-Generation Hepatitis B Vaccine) in HIV-Positive Adults.

    PubMed

    Alon, Danny; Stein, Gideon Y; Hadas-Golan, Vered; Tau, Luba; Brosh, Tal; Turner, Dan

    2017-03-01

    Guidelines recommend hepatitis B virus (HBV) vaccination of all adults positive for human immunodeficiency virus (HIV). Immune responses to single-antigen HBV vaccine among HIV-positive patients are low when compared with HIV-negative adults. Sci-B-Vac™ is a recombinant third-generation HBV that may be advantageous in this population. To examine the immune responses to Sci-B-Vac among HIV-positive adults. We conducted a prospective cohort study involving HIV-positive adults who had negative HBV serology (HBSAg, HBSAb, HBcoreAb). Sci-B-Vac at 10 µg/dose was administered intramuscularly upon recruitment and after 1 and 6 months. HBSAb levels were checked 1 month after each dose; a level > 10 mlU/ml was considered protective. Data regarding age, gender, CD4 level, and viral load were collected. The study group comprised 31 patients. Average CD4 count was 503 ± 281 cells/ml, and average viral load was 44 copies/ml. Median interquartile range (IQR) HBVAb titers after the first, second and third immunizations were 0 (0, 3.5), 30 (6, 126) and 253 (81, 408) mlU/ml. Significant titer elevations were found between the second and third immunizations (P = 0.0003). The rate of patients considered protected was 16% after the first, 65% after the second (P < 0.0001), and 84% after the third dose (P = 0.045). No adverse events were reported. More patients under the age of 40 years responded to the first immunization (28% vs. 0%, P = 0.038). CD4 level had no influence on immunization rates. Sci-B-Vac might achieve better immunization rates among HIV-positive adults compared to the single-antigen vaccine and thus deserves further evaluation in a randomized, double-blind study in this population.

  4. Coadministration of Recombinant Adenovirus Expressing GM-CSF with Inactivated H5N1 Avian Influenza Vaccine Increased the Immune Responses and Protective Efficacy Against a Wild Bird Source of H5N1 Challenge.

    PubMed

    Wang, Xiangwei; Wang, Xinglong; Jia, Yanqing; Wang, Chongyang; Tang, Qiuxia; Han, Qingsong; Xiao, Sa; Yang, Zengqi

    2017-10-01

    Wild birds play a key role in the spread of avian influenza virus (AIV). There is a continual urgent requirement for AIV vaccines to address the ongoing genetic changes of AIV. In the current study, we trialed a novel AIV vaccine against the wild bird source of H5N1 type AIV with recombinant adenovirus expressing granulocyte monocyte colony-stimulating factor (GM-CSF) as an adjuvant. A total of 150-day-old commercial chicks, with AIV-maternal-derived antibody, were divided into 6 groups. The primary vaccination was performed at day 14 followed by a subsequent boosting and intramuscular challenge on day 28 and 42, respectively. Recombinant GM-CSF (rGM-CSF) expressed by adenovirus, named as rAd-GM-CSF, raised the hemagglutination inhibition (HI) titers (log 2 ) against AIV from 7.0 (vaccinate with inactivated vaccine alone) to 8.4 after booster immunization. Moreover, the rGM-CSF addition markedly increased the expression of interferon-γ, interleukin-4, and major histocompatibility complex-II in the lungs, compared with those immunized with inactivated vaccine alone on day 29, that is, 18 h post booster immunization. Following challenge, chicks inoculated with the inactivated AIV vaccine and rAd-GM-CSF together exhibited mild clinical signs and 62% survivals compared to 33% in the group immunized with inactivated AIV vaccine alone. Higher level of HI titers, immune related molecule expressions, and protection ratio demonstrates a good potential of rGM-CSF in improving humoral and cell mediated immune responses of inactivated AIV vaccines.

  5. Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

    PubMed Central

    Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

    2013-01-01

    To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

  6. Opsonic and protective activity of immunoglobulin, modified immunoglobulin, and serum against neonatal Escherichia coli K1 infection.

    PubMed

    Bortolussi, R; Fischer, G W

    1986-02-01

    Because modified immune serum globulin (M-ISG) has been proposed for therapy in neonatal bacterial sepsis, we evaluated it in a suckling rat model of Escherichia coli K1 sepsis. We compared a M-ISG preparation (lot 2581), which was protective against group B streptococcal (GBS) sepsis, with other M-ISG, standard ISG preparations and with adult and cord serum. All immune serum preparations and sera demonstrated opsonic activity against E. coli K1 and were superior to saline in protecting against death due to E. coli K1 sepsis. Survival rates were higher for one M-ISG preparation (lot 2581) than for randomly selected standard immune serum globulin and cord sera but were similar to adult sera in these protection studies. Therapeutic and opsonic activity of standard immune serum globulin and M-ISG prepared from the same donors were similar, suggesting that the different processes used for their manufacture did not affect these activities. Because the M-ISG preparation studied showed protective activity to both GBS and E. coli K1, we studied it further by adsorbing the preparation with GBS and E. coli K1. Opsonic activity to E. coli K1 was removed by E. coli adsorption but not by adsorption with GBS, indicating that this activity was not due to a single cross-reacting antibody. Empirical therapy with M-ISG prescreened for opsonic activity to both E. coli K1 and GBS may be of clinical value. Trials appear warranted to study the pharmacology and efficacy of M-ISG in septic newborns.

  7. Prevalence and socio-demographic factors associated with non-protective immunity against tetanus among high school adolescents girls in Nigeria

    PubMed Central

    2014-01-01

    Background The low uptake of tetanus vaccine and its resultant high burden of tetanus in Nigeria suggest the need to improve routine and booster vaccination in children and adolescents. However, epidemiological evidence for vaccination in the adolescent age group needed for effective strategy and policy formulation is lacking. This study was carried out to determine the prevalence of protective immunity against tetanus and to identify risk factors for non-protective immunity among schooling adolescents. Methods Using a three-stage sampling technique, 851 female adolescents were randomly selected from secondary schools in Ibadan, Nigeria. A pre-tested questionnaire was used to obtain data on demographic and socio-economic characteristics and history of tetanus vaccination. An immuno-chromatographic rapid test kit, “Tetanos Quick Stick” was used to test specific anti-tetanus antibody protective level in venous blood samples. Descriptive statistics, Chi-square and logistic regression analyses were done with level of significance set at p = 0.05. Results Mean age of participants was 14.3 ± 1.9 years. Seroprevalence of protective immunity against tetanus was 38.1% and it significantly decreased with increasing age. More adolescents in public (65.4%) than private (44.7%) schools had non-protective level of immunity. A significantly increasing trend in the risk of non-protective immunity was observed with decreasing level of mothers’ education. Also, the Odds of non-protective level of immunity was significantly higher in public than private schools (OR = 2.14; 95% CI =1.39, 3.20) but lower among adolescents who had history of recent tetanus toxoid injection than those who did not (OR = 0.11 95% CI = 0.09, 0.22). However, no significant association was found between protective immunity against tetanus and parents’ marital status as well as family size. Conclusion Protective immunity against tetanus among female adolescents was poor, more so in public schools and those who had not received vaccination a year prior to the study. Policy-makers need to consider the inclusion of immunization against tetanus in the school health programme. PMID:24636576

  8. Dietary amino acid and vitamin complex protects honey bee from immunosuppression caused by Nosema ceranae.

    PubMed

    Glavinic, Uros; Stankovic, Biljana; Draskovic, Vladimir; Stevanovic, Jevrosima; Petrovic, Tamas; Lakic, Nada; Stanimirovic, Zoran

    2017-01-01

    Microsporidium Nosema ceranae is well known for exerting a negative impact on honey bee health, including down-regulation of immunoregulatory genes. Protein nutrition has been proven to have beneficial effects on bee immunity and other aspects of bee health. Bearing this in mind, the aim of our study was to evaluate the potential of a dietary amino acid and vitamin complex "BEEWELL AminoPlus" to protect honey bees from immunosuppression induced by N. ceranae. In a laboratory experiment bees were infected with N. ceranae and treated with supplement on first, third, sixth and ninth day after emergence. The expression of genes for immune-related peptides (abaecin, apidaecin, hymenoptaecin, defensin and vitellogenin) was compared between groups. The results revealed significantly lower (p<0.01 or p<0.001) numbers of Nosema spores in supplemented groups than in the control especially on day 12 post infection. With the exception of abacein, the expression levels of immune-related peptides were significantly suppressed (p<0.01 or p<0.001) in control group on the 12th day post infection, compared to bees that received the supplement. It was supposed that N. ceranae had a negative impact on bee immunity and that the tested amino acid and vitamin complex modified the expression of immune-related genes in honey bees compromised by infection, suggesting immune-stimulation that reflects in the increase in resistance to diseases and reduced bee mortality. The supplement exerted best efficacy when applied simultaneously with Nosema infection, which can help us to assume the most suitable period for its application in the hive.

  9. Dietary amino acid and vitamin complex protects honey bee from immunosuppression caused by Nosema ceranae

    PubMed Central

    Stankovic, Biljana; Draskovic, Vladimir; Stevanovic, Jevrosima; Petrovic, Tamas; Lakic, Nada; Stanimirovic, Zoran

    2017-01-01

    Microsporidium Nosema ceranae is well known for exerting a negative impact on honey bee health, including down-regulation of immunoregulatory genes. Protein nutrition has been proven to have beneficial effects on bee immunity and other aspects of bee health. Bearing this in mind, the aim of our study was to evaluate the potential of a dietary amino acid and vitamin complex “BEEWELL AminoPlus” to protect honey bees from immunosuppression induced by N. ceranae. In a laboratory experiment bees were infected with N. ceranae and treated with supplement on first, third, sixth and ninth day after emergence. The expression of genes for immune-related peptides (abaecin, apidaecin, hymenoptaecin, defensin and vitellogenin) was compared between groups. The results revealed significantly lower (p<0.01 or p<0.001) numbers of Nosema spores in supplemented groups than in the control especially on day 12 post infection. With the exception of abacein, the expression levels of immune-related peptides were significantly suppressed (p<0.01 or p<0.001) in control group on the 12th day post infection, compared to bees that received the supplement. It was supposed that N. ceranae had a negative impact on bee immunity and that the tested amino acid and vitamin complex modified the expression of immune-related genes in honey bees compromised by infection, suggesting immune-stimulation that reflects in the increase in resistance to diseases and reduced bee mortality. The supplement exerted best efficacy when applied simultaneously with Nosema infection, which can help us to assume the most suitable period for its application in the hive. PMID:29117233

  10. Immunization status of internationally adopted children in Italy.

    PubMed

    Viviano, Enza; Cataldo, Francesco; Accomando, Salvatore; Firenze, Alberto; Valenti, Rosalia Maria; Romano, Nino

    2006-05-08

    An increasing number of internationally adopted children is coming to Italy, and their immunization status is unknown. We evaluated the immunization status of such children in Palermo, Italy. We searched for the presence of a BCG scar in 88 children, 49 boys and 39 girls (mean age 76+/-32 months), most of whom (98%) came from Eastern Europe. Presence of BCG scar was observed in 59 (67.1%) of them, included five children without any pre-adoptive medical records. Twenty-three out of 29 children without any evidence of BCG scar were tested by Mantoux. Seven (30.4%) of 23 were tuberculin positive and diagnosed as having latent tuberculosis infection. We also examined immunization status against poliovirus 1-3, tetanus, diphtheria, pertussis, measles, mumps, rubella and hepatitis B of 70 internationally adopted children and we compared it with the pre-adoptive immunization records of their birth country. Protective titers (>1:8) against poliovirus 1-3, were found respectively in 67.1%, 91.4%, 42.8% of 70 immunized children, and only 38.5% of them had at the same time full protection against all three types of poliovirus. Protective titers against tetanus and diphtheria were found in 91.4% and 95.7% of 70 vaccinated children. Presence of antibodies against pertussis, measles, mumps and rubella was observed respectively in 16 (32.6%) of 49, 40 (62.5%) of 64, 28 (56%) of 50 and 24 (85.7%) of 28 children who had received the vaccine. As regards hepatitis B, only 20 of 29 vaccinated children had detectable hepatitis B surface antibodies, while four of 29 vaccinated and two of 41 not vaccinated children were positive for both hepatitis B surface antibodies and hepatitis B core antibodies. Finally three of 41 not vaccinated children were both hepatitis B surface antigen and hepatitis B core antibodies positive. No relation was found between health status and immunization and between age and antibody positiveness of vaccinated children except for hepatitis B, therefore the youngest immunized children were more likely to be hepatitis B surface antibodies positive. Our data suggest that internationally adopted children should be tested for their immunization status on arrival in the adopting country, because they are not protected in a sufficient way against vaccine-preventable diseases and their pre-adoptive immunization records sometimes are lacking and frequently are scarcely reliable.

  11. Immunization of C57BL/6 Mice with GRA2 Combined with MPL Conferred Partial Immune Protection against Toxoplasma gondii

    PubMed

    Babaie, Jalal; Amiri, Samira; Homayoun, Robab; Azimi, Ebrahim; Mohabati, Reyhaneh; Berizi, Mahboobe; Sadaie, M. Reza; Golkar, Majid

    2018-01-01

    We have previously reported that immunization with GRA2 antigen of Toxoplasma gondii induces protective immunity in CBA/J (H2k) and BALB/c mice (H2d). We aimed to examine whether immunization of a distinct strain of rodent with recombinant dense granule antigens (GRA2) combined with monophosphorryl lipid A (MPL) adjuvant elicits protective immune response against T. gondii. C57BL/6 (H2b haplotype) mice were immunized with GRA2, formulated in MPL adjuvant. Strong humoral response, predominantly of IgG1 subclass and cellular response, IFN-γ, was detected at three weeks post immunization. Mice immunized with GRA2 had significantly (p < 0.01) fewer brain cysts than those in the adjuvant group, upon challenge infection. Despite the production of a strong antibody response, IFN-γ production and brain cyst reduction were not significant when the immunized mice were infected four months after the immunization. We can conclude that GRA2 immunization partially protects against T. gondii infection in C57BL/6 mice, though the potency and longevity of this antigen as a standalone vaccine may vary in distinct genetic backgrounds. This observation further emphasizes the utility of GRA2 for incorporation into a multi-antigenic vaccine against T. gondii.

  12. Comparative Efficacy of Hemagglutinin, Nucleoprotein, and Matrix 2 Protein Gene-Based Vaccination against H5N1 Influenza in Mouse and Ferret

    PubMed Central

    Rao, Srinivas S.; Kong, Wing-Pui; Wei, Chih-Jen; Van Hoeven, Neal; Gorres, J. Patrick; Nason, Martha; Andersen, Hanne; Tumpey, Terrence M.; Nabel, Gary J.

    2010-01-01

    Efforts to develop a broadly protective vaccine against the highly pathogenic avian influenza A (HPAI) H5N1 virus have focused on highly conserved influenza gene products. The viral nucleoprotein (NP) and ion channel matrix protein (M2) are highly conserved among different strains and various influenza A subtypes. Here, we investigate the relative efficacy of NP and M2 compared to HA in protecting against HPAI H5N1 virus. In mice, previous studies have shown that vaccination with NP and M2 in recombinant DNA and/or adenovirus vectors or with adjuvants confers protection against lethal challenge in the absence of HA. However, we find that the protective efficacy of NP and M2 diminishes as the virulence and dose of the challenge virus are increased. To explore this question in a model relevant to human disease, ferrets were immunized with DNA/rAd5 vaccines encoding NP, M2, HA, NP+M2 or HA+NP+M2. Only HA or HA+NP+M2 vaccination conferred protection against a stringent virus challenge. Therefore, while gene-based vaccination with NP and M2 may provide moderate levels of protection against low challenge doses, it is insufficient to confer protective immunity against high challenge doses of H5N1 in ferrets. These immunogens may require combinatorial vaccination with HA, which confers protection even against very high doses of lethal viral challenge. PMID:20352112

  13. Intramuscular delivery of adenovirus serotype 5 vector expressing humanized protective antigen induces rapid protection against anthrax that may bypass intranasally originated preexisting adenovirus immunity.

    PubMed

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie; Hou, Lihua; Chen, Wei

    2014-02-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 10⁸ infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD₅₀) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax.

  14. Intramuscular Delivery of Adenovirus Serotype 5 Vector Expressing Humanized Protective Antigen Induces Rapid Protection against Anthrax That May Bypass Intranasally Originated Preexisting Adenovirus Immunity

    PubMed Central

    Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie

    2014-01-01

    Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 108 infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD50) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax. PMID:24307239

  15. Downregulation of the T-cell receptor by human immunodeficiency virus type 2 Nef does not protect against disease progression.

    PubMed

    Feldmann, Jérôme; Leligdowicz, Aleksandra; Jaye, Assan; Dong, Tao; Whittle, Hilton; Rowland-Jones, Sarah L

    2009-12-01

    Chronic immune activation is thought to play a major role in human immunodeficiency virus (HIV) pathogenesis, but the relative contributions of multiple factors to immune activation are not known. One proposed mechanism to protect against immune activation is the ability of Nef proteins from some HIV and simian immunodeficiency virus strains to downregulate the T-cell receptor (TCR)-CD3 complex of the infected cell, thereby reducing the potential for deleterious activation. HIV type 1 (HIV-1) Nef has lost this property. In contrast to HIV-1, HIV-2 infection is characterized by a marked disparity in the disease course, with most individuals maintaining a normal life span. In this study, we examined the relationship between the ability of HIV-2 Nef proteins to downregulate the TCR and immune activation, comparing progressors and nonprogressors. Representative Nef variants were isolated from 28 HIV-2-infected individuals. We assessed their abilities to downregulate the TCR from the surfaces of CD4 T cells. In the same individuals, the activation of peripheral lymphocytes was evaluated by measurement of the expression levels of HLA-DR and CD38. We observed a striking correlation of the TCR downregulation efficiency of HIV-2 Nef variants with immune activation in individuals with a low viral load. This strongly suggests that Nef expression can influence the activation state of the immune systems of infected individuals. However, the efficiency of TCR downregulation by Nef was not reduced in progressing individuals, showing that TCR downregulation does not protect against progression in HIV-2 infection.

  16. Age and long-term protective immunity in dogs and cats.

    PubMed

    Schultz, R D; Thiel, B; Mukhtar, E; Sharp, P; Larson, L J

    2010-01-01

    Vaccination can provide an immune response that is similar in duration to that following a natural infection. In general, adaptive immunity to viruses develops earliest and is highly effective. Such anti-viral immune responses often result in the development of sterile immunity and the duration of immunity (DOI) is often lifelong. In contrast, adaptive immunity to bacteria, fungi or parasites develops more slowly and the DOI is generally short compared with most systemic viral infections. Sterile immunity to these infectious agents is less commonly engendered. Old dogs and cats rarely die from vaccine-preventable infectious disease, especially when they have been vaccinated and immunized as young adults (i.e. between 16 weeks and 1 year of age). However, young animals do die, often because vaccines were either not given or not given at an appropriate age (e.g. too early in life in the presence of maternally derived antibody [MDA]). More animals need to be vaccinated to increase herd (population) immunity. The present study examines the DOI for core viral vaccines in dogs that had not been revaccinated for as long as 9 years. These animals had serum antibody to canine distemper virus (CDV), canine parvovirus type 2 (CPV-2) and canine adenovirus type-1 (CAV-1) at levels considered protective and when challenged with these viruses, the dogs resisted infection and/or disease. Thus, even a single dose of modified live virus (MLV) canine core vaccines (against CDV, cav-2 and cpv-2) or MLV feline core vaccines (against feline parvovirus [FPV], feline calicivirus [FCV] and feline herpesvirus [FHV]), when administered at 16 weeks or older, could provide long-term immunity in a very high percentage of animals, while also increasing herd immunity. Copyright 2009 Elsevier Ltd. All rights reserved.

  17. Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase.

    PubMed

    Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L

    2014-12-01

    Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection. © 2014 John Wiley & Sons Ltd.

  18. Inactivated recombinant plant virus protects dogs from a lethal challenge with canine parvovirus.

    PubMed

    Langeveld, J P; Brennan, F R; Martínez-Torrecuadrada, J L; Jones, T D; Boshuizen, R S; Vela, C; Casal, J I; Kamstrup, S; Dalsgaard, K; Meloen, R H; Bendig, M M; Hamilton, W D

    2001-06-14

    A vaccine based upon a recombinant plant virus (CPMV-PARVO1), displaying a peptide derived from the VP2 capsid protein of canine parvovirus (CPV), has previously been described. To date, studies with the vaccine have utilized viable plant chimaeric particles (CVPs). In this study, CPMV-PARVO1 was inactivated by UV treatment to remove the possibility of replication of the recombinant plant virus in a plant host after manufacture of the vaccine. We show that the inactivated CVP is able to protect dogs from a lethal challenge with CPV following parenteral immunization with the vaccine. Dogs immunized with the inactivated CPMV-PARVO1 in adjuvant displayed no clinical signs of disease and shedding of CPV in faeces was limited following CPV challenge. All immunized dogs elicited high titres of peptide-specific antibody, which neutralized CPV in vitro. Levels of protection, virus shedding and VP2-specific antibody were comparable to those seen in dogs immunized with the same VP2- peptide coupled to keyhole limpet hemocyanin (KLH). Since plant virus-derived vaccines have the potential for cost-effective manufacture and are not known to replicate in mammalian cells, they represent a viable alternative to current replicating vaccine vectors for development of both human and veterinary vaccines.

  19. Subnormal and waning immunity to tetanus toxoid in previously vaccinated HIV-infected children and response to booster doses of the vaccine.

    PubMed

    Choudhury, Shahana A; Matin, Fazle

    2013-12-01

    Little is known regarding waning immunity to tetanus toxoid (TT) in HIV-infected children and the need for booster doses before the recommended interval of 5-10 years. Anti-tetanus antibodies were assessed by ELISA in 24 HIV-infected and 24 control children. A protective level (>0.1 IU/ml) of TT antibodies was observed in 62% of HIV-infected children and in 100% of controls. HIV-infected children with five doses had a significantly (p=0.01) lower prevalence of protective immunity compared to controls. Follow-up anti-TT antibody levels in nine HIV-infected children declined from 1.27 to 0.26 IU/ml, but levels did not decline in the seven controls; five of the seven (71%) children with a non-protective level of antibodies responded with a level>0.16 IU/ml following one booster dose of the vaccine. HIV-infected children may need TT boosters before the recommended 5-10 years. Copyright © 2013 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. Regulatory T-cell activity but not conventional HIV-specific T-cell responses are associated with protection from HIV-1 infection

    PubMed Central

    Pattacini, Laura; Baeten, Jared M.; Thomas, Katherine K.; Fluharty, Tayler R.; Murnane, Pamela M.; Donnell, Deborah; Bukusi, Elizabeth; Ronald, Allan; Mugo, Nelly; Lingappa, Jairam R.; Celum, Connie; McElrath, M. Juliana; Lund, Jennifer M.

    2015-01-01

    Objective Two distinct hypotheses have been proposed for T-cell involvement in protection from HIV-1 acquisition. First, HIV-1-specific memory T-cell responses generated upon HIV-1 exposure could mount an efficient response to HIV-1 and inhibit the establishment of an infection. Second, a lower level of immune activation could reduce the numbers of activated, HIV-1-susceptible CD4+ T-cells, thereby diminishing the likelihood of infection. Methods To test these hypotheses, we conducted a prospective study among high-risk heterosexual men and women, and tested peripheral blood samples from individuals who subsequently acquired HIV-1 during follow-up (cases) and from a subset of those who remained HIV-1 uninfected (controls). Results We found no difference in HIV-1-specific immune responses between cases and controls, but Treg frequency was higher in controls as compared to cases and was negatively associated with frequency of effector memory CD4+ T-cells. Conclusions Our findings support the hypothesis that low immune activation assists in protection from HIV-1 infection. PMID:26656786

  1. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    PubMed

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  2. Computational Modeling of Interventions and Protective Thresholds to Prevent Disease Transmission in Deploying Populations

    PubMed Central

    2014-01-01

    Military personnel are deployed abroad for missions ranging from humanitarian relief efforts to combat actions; delay or interruption in these activities due to disease transmission can cause operational disruptions, significant economic loss, and stressed or exceeded military medical resources. Deployed troops function in environments favorable to the rapid and efficient transmission of many viruses particularly when levels of protection are suboptimal. When immunity among deployed military populations is low, the risk of vaccine-preventable disease outbreaks increases, impacting troop readiness and achievement of mission objectives. However, targeted vaccination and the optimization of preexisting immunity among deployed populations can decrease the threat of outbreaks among deployed troops. Here we describe methods for the computational modeling of disease transmission to explore how preexisting immunity compares with vaccination at the time of deployment as a means of preventing outbreaks and protecting troops and mission objectives during extended military deployment actions. These methods are illustrated with five modeling case studies for separate diseases common in many parts of the world, to show different approaches required in varying epidemiological settings. PMID:25009579

  3. Computational modeling of interventions and protective thresholds to prevent disease transmission in deploying populations.

    PubMed

    Burgess, Colleen; Peace, Angela; Everett, Rebecca; Allegri, Buena; Garman, Patrick

    2014-01-01

    Military personnel are deployed abroad for missions ranging from humanitarian relief efforts to combat actions; delay or interruption in these activities due to disease transmission can cause operational disruptions, significant economic loss, and stressed or exceeded military medical resources. Deployed troops function in environments favorable to the rapid and efficient transmission of many viruses particularly when levels of protection are suboptimal. When immunity among deployed military populations is low, the risk of vaccine-preventable disease outbreaks increases, impacting troop readiness and achievement of mission objectives. However, targeted vaccination and the optimization of preexisting immunity among deployed populations can decrease the threat of outbreaks among deployed troops. Here we describe methods for the computational modeling of disease transmission to explore how preexisting immunity compares with vaccination at the time of deployment as a means of preventing outbreaks and protecting troops and mission objectives during extended military deployment actions. These methods are illustrated with five modeling case studies for separate diseases common in many parts of the world, to show different approaches required in varying epidemiological settings.

  4. Endogenous egg immune defenses in the yellow mealworm beetle (Tenebrio molitor).

    PubMed

    Jacobs, Chris G C; Gallagher, Joe D; Evison, Sophie E F; Heckel, David G; Vilcinskas, Andreas; Vogel, Heiko

    2017-05-01

    In order to survive microbe encounters, insects rely on both physical barriers as well as local and systemic immune responses. Most research focusses on adult or larval defenses however, whereas insect eggs are also in need of protection. Lately, the defense of eggs against microbes has received an increasing amount of attention, be it through endogenous egg defenses, trans-generational immune priming (TGIP) or parental investment. Here we studied the endogenous immune response in eggs and adults of Tenebrio molitor. We show that many immune genes are induced in both adults and eggs. Furthermore, we show that eggs reach comparable levels of immune gene expression as adults. These findings show that the eggs of Tenebrio are capable of an impressive endogenous immune response, and indicate that such inducible egg defenses are likely common in insects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Live Attenuated B. pertussis as a Single-Dose Nasal Vaccine against Whooping Cough

    PubMed Central

    Mielcarek, Nathalie; Debrie, Anne-Sophie; Raze, Dominique; Bertout, Julie; Rouanet, Carine; Younes, Amena Ben; Creusy, Colette; Engle, Jacquelyn; Goldman, William E; Locht, Camille

    2006-01-01

    Pertussis is still among the principal causes of death worldwide, and its incidence is increasing even in countries with high vaccine coverage. Although all age groups are susceptible, it is most severe in infants too young to be protected by currently available vaccines. To induce strong protective immunity in neonates, we have developed BPZE1, a live attenuated Bordetella pertussis strain to be given as a single-dose nasal vaccine in early life. BPZE1 was developed by the genetic inactivation or removal of three major toxins. In mice, BPZE1 was highly attenuated, yet able to colonize the respiratory tract and to induce strong protective immunity after a single nasal administration. Protection against B. pertussis was comparable to that induced by two injections of acellular vaccine (aPV) in adult mice, but was significantly better than two administrations of aPV in infant mice. Moreover, BPZE1 protected against Bordetella parapertussis infection, whereas aPV did not. BPZE1 is thus an attractive vaccine candidate to protect against whooping cough by nasal, needle-free administration early in life, possibly at birth. PMID:16839199

  6. A single vaccination with non-replicating MVA at birth induces both immediate and long-term protective immune responses.

    PubMed

    Cheminay, Cédric; Körner, Jana; Bernig, Constanze; Brückel, Michael; Feigl, Markus; Schletz, Martin; Suter, Mark; Chaplin, Paul; Volkmann, Ariane

    2018-04-25

    Newborns are considered difficult to protect against infections shortly after birth, due to their ineffective immune system that shows quantitative and qualitative differences compared to adults. However, here we show that a single vaccination of mice at birth with a replication-deficient live vaccine Modified Vaccinia Ankara [MVA] efficiently induces antigen-specific B- and T-cells that fully protect against a lethal Ectromelia virus challenge. Protection was induced within 2 weeks and using genetically modified mice we show that this protection was mainly T-cell dependent. Persisting immunological T-cell memory and neutralizing antibodies were obtained with the single vaccination. Thus, MVA administered as early as at birth induced immediate and long-term protection against an otherwise fatal disease and appears attractive as a new generation smallpox vaccine that is effective also in children. Moreover, it may have the potential to serve as platform for childhood vaccines as indicated by measles specific T- and B-cell responses induced in newborn mice vaccinated with recombinant MVA expressing measles antigens. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Protective immunity and lack of histopathological damage two years after DNA vaccination against infectious hematopoietic necrosis virus in trout

    USGS Publications Warehouse

    Kurath, Gael; Garver, Kyle A.; Corbeil, Serge; Elliott, Diane G.; Anderson, Eric D.; LaPatra, Scott E.

    2006-01-01

    The DNA vaccine pIHNw-G encodes the glycoprotein of the fish rhabdovirus infectious hematopoietic necrosis virus (IHNV). Vaccine performance in rainbow trout was measured 3, 6, 13, 24, and 25 months after vaccination. At three months all fish vaccinated with 0.1 μg pIHNw-G had detectable neutralizing antibody (NAb) and they were completely protected from lethal IHNV challenge with a relative percent survival (RPS) of 100% compared to control fish. Viral challenges at 6, 13, 24, and 25 months post-vaccination showed protection with RPS values of 47–69%, while NAb seroprevalence declined to undetectable levels. Passive transfer experiments with sera from fish after two years post-vaccination were inconsistent but significant protection was observed in some cases. The long-term duration of protection observed here defined a third temporal phase in the immune response to IHNV DNA vaccination, characterized by reduced but significant levels of protection, and decline or absence of detectable NAb titers. Examination of multiple tissues showed an absence of detectable long-term histopathological damage due to DNA vaccination.

  8. Yeast-expressed recombinant As16 protects mice against Ascaris suum infection through induction of a Th2-skewed immune response

    PubMed Central

    Liu, Zhuyun; Keegan, Brian; Gazzinelli-Guimarães, Ana Clara; Fujiwara, Ricardo T.; Briggs, Neima; Jones, Kathryn M.; Strych, Ulrich; Beaumier, Coreen M.; Bottazzi, Maria Elena; Zhan, Bin

    2017-01-01

    Background Ascariasis remains the most common helminth infection in humans. As an alternative or complementary approach to global deworming, a pan-anthelminthic vaccine is under development targeting Ascaris, hookworm, and Trichuris infections. As16 and As14 have previously been described as two genetically related proteins from Ascaris suum that induced protective immunity in mice when formulated with cholera toxin B subunit (CTB) as an adjuvant, but the exact protective mechanism was not well understood. Methodology/Principal findings As16 and As14 were highly expressed as soluble recombinant proteins (rAs16 and rAs14) in Pichia pastoris. The yeast-expressed rAs16 was highly recognized by immune sera from mice infected with A. suum eggs and elicited 99.6% protection against A. suum re-infection. Mice immunized with rAs16 formulated with ISA720 displayed significant larva reduction (36.7%) and stunted larval development against A. suum eggs challenge. The protective immunity was associated with a predominant Th2-type response characterized by high titers of serological IgG1 (IgG1/IgG2a > 2000) and high levels of IL-4 and IL-5 produced by restimulated splenocytes. A similar level of protection was observed in mice immunized with rAs16 formulated with alum (Alhydrogel), known to induce mainly a Th2-type immune response, whereas mice immunized with rAs16 formulated with MPLA or AddaVax, both known to induce a Th1-type biased response, were not significantly protected against A. suum infection. The rAs14 protein was not recognized by A. suum infected mouse sera and mice immunized with rAs14 formulated with ISA720 did not show significant protection against challenge infection, possibly due to the protein’s inaccessibility to the host immune system or a Th1-type response was induced which would counter a protective Th2-type response. Conclusions/Significance Yeast-expressed rAs16 formulated with ISA720 or alum induced significant protection in mice against A. suum egg challenge that associates with a Th2-skewed immune response, suggesting that rAS16 could be a feasible vaccine candidate against ascariasis. PMID:28708895

  9. LEE-encoded regulator (Ler) mutants elicit serotype-specific protection, but not cross protection, against attaching and effacing E. coli strains.

    PubMed

    Zhu, C; Feng, S; Yang, Z; Davis, K; Rios, H; Kaper, J B; Boedeker, E C

    2007-02-26

    We previously showed that single dose orogastric immunization with an attenuated regulatory Lee-encoded regulator (ler) mutant of the rabbit enteropathogenic Escherichia coli (REPEC) strain E22 (O103:H2) protected rabbits from fatal infection with the highly virulent parent strain. In the current study we assessed the degree of homologous (serotype-specific) and heterologous (cross-serotype) protection induced by immunization with REPEC ler mutant strains of differing serotypes, or with a prototype strain RDEC-1 (O15:H-) which expresses a full array of ler up-regulated proteins. We constructed an additional ler mutant using RDEC-1 thus, permitting immunization with a ler mutant of either serotype, O15 or O103, followed by challenge with a virulent REPEC strain of the same or different serotypes. Consistent with our previous data, the current study demonstrated that rabbits immunized with a RDEC-1 ler mutant were protected from challenge with virulent RDEC-H19A (RDEC-1 transduced with Shiga toxin-producing phage H19A) of the same serotype. Rabbits immunized with RDEC-1 or E22 derivative ler mutants demonstrated significant increase in serum antibody titers to the respective whole bacterial cells expressing O antigen but not to the LEE-encoded proteins. However, immunization with the ler mutants of either E22 or RDEC-1 failed to protect rabbits from infections with virulent organisms belonging to different serotypes. In contrast, rabbits immunized with the prototype RDEC-1 were cross protected against challenge with the heterologous E22 strain as shown by normal weight gain, and the absence of clinical signs of disease or characteristic attaching and effacing (A/E) lesions. Immunization with RDEC-1 induced significantly elevated serum IgG titers to LEE-encoded proteins. We thus, demonstrated homologous protection induced by the REPEC ler mutants and heterologous protection by RDEC-1. The observed correlation between elevated immune responses to the LEE-encoded proteins and the protection against challenge with heterologous virulent REPEC strain suggests that serotype-non-specific cross protection requires the expression of, and induction of antibody to, LEE-encoded virulence factors.

  10. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations.

    PubMed Central

    Fynan, E F; Webster, R G; Fuller, D H; Haynes, J R; Santoro, J C; Robinson, H L

    1993-01-01

    Plasmid DNAs expressing influenza virus hemagglutinin glycoproteins have been tested for their ability to raise protective immunity against lethal influenza challenges of the same subtype. In trials using two inoculations of from 50 to 300 micrograms of purified DNA in saline, 67-95% of test mice and 25-63% of test chickens have been protected against a lethal influenza challenge. Parenteral routes of inoculation that achieved good protection included intramuscular and intravenous injections. Successful mucosal routes of vaccination included DNA drops administered to the nares or trachea. By far the most efficient DNA immunizations were achieved by using a gene gun to deliver DNA-coated gold beads to the epidermis. In mice, 95% protection was achieved by two immunizations with beads loaded with as little as 0.4 micrograms of DNA. The breadth of routes supporting successful DNA immunizations, coupled with the very small amounts of DNA required for gene-gun immunizations, highlight the potential of this remarkably simple technique for the development of subunit vaccines. Images Fig. 1 PMID:8265577

  11. The immune enhancement of propolis adjuvant on inactivated porcine parvovirus vaccine in guinea pig.

    PubMed

    Ma, Xia; Guo, Zhenhuan; Shen, Zhiqiang; Wang, Jinliang; Hu, Yuanliang; Wang, Deyun

    2011-01-01

    Two experiments were carried out. In immune response test, the immune enhancement of propolis, oilemulsion and aluminium salt were compared in guinea pig vaccinated with inactivated porcine parvovirus (PPV) vaccine. The result showed that three adjuvants could enhance antibody titer, T lymphocyte proliferation, IL-2 and IL-4 secretion of splenic lymphocyte. The action of propolis was similar to that of oilemulsion and superior to that of aluminium salt, especially in early period of vaccination propolis could accelerate antibody production. In immune protection test, the effects of three adjuvants on PPV infection were compared in guinea pig vaccinated with PPV vaccine then challenged with PPV. The result showed that propolis and oilemulsion could enhance the antibody titer, IL-2 and IL-4 content in serum and decrease the PPV content in blood and viscera. In the effect of improving cellular immune response, the propolis was the best. These results indicated that propolis possessed better immune enhancement and would be exploited into a effective adjuvant of inactivated vaccine. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Protective Immunity and Reduced Renal Colonization Induced by Vaccines Containing Recombinant Leptospira interrogans Outer Membrane Proteins and Flagellin Adjuvant

    PubMed Central

    Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.

    2015-01-01

    Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285

  13. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.

    PubMed

    Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B

    2013-01-01

    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  14. Innate humoural immunity is related to eggshell bacterial load of European birds: a comparative analysis.

    PubMed

    Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape

    2011-09-01

    Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.

  15. Innate humoural immunity is related to eggshell bacterial load of European birds: a comparative analysis

    NASA Astrophysics Data System (ADS)

    Soler, Juan José; Peralta-Sánchez, Juan Manuel; Flensted-Jensen, Einar; Martín-Platero, Antonio Manuel; Møller, Anders Pape

    2011-09-01

    Fitness benefits associated with the development of a costly immune system would include not only self-protection against pathogenic microorganisms but also protection of host offspring if it reduces the probability and the rate of vertical transmission of microorganisms. This possibility predicts a negative relationship between probabilities of vertical transmission of symbionts and level of immune response that we here explore inter-specifically. We estimated eggshell bacterial loads by culturing heterotrophic bacteria, Enterococcus, Staphylococcus and Enterobacteriaceae on the eggshells of 29 species of birds as a proxy of vertical transmission of bacteria from mother to offspring. For this pool of species, we also estimated innate immune response (natural antibody and complement (lysis)) of adults, which constitute the main defence against bacterial infection. Multivariate general linear models revealed the predicted negative association between natural antibodies and density of bacteria on the eggshell of 19 species of birds for which we sampled the eggs in more than one nest. Univariate analyses revealed significant associations for heterotrophic bacteria and for Enterobacteriaceae, a group of bacteria that includes important pathogens of avian embryos. Therefore, these results suggest a possible trans-generational benefit of developing a strong immune system by reducing vertical transmission of pathogens.

  16. Mechanisms of Cross-protection by Influenza Virus M2-based Vaccines.

    PubMed

    Lee, Yu-Na; Kim, Min-Chul; Lee, Young-Tae; Kim, Yu-Jin; Kang, Sang-Moo

    2015-10-01

    Current influenza virus vaccines are based on strain-specific surface glycoprotein hemagglutinin (HA) antigens and effective only when the predicted vaccine strains and circulating viruses are well-matched. The current strategy of influenza vaccination does not prevent the pandemic outbreaks and protection efficacy is reduced or ineffective if mutant strains emerge. It is of high priority to develop effective vaccines and vaccination strategies conferring a broad range of cross protection. The extracellular domain of M2 (M2e) is highly conserved among human influenza A viruses and has been utilized to develop new vaccines inducing cross protection against different subtypes of influenza A virus. However, immune mechanisms of cross protection by M2e-based vaccines still remain to be fully elucidated. Here, we review immune correlates and mechanisms conferring cross protection by M2e-based vaccines. Molecular and cellular immune components that are known to be involved in M2 immune-mediated protection include antibodies, B cells, T cells, alveolar macrophages, Fc receptors, complements, and natural killer cells. Better understanding of protective mechanisms by immune responses induced by M2e vaccination will help facilitate development of broadly cross protective vaccines against influenza A virus.

  17. Leishmania infantum FML pulsed-dendritic cells induce a protective immune response in murine visceral leishmaniasis.

    PubMed

    Foroughi-Parvar, Faeze; Hatam, Gholam-Reza; Sarkari, Bahador; Kamali-Sarvestani, Eskandar

    2015-01-01

    To investigate the efficacy of FML loaded dendritic cells (DCs) in protection against visceral leishmaniasis. Mice were immunized with FML- or soluble Leishmania antigen-loaded DCs as well as FML or soluble Leishmania antigen in saponin and challenged with parasite. The levels of cytokines before and after challenge were detected by ELISA. Parasite burden (total Leishman-Donovan unit) was determined after parasite challenge. FML-saponin induced the highest IFN-γ/IL-4 ratio among vaccinated groups, though this ratio was higher in FML-loaded DCs group subsequent to challenge with Leishmania infantum. Moreover, the greatest reduction in parasite number was detected in mice vaccinated with FML-loaded DCs compared with phosphate-buffered saline-treated mice (p = 0.002). FML-loaded DCs are one of the promising tools for protection against murine visceral leishmaniasis.

  18. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.

    PubMed

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.

  19. Protein- and DNA-based anthrax toxin vaccines confer protection in guinea pigs against inhalational challenge with Bacillus cereus G9241.

    PubMed

    Palmer, John; Bell, Matt; Darko, Christian; Barnewall, Roy; Keane-Myers, Andrea

    2014-11-01

    In the past decade, several Bacillus cereus strains have been isolated from otherwise healthy individuals who succumbed to bacterial pneumonia presenting symptoms resembling inhalational anthrax. One strain was indistinguishable from B. cereus G9241, previously cultured from an individual who survived a similar pneumonia-like illness and which was shown to possess a complete set of plasmid-borne anthrax toxin-encoding homologs. The finding that B. cereus G9241 pathogenesis in mice is dependent on pagA1-derived protective antigen (PA) synthesis suggests that an anthrax toxin-based vaccine may be effective against this toxin-encoding B. cereus strain. Dunkin Hartley guinea pigs were immunized with protein- and DNA-based anthrax toxin-based vaccines, immune responses were evaluated and survival rates were calculated after lethal aerosol exposure with B. cereus G9241 spores. Each vaccine induced seroconversion with the protein immunization regimen eliciting significantly higher serum levels of antigen-specific antibodies at the prechallenge time-point compared with the DNA-protein prime-boost immunization schedule. Complete protection against lethal challenge was observed in all groups with a detectable prechallenge serum titer of toxin neutralizing antibodies. For the first time, we demonstrated that the efficacy of fully defined anthrax toxin-based vaccines was protective against lethal B. cereus G9241 aerosol challenge in the guinea pig animal model. Published 2014. This article is a US Government work and is in the public domain in the USA.

  20. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH

    PubMed Central

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592

  1. Protective Microbiota: From Localized to Long-Reaching Co-Immunity

    PubMed Central

    Chiu, Lynn; Bazin, Thomas; Truchetet, Marie-Elise; Schaeverbeke, Thierry; Delhaes, Laurence; Pradeu, Thomas

    2017-01-01

    Resident microbiota do not just shape host immunity, they can also contribute to host protection against pathogens and infectious diseases. Previous reviews of the protective roles of the microbiota have focused exclusively on colonization resistance localized within a microenvironment. This review shows that the protection against pathogens also involves the mitigation of pathogenic impact without eliminating the pathogens (i.e., “disease tolerance”) and the containment of microorganisms to prevent pathogenic spread. Protective microorganisms can have an impact beyond their niche, interfering with the entry, establishment, growth, and spread of pathogenic microorganisms. More fundamentally, we propose a series of conceptual clarifications in support of the idea of a “co-immunity,” where an organism is protected by both its own immune system and components of its microbiota. PMID:29270167

  2. Fungal β-glucan, a Dectin-1 ligand, promotes protection from Type 1 Diabetes by inducing regulatory innate immune response1

    PubMed Central

    Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan

    2014-01-01

    Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443

  3. Immunization with a Borrelia burgdorferi BB0172-Derived Peptide Protects Mice against Lyme Disease

    PubMed Central

    Small, Christina M.; Ajithdoss, Dharani K.; Rodrigues Hoffmann, Aline; Mwangi, Waithaka; Esteve-Gassent, Maria D.

    2014-01-01

    Lyme disease is the most prevalent arthropod borne disease in the US and it is caused by the bacterial spirochete Borrelia burgdorferi (Bb), which is acquired through the bite of an infected Ixodes tick. Vaccine development efforts focused on the von Willebrand factor A domain of the borrelial protein BB0172 from which four peptides (A, B, C and D) were synthesized and conjugated to Keyhole Limpet Hemocyanin, formulated in Titer Max® adjuvant and used to immunize C3H/HeN mice subcutaneously at days 0, 14 and 21. Sera were collected to evaluate antibody responses and some mice were sacrificed for histopathology to evaluate vaccine safety. Twenty-eight days post-priming, protection was evaluated by needle inoculation of half the mice in each group with 103 Bb/mouse, whereas the rest were challenged with 105Bb/mouse. Eight weeks post-priming, another four groups of similarly immunized mice were challenged using infected ticks. In both experiments, twenty-one days post-challenge, the mice were sacrificed to determine antibody responses, bacterial burdens and conduct histopathology. Results showed that only mice immunized with peptide B were protected against challenge with Bb. In addition, compared to the other the treatment groups, peptide B-immunized mice showed very limited inflammation in the heart and joint tissues. Peptide B-specific antibody titers peaked at 8 weeks post-priming and surprisingly, the anti-peptide B antibodies did not cross-react with Bb lysates. These findings strongly suggest that peptide B is a promising candidate for the development of a new DIVA vaccine (Differentiate between Infected and Vaccinated Animals) for protection against Lyme disease. PMID:24505447

  4. Persistence at one year of age of antigen-induced cellular immune responses in preterm infants vaccinated against whooping cough: comparison of three different vaccines and effect of a booster dose.

    PubMed

    Vermeulen, Françoise; Dirix, Violette; Verscheure, Virginie; Damis, Eliane; Vermeylen, Danièle; Locht, Camille; Mascart, Françoise

    2013-04-08

    Due to their high risk of developing severe Bordetella pertussis (Bp) infections, it is recommended to immunize preterm infants at their chronological age. However, little is known about the persistence of their specific immune responses, especially of the cellular responses recognized to play a role in protection. We compared here the cellular immune responses to two major antigens of Bp between three groups of one year-old children born prematurely, who received for their primary vaccination respectively the whole cell vaccine Tetracoq(®) (TC), the acellular vaccine Tetravac(®) (TV), or the acellular vaccine Infanrix-hexa(®) (IR). Whereas most children had still detectable IFN-γ responses at one year of age, they were lower in the IR-vaccinated children compared to the two other groups. In contrast, both the TV- and the IR-vaccinated children displayed higher Th2-type immune responses, resulting in higher antigen-specific IFN-γ/IL-5 ratios in TC- than in TV- or IR-vaccinated children. The IFN-γ/IL-5 ratio of mitogen-induced cytokines was also lower in IR- compared to TC- or TV-vaccinated children. No major differences in the immune responses were noted after the booster compared to the pre-booster responses for each vaccine. The IR-vaccinated children had a persistently low specific Th1-type immune response associated with high specific Th2-type immune responses, resulting in lower antigen-specific IFN-γ/IL-5 ratios compared to the two other groups. We conclude that antigen-specific cellular immune responses persisted in one year-old children born prematurely and vaccinated during infancy at their chronological age, that a booster dose did not significantly boost the cellular immune responses, and that the Th1/Th2 balance of the immune responses is modulated by the different vaccines. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Innate and adaptive immunity at Mucosal Surfaces of the Female Reproductive Tract: Stratification and Integration of Immune Protection against the Transmission of Sexually Transmitted Infections

    PubMed Central

    Hickey, DK; Patel, MV; Fahey, JV; Wira, CR

    2011-01-01

    This review examines the multiple levels of pre-existing immunity in the upper and lower female reproductive tract. In addition, we highlight the need for further research of innate and adaptive immune protection of mucosal surfaces in the female reproductive tract. Innate mechanisms include the mucus lining, a tight epithelial barrier and the secretion of antimicrobial peptides and cytokines by epithelial and innate immune cells. Stimulation of the innate immune system also serves to bridge the adaptive arm resulting in the generation of pathogen-specific humoral and cell-mediated immunity. Less understood are the multiple components that act in a coordinated way to provide a network of ongoing protection. Innate and adaptive immunity in the human female reproductive tract are influenced by the stage of menstrual cycle and are directly regulated by the sex steroid hormones, progesterone and estradiol. Furthermore, the effect of hormones on immunity is mediated both directly on immune and epithelial cells and indirectly by stimulating growth factor secretion from stromal cells. The goal of this review is to focus on the diverse aspects of the innate and adaptive immune systems that contribute to a unique network of protection throughout the female reproductive tract. PMID:21353708

  6. Discovering naturally processed antigenic determinants that confer protective T cell immunity

    PubMed Central

    Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian

    2013-01-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059

  7. Discovering naturally processed antigenic determinants that confer protective T cell immunity.

    PubMed

    Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian

    2013-05-01

    CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.

  8. Eimeria maxima microneme protein 2 delivered as DNA vaccine and recombinant protein induces immunity against experimental homogenous challenge.

    PubMed

    Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-10-01

    E. maxima is one of the seven species of Eimeria that infects chicken. Until now, only a few antigenic genes of E. maxima have been reported. In the present study, the immune protective effects against E. maxima challenge of recombinant protein and DNA vaccine encoding EmMIC2 were evaluated. Two-week-old chickens were randomly divided into five groups. The experimental group of chickens was immunized with 100 μg DNA vaccine pVAX1-MIC2 or 200 μg rEmMIC2 protein while the control group of chickens was injected with pVAX1 plasmid or sterile PBS. The results showed that the anti-EmMIC2 antibody titers of both rEmMIC2 protein and pVAX1-MIC2 groups were significantly higher as compared to PBS and pVAX1 control (P<0.05). The splenocytes from both vaccinated groups of chickens displayed significantly greater proliferation compared with the controls (P<0.05). Serum from chickens immunized with pVAX1-MIC2 and rEmMIC2 protein displayed significantly high levels of IL-2, IFN-γ, IL-10, IL-17, TGF-β and IL-4 (P<0.05) compared to those of negative controls. The challenge experiment results showed that both the recombinant protein and the DNA vaccine could obviously alleviate jejunum lesions, body weight loss, increase oocyst, decrease ratio and provide ACIs of more than 165. All the above results suggested that immunization with EmMIC2 was effective in imparting partial protection against E. maxima challenge and it could be an effective antigen candidate for the development of new vaccines against E. maxima. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Risk factors for incomplete immunization in children with HIV infection.

    PubMed

    Bhattacharya, Sangeeta Das; Bhattacharyya, Subhasish; Chatterjee, Devlina; Niyogi, Swapan Kumar; Chauhan, Nageshwar; Sudar, A

    2014-09-01

    To document the immunization rates, factors associated with incomplete immunization, and missed opportunities for immunizations in children affected by HIV presenting for routine outpatient follow-up. A cross-sectional study of immunization status of children affected by HIV presenting for routine outpatient care was conducted. Two hundred and six HIV affected children were enrolled. The median age of children in this cohort was 6 y. One hundred ninety seven of 206 children were HIV infected, nine were HIV exposed, but indeterminate. Fifty (25 %) children had incomplete immunizations per the Universal Immunization Program (UIP) of India. Hundred percent of children had received OPV. Ninety three percent of children got their UIP vaccines from a government clinic. Children with incomplete immunization were older, median age of 8 compared to 5 (p = 0.003). Each year of maternal education increased the odds of having a child with complete UIP immunizations by 1.18 (p = 0.008)-children of mothers with 6 y of education compared to those with no education were seven times more likely to have complete UIP vaccine status. The average number of visits to the clinic by an individual child in a year was 4. This represents 200 missed opportunities for immunizations. HIV infected children are at risk for incomplete immunization coverage though they regularly access medical care. Including routine immunizations, particularly catch-up immunizations in programs for HIV infected children maybe an effective way of protecting these children from vaccine preventable disease.

  10. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    PubMed

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  11. Improved immunogenicity of tetanus toxoid by Brucella abortus S19 LPS adjuvant.

    PubMed

    Mohammadi, Mohsen; Kianmehr, Zahra; Kaboudanian Ardestani, Sussan; Gharegozlou, Behnaz

    2014-09-01

    Adjuvants are used to increase the immunogenicity of new generation vaccines, especially those based on recombinant proteins. Despite immunostimulatory properties, the use of bacterial lipopolysaccharide (LPS) as an adjuvant has been hampered due to its toxicity and pyrogenicity. Brucella abortus LPS is less toxic and has no pyrogenic properties compared to LPS from other gram negative bacteria. To evaluate the adjuvant effect of B. abortus (vaccine strain, S19) LPS for tetanus toxoid antigen (TT) and to investigate the protective effect of different tetanus vaccine preparations. LPS was extracted and purified from B. abortus S19 and KDO, glycan, phosphate content, and protein contamination were measured. Adipic acid dihydrazide (ADH) was used as a linker for conjugation of TT to LPS. Different amounts of B. abortus LPS, TT, TT conjugated with LPS, and TT mixed with LPS or complete Freund's adjuvant (CFA) were injected into mice and antibody production against TT was measured. The protective effect of induced antibodies was determined by LD50. Immunization of mice with TT+LPS produced the highest anti-TT antibody titer in comparison to the group immunized with TT without any adjuvant or the groups immunized with TT-LPS or TT+CFA. Tetanus toxid-S19 LPS also produced a 100% protective effect against TT in immunized mice. These data indicate that B. abortus LPS enhances the immune responses to TT and suggest the possible use of B. abortus LPS as an adjuvant in vaccine preparations.

  12. Chloroform-Methanol Residue of Coxiella burnetii Markedly Potentiated the Specific Immunoprotection Elicited by a Recombinant Protein Fragment rOmpB-4 Derived from Outer Membrane Protein B of Rickettsia rickettsii in C3H/HeN Mice

    PubMed Central

    Gong, Wenping; Wang, Pengcheng; Xiong, Xiaolu; Jiao, Jun; Yang, Xiaomei; Wen, Bohai

    2015-01-01

    The obligate intracellular bacteria, Rickettsia rickettsii and Coxiella burnetii, are the potential agents of bio-warfare/bio-terrorism. Here C3H/HeN mice were immunized with a recombinant protein fragment rOmp-4 derived from outer membrane protein B, a major protective antigen of R. rickettsii, combined with chloroform-methanol residue (CMR) extracted from phase I C. burnetii organisms, a safer Q fever vaccine. These immunized mice had significantly higher levels of IgG1 and IgG2a to rOmpB-4 and interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α), two crucial cytokines in resisting intracellular bacterial infection, as well as significantly lower rickettsial loads and slighter pathological lesions in organs after challenge with R. rickettsii, compared with mice immunized with rOmpB-4 or CMR alone. Additionally, after challenge with C. burnetii, the coxiella loads in the organs of these mice were significantly lower than those of mice immunized with rOmpB-4 alone. Our results prove that CMR could markedly potentiate enhance the rOmpB-4-specific immunoprotection by promoting specific and non-specific immunoresponses and the immunization with the protective antigen of R. rickettsii combined with CMR of C. burnetii could confer effective protection against infection of R. rickettsii or C. burnetii. PMID:25909586

  13. Transcutaneous immunization via rapidly dissolvable microneedles protects against hand-foot-and-mouth disease caused by enterovirus 71.

    PubMed

    Zhu, Zhuangzhi; Ye, Xiaohua; Ku, Zhiqiang; Liu, Qingwei; Shen, Chaoyun; Luo, Huafei; Luan, Hansen; Zhang, Chenghao; Tian, Shaoqiong; Lim, CheeYen; Huang, Zhong; Wang, Hao

    2016-12-10

    Recent large outbreaks of hand-foot-and-mouth disease (HFMD) have seriously affected the health of young children. Enterovirus 71 (EV71) is the main causative agent of HFMD. Herein, for the first time, rapidly dissolvable microneedles (MNs) loaded with EV71 virus-like particles (VLPs) were evaluated whether they could induce robust immune responses that confer protection against EV71 infection. The characteristics of prepared MNs including hygroscopy, mechanical strength, insertion capacity, dissolution profile, skin irritation and storage stability were comprehensively assessed. EV71 VLPs remained morphologically stable during fabrication. The MNs made of sodium hyaluronate maintained their insertion ability for at least 3h even at a high relative humidity of 75%. With the aid of spring-operated applicator, EV71 MNs (approximately 500μm length) could be readily penetrated into the mouse skin in vivo, and then rapidly dissolved to release encapsulated antigen within 2min. Additionally, MNs induced slight erythema that disappeared within a few hours. More importantly, mouse immunization and virus challenge studies demonstrated that MNs immunization induced high level of antibody responses conferring full protection against lethal EV71 virus challenge that were comparable to conventional intramuscular injection, but with only 1/10th of the delivered antigen (dose sparing). Consequently, our rapidly dissolving MNs may present as an effective and promising transcutaneous immunization device for HFMD prophylaxis among children. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Strategies for Coordination of a Serosurvey in Parallel with an Immunization Coverage Survey

    PubMed Central

    Travassos, Mark A.; Beyene, Berhane; Adam, Zenaw; Campbell, James D.; Mulholland, Nigisti; Diarra, Seydou S.; Kassa, Tassew; Oot, Lisa; Sequeira, Jenny; Reymann, Mardi; Blackwelder, William C.; Pasetti, Marcela F.; Sow, Samba O.; Steinglass, Robert; Kebede, Amha; Levine, Myron M.

    2015-01-01

    A community-based immunization coverage survey is the standard way to estimate effective vaccination delivery to a target population in a region. Accompanying serosurveys can provide objective measures of protective immunity against vaccine-preventable diseases but pose considerable challenges with respect to specimen collection and preservation and community compliance. We performed serosurveys coupled to immunization coverage surveys in three administrative districts (woredas) in rural Ethiopia. Critical to the success of this effort were serosurvey equipment and supplies, team composition, and tight coordination with the coverage survey. Application of these techniques to future studies may foster more widespread use of serosurveys to derive more objective assessments of vaccine-derived seroprotection and monitor and compare the performance of immunization services in different districts of a country. PMID:26055737

  15. Transcutaneous immunization with a novel imiquimod nanoemulsion induces superior T cell responses and virus protection.

    PubMed

    Lopez, Pamela Aranda; Denny, Mark; Hartmann, Ann-Kathrin; Alflen, Astrid; Probst, Hans Christian; von Stebut, Esther; Tenzer, Stefan; Schild, Hansjörg; Stassen, Michael; Langguth, Peter; Radsak, Markus P

    2017-09-01

    Transcutaneous immunization (TCI) is a novel vaccination strategy utilizing the skin associated lymphatic tissue to induce immune responses. TCI using a cytotoxic T lymphocyte (CTL) epitope and the Toll-like receptor 7 (TLR7) agonist imiquimod mounts strong CTL responses by activation and maturation of skin-derived dendritic cells (DCs) and their migration to lymph nodes. However, TCI based on the commercial formulation Aldara only induces transient CTL responses that needs further improvement for the induction of durable therapeutic immune responses. Therefore we aimed to develop a novel imiquimod solid nanoemulsion (IMI-Sol) for TCI with superior vaccination properties suited to induce high quality T cell responses for enhanced protection against infections. TCI was performed by applying a MHC class I or II restricted epitope along with IMI-Sol or Aldara (each containing 5% Imiquimod) on the shaved dorsum of C57BL/6, IL-1R, Myd88, Tlr7 or Ccr7 deficient mice. T cell responses as well as DC migration upon TCI were subsequently analyzed by flow cytometry. To determine in vivo efficacy of TCI induced immune responses, CTL responses and frequency of peptide specific T cells were evaluated on day 8 or 35 post vaccination and protection in a lymphocytic choriomeningitis virus (LCMV) infection model was assessed. TCI with the imiquimod formulation IMI-Sol displayed equal skin penetration of imiquimod compared to Aldara, but elicited superior CD8 + as well as CD4 + T cell responses. The induction of T-cell responses induced by IMI-Sol TCI was dependent on the TLR7/MyD88 pathway and independent of IL-1R. IMI-Sol TCI activated skin-derived DCs in skin-draining lymph nodes more efficiently compared to Aldara leading to enhanced protection in a LCMV infection model. Our data demonstrate that IMI-Sol TCI can overcome current limitations of previous imiquimod based TCI approaches opening new perspectives for transcutaneous vaccination strategies and allowing the use of this enhanced cutaneous drug-delivery system to be tailored for the improved prevention and treatment of infectious diseases and cancers. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  16. Cattle Immunized with a Recombinant Subunit Vaccine Formulation Exhibits a Trend towards Protection against Histophilus somni Bacterial Challenge

    PubMed Central

    Madampage, Claudia Avis; Wilson, Don; Townsend, Hugh; Crockford, Gordon; Rawlyk, Neil; Dent, Donna; Evans, Brock; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2016-01-01

    Histophilosis, a mucosal and septicemic infection of cattle is caused by the Gram negative pathogen Histophilus somni (H. somni). As existing vaccines against H. somni infection have shown to be of limited efficacy, we used a reverse vaccinology approach to identify new vaccine candidates. Three groups (B, C, D) of cattle were immunized with subunit vaccines and a control group (group A) was vaccinated with adjuvant alone. All four groups were challenged with H. somni. The results demonstrate that there was no significant difference in clinical signs, joint lesions, weight change or rectal temperature between any of the vaccinated groups (B,C,D) vs the control group A. However, the trend to protection was greatest for group C vaccinates. The group C vaccine was a pool of six recombinant proteins. Serum antibody responses determined using ELISA showed significantly higher titers for group C, with P values ranging from < 0.0148 to < 0.0002, than group A. Even though serum antibody titers in group B (5 out of 6 antigens) and group D were significantly higher compared to group A, they exerted less of a trend towards protection. In conclusion, the vaccine used in group C exhibits a trend towards protective immunity in cattle and would be a good candidate for further analysis to determine which proteins were responsible for the trend towards protection. PMID:27501390

  17. Immune parameters to p67C antigen adjuvanted with ISA206VG correlate with protection against East Coast fever.

    PubMed

    Lacasta, Anna; Mwalimu, Stephen; Kibwana, Elisabeth; Saya, Rosemary; Awino, Elias; Njoroge, Thomas; Poole, Jane; Ndiwa, Nicholas; Pelle, Roger; Nene, Vishvanath; Steinaa, Lucilla

    2018-03-07

    East Coast fever (ECF) is a lymphoproliferative disease caused by the tick-transmitted protozoan parasite Theileria parva. ECF is one of the most serious cattle tick-borne diseases in Sub-Saharan Africa. We have previously demonstrated that three doses of the C-terminal part of the sporozoite protein p67 (p67C) adjuvanted with ISA206VG confers partial protection against ECF at a herd level. We have tested the efficacy of two doses of this experimental vaccine, as reducing the vaccination regimen would facilitate its deployment in the field. We reconfirm that three antigen doses gave a significant level of protection to severe disease (46%, ECF score < 6) when compared with the control group, while two doses did not (23%). Animals receiving three doses of p67C developed higher antibody titers and CD4 + T-cell proliferation indices, than those which received two doses. A new panel of immune parameters were tested in order to identify factors correlating with protection: CD4 + proliferation index, total IgG, IgG1, IgG2 and IgM half maximal titers and neutralization capacity of the sera with and without complement. We show that some of the cellular and humoral immune responses provide preliminary correlates of protection. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Cattle Immunized with a Recombinant Subunit Vaccine Formulation Exhibits a Trend towards Protection against Histophilus somni Bacterial Challenge.

    PubMed

    Madampage, Claudia Avis; Wilson, Don; Townsend, Hugh; Crockford, Gordon; Rawlyk, Neil; Dent, Donna; Evans, Brock; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2016-01-01

    Histophilosis, a mucosal and septicemic infection of cattle is caused by the Gram negative pathogen Histophilus somni (H. somni). As existing vaccines against H. somni infection have shown to be of limited efficacy, we used a reverse vaccinology approach to identify new vaccine candidates. Three groups (B, C, D) of cattle were immunized with subunit vaccines and a control group (group A) was vaccinated with adjuvant alone. All four groups were challenged with H. somni. The results demonstrate that there was no significant difference in clinical signs, joint lesions, weight change or rectal temperature between any of the vaccinated groups (B,C,D) vs the control group A. However, the trend to protection was greatest for group C vaccinates. The group C vaccine was a pool of six recombinant proteins. Serum antibody responses determined using ELISA showed significantly higher titers for group C, with P values ranging from < 0.0148 to < 0.0002, than group A. Even though serum antibody titers in group B (5 out of 6 antigens) and group D were significantly higher compared to group A, they exerted less of a trend towards protection. In conclusion, the vaccine used in group C exhibits a trend towards protective immunity in cattle and would be a good candidate for further analysis to determine which proteins were responsible for the trend towards protection.

  19. Single vector platform vaccine protects against lethal respiratory challenge with Tier 1 select agents of anthrax, plague, and tularemia.

    PubMed

    Jia, Qingmei; Bowen, Richard; Dillon, Barbara Jane; Masleša-Galić, Saša; Chang, Brennan T; Kaidi, Austin C; Horwitz, Marcus A

    2018-05-03

    Bacillus anthracis, Yersinia pestis, and Francisella tularensis are the causative agents of Tier 1 Select Agents anthrax, plague, and tularemia, respectively. Currently, there are no licensed vaccines against plague and tularemia and the licensed anthrax vaccine is suboptimal. Here we report F. tularensis LVS ΔcapB (Live Vaccine Strain with a deletion in capB)- and attenuated multi-deletional Listeria monocytogenes (Lm)-vectored vaccines against all three aforementioned pathogens. We show that LVS ΔcapB- and Lm-vectored vaccines express recombinant B. anthracis, Y. pestis, and F. tularensis immunoprotective antigens in broth and in macrophage-like cells and are non-toxic in mice. Homologous priming-boosting with the LVS ΔcapB-vectored vaccines induces potent antigen-specific humoral and T-cell-mediated immune responses and potent protective immunity against lethal respiratory challenge with all three pathogens. Protection against anthrax was far superior to that obtained with the licensed AVA vaccine and protection against tularemia was comparable to or greater than that obtained with the toxic and unlicensed LVS vaccine. Heterologous priming-boosting with LVS ΔcapB- and Lm-vectored B. anthracis and Y. pestis vaccines also induced potent protective immunity against lethal respiratory challenge with B. anthracis and Y. pestis. The single vaccine platform, especially the LVS ΔcapB-vectored vaccine platform, can be extended readily to other pathogens.

  20. Social immunity and the superorganism: Behavioral defenses protecting honey bee colonies from pathogens and parasites

    USDA-ARS?s Scientific Manuscript database

    Honey bees (Apis mellifera) have a number of traits that effectively reduce the spread of pathogens and parasites throughout the colony. These mechanisms of social immunity are often analogous to the individual immune system. As such social immune defences function to protect the colony or superorga...

  1. Increased tumor localization and reduced immune response to adenoviral vector formulated with the liposome DDAB/DOPE.

    PubMed

    Steel, Jason C; Cavanagh, Heather M A; Burton, Mark A; Abu-Asab, Mones S; Tsokos, Maria; Morris, John C; Kalle, Wouter H J

    2007-04-01

    We aimed to increase the efficiency of adenoviral vectors by limiting adenoviral spread from the target site and reducing unwanted host immune responses to the vector. We complexed adenoviral vectors with DDAB-DOPE liposomes to form adenovirus-liposomal (AL) complexes. AL complexes were delivered by intratumoral injection in an immunocompetent subcutaneous rat tumor model and the immunogenicity of the AL complexes and the expression efficiency in the tumor and other organs was examined. Animals treated with the AL complexes had significantly lower levels of beta-galactosidase expression in systemic tissues compared to animals treated with the naked adenovirus (NA) (P<0.05). The tumor to non-tumor ratio of beta-galactosidase marker expression was significantly higher for the AL complex treated animals. NA induced significantly higher titers of adenoviral-specific antibodies compared to the AL complexes (P<0.05). The AL complexes provided protection (immunoshielding) to the adenovirus from neutralizing antibody. Forty-seven percent more beta-galactosidase expression was detected following intratumoral injection with AL complexes compared to the NA in animals pre-immunized with adenovirus. Complexing of adenovirus with liposomes provides a simple method to enhance tumor localization of the vector, decrease the immunogenicity of adenovirus, and provide protection of the virus from pre-existing neutralizing antibodies.

  2. Mice are actively immunized after passive monoclonal antibody prophylaxis and ricin toxin challenge. (Reannouncement with new availability information)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lemley, P.V.; Wright, D.C.

    1992-12-31

    Mice passively immunized by a protective, anti-ricin A-chain monoclonal antibody, then challenged intravenously with ricin, were protected from a subsequent ricin challenge, and were actively immunized. Two significant advantages accrued from this experiment: the monoclonal antibody neutralized the toxicity of the ricin immunogen, and active immunization was achieved with very low antigen load (approx. 0.5 micrograms/mouse). We ruled out the possibility that residual monoclonal antibody provided the protection by using three independent criteria. There was significant (four orders of magnitude) enhancement of the immune response in the presence of the monoclonal antibody; control immunizations of mice with ricin A-chain, ricinmore » B-chain or either chain with the monoclonal antibody did not induce active immunity; and the active immunization could not be replicated when protective goat polyclonal antibody was substituted for the monoclonal antibody. Because high titers were achieved rapidly without any adjuvant, we are currently investigating haptenized ricin to determine if anti-hapten monoclonal antibodies can be produced by this refined procedure.« less

  3. Killed but metabolically active Bacillus anthracis vaccines induce broad and protective immunity against anthrax.

    PubMed

    Skoble, Justin; Beaber, John W; Gao, Yi; Lovchik, Julie A; Sower, Laurie E; Liu, Weiqun; Luckett, William; Peterson, Johnny W; Calendar, Richard; Portnoy, Daniel A; Lyons, C Rick; Dubensky, Thomas W

    2009-04-01

    Bacillus anthracis is the causative agent of anthrax. We have developed a novel whole-bacterial-cell anthrax vaccine utilizing B. anthracis that is killed but metabolically active (KBMA). Vaccine strains that are asporogenic and nucleotide excision repair deficient were engineered by deleting the spoIIE and uvrAB genes, rendering B. anthracis extremely sensitive to photochemical inactivation with S-59 psoralen and UV light. We also introduced point mutations into the lef and cya genes, which allowed inactive but immunogenic toxins to be produced. Photochemically inactivated vaccine strains maintained a high degree of metabolic activity and secreted protective antigen (PA), lethal factor, and edema factor. KBMA B. anthracis vaccines were avirulent in mice and induced less injection site inflammation than recombinant PA adsorbed to aluminum hydroxide gel. KBMA B. anthracis-vaccinated animals produced antibodies against numerous anthrax antigens, including high levels of anti-PA and toxin-neutralizing antibodies. Vaccination with KBMA B. anthracis fully protected mice against challenge with lethal doses of toxinogenic unencapsulated Sterne 7702 spores and rabbits against challenge with lethal pneumonic doses of fully virulent Ames strain spores. Guinea pigs vaccinated with KBMA B. anthracis were partially protected against lethal Ames spore challenge, which was comparable to vaccination with the licensed vaccine anthrax vaccine adsorbed. These data demonstrate that KBMA anthrax vaccines are well tolerated and elicit potent protective immune responses. The use of KBMA vaccines may be broadly applicable to bacterial pathogens, especially those for which the correlates of protective immunity are unknown.

  4. Smallpox vaccines: targets of protective immunity.

    PubMed

    Moss, Bernard

    2011-01-01

    The eradication of smallpox, one of the great triumphs of medicine, was accomplished through the prophylactic administration of live vaccinia virus, a comparatively benign relative of variola virus, the causative agent of smallpox. Nevertheless, recent fears that variola virus may be used as a biological weapon together with the present susceptibility of unimmunized populations have spurred the development of new-generation vaccines that are safer than the original and can be produced by modern methods. Predicting the efficacy of such vaccines in the absence of human smallpox, however, depends on understanding the correlates of protection. This review outlines the biology of poxviruses with particular relevance to vaccine development, describes protein targets of humoral and cellular immunity, compares animal models of orthopoxvirus disease with human smallpox, and considers the status of second- and third-generation smallpox vaccines. Published 2010. This article is a US Government work and is in the public domain in the USA.

  5. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

    PubMed

    Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

    2014-08-21

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

  6. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    PubMed Central

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

  7. Duration of protection against hepatitis A for the current two-dose vaccine compared to a three-dose vaccine schedule in children

    PubMed Central

    Raczniak, Gregory A.; Thomas, Timothy K.; Bulkow, Lisa R.; Negus, Susan E.; Zanis, Carolyn L.; Bruce, Michael G.; Spradling, Philip R.; Teshale, Eyasu H.; McMahon, Brian J.

    2015-01-01

    Background Hepatitis A is mostly a self-limiting disease but causes substantial economic burden. Consequently, United States Advisory Committee for Immunization Practices recommends inactivated hepatitis A vaccination for all children beginning at age 1 year and for high risk adults. The hepatitis A vaccine is highly effective but the duration of protection is unknown. Methods We examined the proportion of children with protective hepatitis A antibody levels (anti-HAV ≥20 mIU/mL) as well as the geometric mean concentration (GMC) of anti-HAV in a cross sectional convenience sample of individuals aged 12–24 years, who had been vaccinated with a two-dose schedule in childhood, with the initial dose at least 5 years ago. We compared a subset of data from persons vaccinated with two-doses (720 EL.U.) at age 3–6 years with a demographically similar prospective cohort that received a three-dose (360 EL.U.) schedule and have been followed for 17 years. Results No significant differences were observed when comparing GMC between the two cohorts at 10 (P = 0.467), 12 (P = 0.496), and 14 (P = 0.175) years post-immunization. For the three-dose cohort, protective antibody levels remain for 17 years and have leveled-off over the past 7 years. Conclusion The two- and three-dose schedules provide similar protection >14 years after vaccination, indicating a booster dose is not needed at this time. Plateauing anti-HAV GMC levels suggest protective antibody levels may persist long-term. PMID:23470239

  8. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA) Induce Protective Immune Responses in Dogs

    PubMed Central

    Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel

    2016-01-01

    Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates. PMID:27223609

  9. Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA) Induce Protective Immune Responses in Dogs.

    PubMed

    Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel

    2016-05-01

    Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.

  10. A boosting skin vaccination with dissolving microneedle patch encapsulating M2e vaccine broadens the protective efficacy of conventional influenza vaccines.

    PubMed

    Zhu, Wandi; Pewin, Winston; Wang, Chao; Luo, Yuan; Gonzalez, Gilbert X; Mohan, Teena; Prausnitz, Mark R; Wang, Bao-Zhong

    2017-09-10

    The biodegradable microneedle patch (MNP) is a novel technology for vaccine delivery that could improve the immunogenicity of vaccines. To broaden the protective efficiency of conventional influenza vaccines, a new 4M2e-tFliC fusion protein construct containing M2e sequences from different subtypes was generated. Purified fusion protein was encapsulate into MNPs with a biocompatible polymer for use as a boosting vaccine. The results demonstrated that mice receiving a conventional inactivated vaccine followed by a skin-applied dissolving 4M2e-tFliC MNP boost could better maintain the humoral antibody response than that by the conventional vaccine-prime alone. Compared with an intramuscular injection boost, mice receiving the MNP boost showed significantly enhanced cellular immune responses, hemagglutination-inhibition (HAI) titers, and neutralization titers. Increased frequency of antigen-specific plasma cells and long-lived bone marrow plasma cells was detected in the MNP boosted group as well, indicating that skin vaccination with 4M2e-tFliC facilitated a long-term antibody-mediated immunity. The 4M2e-tFliC MNP-boosted group also possessed enhanced protection against high lethal dose challenges against homologous A/PR/8/34 and A/Aichi/2/68 viruses and protection for a majority of immunized mice against a heterologous A/California/07/2009 H1N1 virus. High levels of M2e specific immune responses were observed in the 4M2e-tFliC MNP-boosted group as well. These results demonstrate that a skin-applied 4M2e-tFliC MNP boosting immunization to seasonal vaccine recipients may be a rapid approach for increasing the protective efficacy of seasonal vaccines in response to a significant drift seen in circulating viruses. The results also provide a new perspective for future exploration of universal influenza vaccines. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Protective Effect of Immunization of Rats with Holotoxin or B Subunit of Escherichia coli Heat-Labile Enterotoxin

    PubMed Central

    Klipstein, Frederick A.; Engert, Richard F.

    1981-01-01

    The relative immunogenicities of three forms of the Escherichia coli heatlabile enterotoxin (LT), the holotoxin, its B subunit, and the polymyxin-release form (PM LT) were compared by immunizing rats with various dosages of each given exclusively by the parenteral (IP/IP) or peroral (PO/PO) routes or by a combination of the two (IP/PO). The degree of protection was evaluated by challenge in ligated ileal loops, and the serum antitoxin response was determined by an enzyme-linked immunosorbent assay with homologous antigens. When given by the PO/PO route, each LT antigen provided only weak protection against the toxin and virtually none against viable LT-producing strains; serum antitoxin titers were not significantly increased. When the toxins were given after a parental primary immunization by either the IP/IP or the IP/PO routes, each LT antigen provided a dose-related increase in serum antitoxin titers and in the degree of protection against the toxin as well as against viable strains which produce LT alone (LT+/ST−) or in combination with the heat-stable toxin (LT+/ST+). The degree of protection against viable bacteria, particularly the LT+/ST+ strain, was stronger in animals which received booster immunizations by the PO route. When expressed on the basis of molar equivalents, holotoxin provided significant protection (a protection index of >5 against toxin challenge and >50% reduced secretion with bacterial challenge) with 4 to 15 times fewer moles than PM LT and up to 50 times fewer moles than the B subunit. These observations indicate that, on the basis of molar equivalents, the holotoxin (which contains one A plus five or six B subunits) is a more potent immunogen than either PM LT (which contains one A and probably one B subunit) or the B subunit. PMID:7011990

  12. Immunization with apical membrane antigen 1 confers sterile infection-blocking immunity against Plasmodium sporozoite challenge in a rodent model.

    PubMed

    Schussek, Sophie; Trieu, Angela; Apte, Simon H; Sidney, John; Sette, Alessandro; Doolan, Denise L

    2013-10-01

    Apical membrane antigen 1 (AMA-1) is a leading blood-stage malaria vaccine candidate. Consistent with a key role in erythrocytic invasion, AMA-1-specific antibodies have been implicated in AMA-1-induced protective immunity. AMA-1 is also expressed in sporozoites and in mature liver schizonts where it may be a target of protective cell-mediated immunity. Here, we demonstrate for the first time that immunization with AMA-1 can induce sterile infection-blocking immunity against Plasmodium sporozoite challenge in 80% of immunized mice. Significantly higher levels of gamma interferon (IFN-γ)/interleukin-2 (IL-2)/tumor necrosis factor (TNF) multifunctional T cells were noted in immunized mice than in control mice. We also report the first identification of minimal CD8(+) and CD4(+) T cell epitopes on Plasmodium yoelii AMA-1. These data establish AMA-1 as a target of both preerythrocytic- and erythrocytic-stage protective immune responses and validate vaccine approaches designed to induce both cellular and humoral immunity.

  13. Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ T cell release of IFN-gamma.

    PubMed

    Heal, Karen G; Taylor-Robinson, Andrew W

    2010-01-01

    The glycoalkaloid tomatine, derived from the wild tomato, can act as a powerful adjuvant to elicit an antigen-specific cell-mediated immune response to the circumsporozoite (CS) protein, a major pre-erythrocytic stage malaria vaccine candidate antigen. Using a defined MHC-class-I-restricted CS epitope in a Plasmodium berghei rodent model, antigen-specific cytotoxic T lymphocyte activity and IFN-gamma secretion ex vivo were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunized mice. Further, through lymphocyte depletion it is demonstrated that antigen-specific IFN-gamma is produced exclusively by the CD8(+) T cell subset. We conclude that the processing of the P. berghei CS peptide as an exogenous antigen and its presentation via MHC class I molecules to CD8(+) T cells leads to an immune response that is an in vitro correlate of protection against pre-erythrocytic malaria. Further characterization of tomatine as an adjuvant in malaria vaccine development is indicated.

  14. Protection against Foot-and-Mouth Disease Virus in Guinea Pigs via Oral Administration of Recombinant Lactobacillus plantarum Expressing VP1

    PubMed Central

    Wang, Miao; Pan, Li; Zhou, Peng; Lv, Jianliang; Zhang, Zhongwang; Wang, Yonglu; Zhang, Yongguang

    2015-01-01

    Mucosal vaccination is an effective strategy for generating antigen-specific immune responses against mucosal infections of foot-and-mouth disease virus (FMDV). In this study, Lactobacillus plantarum strains NC8 and WCFS1 were used as oral delivery vehicles containing a pSIP411-VP1 recombinant plasmid to initiate mucosal and systemic immune responses in guinea pigs. Guinea pigs were orally vaccinated (three doses) with NC8-pSIP411, NC8-pSIP411-VP1, WCFS1-pSIP411, WCFS1-pSIP411-VP1 or milk. Animals immunized with NC8-pSIP411-VP1 and WCFS1-pSIP411-VP1 developed high levels of antigen-specific serum IgG, IgA, IgM, mucosal secretory IgA (sIgA) and neutralizing antibodies, and revealed stronger cell-mediated immune responses and enhanced protection against FMDV challenge compared with control groups. The recombinant pSIP411-VP1 effectively improved immunoprotection against FMDV in guinea pigs. PMID:26629822

  15. Molecular Signatures of Immunity and Immunogenicity in Infection and Vaccination

    PubMed Central

    Haks, Mariëlle C.; Bottazzi, Barbara; Cecchinato, Valentina; De Gregorio, Corinne; Del Giudice, Giuseppe; Kaufmann, Stefan H. E.; Lanzavecchia, Antonio; Lewis, David J. M.; Maertzdorf, Jeroen; Mantovani, Alberto; Sallusto, Federica; Sironi, Marina; Uguccioni, Mariagrazia; Ottenhoff, Tom H. M.

    2017-01-01

    Vaccinology aims to understand what factors drive vaccine-induced immunity and protection. For many vaccines, however, the mechanisms underlying immunity and protection remain incompletely characterized at best, and except for neutralizing antibodies induced by viral vaccines, few correlates of protection exist. Recent omics and systems biology big data platforms have yielded valuable insights in these areas, particularly for viral vaccines, but in the case of more complex vaccines against bacterial infectious diseases, understanding is fragmented and limited. To fill this gap, the EC supported ADITEC project (http://www.aditecproject.eu/; http://stm.sciencemag.org/content/4/128/128cm4.full) featured a work package on “Molecular signatures of immunity and immunogenicity,” aimed to identify key molecular mechanisms of innate and adaptive immunity during effector and memory stages of immune responses following vaccination. Specifically, technologies were developed to assess the human immune response to vaccination and infection at the level of the transcriptomic and proteomic response, T-cell and B-cell memory formation, cellular trafficking, and key molecular pathways of innate immunity, with emphasis on underlying mechanisms of protective immunity. This work intersected with other efforts in the ADITEC project. This review summarizes the main achievements of the work package. PMID:29204145

  16. Prime-boost bacillus Calmette-Guérin vaccination with lentivirus-vectored and DNA-based vaccines expressing antigens Ag85B and Rv3425 improves protective efficacy against Mycobacterium tuberculosis in mice.

    PubMed

    Xu, Ying; Yang, Enzhuo; Wang, Jianguang; Li, Rui; Li, Guanghua; Liu, Guoyuan; Song, Na; Huang, Qi; Kong, Cong; Wang, Honghai

    2014-10-01

    To prevent the global spread of tuberculosis (TB), more effective vaccines and vaccination strategies are urgently needed. As a result of the success of bacillus Calmette-Guérin (BCG) in protecting children against miliary and meningeal TB, the majority of individuals will have been vaccinated with BCG; hence, boosting BCG-primed immunity will probably be a key component of future vaccine strategies. In this study, we compared the ability of DNA-, protein- and lentiviral vector-based vaccines that express the antigens Ag85B and Rv3425 to boost the effects of BCG in the context of immunity and protection against Mycobacterium tuberculosis in C57BL/6 mice. Our results demonstrated that prime-boost BCG vaccination with a lentiviral vector expressing the antigens Ag85B and Rv3425 significantly enhanced immune responses, including T helper type 1 and CD8(+) cytotoxic T lymphocyte responses, compared with DNA- and protein-based vaccines. However, lentivirus-vectored and DNA-based vaccines greatly improved the protective efficacy of BCG against M. tuberculosis, as indicated by a lack of weight loss and significantly reduced bacterial loads and histological damage in the lung. Our study suggests that the use of lentiviral or DNA vaccines containing the antigens Ag85B and Rv3425 to boost BCG is a good choice for the rational design of an efficient vaccination strategy against TB. © 2014 John Wiley & Sons Ltd.

  17. Nonreplicating Influenza A Virus Vaccines Confer Broad Protection against Lethal Challenge

    PubMed Central

    Baz, Mariana; Boonnak, Kobporn; Paskel, Myeisha; Santos, Celia; Powell, Timothy; Townsend, Alain

    2015-01-01

    ABSTRACT New vaccine technologies are being investigated for their ability to elicit broadly cross-protective immunity against a range of influenza viruses. We compared the efficacies of two intranasally delivered nonreplicating influenza virus vaccines (H1 and H5 S-FLU) that are based on the suppression of the hemagglutinin signal sequence, with the corresponding H1N1 and H5N1 cold-adapted (ca) live attenuated influenza virus vaccines in mice and ferrets. Administration of two doses of H1 or H5 S-FLU vaccines protected mice and ferrets from lethal challenge with homologous, heterologous, and heterosubtypic influenza viruses, and two doses of S-FLU and ca vaccines yielded comparable effects. Importantly, when ferrets immunized with one dose of H1 S-FLU or ca vaccine were challenged with the homologous H1N1 virus, the challenge virus failed to transmit to naive ferrets by the airborne route. S-FLU technology can be rapidly applied to any emerging influenza virus, and the promising preclinical data support further evaluation in humans. PMID:26489862

  18. Novel Catanionic Surfactant Vesicle Vaccines Protect against Francisella tularensis LVS and Confer Significant Partial Protection against F. tularensis Schu S4 Strain

    PubMed Central

    Richard, Katharina; Mann, Barbara J.; Stocker, Lenea; Barry, Eileen M.; Qin, Aiping; Cole, Leah E.; Hurley, Matthew T.; Ernst, Robert K.; Michalek, Suzanne M.; Stein, Daniel C.; DeShong, Philip

    2014-01-01

    Francisella tularensis is a Gram-negative immune-evasive coccobacillus that causes tularemia in humans and animals. A safe and efficacious vaccine that is protective against multiple F. tularensis strains has yet to be developed. In this study, we tested a novel vaccine approach using artificial pathogens, synthetic nanoparticles made from catanionic surfactant vesicles that are functionalized by the incorporation of either F. tularensis type B live vaccine strain (F. tularensis LVS [LVS-V]) or F. tularensis type A Schu S4 strain (F. tularensis Schu S4 [Schu S4-V]) components. The immunization of C57BL/6 mice with “bare” vesicles, which did not express F. tularensis components, partially protected against F. tularensis LVS, presumably through activation of the innate immune response, and yet it failed to protect against the F. tularensis Schu S4 strain. In contrast, immunization with LVS-V fully protected mice against intraperitoneal (i.p.) F. tularensis LVS challenge, while immunization of mice with either LVS-V or Schu S4-V partially protected C57BL/6 mice against an intranasal (i.n.) F. tularensis Schu S4 challenge and significantly increased the mean time to death for nonsurvivors, particularly following the i.n. and heterologous (i.e., i.p./i.n.) routes of immunization. LVS-V immunization, but not immunization with empty vesicles, elicited high levels of IgG against nonlipopolysaccharide (non-LPS) epitopes that were increased after F. tularensis LVS challenge and significantly increased early cytokine production. Antisera from LVS-V-immunized mice conferred passive protection against challenge with F. tularensis LVS. Together, these data indicate that functionalized catanionic surfactant vesicles represent an important and novel tool for the development of a safe and effective F. tularensis subunit vaccine and may be applicable for use with other pathogens. PMID:24351755

  19. Adjuvant-enhanced CD4 T Cell Responses are Critical to Durable Vaccine Immunity.

    PubMed

    Martins, Karen A O; Cooper, Christopher L; Stronsky, Sabrina M; Norris, Sarah L W; Kwilas, Steven A; Steffens, Jesse T; Benko, Jacqueline G; van Tongeren, Sean A; Bavari, Sina

    2016-01-01

    Protein-based vaccines offer a safer alternative to live-attenuated or inactivated vaccines but have limited immunogenicity. The identification of adjuvants that augment immunogenicity, specifically in a manner that is durable and antigen-specific, is therefore critical for advanced development. In this study, we use the filovirus virus-like particle (VLP) as a model protein-based vaccine in order to evaluate the impact of four candidate vaccine adjuvants on enhancing long term protection from Ebola virus challenge. Adjuvants tested include poly-ICLC (Hiltonol), MPLA, CpG 2395, and alhydrogel. We compared and contrasted antibody responses, neutralizing antibody responses, effector T cell responses, and T follicular helper (Tfh) cell frequencies with each adjuvant's impact on durable protection. We demonstrate that in this system, the most effective adjuvant elicits a Th1-skewed antibody response and strong CD4 T cell responses, including an increase in Tfh frequency. Using immune-deficient animals and adoptive transfer of serum and cells from vaccinated animals into naïve animals, we further demonstrate that serum and CD4 T cells play a critical role in conferring protection within effective vaccination regimens. These studies inform on the requirements of long term immune protection, which can potentially be used to guide screening of clinical-grade adjuvants for vaccine clinical development.

  20. Anti-pathogen protection versus survival costs mediated by an ectosymbiont in an ant host

    PubMed Central

    Konrad, Matthias; Grasse, Anna V.; Tragust, Simon; Cremer, Sylvia

    2015-01-01

    The fitness effects of symbionts on their hosts can be context-dependent, with usually benign symbionts causing detrimental effects when their hosts are stressed, or typically parasitic symbionts providing protection towards their hosts (e.g. against pathogen infection). Here, we studied the novel association between the invasive garden ant Lasius neglectus and its fungal ectosymbiont Laboulbenia formicarum for potential costs and benefits. We tested ants with different Laboulbenia levels for their survival and immunity under resource limitation and exposure to the obligate killing entomopathogen Metarhizium brunneum. While survival of L. neglectus workers under starvation was significantly decreased with increasing Laboulbenia levels, host survival under Metarhizium exposure increased with higher levels of the ectosymbiont, suggesting a symbiont-mediated anti-pathogen protection, which seems to be driven mechanistically by both improved sanitary behaviours and an upregulated immune system. Ants with high Laboulbenia levels showed significantly longer self-grooming and elevated expression of immune genes relevant for wound repair and antifungal responses (β-1,3-glucan binding protein, Prophenoloxidase), compared with ants carrying low Laboulbenia levels. This suggests that the ectosymbiont Laboulbenia formicarum weakens its ant host by either direct resource exploitation or the costs of an upregulated behavioural and immunological response, which, however, provides a prophylactic protection upon later exposure to pathogens. PMID:25473011

  1. Virus-Like Particles Displaying Trimeric Simian Immunodeficiency Virus (SIV) Envelope gp160 Enhance the Breadth of DNA/Modified Vaccinia Virus Ankara SIV Vaccine-Induced Antibody Responses in Rhesus Macaques.

    PubMed

    Iyer, Smita S; Gangadhara, Sailaja; Victor, Blandine; Shen, Xiaoying; Chen, Xuemin; Nabi, Rafiq; Kasturi, Sudhir P; Sabula, Michael J; Labranche, Celia C; Reddy, Pradeep B J; Tomaras, Georgia D; Montefiori, David C; Moss, Bernard; Spearman, Paul; Pulendran, Bali; Kozlowski, Pamela A; Amara, Rama Rao

    2016-10-01

    The encouraging results of the RV144 vaccine trial have spurred interest in poxvirus prime-protein boost human immunodeficiency virus (HIV) vaccine modalities as a strategy to induce protective immunity. Because vaccine-induced protective immunity is critically determined by HIV envelope (Env) conformation, significant efforts are directed toward generating soluble trimeric Env immunogens that assume native structures. Using the simian immunodeficiency virus (SIV)-macaque model, we tested the immunogenicity and efficacy of sequential immunizations with DNA (D), modified vaccinia virus Ankara (MVA) (M), and protein immunogens, all expressing virus-like particles (VLPs) displaying membrane-anchored trimeric Env. A single VLP protein boost displaying trimeric gp160 adjuvanted with nanoparticle-encapsulated Toll-like receptor 4/7/8 (TLR4/7/8) agonists, administered 44 weeks after the second MVA immunization, induced up to a 3-fold increase in Env-specific IgG binding titers in serum and mucosa. Importantly, the VLP protein boost increased binding antibody against scaffolded V1V2, antibody-dependent phagocytic activity against VLP-coated beads, and antibody breadth and neutralizing antibody titers against homologous and heterologous tier 1 SIVs. Following 5 weekly intrarectal SIVmac251 challenges, two of seven DNA/MVA and VLP (DM+VLP)-vaccinated animals were completely protected compared to productive infection in all seven DM-vaccinated animals. Vaccinated animals demonstrated stronger acute viral pulldown than controls, but a trend for higher acute viremia was observed in the DM+VLP group, likely due to a slower recall of Gag-specific CD8 T cells. Our findings support immunization with VLPs containing trimeric Env as a strategy to augment protective antibody but underscore the need for optimal engagement of CD8 T cells to achieve robust early viral control. The development of an effective HIV vaccine remains a global necessity for preventing HIV infection and reducing the burden of AIDS. While this goal represents a formidable challenge, the modest efficacy of the RV144 trial indicates that multicomponent vaccination regimens that elicit both cellular and humoral immune responses can prevent HIV infection in humans. However, whether protein immunizations synergize with DNA prime-viral vector boosts to enhance cellular and humoral immune responses remains poorly understood. We addressed this question in a nonhuman primate model, and our findings show benefit for sequential protein immunization combined with a potent adjuvant in boosting antibody titers induced by a preceding DNA/MVA immunization. This promising strategy can be further developed to enhance neutralizing antibody responses and boost CD8 T cells to provide robust protection and viral control. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Protective effect of intranasal immunization with Neospora caninum membrane antigens against murine neosporosis established through the gastrointestinal tract

    PubMed Central

    Ferreirinha, Pedro; Dias, Joana; Correia, Alexandra; Pérez-Cabezas, Begoña; Santos, Carlos; Teixeira, Luzia; Ribeiro, Adília; Rocha, António; Vilanova, Manuel

    2014-01-01

    Neospora caninum is an Apicomplexa parasite that in the last two decades was acknowledged as the main pathogenic agent responsible for economic losses in the cattle industry. In the present study, the effectiveness of intranasal immunization with N. caninum membrane antigens plus CpG adjuvant was assessed in a murine model of intragastrically established neosporosis. Immunized mice presented a lower parasitic burden in the brain on infection with 5 × 107 tachyzoites, showing that significant protection was achieved by this immunization strategy. Intestinal IgA antibodies raised by immunization markedly agglutinated live N. caninum tachyzoites whereas previous opsonization with IgG antibodies purified from immunized mice sera reduced parasite survival within macrophage cells. Although an IgG1 : IgG2a ratio < 1 was detected in the immunized mice before and after infection, indicative of a predominant T helper type 1 immune response, no increased production of interferon-γ was detected in the spleen or mesenteric lymph nodes of the immunized mice. Altogether, these results show that mucosal immunization with N. caninum membrane proteins plus CpG adjuvant protect against intragastrically established neosporosis and indicate that parasite-specific mucosal and circulating antibodies have a protective role against this parasitic infection. PMID:24128071

  3. Surface protein Adr2 of Rickettsia rickettsii induced protective immunity against Rocky Mountain spotted fever in C3H/HeN mice.

    PubMed

    Gong, Wenping; Xiong, Xiaolu; Qi, Yong; Jiao, Jun; Duan, Changsong; Wen, Bohai

    2014-04-11

    Rickettsia rickettsii is the pathogen of Rocky Mountain spotted fever (RMSF), a life-threatening tick-transmitted infection. Adr2 was a surface-exposed adhesion protein of R. rickettsii and its immunoprotection against RMSF was investigated in mice. Recombinant Adr2 (rAdr2) was used to immunize C3H/HeN mice, and the rickettsial loads in organs of the mice were detected after challenge with R. rickettsii. The levels of specific antibodies of sera from the immunized mice were determined and the sera from immunized mice were applied to neutralize R. rickettsii. Proliferation and cytokine secretion of CD4(+) and CD8(+) T cells isolated from R. rickettsii-infected mice were also assayed after rAdr2 stimulation. After R. rickettsii challenge, the rickettsial loads in spleens, livers, and lungs were significantly lower and the impairment degrees of these organs in rAdr2-immunized mice were markedly slighter, compared with those in negative control mice. The ratio of specific IgG2a/IgG1 of rAdr2-immunized mice kept increasing during the immunization. After treatment with rAdr2-immunized sera, the total number of R. rickettsii organisms adhering and invading host cells was significantly lower than that treated with PBS-immunized sera. Interferon-γ secretion by CD4(+) or CD8(+) T cells and tumor necrosis factor-α secretion by CD4(+) T cells from R. rickettsii-infected mice were respectively significantly greater than those from uninfected mice after rAdr2 stimulation. Adr2 is a protective antigen of R. rickettsii. Protection offered by Adr2 is mainly dependent on antigen-specific cell-mediated immune responses, including efficient activity of CD4(+) and CD8(+) T cells to produce great amount of TNF-α and/or IFN-γ as well as rapid increase of specific IgG2a, which synergistically activate and opsonize host cells to killing intracellular rickettsiae. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. A Bivalent Typhoid Live Vector Vaccine Expressing both Chromosome- and Plasmid-Encoded Yersinia pestis Antigens Fully Protects against Murine Lethal Pulmonary Plague Infection

    PubMed Central

    Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.

    2014-01-01

    Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120

  5. Correlative Gene Expression to Protective Seroconversion in Rift Valley Fever Vaccinates.

    PubMed

    Laughlin, Richard C; Drake, Kenneth L; Morrill, John C; Adams, L Garry

    2016-01-01

    Rift Valley fever Virus (RVFV), a negative-stranded RNA virus, is the etiological agent of the vector-borne zoonotic disease, Rift Valley fever (RVF). In both humans and livestock, protective immunity can be achieved through vaccination. Earlier and more recent vaccine trials in cattle and sheep demonstrated a strong neutralizing antibody and total IgG response induced by the RVF vaccine, authentic recombinant MP-12 (arMP-12). From previous work, protective immunity in sheep and cattle vaccinates normally occurs from 7 to 21 days after inoculation with arMP-12. While the serology and protective response induced by arMP-12 has been studied, little attention has been paid to the underlying molecular and genetic events occurring prior to the serologic immune response. To address this, we isolated RNA from whole blood of vaccinated calves over a time course of 21 days before and after vaccination with arMP-12. The time course RNAs were sequenced by RNASeq and bioinformatically analyzed. Our results revealed time-dependent activation or repression of numerous gene ontologies and pathways related to the vaccine induced immune response and its regulation. Additional bioinformatic analyses identified a correlative relationship between specific host immune response genes and protective immunity prior to the detection of protective serum neutralizing antibody responses. These results contribute an important proof of concept for identifying molecular and genetic components underlying the immune response to RVF vaccination and protection prior to serologic detection.

  6. Group 2 ILCs: A way of enhancing immune protection against human helminths?

    PubMed

    Nausch, N; Mutapi, F

    2018-02-01

    Group 2 innate lymphoid cells (ILC2s) play crucial roles in type 2 immune responses associated with allergic and autoimmune diseases, viral and helminth infections and tissue homoeostasis. Experimental models show that in helminth infections ILC2s provide an early source of type 2 cytokines and therefore are essential for the induction of potentially protective type 2 responses. Much of our knowledge of ILC2s in helminth infections has come from experimental mouse models with very few studies analysing ILC2s in natural human infections. In attempts to harness knowledge from paradigms of the development of protective immunity in human helminth infections for vaccine development, the role of ILC2 cells could be pivotal. So far, potential vaccines against human helminth infections have failed to provide effective protection when evaluated in human studies. In addition to appropriate antigen selection, it is apparent that more detailed knowledge on mechanisms of induction and maintenance of protective immune responses is required. Therefore, there is need to understand how ILC2 cells induce type 2 responses and subsequently support the development of a protective immune response in the context of immunizations. Within this review, we summarize the current knowledge of the biology of ILC2s, discuss the importance of ILC2s in human helminth infections and explore how ILC2 responses could be boosted to efficiently induce protective immunity. © 2017 The Authors. Parasite Immunology Published by John Wiley & Sons Ltd.

  7. Preliminary comparison of different immune and production components in local and imported Saanen goats reared under a sub-tropical environment.

    PubMed

    Barbour, Elie K; Itani, Houssam H; Sleiman, Fawwak T; Saade, Maya F; Harakeh, Steve; Nour, Afif M Abdel; Shaib, Houssam A

    2012-01-01

    Three objectives were included in this research work. The first objective compared different immune components in healthy mature males, mature females, and female kids of local and imported Saanen goats, reared under a sub-tropical environment. The significantly differing immune components were the blood monocyte percent, blood CD8 count, and the total white blood cell count. The second objective compared the performance of Saanen versus local does. The means of the milk yield and prolificacy of the imported Saanen does were significantly higher than those of the local does (p<0.05). The third objective compared the immune responses (hemagglutination-HA titers) and complement fixation (CF) titers in mature does of the two breeds to chicken red blood cells (c-RBC). The HA titers showed a significant seroconversion only in imported Saanen (p<0.05) but not in local does; however, the CF titers increased significantly at 4 weeks following priming with c-RBC in local (p<0.05) but not in the imported Saanen does. The impact of the differences in blood immune components and responses to antigens in the compared goats on protection potential against prevalent diseases in the sub-tropical zone of the eastern Mediterranean countries is discussed.

  8. Passive immunization with Pneumovax® 23 and pneumolysin in combination with vancomycin for pneumococcal endophthalmitis.

    PubMed

    Sanders, Melissa E; Taylor, Sidney; Tullos, Nathan; Norcross, Erin W; Moore, Quincy C; Thompson, Hilary; King, Lauren B; Marquart, Mary E

    2013-03-11

    Capsule and pneumolysin (PLY) are two major virulence factors of Streptococcus pneumoniae. S. pneumoniae is one of the leading causes of bacterial endophthalmitis. The aim of this study is to determine whether passive immunization with the 23-valent pneumococcal polysaccharide vaccine (Pneumovax® 23; PPSV23) or PLY protects against pneumococcal endophthalmitis. New Zealand white rabbits were passively immunized with antiserum to PLY, PPSV23, a mixture of PPSV23/PLY, or PBS (mock). Vitreous was infected with a clinical strain of S. pneumoniae. In a separate group of experiments, vancomycin was injected 4 hours post-infection (PI) for each passively immunized group. Severity of infection, bacterial recovery, myeloperoxidase (MPO) activity and percent loss of retinal function were determined. Passive immunization with each antiserum significantly lowered clinical severity compared to mock immunization (PPSV23 = 9.19, PPSV23/PLY = 10.45, PLY = 8.71, Mock = 16.83; P = 0.0467). A significantly higher bacterial load was recovered from the vitreous of PLY passively immunized rabbits 24 hours PI (7.87 log10 CFU) compared to controls (7.10 log10 CFU; P = 0.0134). Retinas from immunized rabbits were more intact. Vitreous of PLY (2.88 MPO untis/mL) and PPSV23/PLY (2.17) passively immunized rabbits had less MPO activity compared to controls (5.64; P = 0.0480), and both passive immunizations (PLY = 31.34% loss of retinal function, PPSV23/PLY = 27.44%) helped to significantly preserve retinal function compared to controls (64.58%; P = 0.0323). When vancomycin was administered 4 hours PI, all eyes were sterile at 24 hours PI. A significantly lower clinical severity was observed for rabbits administered the combination immunization (5.29) or PPSV23 (5.29) with vancomycin treatment compared to controls (17.68; P = 0.0469). Passive immunization with antisera to these antigens is effective in reducing clinical severity of pneumococcal endophthalmitis in rabbits. Addition of vancomycin to immunization is effective at eliminating the bacteria.

  9. Infection of mice with a human influenza A/H3N2 virus induces protective immunity against lethal infection with influenza A/H5N1 virus.

    PubMed

    Kreijtz, J H C M; Bodewes, R; van den Brand, J M A; de Mutsert, G; Baas, C; van Amerongen, G; Fouchier, R A M; Osterhaus, A D M E; Rimmelzwaan, G F

    2009-08-06

    The transmission of highly pathogenic avian influenza (HPAI) A viruses of the H5N1 subtype from poultry to man and the high case fatality rate fuels the fear for a pandemic outbreak caused by these viruses. However, prior infections with seasonal influenza A/H1N1 and A/H3N2 viruses induce heterosubtypic immunity that could afford a certain degree of protection against infection with the HPAI A/H5N1 viruses, which are distantly related to the human influenza A viruses. To assess the protective efficacy of such heterosubtypic immunity mice were infected with human influenza virus A/Hong Kong/2/68 (H3N2) 4 weeks prior to a lethal infection with HPAI virus A/Indonesia/5/05 (H5N1). Prior infection with influenza virus A/Hong Kong/2/68 reduced clinical signs, body weight loss, mortality and virus replication in the lungs as compared to naive mice infected with HPAI virus A/Indonesia/5/05. Priming by infection with respiratory syncytial virus, a non-related virus did not have a beneficial effect on the outcome of A/H5N1 infections, indicating that adaptive immune responses were responsible for the protective effect. In mice primed by infection with influenza A/H3N2 virus cytotoxic T lymphocytes (CTL) specific for NP(366-374) epitope ASNENMDAM and PA(224-232) SCLENFRAYV were observed. A small proportion of these CTL was cross-reactive with the peptide variant derived from the influenza A/H5N1 virus (ASNENMEVM and SSLENFRAYV respectively) and upon challenge infection with the influenza A/H5N1 virus cross-reactive CTL were selectively expanded. These CTL, in addition to those directed to conserved epitopes, shared by the influenza A/H3N2 and A/H5N1 viruses, most likely contributed to accelerated clearance of the influenza A/H5N1 virus infection. Although also other arms of the adaptive immune response may contribute to heterosubtypic immunity, the induction of virus-specific CTL may be an attractive target for development of broad protective vaccines. Furthermore the existence of pre-existing heterosubtypic immunity may dampen the impact a future influenza pandemic may have.

  10. Beyond empiricism: informing vaccine development through innate immunity research.

    PubMed

    Levitz, Stuart M; Golenbock, Douglas T

    2012-03-16

    Although a great public heath success, vaccines provide suboptimal protection in some patient populations and are not available to protect against many infectious diseases. Insights from innate immunity research have led to a better understanding of how existing vaccines work and have informed vaccine development. New adjuvants and delivery systems are being designed based upon their capacity to stimulate innate immune sensors and target antigens to dendritic cells, the cells responsible for initiating adaptive immune responses. Incorporating these adjuvants and delivery systems in vaccines can beneficially alter the quantitative and qualitative nature of the adaptive immune response, resulting in enhanced protection. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Beyond empiricism: Informing vaccine development through innate immunity research

    PubMed Central

    Levitz, Stuart M.; Golenbock, Douglas T.

    2012-01-01

    Summary While a great public heath success, vaccines provide suboptimal protection in some patient populations and are not available to protect against many infectious diseases. Insights from innate immunity research have led to a better understanding of how existing vaccines work and informed vaccine development. New adjuvants and delivery systems are being designed based upon their capacity to stimulate innate immune sensors and target antigens to dendritic cells, the cells responsible for initiating adaptive immune responses. Incorporating these adjuvants and delivery systems in vaccines can beneficially alter the quantitative and qualitative nature of the adaptive immune response resulting in enhanced protection. PMID:22424235

  12. Prolonged protection against Intranasal challenge with influenza virus following systemic immunization or combinations of mucosal and systemic immunizations with a heat-labile toxin mutant.

    PubMed

    Zhou, Fengmin; Goodsell, Amanda; Uematsu, Yasushi; Vajdy, Michael

    2009-04-01

    Seasonal influenza virus infections cause considerable morbidity and mortality in the world, and there is a serious threat of a pandemic influenza with the potential to cause millions of deaths. Therefore, practical influenza vaccines and vaccination strategies that can confer protection against intranasal infection with influenza viruses are needed. In this study, we demonstrate that using LTK63, a nontoxic mutant of the heat-labile toxin from Escherichia coli, as an adjuvant for both mucosal and systemic immunizations, systemic (intramuscular) immunization or combinations of mucosal (intranasal) and intramuscular immunizations protected mice against intranasal challenge with a lethal dose of live influenza virus at 3.5 months after the second immunization.

  13. Vaccination with plasmid DNA encoding TSA/LmSTI1 leishmanial fusion proteins confers protection against Leishmania major infection in susceptible BALB/c mice.

    PubMed

    Campos-Neto, A; Webb, J R; Greeson, K; Coler, R N; Skeiky, Y A W; Reed, S G

    2002-06-01

    We have recently shown that a cocktail containing two leishmanial recombinant antigens (LmSTI1 and TSA) and interleukin-12 (IL-12) as an adjuvant induces solid protection in both a murine and a nonhuman primate model of cutaneous leishmaniasis. However, because IL-12 is difficult to prepare, is expensive, and does not have the stability required for a vaccine product, we have investigated the possibility of using DNA as an alternative means of inducing protective immunity. Here, we present evidence that the antigens TSA and LmSTI1 delivered in a plasmid DNA format either as single genes or in a tandem digene construct induce equally solid protection against Leishmania major infection in susceptible BALB/c mice. Immunization of mice with either TSA DNA or LmSTI1 DNA induced specific CD4(+)-T-cell responses of the Th1 phenotype without a requirement for specific adjuvant. CD8 responses, as measured by cytotoxic-T-lymphocyte activity, were generated after immunization with TSA DNA but not LmSTI1 DNA. Interestingly, vaccination of mice with TSA DNA consistently induced protection to a much greater extent than LmSTI1 DNA, thus supporting the notion that CD8 responses might be an important accessory arm of the immune response for acquired resistance against leishmaniasis. Moreover, the protection induced by DNA immunization was specific for infection with Leishmania, i.e., the immunization had no effect on the course of infection of the mice challenged with an unrelated intracellular pathogen such as Mycobacterium tuberculosis. Conversely, immunization of BALB/c mice with a plasmid DNA that is protective against challenge with M. tuberculosis had no effect on the course of infection of these mice with L. major. Together, these results indicate that the protection observed with the leishmanial DNA is mediated by acquired specific immune response rather than by the activation of nonspecific innate immune mechanisms. In addition, a plasmid DNA containing a fusion construct of the two genes was also tested. Similarly to the plasmids encoding individual proteins, the fusion construct induced both specific immune responses to the individual antigens and protection against challenge with L. major. These results confirm previous observations about the possibility of DNA immunization against leishmaniasis and lend support to the idea of using a single polygenic plasmid DNA construct to achieve polyspecific immune responses to several distinct parasite antigens.

  14. Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges.

    PubMed

    Cooper, Dustin; Eleftherianos, Ioannis

    2017-01-01

    The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a "loitering" innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

  15. Cancer immunoediting by the innate immune system in the absence of adaptive immunity

    PubMed Central

    O’Sullivan, Timothy; Saddawi-Konefka, Robert; Vermi, William; Koebel, Catherine M.; Arthur, Cora; White, J. Michael; Uppaluri, Ravi; Andrews, Daniel M.; Ngiow, Shin Foong; Teng, Michele W.L.; Smyth, Mark J.; Schreiber, Robert D.

    2012-01-01

    Cancer immunoediting is the process whereby immune cells protect against cancer formation by sculpting the immunogenicity of developing tumors. Although the full process depends on innate and adaptive immunity, it remains unclear whether innate immunity alone is capable of immunoediting. To determine whether the innate immune system can edit tumor cells in the absence of adaptive immunity, we compared the incidence and immunogenicity of 3′methylcholanthrene-induced sarcomas in syngeneic wild-type, RAG2−/−, and RAG2−/−x γc−/− mice. We found that innate immune cells could manifest cancer immunoediting activity in the absence of adaptive immunity. This activity required natural killer (NK) cells and interferon γ (IFN-γ), which mediated the induction of M1 macrophages. M1 macrophages could be elicited by administration of CD40 agonists, thereby restoring editing activity in RAG2−/−x γc−/− mice. Our results suggest that in the absence of adaptive immunity, NK cell production of IFN-γ induces M1 macrophages, which act as important effectors during cancer immunoediting. PMID:22927549

  16. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    PubMed

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (p<0.05). IFN-γ/ Interleukin (IL)-4 and IgG2a/IgG1 ratios demonstrated the highest IFN-γ and IgG2a levels in the group receiving LACK-TSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (p<0.05). In addition, there was a significant reduction in mean lesion size of LACK-TSA and TSA groups than LACK group after challenge (p<0.05). In the present study, DNA immunization promoted Th1 immune response and confirmed the previous observations on immunogenicity of LACK and TSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  17. Broadly protective anti-hemagglutinin stalk antibodies induced by live attenuated influenza vaccine expressing chimeric hemagglutinin.

    PubMed

    Isakova-Sivak, Irina; Korenkov, Daniil; Smolonogina, Tatiana; Kotomina, Tatiana; Donina, Svetlana; Matyushenko, Victoria; Mezhenskaya, Daria; Krammer, Florian; Rudenko, Larisa

    2018-05-01

    The development of influenza vaccines that can provide broad protection against all drifted seasonal virus variants, zoonotic infections and emerging pandemic strains, has been a priority for two decades. Here we propose a strategy of inducing broadly-reactive anti-stalk antibody by sequential immunizations with live attenuated influenza vaccines (LAIVs) expressing chimeric HAs (cHAs). These vaccines are designed to contain identical hemagglutinin stalk domains from H1N1 virus but antigenically unrelated globular head domains from avian influenza virus subtypes H5, H8 and H9. Mouse experiments demonstrated enhanced cross-protection of cHA-containing LAIVs compared to the relevant vaccine viruses expressing natural HAs, and this enhanced protection was driven by stalk-HA-reactive IgG antibodies. The establishment of fully functional cross-protective immunity after two doses of cHA LAIV vaccination in naïve animals suggests that a similar effect might be expected after a single cHA LAIV dose in primed individuals, or after two to three doses in naïve children. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. A Population Profile of Measles Susceptibility in Tianjin, China

    PubMed Central

    Boulton, Matthew L.; Wang, Xiexiu; Zhang, Ying; Montgomery, JoLynn P.; Wagner, Abram L.; Carlson, Bradley F.; Ding, Yaxing; Li, Xiaoyan; Gillespie, Brenda; Su, Xu

    2016-01-01

    Background Measles is a highly infectious illness requiring herd immunity of 95% to interrupt transmission. Measles is targeted for elimination in China, which has not reached elimination goals despite high vaccination coverage. We developed a population profile of measles immunity among residents aged 0 through 49 years in Tianjin, China. Methods Participants were either from community population registers or community immunization records. Measles IgG antibody status was assessed using dried blood spots. We examined the association between measles IgG antibody status and independent variables including urbanicity, sex, vaccination, measles history, and age. Results 2,818 people were enrolled. The proportion measles IgG negative increased from 50.7% for infants aged 1 month to 98.3% for those aged 7 months. After 8 months, the age of vaccination eligibility, the proportion of infants and children measles IgG negative decreased. Overall, 7.8% of participants 9 months of age or older lacked measles immunity including over 10% of those 20–39 years. Age and vaccination status were significantly associated with measles IgG status in the multivariable model. The odds of positive IgG status were 0.337 times as high for unvaccinated compared to vaccinated (95% CI: 0.217, 0.524). Conclusions The proportion of persons in Tianjin, China immune to measles was lower than herd immunity threshold with less than 90% of people aged 20–39 years demonstrating protection. Immunization programs in Tianjin have been successful in vaccinating younger age groups although high immunization coverage in infants and children alone won’t provide protective herd immunity, given the large proportion of non-immune adults. PMID:27151881

  19. Vaccination with Recombinant Non-transmembrane Domain of Protein Mannosyltransferase 4 Improves Survival during Murine Disseminated Candidiasis.

    PubMed

    Wang, Li; Yan, Lan; Li, Xing Xing; Xu, Guo Tong; An, Mao Mao; Jiang, Yuan Ying

    2015-01-01

    Candida albicans is the most common cause of invasive fungal infections in humans. The C. albicans cell wall proteins play an important role in crucial host-fungus interactions and might be ideal vaccine targets to induce protective immune response in host. Meanwhile, protein that is specific to C. albicans is also an ideal target of vaccine. In this study, 11 proteins involving cell wall biosynthesis, yeast-to-hypha formation, or specific to C. albicans were chosen and were successfully cloned, purified and verified. The immune protection of vaccination with each recombinant protein respectively in preventing systemic candidiasis in BALB/c mice was assessed. The injection of rPmt4p vaccination significantly increased survival rate, decreased fungal burdens in the heart, liver, brain, and kidneys, and increased serum levels of both immunoglobulin G (IgG) and IgM against rPmt4p in the immunized mice. Histopathological assessment demonstrated that rPmt4p vaccination protected the tissue structure, and decreased the infiltration of inflammatory cells. Passive transfer of the rPmt4p immunized serum increased survival rate against murine systemic candidiasis and significantly reduced organ fungal burden. The immune serum enhanced mouse neutrophil killing activity by directly neutralizing rPmt4p effects in vitro. Levels of interleukin (IL)-4, IL-10, IL-12p70, IL-17A and tumor necrosis factor (TNF)-α in serum were higher in the immunized mice compared to those in the adjuvant control group. In conclusion, our results suggested that rPmt4p vaccination may be considered as a potential vaccine candidate against systemic candidiasis.

  20. Vaccination with a DNA vaccine encoding Toxoplasma gondii ROP54 induces protective immunity against toxoplasmosis in mice.

    PubMed

    Yang, Wen-Bin; Zhou, Dong-Hui; Zou, Yang; Chen, Kai; Liu, Qing; Wang, Jin-Lei; Zhu, Xing-Quan; Zhao, Guang-Hui

    2017-12-01

    Toxoplasma gondii is an obligatory intracellular protozoan, which infects most of the warm-blooded animals, causing serious public health problems and enormous economic losses worldwide. The rhoptry effector protein 54 (ROP54) has been indicated as a virulence factor that promotes Toxoplasma infection by modulating GBP2 loading onto parasite-containing vacuoles, which can modulate some aspects of the host immune response. In order to evaluate the immuno-protective value of ROP54, we constructed a eukaryotic recombinant plasmid expressing T. gondii ROP54 and intramuscularly immunized Kunming mice with this recombinant plasmid against acute and chronic toxoplasmosis. All mice immunized with pVAX-ROP54 elicited a high level of specific antibody responses, a significant increase of lymphocyte proliferation, and a significant level of Th1-type cytokines (IFN-γ, IL-2 and IL-12p70), in addition to an increased production of Th2-type cytokines (IL-4 and IL-10). These results demonstrated that pVAX-ROP54 induced significant cellular and humoral (Th1/Th2) immune responses, which extended the survival time (13.0±1.15days for pVAX-ROP54 vs 6.7±0.48days for pVAX I, 6.8±0.42days for PBS and 6.5±0.53 for blank control) and significantly reduced cyst burden (35.9% for pVAX-ROP54, 1% for pVAX I and 2% for PBS, compared with blank control) of immunized mice. These results indicate that the recombinant ROP54 plasmid can provide partial protection and might be a potential vaccine candidate against acute and chronic toxoplasmosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Streptococcus pneumoniae fructose-1,6-bisphosphate aldolase, a protein vaccine candidate, elicits Th1/Th2/Th17-type cytokine responses in mice.

    PubMed

    Elhaik Goldman, Shirin; Dotan, Shahar; Talias, Amir; Lilo, Amit; Azriel, Shalhevet; Malka, Itay; Portnoi, Maxim; Ohayon, Ariel; Kafka, Daniel; Ellis, Ronald; Elkabets, Moshe; Porgador, Angel; Levin, Ditza; Azhari, Rosa; Swiatlo, Edwin; Ling, Eduard; Feldman, Galia; Tal, Michael; Dagan, Ron; Mizrachi Nebenzahl, Yaffa

    2016-04-01

    Streptococcus pneumoniae (S. pneumoniae) is a major pathogen worldwide. The currently available polysaccharide-based vaccines significantly reduce morbidity and mortality. However, the inherent disadvantages of the currently available polysaccharide-based vaccines have motivated the search for other bacterial immunogens capable of eliciting a protective immune response against S. pneumoniae. Fructose-1,6-bisphosphate aldolase (FBA) is a glycolytic enzyme, which was found to localize to the bacterial surface, where it functions as an adhesin. Previously, immunizing mice with recombinant FBA (rFBA) in the presence of alum elicited a protective immune response against a lethal challenge with S. pneumoniae. Thus, the aim of the present study was to determine the cytokine responses that are indicative of protective immunity following immunization with rFBA. The protective effects against pneumococcal challenge in mice immunized with rFBA with complete Freund's adjuvant (CFA) in the initial immunization and with incomplete Freund's adjuvant (IFA) in booster immunizations surpassed the protective effects observed following immunization with either rFBA + alum or pVACfba. CD4+ T-cells obtained from the rFBA/CFA/IFA/IFA-immunized mice co-cultured with rFBA-pulsed antigen-presenting cells (APCs), exhibited a significantly greater proliferative ability than CD4+ T-cells obtained from the adjuvant-immunized mice co-cultured with rFBA‑pulsed APCs. The levels of the Th1-type cytokines, interferon (IFN)-γ, interleukin (IL)-2, tumor necrosis factor (TNF)-α and IL-12, the Th2-type cytokines, IL-4, IL-5 and IL-10, and the Th17-type cytokine, IL-17A, significantly increased within 72 h of the initiation of co-culture with CD4+ T-cells obtained from the rFBA‑immunized mice, in comparison with the co-cultures with CD4+ T-cells obtained from the adjuvant-immunized mice. Immunizing mice with rFBA resulted in an IgG1/IgG2 ratio of 41, indicating a Th2 response with substantial Th1 involvement. In addition, rabbit and mouse anti-rFBA antisera significantly protected the mice against a lethal S. pneumoniae challenge in comparison with preimmune sera. Our results emphasize the mixed involvement of the Th1, Th2 and Th17 arms of the immune system in response to immunization with pneumococcal rFBA, a potential vaccine candidate.

  2. Potentiation by a novel alkaloid glycoside adjuvant of a protective cytotoxic T cell immune response specific for a preerythrocytic malaria vaccine candidate antigen.

    PubMed

    Heal, K G; Sheikh, N A; Hollingdale, M R; Morrow, W J; Taylor-Robinson, A W

    2001-07-20

    We have recently demonstrated that the novel glycoalkaloid tomatine, derived from leaves of the wild tomato Lycopersicon pimpinellifolium, can act as a powerful adjuvant for the elicitation of antigen-specific CD8+ T cell responses. Here, we have extended our previous investigation with the model antigen ovalbumin to an established malaria infection system in mice and evaluated the cellular immune response to a major preerythrocytic stage malaria vaccine candidate antigen when administered with tomatine. The defined MHC H-2kd class I-binding 9-mer peptide (amino acids 252-260) from Plasmodium berghei circumsporozoite (CS) protein was prepared with tomatine to form a molecular aggregate formulation and this used to immunise BALB/c (H-2kd) mice. Antigen-specific IFN-gamma secretion and cytotoxic T lymphocyte activity in vitro were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunised control mice. Moreover, when challenged with P. berghei sporozoites, mice immunised with the CS 9-mer-tomatine preparation had a significantly delayed onset of erythrocytic infection compared to controls. The data presented validate the use of tomatine to potentiate a cellular immune response to antigenic stimulus by testing in an important biologically relevant system. Specifically, the processing of the P. berghei CS 9-mer as an exogenous antigen and its presentation via MHC class I molecules to CD8+ T cells led to an immune response that is an in vitro correlate of protection against preerythrocytic malaria. This was confirmed by the protective capacity of the 9-mer-tomatine combination upon in vivo immunisation. These findings merit further work to optimise the use of tomatine as an adjuvant in malaria vaccine development.

  3. Regulatory T cells protect mice against coxsackievirus-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway.

    PubMed

    Shi, Yu; Fukuoka, Masahiro; Li, Guohua; Liu, Youan; Chen, Manyin; Konviser, Michael; Chen, Xin; Opavsky, Mary Anne; Liu, Peter P

    2010-06-22

    Coxsackievirus B3 infection is an excellent model of human myocarditis and dilated cardiomyopathy. Cardiac injury is caused either by a direct cytopathic effect of the virus or through immune-mediated mechanisms. Regulatory T cells (Tregs) play an important role in the negative modulation of host immune responses and set the threshold of autoimmune activation. This study was designed to test the protective effects of Tregs and to determine the underlying mechanisms. Carboxyfluorescein diacetate succinimidyl ester-labeled Tregs or naïve CD4(+) T cells were injected intravenously once every 2 weeks 3 times into mice. The mice were then challenged with intraperitoneal coxsackievirus B3 immediately after the last cell transfer. Transfer of Tregs showed higher survival rates than transfer of CD4(+) T cells (P=0.0136) but not compared with the PBS injection group (P=0.0589). Interestingly, Tregs also significantly decreased virus titers and inflammatory scores in the heart. Transforming growth factor-beta and phosphorylated AKT were upregulated in Tregs-transferred mice and coxsackie-adenovirus receptor expression was decreased in the heart compared with control groups. Transforming growth factor-beta decreased coxsackie-adenovirus receptor expression and inhibited coxsackievirus B3 infection in HL-1 cells and neonatal cardiac myocytes. Splenocytes collected from Treg-, CD4(+) T-cell-, and PBS-treated mice proliferated equally when stimulated with heat-inactivated virus, whereas in the Treg group, the proliferation rate was reduced significantly when stimulated with noninfected heart tissue homogenate. Adoptive transfer of Tregs protected mice from coxsackievirus B3-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway and thus suppresses the immune response to cardiac tissue, maintaining the antiviral immune response.

  4. Immunogenicity and protective efficacy of a Salmonella Enteritidis sptP mutant as a live attenuated vaccine candidate.

    PubMed

    Lin, Zhijie; Tang, Peipei; Jiao, Yang; Kang, Xilong; Li, Qiuchun; Xu, Xiulong; Sun, Jun; Pan, Zhiming; Jiao, Xinan

    2017-06-24

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is a highly adaptive pathogen in both humans and animals. As a Salmonella Type III secretion system (T3SS) effector, Salmonella protein tyrosine phosphatase (SptP) is critical for virulence in this genus. To investigate the feasibility of using C50336ΔsptP as a live attenuated oral vaccine in mice, we generated the sptP gene deletion mutant C50336ΔsptP in S. Enteritidis strain C50336 by λ-Red mediated recombination and evaluated the protective ability of the S. Enteritidis sptP mutant strain C50336ΔsptP against mice salmonellosis. We found that C50336ΔsptP was a highly immunogenic, effective, and safe vaccine in mice. Compared to wild-type C50336, C50336ΔsptP showed reduced virulence as confirmed by the 50% lethal dose (LD 50 ) in orally infected mice. C50336ΔsptP also showed decreased bacterial colonization both in vivo and in vitro. Immunization with C50336ΔsptP had no significant effect on body weight and did not result in obvious clinical symptoms relative to control animals treated with phosphate-buffered saline (PBS), but induced humoral and cellular immune responses at 12 and 26 days post inoculation. Immunization with 1 × 10 8 colony-forming units (CFU) C50336ΔsptP per mouse provided 100% protection against subsequent challenge with the wild-type C50336 strain, and immunized mice showed mild and temporary clinical symptoms as compared to those of control group. These results demonstrate that C50336ΔsptP can be a live attenuated oral vaccine for salmonellosis.

  5. Protection of pigs against pandemic swine origin H1N1 influenza A virus infection by hemagglutinin- or neuraminidase-expressing attenuated pseudorabies virus recombinants.

    PubMed

    Klingbeil, Katharina; Lange, Elke; Blohm, Ulrike; Teifke, Jens P; Mettenleiter, Thomas C; Fuchs, Walter

    2015-03-02

    Influenza is an important respiratory disease of pigs, and may lead to novel human pathogens like the 2009 pandemic H1N1 swine-origin influenza virus (SoIV). Therefore, improved influenza vaccines for pigs are required. Recently, we demonstrated that single intranasal immunization with a hemagglutinin (HA)-expressing pseudorabies virus recombinant of vaccine strain Bartha (PrV-Ba) protected pigs from H1N1 SoIV challenge (Klingbeil et al., 2014). Now we investigated enhancement of efficacy by prime-boost vaccination and/or intramuscular administration. Furthermore, a novel PrV-Ba recombinant expressing codon-optimized N1 neuraminidase (NA) was included. In vitro replication of this virus was only slightly affected compared to parental virus. Unlike HA, the abundantly expressed NA was efficiently incorporated into PrV particles. Immunization of pigs with the two PrV recombinants, either singly or in combination, induced B cell proliferation and the expected SoIV-specific antibodies, whose titers increased substantially after boost vaccination. After immunization of animals with either PrV recombinant H1N1 SoIV challenge virus replication was significantly reduced compared to PrV-Ba vaccinated or naïve controls. Protective efficacy of HA-expressing PrV was higher than of NA-expressing PrV, and not significantly enhanced by combination. Despite higher serum antibody titers obtained after intramuscular immunization, transmission of challenge virus to naïve contact animals was only prevented after intranasal prime-boost vaccination with HA-expressing PrV-Ba. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Revisiting immunosurveillance and immunostimulation: Implications for cancer immunotherapy

    PubMed Central

    Ichim, Christine V

    2005-01-01

    Experimental and clinical experience demonstrates that the resolution of a pathogenic challenge depends not only on the presence or absence of an immune reaction, but also on the initiation of the proper type of immune reaction. The initiation of a non-protective type of immune reaction will not only result in a lack of protection, but may also exacerbate the underlying condition. For example, in cancer, constituents of the immune system have been shown to augment tumor proliferation, angiogenesis, and metastases. This review discusses the duality of the role of the immune system in cancer, from the theories of immunosurveillance and immunostimulation to current studies, which illustrate that the immune system has both a protective role and a tumor-promoting role in neoplasia. The potential of using chemotherapy to inhibit a tumor-promoting immune reaction is also discussed. PMID:15698481

  7. [Attitudes and practices towards seasonal influenza vaccination amongst French hospital staff].

    PubMed

    Maurette, Max; Pinzelli, Pierre; Yordanov Sandev, Aleksandar; Nock, Francis

    2017-04-27

    This survey intends to describe the attitudes towards vaccination amongst the hospital staff in the region of Castres, in the south-west of France, and their influenza vaccination coverage. A questionnaire was attached to all pay slips in March 2014 and 471 questionnaires were completed (return rate: 22.4%). Seasonal influenza vaccination coverage rate was similar to that reported in other French surveys. Paramedical personnel were less commonly immunized against influenza compared to medical personnel and age was the major factor associated with vaccination. Three quarters of the non-immunized hospital personnel did not wish to be vaccinated against influenza. Nearly 50% of respondents believed that healthcare personnel do not have to be role models regarding vaccination. The arguments considered most compelling in favour of vaccination are protection of the family, then patient protection and finally protection of other staff members. A demand for accurate scientific information was expressed by respondents, preferably delivered at their workplace.

  8. From folklore to fact: the rhetorical history of breastfeeding and immunity, 1950-1997.

    PubMed

    Koerber, Amy

    2006-01-01

    This article examines the recent construction of human milk's immune-protective qualities as scientific fact, demonstrating that long-standing controversies about human milk's immune-protective effects have not been resolved by a particular scientific discovery. Rather, experts' consensus on how to respond to this uncertainty has been transformed, and this transformation has had as much to do with a change in the metaphor that governs interpretation of evidence about immune protection as it has with discovering new evidence about either human milk or the antibodies in it.

  9. [Mucosal immunity with emphasis on urinary tract immunity and diabetes].

    PubMed

    Krejsek, J; Kudlová, M; Kolácková, M; Novosad, J

    2008-05-01

    Protective immune response in urinary tract is frequently impaired in patients with diabetes. Immunity in this mucosal compartment displays unique characteristics; e.g. absence of physiological microflora and lack of mucus. Pathogens are identified by the PRR receptors expressed on both epithelial and immune cells. Inflammatory response characterised by the acumulation ofgranulocytes is followed. Both protective and harm characteristics of inflammatory response are inseparable linked and delineated by gene polymorphisms in PRR receptors.

  10. Evaluation of immunogenicity and protective efficacy of orally delivered Shigella type III secretion system proteins IpaB and IpaD

    PubMed Central

    Heine, Shannon J.; Diaz-McNair, Jovita; Martinez-Becerra, Francisco J.; Choudhari, Shyamal P.; Clements, John D.; Picking, Wendy L.; Pasetti, Marcela F.

    2013-01-01

    Shigella spp. are food- and water-borne pathogens that cause shigellosis, a severe diarrheal and dysenteric disease that is associated with a high morbidity and mortality in resource-poor countries. No licensed vaccine is available to prevent shigellosis. We have recently demonstrated that Shigella invasion plasmid antigens (Ipas), IpaB and IpaD, which are components of the bacterial type III secretion system (TTSS), can prevent infection in a mouse model of intranasal immunization and lethal pulmonary challenge. Because they are conserved across Shigella spp. and highly immunogenic, these proteins are excellent candidates for a cross-protective vaccine. Ideally, such a vaccine could be administered to humans orally to induce mucosal and systemic immunity. In this study, we investigated the immunogenicity and protective efficacy of Shigella IpaB and IpaD administered orally with a double mutant of the Escherichia coli heat labile toxin (dmLT) as a mucosal adjuvant. We characterized the immune responses induced by oral vs. intranasal immunization and the protective efficacy using a mouse pulmonary infection model. Serum IgG and fecal IgA against IpaB were induced after oral immunization. These responses, however, were lower than those obtained after intranasal immunization despite a 100-fold dosage increase. The level of protection induced by oral immunization with IpaB and IpaD was 40%, while intranasal immunization resulted in 90% protective efficacy. IpaB- and IpaD-specific IgA antibody-secreting cells in the lungs and spleen and T-cell-derived IL-2, IL-5, IL-17 and IL-10 were associated with protection. These results demonstrate the immunogenicity of orally administered IpaB and IpaD and support further studies in humans. PMID:23644075

  11. Preexisting CD4+ T-Cell Immunity in Human Population to Avian Influenza H7N9 Virus: Whole Proteome-Wide Immunoinformatics Analyses

    PubMed Central

    Duvvuri, Venkata R.; Duvvuri, Bhargavi; Alice, Christilda; Wu, Gillian E.; Gubbay, Jonathan B.; Wu, Jianhong

    2014-01-01

    In 2013, a novel avian influenza H7N9 virus was identified in human in China. The antigenically distinct H7N9 surface glycoproteins raised concerns about lack of cross-protective neutralizing antibodies. Epitope-specific preexisting T-cell immunity was one of the protective mechanisms in pandemic 2009 H1N1 even in the absence of cross-protective antibodies. Hence, the assessment of preexisting CD4+ T-cell immunity to conserved epitopes shared between H7N9 and human influenza A viruses (IAV) is critical. A comparative whole proteome-wide immunoinformatics analysis was performed to predict the CD4+ T-cell epitopes that are commonly conserved within the proteome of H7N9 in reference to IAV subtypes (H1N1, H2N2, and H3N2). The CD4+ T-cell epitopes that are commonly conserved (∼556) were further screened against the Immune Epitope Database (IEDB) to validate their immunogenic potential. This analysis revealed that 45.5% (253 of 556) epitopes are experimentally proven to induce CD4+ T-cell memory responses. In addition, we also found that 23.3% of CD4+ T-cell epitopes have ≥90% of sequence homology with experimentally defined CD8+ T-cell epitopes. We also conducted the population coverage analysis across different ethnicities using commonly conserved CD4+ T-cell epitopes and corresponding HLA-DRB1 alleles. Interestingly, the indigenous populations from Canada, United States, Mexico and Australia exhibited low coverage (28.65% to 45.62%) when compared with other ethnicities (57.77% to 94.84%). In summary, the present analysis demonstrate an evidence on the likely presence of preexisting T-cell immunity in human population and also shed light to understand the potential risk of H7N9 virus among indigenous populations, given their high susceptibility during previous pandemic influenza events. This information is crucial for public health policy, in targeting priority groups for immunization programs. PMID:24609014

  12. Prophylactic immunization against experimental leishmaniasis. III. Protection against fatal Leishmania tropica infection induced by irradiated promastigotes involves Lyt-1/sup +/2/sup -/ T cells that do not mediate cutaneous DTH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liew, F.Y.; Howard, J.G.; Hale, C.

    1984-01-01

    Protective immunity against fatal L. tropica infection in genetically vulnerable BALB/c mice can be induced by prophylactic immunization with irradiated promastigotes even when heat-killed. Such immunity is adoptively transferable transiently into intact or durably into sub-lethally irradiated (200 or 550 rad) syngeneic recipients by splenic T but not B cells. The effector T cells are of the Lyt-1/sup +/2/sup -/ phenotype, devoid of demonstrable cytotoxic activity. The immune splenic T cell population expresses specific helper activity for antibody synthesis. A causal role for helper T cells in this capacity, however, seems unlikely, because it was shown that antibody does notmore » determine the protective immunity against L. tropica. The immunized donors show no detectable cutaneous DTH or its early memory recall in response to live or killed promastigotes or a soluble L. tropica antigen preparation. Spleen, lymph node, and peritoneal exudate cells from protectively immunized donors similarly fail to transfer DTH locally or systemically. These cells also lack demonstrable suppressive activity against the expression or induction of DTH to L. tropica. Thus, protection against L. tropica induced by prophylactic i.v. immunization with irradiated promastigotes appears to be conferred by Lyt-1/sup +/2/sup -/ T cells that are distinguishable from T cells mediating either both DTH and T help, or cytotoxicity.« less

  13. Dissecting polyclonal vaccine-induced humoral immunity against HIV using Systems Serology

    PubMed Central

    Chung, Amy W.; Kumar, Manu P.; Arnold, Kelly B.; Yu, Wen Han; Schoen, Matthew K.; Dunphy, Laura J.; Suscovich, Todd J.; Frahm, Nicole; Linde, Caitlyn; Mahan, Alison E.; Hoffner, Michelle; Streeck, Hendrik; Ackerman, Margaret E.; McElrath, M. Juliana; Schuitemaker, Hanneke; Pau, Maria G.; Baden, Lindsey R.; Kim, Jerome H.; Michael, Nelson L.; Barouch, Dan H.; Lauffenburger, Douglas A.; Alter, Galit

    2017-01-01

    While antibody titers and neutralization are considered the gold standard for the selection of successful vaccines, these parameters are often inadequate predictors of protective immunity. As antibodies mediate an array of extra-neutralizing Fc-functions, when neutralization fails to predict protection, investigating Fc-mediated activity may help identify immunological correlates and mechanism(s) of humoral protection. Here, we used an integrative approach termed Systems Serology to analyze relationships among humoral responses elicited in four HIV vaccine-trials. Each vaccine regimen induced a unique humoral “Fc-fingerprint”. Moreover, analysis of case:control data from the first moderately protective HIV vaccine trial, RV144, pointed to mechanistic insights into immune complex composition that may underlie protective immunity to HIV. Thus, multi-dimensional relational comparisons of vaccine humoral fingerprints offer a unique approach for the evaluation and design of novel vaccines against pathogens for which correlates of protection remain elusive. PMID:26544943

  14. Identification of immune signatures predictive of clinical protection from malaria.

    PubMed

    Valletta, John Joseph; Recker, Mario

    2017-10-01

    Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual's malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone.

  15. Pre-clinical efficacy and safety of experimental vaccines based on non-replicating vaccinia vectors against yellow fever.

    PubMed

    Schäfer, Birgit; Holzer, Georg W; Joachimsthaler, Alexandra; Coulibaly, Sogue; Schwendinger, Michael; Crowe, Brian A; Kreil, Thomas R; Barrett, P Noel; Falkner, Falko G

    2011-01-01

    Currently existing yellow fever (YF) vaccines are based on the live attenuated yellow fever virus 17D strain (YFV-17D). Although, a good safety profile was historically attributed to the 17D vaccine, serious adverse events have been reported, making the development of a safer, more modern vaccine desirable. A gene encoding the precursor of the membrane and envelope (prME) protein of the YFV-17D strain was inserted into the non-replicating modified vaccinia virus Ankara and into the D4R-defective vaccinia virus. Candidate vaccines based on the recombinant vaccinia viruses were assessed for immunogenicity and protection in a mouse model and compared to the commercial YFV-17D vaccine. The recombinant live vaccines induced γ-interferon-secreting CD4- and functionally active CD8-T cells, and conferred full protection against lethal challenge already after a single low immunization dose of 10(5) TCID(50). Surprisingly, pre-existing immunity against wild-type vaccinia virus did not negatively influence protection. Unlike the classical 17D vaccine, the vaccinia virus-based vaccines did not cause mortality following intracerebral administration in mice, demonstrating better safety profiles. The non-replicating recombinant YF candidate live vaccines induced a broad immune response after single dose administration, were effective even in the presence of a pre-existing immunity against vaccinia virus and demonstrated an excellent safety profile in mice.

  16. Evaluation of humoral immunity and protective efficacy of biofilm producing Staphylococcus aureus bacterin-toxoid prepared from a bovine mastitis isolate in rabbit

    PubMed Central

    A., Raza; G., Muhammad; S. U., Rahman; I., Rashid; K., Hanif; A., Atta; S., Sharif

    2015-01-01

    Mastitis is a one of the major diseases of dairy animals. Staphylococcus aureus is the most common microorganism associated with this dairy scourge. Cure rates of mastitis associated with this pathogen are appallingly low. Biofilm is an important virulence factor and immunogenic structure of S. aureus that makes it resistant to phagocytosis and antibiotics. Reports on the efficacy of vaccine prepared from a biofilm producing S. aureus are infrequent. The present study was designed to evaluate the role of a bacterin-toxoid prepared from a strong biofilm producing S. aureus in effective immunization of rabbits. The strong biofilm producing S. aureus selected from 64 isolates of staphylococci was used to prepare bacterin-toxoid and aluminum hydroxide gel was added as an adjuvant. The vaccine was evaluated in rabbits by challenge protection assay and humoral immune response. The mortality rates in control and vaccinated groups were 80% and 10% at day 7 post challenge and 100% and 20% at day 15 post challenge, respectively. Serum antibody titer (GMT) was significantly higher (294.0) in vaccinated group as compared to control group of rabbits (2.63) at day 45. The results showed that the vaccine has significantly elicited humoral immune response in rabbit and developed protective efficacy against new infections. PMID:27175154

  17. Mice chronically infected with chimeric HIV resist peripheral and brain superinfection: a model of protective immunity to HIV.

    PubMed

    Kelschenbach, Jennifer L; Saini, Manisha; Hadas, Eran; Gu, Chao-Jiang; Chao, Wei; Bentsman, Galina; Hong, Jessie P; Hanke, Tomas; Sharer, Leroy R; Potash, Mary Jane; Volsky, David J

    2012-06-01

    Infection by some viruses induces immunity to reinfection, providing a means to identify protective epitopes. To investigate resistance to reinfection in an animal model of HIV disease and its control, we employed infection of mice with chimeric HIV, EcoHIV. When immunocompetent mice were infected by intraperitoneal (IP) injection of EcoHIV, they resisted subsequent secondary infection by IP injection, consistent with a systemic antiviral immune response. To investigate the potential role of these responses in restricting neurotropic HIV infection, we established a protocol for efficient EcoHIV expression in the brain following intracranial (IC) inoculation of virus. When mice were inoculated by IP injection and secondarily by IC injection, they also controlled EcoHIV replication in the brain. To investigate their role in EcoHIV antiviral responses, CD8+ T lymphocytes were isolated from spleens of EcoHIV infected and uninfected mice and adoptively transferred to isogenic recipients. Recipients of EcoHIV primed CD8+ cells resisted subsequent EcoHIV infection compared to recipients of cells from uninfected donors. CD8+ spleen cells from EcoHIV-infected mice also mounted modest but significant interferon-γ responses to two HIV Gag peptide pools. These findings suggest EcoHIV-infected mice may serve as a useful system to investigate the induction of anti-HIV protective immunity for eventual translation to human beings.

  18. Sterile Immunity to Malaria after DNA Prime/Adenovirus Boost Immunization Is Associated with Effector Memory CD8+T Cells Targeting AMA1 Class I Epitopes

    PubMed Central

    Sedegah, Martha; Hollingdale, Michael R.; Farooq, Fouzia; Ganeshan, Harini; Belmonte, Maria; Kim, Yohan; Peters, Bjoern; Sette, Alessandro; Huang, Jun; McGrath, Shannon; Abot, Esteban; Limbach, Keith; Shi, Meng; Soisson, Lorraine; Diggs, Carter; Chuang, Ilin; Tamminga, Cindy; Epstein, Judith E.; Villasante, Eileen; Richie, Thomas L.

    2014-01-01

    Background Fifteen volunteers were immunized with three doses of plasmid DNA encoding P. falciparum circumsporozoite protein (CSP) and apical membrane antigen-1 (AMA1) and boosted with human adenovirus-5 (Ad) expressing the same antigens (DNA/Ad). Four volunteers (27%) demonstrated sterile immunity to controlled human malaria infection and, overall, protection was statistically significantly associated with ELISpot and CD8+ T cell IFN-γ activities to AMA1 but not CSP. DNA priming was required for protection, as 18 additional subjects immunized with Ad alone (AdCA) did not develop sterile protection. Methodology/Principal Findings We sought to identify correlates of protection, recognizing that DNA-priming may induce different responses than AdCA alone. Among protected volunteers, two and three had higher ELISpot and CD8+ T cell IFN-γ responses to CSP and AMA1, respectively, than non-protected volunteers. Unexpectedly, non-protected volunteers in the AdCA trial showed ELISpot and CD8+ T cell IFN-γ responses to AMA1 equal to or higher than the protected volunteers. T cell functionality assessed by intracellular cytokine staining for IFN-γ, TNF-α and IL-2 likewise did not distinguish protected from non-protected volunteers across both trials. However, three of the four protected volunteers showed higher effector to central memory CD8+ T cell ratios to AMA1, and one of these to CSP, than non-protected volunteers for both antigens. These responses were focused on discrete regions of CSP and AMA1. Class I epitopes restricted by A*03 or B*58 supertypes within these regions of AMA1 strongly recalled responses in three of four protected volunteers. We hypothesize that vaccine-induced effector memory CD8+ T cells recognizing a single class I epitope can confer sterile immunity to P. falciparum in humans. Conclusions/Significance We suggest that better understanding of which epitopes within malaria antigens can confer sterile immunity and design of vaccine approaches that elicit responses to these epitopes will increase the potency of next generation gene-based vaccines. PMID:25211344

  19. Immunization of broiler chickens against Clostridium perfringens-induced necrotic enteritis using purified recombinant immunogenic proteins.

    PubMed

    Jiang, Yanfen; Kulkarni, Raveendra R; Parreira, Valeria R; Prescott, John F

    2009-09-01

    This study identified and assessed secreted proteins of Clostridium perfringens additional to those previously described for their ability to protect broiler chickens against necrotic enteritis (NE). Secreted proteins of virulent and avirulent C. perfringens were electrophoretically separated and reacted with serum of chickens immune to NE. Three immunoreactive protein bands unique to the virulent C. perfringens were identified by mass spectrometry as the toxin C. perfringens large cytotoxin (TpeL), endo-beta-N-acetylglucosaminidase (Naglu), and phosphoglyceromutase (Pgm). The genes encoding Naglu and Pgm proteins were cloned, and their gene products were purified as histidine-tagged recombinant proteins from Escherichia coli and used in immunizing chickens. Immunized and nonimmunized control broiler chickens were then challenged with two different strains (CP1, CP4) of C. perfringens and assessed for the development of NE. Of the two immunogens, Pgm immunization showed significant protection of broiler chickens against experimental NE, although protection reduced as challenge severity increased. However, birds immunized with Naglu were protected from challenge only with strain CP4. Birds immunized with these proteins had antigen-specific antibodies when tested in an enzyme-linked immunosorbent assay. In conclusion, this study demonstrated the partial efficacy of additional secreted proteins in immunity of broiler chickens to NE. The study also showed that there may be differences in the protective ability of immunogens depending on the infecting C. perfringens strain.

  20. [Environmental pollutants as adjuvant factors of immune system derived diseases].

    PubMed

    Lehmann, Irina

    2017-06-01

    The main task of the immune system is to protect the body against invading pathogens. To be able to do so, immune cells must be able to recognize and combat exogenous challenges and at the same time tolerate body-borne structures. A complex regulatory network controls the sensitive balance between defense and tolerance. Perturbation of this network ultimately leads to the development of chronic inflammation, such as allergies, autoimmune reactions, and infections, because the immune system is no longer able to efficiently eliminate invading pathogens. Environmental pollutants can cause such perturbations by affecting the function of immune cells in such a way that they would react hypersensitively against allergens and the body's own structures, respectively, or that they would be no longer able to adequately combat pathogens. This indirect effect is also known as adjuvant effect. For pesticides, heavy metals, wood preservatives, or volatile organic compounds such adjuvant effects are well known. Examples of the mechanism by which environmental toxins contribute to chronic inflammatory diseases are manifold and will be discussed along asthma and allergies.While the immune system of healthy adults is typically well able to distinguish between foreign and endogenous substances even under adverse environmental conditions, that of children would react much more sensible upon comparable environmental challenges. To prevent priming for diseases by environmental cues during that highly sensitive period of early childhood children are to be particularly protected.

  1. Improved immunogenicity of individual influenza vaccine components delivered with a novel dissolving microneedle patch stable at room temperature

    PubMed Central

    Vassilieva, Elena V.; Kalluri, Haripriya; McAllister, Devin; Taherbhai, Misha T.; Esser, E. Stein; Pewin, Winston P.; Pulit-Penaloza, Joanna A.; Prausnitz, Mark R.; Compans, Richard W.; Skountzou, Ioanna

    2015-01-01

    Prevention of seasonal influenza epidemics and pandemics relies on widespread vaccination coverage to induce protective immunity. In addition to a good antigenic match with the circulating viruses, the effectiveness of individual strains represented in the trivalent vaccines depends on their immunogenicity. In this study we evaluated the immunogenicity of H1N1, H3N2 and B seasonal influenza virus vaccine strains delivered individually with a novel dissolving microneedle patch and the stability of this formulation during storage at 25°C. Our data demonstrate that all strains retained their antigenic activity after incorporation in the dissolving patches as measured by SRID assay and immune responses to vaccination in BALB/c mice. After a single immunization all three antigens delivered with microneedle patches induced superior neutralizing antibody titers compared to intramuscular immunization. Cutaneous antigen delivery was especially beneficial for the less immunogenic B strain. Mice immunized with dissolving microneedle patches encapsulating influenza A/Brisbane/59/07 (H1N1) vaccine were fully protected against lethal challenge by homologous mouse-adapted influenza virus. All vaccine components retained activity during storage at room temperature for at least three months as measured in vitro by SRID assay and in vivo by mouse immunization studies. Our data demonstrate that dissolving microneedle patches are a promising advance for influenza cutaneous vaccination due to improved immune responses using less immunogenic influenza antigens and enhanced stability. PMID:25895053

  2. Individual variation is the key to the development of a vaccine against Staphylococcus aureus: a comparative study between mice lineages

    PubMed Central

    dos Santos, D.P.; Muniz, I.P.R.; Queiroz, A.F.; Pereira, I.S.; Souza, M.P.A.; Lima, L.J.; Sousa, L.R.O.; Ribeiro, I.S.; Galantini, M.P.L.; Marques, L.M.; Figueiredo, T.B.; da Silva, R.A.A.

    2018-01-01

    Bacterial infections occur worldwide and are a major public health problem. Among pathogens, Staphylococcus aureus is the main causative agent of bacterial diseases in the world. This study aimed to evaluate which components of the immune system could act protectively against a S. aureus infection in intradermally immunized mice. C57BL/6 and A/j mice were immunized intradermally with S. aureus inactivated by heat and then challenged with viable strains in an air pouch model. At 6, 12, and 24 h after the challenge, euthanasia was performed, and the cellular profile of the inflammatory infiltrate, cytokines, and the bacterial load were evaluated in the air pouch lavages. Immunized mice demonstrated that the intradermal immunization with S. aureus promoted protection in C57BL/6 mice by reducing the bacterial, which was correlated with increased serum concentration of IgG antibodies (IgG1 and IgG2a) against S. aureus. The increase in IgG2a antibody levels was correlated with a decrease of bacterial load in intradermally immunized C57BL/6 mice, along with production of IL-17A at the inflammation site, as well as IgG1consumption. Similar results were not found in the A/j lineage. In conclusion, a vaccine against S. aureus should focus more on the individual characteristics of the host because it is a determinant factor for the success of the immunization. PMID:29590259

  3. Mechanisms of immunity in post-exposure vaccination against Ebola virus infection.

    PubMed

    Bradfute, Steven B; Anthony, Scott M; Stuthman, Kelly S; Ayithan, Natarajan; Tailor, Prafullakumar; Shaia, Carl I; Bray, Mike; Ozato, Keiko; Bavari, Sina

    2015-01-01

    Ebolaviruses can cause severe hemorrhagic fever that is characterized by rapid viral replication, coagulopathy, inflammation, and high lethality rates. Although there is no clinically proven vaccine or treatment for Ebola virus infection, a virus-like particle (VLP) vaccine is effective in mice, guinea pigs, and non-human primates when given pre-infection. In this work, we report that VLPs protect Ebola virus-infected mice when given 24 hours post-infection. Analysis of cytokine expression in serum revealed a decrease in pro-inflammatory cytokine and chemokine levels in mice given VLPs post-exposure compared to infected, untreated mice. Using knockout mice, we show that VLP-mediated post-exposure protection requires perforin, B cells, macrophages, conventional dendritic cells (cDCs), and either CD4+ or CD8+ T cells. Protection was Ebola virus-specific, as marburgvirus VLPs did not protect Ebola virus-infected mice. Increased antibody production in VLP-treated mice correlated with protection, and macrophages were required for this increased production. However, NK cells, IFN-gamma, and TNF-alpha were not required for post-exposure-mediated protection. These data suggest that a non-replicating Ebola virus vaccine can provide post-exposure protection and that the mechanisms of immune protection in this setting require both increased antibody production and generation of cytotoxic T cells.

  4. Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

    PubMed

    Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

    2018-07-01

    Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection patients. Gsk3β promotes innate proinflammatory immune activation by restraining AMPK activation. Glycogen synthase kinase 3β promotes macrophage inflammatory activation by inhibiting the immune regulatory signalling of AMP-activated protein kinase and the induction of small heterodimer partner. Therefore, therapeutic targeting of glycogen synthase kinase 3β enhances innate immune regulation and protects liver from ischaemia and reperfusion injury. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  5. Active Immunizations with Peptide-DC Vaccines and Passive Transfer with Antibodies Protect Neutropenic Mice against Disseminated Candidiasis

    PubMed Central

    Xin, Hong

    2015-01-01

    We previously report that peptide-pulsed dendritic cell (DC) vaccination, which targeting two peptides (Fba and Met6) expressed on the cell surface of Candida albicans, can induce high degree of protection against disseminated candidiasis in immunocompetent mice. Passive transfer of immune sera from the peptide immunized mice or peptide-related monoclonal antibodies demonstrated that protection was medicated by peptide-specific antibodies. In this study the efficacy of active and passive immunization against disseminated candidiasis was tested in mice with cyclophosphamide-induced neutropenia. Peptide-DC vaccines were given to mice prior to induction of neutropenia. We show active immunization with either Fba or Met6 peptide-DC vaccine significantly improved the survival and reduced the fungal burden of disseminated candidiasis in those immunocompromised mice. Importantly, we show that administration of two protective monoclonal antibodies also protect neutropenic mice against the disease, implying possibility of developing a successful passive immunotherapy strategy to treat the disease and protect against disseminated candidiasis. The results of this study are crucial as they address the fundamental questions as to whether the synthetic peptide vaccine induced immunity protects the host during a neutropenic episode. We anticipate that this peptide-vaccine study will serve as the foundation of future investigations into new peptide vaccines comprised of cell surface peptides from other medically important Candida species, as well as other fungi. PMID:26620842

  6. Evaluation of the protective immunogencity of the N, P, M, NV and G proteins of infectious hematopoietic necrosis virus in rainbow trout Oncorhynchus mykiss using DNA vaccines

    USGS Publications Warehouse

    Corbeil, S.; LaPatra, S.E.; Anderson, E.D.; Jones, J.; Vincent, B.; Hsu, Ya Li; Kurath, G.

    1999-01-01

    The protective immunogenicity of the nucleoprotein (N), phosphoprotein (P), matrix protein (M), non-virion protein (NV) and glycoprotein (G) of the rhabdovirus infectious hematopoietic necrosis virus (IHNV) was assessed in rainbow trout using DNA vaccine technology. DNA vaccines were produced by amplifying and cloning the viral genes in the plasmid pCDNA 3.1. The protective immunity elicited by each vaccine was evaluated through survival of immunized fry after challenge with live virus. Neutralizing antibody titers were also determined in vaccinated rainbow troutOncorhynchus mykiss fry (mean weight 2 g) and 150 g sockeye salmon Oncorhynchus nerka. The serum from the 150 g fish was also used in passive immunization studies with naïve fry. Our results showed that neither the internal structural proteins (N, P and M) nor the NV protein of IHNV induced protective immunity in fry or neutralizing antibodies in fry and 150 g fish when expressed by a DNA vaccine construct. The G protein, however, did confer significant protection in fry up to 80 d post-immunization and induced protective neutralizing antibodies. We are currently investigating the role of different arms of the fish immune system that contribute to the high level of protection against IHNV seen in vaccinated fish.

  7. Immune response in a wild bird is predicted by oxidative status, but does not cause oxidative stress.

    PubMed

    Cram, Dominic L; Blount, Jonathan D; York, Jennifer E; Young, Andrew J

    2015-01-01

    The immune system provides vital protection against pathogens, but extensive evidence suggests that mounting immune responses can entail survival and fecundity costs. The physiological mechanisms that underpin these costs remain poorly understood, despite their potentially important role in shaping life-histories. Recent studies involving laboratory models highlight the possibility that oxidative stress could mediate these costs, as immune-activation can increase the production of reactive oxygen species leading to oxidative stress. However, this hypothesis has rarely been tested in free-ranging wild populations, where natural oxidative statuses and compensatory strategies may moderate immune responses and their impacts on oxidative status. Furthermore, the possibility that individuals scale their immune responses according to their oxidative status, conceivably to mitigate such costs, remains virtually unexplored. Here, we experimentally investigate the effects of a phytohaemagglutinin (PHA) immune-challenge on oxidative status in wild male and female white-browed sparrow weavers, Plocepasser mahali. We also establish whether baseline oxidative status prior to challenge predicts the scale of the immune responses. Contrary to previous work on captive animals, our findings suggest that PHA-induced immune-activation does not elicit oxidative stress. Compared with controls (n = 25 birds), PHA-injected birds (n = 27 birds) showed no evidence of a differential change in markers of oxidative damage or enzymatic and non-enzymatic antioxidant protection 24 hours after challenge. We did, however, find that the activity of a key antioxidant enzyme (superoxide dismutase, SOD) prior to immune-activation predicted the scale of the resulting swelling: birds with stronger initial SOD activity subsequently produced smaller swellings. Our findings (i) suggest that wild birds can mount immune responses without suffering from systemic oxidative stress, and (ii) lend support to biomedical evidence that baseline oxidative status can impact the scale of immune responses; a possibility not yet recognised in ecological studies of immunity.

  8. Immune Response in a Wild Bird Is Predicted by Oxidative Status, but Does Not Cause Oxidative Stress

    PubMed Central

    Cram, Dominic L.; Blount, Jonathan D.; York, Jennifer E.; Young, Andrew J.

    2015-01-01

    The immune system provides vital protection against pathogens, but extensive evidence suggests that mounting immune responses can entail survival and fecundity costs. The physiological mechanisms that underpin these costs remain poorly understood, despite their potentially important role in shaping life-histories. Recent studies involving laboratory models highlight the possibility that oxidative stress could mediate these costs, as immune-activation can increase the production of reactive oxygen species leading to oxidative stress. However, this hypothesis has rarely been tested in free-ranging wild populations, where natural oxidative statuses and compensatory strategies may moderate immune responses and their impacts on oxidative status. Furthermore, the possibility that individuals scale their immune responses according to their oxidative status, conceivably to mitigate such costs, remains virtually unexplored. Here, we experimentally investigate the effects of a phytohaemagglutinin (PHA) immune-challenge on oxidative status in wild male and female white-browed sparrow weavers, Plocepasser mahali. We also establish whether baseline oxidative status prior to challenge predicts the scale of the immune responses. Contrary to previous work on captive animals, our findings suggest that PHA-induced immune-activation does not elicit oxidative stress. Compared with controls (n = 25 birds), PHA-injected birds (n = 27 birds) showed no evidence of a differential change in markers of oxidative damage or enzymatic and non-enzymatic antioxidant protection 24 hours after challenge. We did, however, find that the activity of a key antioxidant enzyme (superoxide dismutase, SOD) prior to immune-activation predicted the scale of the resulting swelling: birds with stronger initial SOD activity subsequently produced smaller swellings. Our findings (i) suggest that wild birds can mount immune responses without suffering from systemic oxidative stress, and (ii) lend support to biomedical evidence that baseline oxidative status can impact the scale of immune responses; a possibility not yet recognised in ecological studies of immunity. PMID:25815888

  9. Plant Immunity Inducer Development and Application.

    PubMed

    Dewen, Qiu; Yijie, Dong; Yi, Zhang; Shupeng, Li; Fachao, Shi

    2017-05-01

    Plant immunity inducers represent a new and rapidly developing field in plant-protection research. In this paper, we discuss recent research on plant immunity inducers and their development and applications in China. Plant immunity inducers include plant immunity-inducing proteins, chitosan oligosaccharides, and microbial inducers. These compounds and microorganisms can trigger defense responses and confer disease resistance in plants. We also describe the mechanisms of plant immunity inducers and how they promote plant health. Furthermore, we summarize the current situation in plant immunity inducer development in China and the global marketplace. Finally, we also deeply analyze the development trends and application prospects of plant immunity inducers in environmental protection and food safety.

  10. How might infant and paediatric immune responses influence malaria vaccine efficacy?

    PubMed

    Moormann, A M

    2009-09-01

    Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.

  11. Increased virulence of Mycobacterium tuberculosis H37Rv overexpressing LipY in a murine model.

    PubMed

    Singh, Vipul K; Srivastava, Mrigank; Dasgupta, Arunava; Singh, Mohan P; Srivastava, Ranjana; Srivastava, Brahm S

    2014-05-01

    We have investigated the role of Rv3097c-encoded lipase (LipY) on the virulence of Mycobacterium tuberculosis. It has been shown that the overexpression of LipY in strain H37Rv induced increase in virulence of recombinant H37Rv::LipY strain. Compared to H37Rv, infection with H37Rv::LipY caused enhanced mortality, weight loss, bacterial load in lungs, splenomegaly, worsening lung morphology and pathology. Mice immunized with recombinant LipY antigen were protected against challenge with H37Rv::LipY, which correlated with enhanced survival of challenged mice and striking decrease in pathological features observed in unimmunized mice. To probe the cause of increase in virulence of H37Rv::LipY, the immune status of the host infected with H37Rv and H37Rv::LipY was compared. It was found that overexpression of LipY compromised immune responses resulting in attenuation of Th1 and Th17 responses, significant increase in IL-10, decrease in number of macrophages and T cells, and increase in numbers of Treg, and DCs in the lungs whereas in mice immunized with LipY an increased pool of T cells and DCs was observed. This led us to conclude that the increase in the virulence of H37Rv::LipY was due to downregulation of the host's protective immunity and the Rv3097c encoded LipY lipase is a virulence factor of M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Use of the mice passive protection test to evaluate the humoral response in goats vaccinated with Sterne 34F2 live spore vaccine.

    PubMed

    Phaswana, P H; Ndumnego, O C; Koehler, S M; Beyer, W; Crafford, J E; van Heerden, H

    2017-09-07

    The Sterne live spore vaccine (34F2) is the most widely used veterinary vaccine against anthrax in animals. Antibody responses to several antigens of Bacillus anthracis have been described with a large focus on those against protective antigen (PA). The focus of this study was to evaluate the protective humoral immune response induced by the live spore anthrax vaccine in goats. Boer goats vaccinated twice (week 0 and week 12) with the Sterne live spore vaccine and naive goats were used to monitor the anti-PA and toxin neutralizing antibodies at week 4 and week 17 (after the second vaccine dose) post vaccination. A/J mice were passively immunized with different dilutions of sera from immune and naive goats and then challenged with spores of B. anthracis strain 34F2 to determine the protective capacity of the goat sera. The goat anti-PA ELISA titres indicated significant sero-conversion at week 17 after the second doses of vaccine (p = 0.009). Mice receiving undiluted sera from goats given two doses of vaccine (twice immunized) showed the highest protection (86%) with only 20% of mice receiving 1:1000 diluted sera surviving lethal challenge. The in vitro toxin neutralization assay (TNA) titres correlated to protection of passively immunized A/J mice against lethal infection with the vaccine strain Sterne 34F2 spores using immune goat sera up to a 1:10 dilution (r s  ≥ 0.522, p = 0.046). This study suggests that the passive mouse protection model could be potentially used to evaluate the protective immune response in livestock animals vaccinated with the current live vaccine and new vaccines.

  13. Evaluation of formalin-inactivated Clostridium difficile vaccines administered by parenteral and mucosal routes of immunization in hamsters.

    PubMed Central

    Torres, J F; Lyerly, D M; Hill, J E; Monath, T P

    1995-01-01

    Clostridium difficile produces toxins that cause inflammation, necrosis, and fluid in the intestine and is the most important cause of nosocomial antibiotic-associated diarrhea and colitis. We evaluated C. difficile antigens as vaccines to protect against systemic and intestinal disease in a hamster model of clindamycin colitis. Formalin-inactivated culture filtrates from a highly toxigenic strain were administered by mucosal routes (intranasal, intragastric, and rectal) with cholera toxin as a mucosal adjuvant. A preparation of culture filtrate and killed whole cells was also tested rectally. The toxoid was also tested parenterally (subcutaneously and intraperitoneally) and by a combination of three intranasal immunizations followed by a combined intranasal-intraperitoneal boost. Serum antibodies against toxins A and B and whole-cell antigen were measured by enzyme-linked immunosorbent assay, neutralization of cytotoxic activity, and bacterial agglutination. The two rectal immunization regimens induced low antibody responses and protected only 20% of hamsters against death and 0% against diarrhea. The intragastric regimen induced high antibody responses but low protection, 40% against death and 0% against diarrhea. Hamsters immunized by the intranasal, intraperitoneal, and subcutaneous routes were 100% protected against death and partially protected (40, 40, and 20%, respectively) against diarrhea. Among the latter groups, intraperitoneally immunized animals had the highest serum anticytotoxic activity and the highest agglutinating antibody responses. Hamsters immunized intranasally and revaccinated intraperitoneally were 100% protected against both death and diarrhea. Protection against death and diarrhea correlated with antibody responses to all antigens tested. The results indicate that optimal protection against C. difficile disease can be achieved with combined parenteral and mucosal immunization. PMID:7591115

  14. Innate control of adaptive immunity: Beyond the three-signal paradigm

    PubMed Central

    Jain, Aakanksha; Pasare, Chandrashekhar

    2017-01-01

    Activation of cells in the adaptive immune system is a highly orchestrated process dictated by multiples cues from the innate immune system. Although the fundamental principles of innate control of adaptive immunity are well established, it is not fully understood how innate cells integrate qualitative pathogenic information in order to generate tailored protective adaptive immune responses. In this review, we discuss complexities involved in the innate control of adaptive immunity that extend beyond T cell receptor engagement, co-stimulation and priming cytokine production but are critical for generation of protective T cell immunity. PMID:28483987

  15. Immunogenicity and Safety of the HZ/su Adjuvanted Herpes Zoster Subunit Vaccine in Adults Previously Vaccinated With a Live Attenuated Herpes Zoster Vaccine

    PubMed Central

    Grupping, Katrijn; Campora, Laura; Douha, Martine; Heineman, Thomas C; Klein, Nicola P; Lal, Himal; Peterson, James; Vastiau, Ilse; Oostvogels, Lidia

    2017-01-01

    Abstract Background Protection against herpes zoster (HZ) induced by the live attenuated zoster vaccine Zostavax (ZVL) wanes within 3–7 years. Revaccination may renew protection. We assessed whether (re)vaccination with the adjuvanted HZ subunit vaccine candidate (HZ/su) induced comparable immune responses in previous ZVL recipients and ZVL-naive individuals (HZ-NonVac). Methods In an open-label, multicenter study, adults ≥65 years of age, vaccinated with ZVL ≥5 years previously (HZ-PreVac), were matched to ZVL-naive adults (HZ-NonVac). Participants received 2 doses of HZ/su 2 months apart. The primary objective of noninferiority of the humoral immune response 1 month post–dose 2 was considered demonstrated if the upper limit of the 95% confidence interval (CI) of the adjusted anti–glycoprotein E geometric mean concentration (GMC) ratio of HZ-NonVac over HZ-PreVac was <1.5. HZ/su cellular immunogenicity, reactogenicity, and safety were also assessed. Results In 430 participants, humoral immune response to HZ/su was noninferior in HZ-PreVac compared with HZ-NonVac (adjusted GMC ratio, 1.04 [95% CI, .92–1.17]). Cellular immunogenicity, reactogenicity, and safety appeared to be comparable between groups. HZ/su was well-tolerated, with no safety concerns raised within 1 month post–dose 2. Conclusions HZ/su induces a strong immune response irrespective of prior vaccination with ZVL, and may be an attractive option to revaccinate prior ZVL recipients. Clinical Trials Registration NCT02581410. PMID:29029122

  16. Vaccination with Brucella abortus rough mutant RB51 protects BALB/c mice against virulent strains of Brucella abortus, Brucella melitensis, and Brucella ovis.

    PubMed Central

    Jiménez de Bagüés, M P; Elzer, P H; Jones, S M; Blasco, J M; Enright, F M; Schurig, G G; Winter, A J

    1994-01-01

    Vaccination of BALB/c mice with live Brucella abortus RB51, a stable rough mutant, produced protection against challenge with virulent strains of Brucella abortus, Brucella melitensis, and Brucella ovis. Passive-transfer experiments indicated that vaccinated mice were protected against B. abortus 2308 through cell-mediated immunity, against B. ovis PA through humoral immunity, and against B. melitensis 16M through both forms of immunity. Live bacteria were required for the induction of protective cell-mediated immunity; vaccination with whole killed cells of strain RB51 failed to protect mice against B. abortus 2308 despite development of good delayed-type hypersensitivity reactions. Protective antibodies against the heterologous species were generated in vaccinated mice primarily through anamnestic responses following challenge infections. Growth of the antigenically unrelated bacterium Listeria monocytogenes in the spleens of vaccinated mice indicated that nonspecific killing by residual activated macrophages contributed minimally to protection. These results encourage the continued investigation of strain RB51 as an alternative vaccine against heterologous Brucella species. However, its usefulness against B. ovis would be limited if, as suggested here, epitopes critical for protective cell-mediated immunity are not shared between B. abortus and B. ovis. Images PMID:7927779

  17. Streptococcal Immunity Is Constrained by Lack of Immunological Memory following a Single Episode of Pyoderma

    PubMed Central

    Pandey, Manisha; Ozberk, Victoria; Calcutt, Ainslie; Langshaw, Emma; Powell, Jessica; Rivera-Hernandez, Tania; Philips, Zachary; Batzloff, Michael R.; Good, Michael F.

    2016-01-01

    The immunobiology underlying the slow acquisition of skin immunity to group A streptococci (GAS), is not understood, but attributed to specific virulence factors impeding innate immunity and significant antigenic diversity of the type-specific M-protein, hindering acquired immunity. We used a number of epidemiologically distinct GAS strains to model the development of acquired immunity. We show that infection leads to antibody responses to the serotype-specific determinants on the M-protein and profound protective immunity; however, memory B cells do not develop and immunity is rapidly lost. Furthermore, antibodies do not develop to a conserved M-protein epitope that is able to induce immunity following vaccination. However, if re-infected with the same strain within three weeks, enduring immunity and memory B-cells (MBCs) to type-specific epitopes do develop. Such MBCs can adoptively transfer protection to naïve recipients. Thus, highly protective M-protein-specific MBCs may never develop following a single episode of pyoderma, contributing to the slow acquisition of immunity and to streptococcal endemicity in at-risk populations. PMID:28027314

  18. Live-Attenuated Lentivirus Immunization Modulates Innate Immunity and Inflammation while Protecting Rhesus Macaques from Vaginal Simian Immunodeficiency Virus Challenge

    PubMed Central

    Genescà, Meritxell; Ma, Zhong-Min; Wang, Yichuan; Assaf, Basel; Qureshi, Huma; Fritts, Linda; Huang, Ying; McChesney, Michael B.

    2012-01-01

    Immunization with attenuated lentiviruses is the only reliable method of protecting rhesus macaques (RM) from vaginal challenge with pathogenic simian immunodeficiency virus (SIV). CD8+ lymphocyte depletion prior to SIVmac239 vaginal challenge demonstrated that a modest, Gag-specific CD8+ T cell response induced by immunization with simian-human immunodeficiency virus 89.6 (SHIV89.6) protects RM. Although CD8+ T cells are required for protection, there is no anamnestic expansion of SIV-specific CD8+ T cells in any tissues except the vagina after challenge. Further, SHIV immunization increased the number of viral target cells in the vagina and cervix, suggesting that the ratio of target cells to antiviral CD8+ T cells was not a determinant of protection. We hypothesized that persistent replication of the attenuated vaccine virus modulates inflammatory responses and limits T cell activation and expansion by inducing immunoregulatory T cell populations. We found that attenuated SHIV infection decreased the number of circulating plasmacytoid dendritic cells, suppressed T cell activation, decreased mRNA levels of proinflammatory mediators, and increased mRNA levels of immunoregulatory molecules. Three days after SIV vaginal challenge, SHIV-immunized RM had significantly more T regulatory cells in the vagina than the unimmunized RM. By day 14 postchallenge, immune activation and inflammation were characteristic of unimmunized RM but were minimal in SHIV-immunized RM. Thus, a modest vaccine-induced CD8+ T cell response in the context of immunoregulatory suppression of T cell activation may protect against vaginal HIV transmission. PMID:22696662

  19. Neutrophils Are Central to Antibody-Mediated Protection against Genital Chlamydia.

    PubMed

    Naglak, Elizabeth K; Morrison, Sandra G; Morrison, Richard P

    2017-10-01

    Determining the effector populations involved in humoral protection against genital chlamydia infection is crucial to development of an effective chlamydial vaccine. Antibody has been implicated in protection studies in multiple animal models, and we previously showed that the passive transfer of immune serum alone does not confer immunity in the mouse. Using the Chlamydia muridarum model of genital infection, we demonstrate a protective role for both Chlamydia -specific immunoglobulin G (IgG) and polymorphonuclear neutrophils and show the importance of an antibody/effector cell interaction in mediating humoral immunity. While neutrophils were found to contribute significantly to antibody-mediated protection in vivo , natural killer (NK) cells were dispensable for protective immunity. Furthermore, gamma interferon (IFN-γ)-stimulated primary peritoneal neutrophils (PPNs) killed chlamydiae in vitro in an antibody-dependent manner. The results from this study support the view that an IFN-γ-activated effector cell population cooperates with antibody to protect against genital chlamydia and establish neutrophils as a key effector cell in this response. Copyright © 2017 Naglak et al.

  20. Variations in glycoprotein B contribute to immunogenic difference between PRV variant JS-2012 and Bartha-K61.

    PubMed

    Yu, Zhi-Qing; Tong, Wu; Zheng, Hao; Li, Li-Wei; Li, Guo-Xin; Gao, Fei; Wang, Tao; Liang, Chao; Ye, Chao; Wu, Ji-Qiang; Huang, Qinfeng; Tong, Guang-Zhi

    2017-09-01

    A newly emerged pseudorabies virus (PRV) variant has been identified in many Bartha-K61-vaccinated pig farms. This variant has caused great economic losses to the swine industry in China since 2011. Sequence analysis demonstrated that the gB gene of the emerging PRV variant JS-2012 had multiple variations compared with the vaccine strain Bartha-K61. In the study, a specific CRISPR/Cas9 system combined with homologous recombination was used to construct two recombinant viruses, BJB (Bartha-K61+JS-2012gB) and JBJ (JS-2012-ΔgE/gI+Bartha-K61gB), by interchanging the full-length gB genes between Bartha-K61 and JS-2012-ΔgE/gI. The two recombinant viruses showed similar characteristics in growth kinetics in vitro and similar pathogenicity in mice, as compared to their parental strains. Immunization of mice with inactivated BJB or JBJ followed by challenge of JS-2012 showed that BJB could increase protective efficacy to 80%, compared to only 40% protection by the parental Bartha-K61 strain. JBJ had a decreased protective efficacy of 65%, as compared to 90% protection by its parental JS-2012-ΔgE/gI strain. Exchange of the gB gene markedly altered the immunogenicity of the recombinant PRV. These data suggest that variations in gB might play an important role in the virulence of the reemergent PRV variant in China. Our results demonstrate the importance of gB in protective immunity and suggest that the recombinant virus BJB could be a promising vaccine candidate for eradication of the PRV variant. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

    PubMed Central

    Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

    1999-01-01

    Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

  2. Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens

    PubMed Central

    da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping

    2017-01-01

    ABSTRACT The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant vaccine strain rabies virus particles, which concurrently display the protective CDV and RABV glycoprotein antigens. The recombinant viruses replicated to near-wild-type titers, and the heterologous glycoproteins were efficiently expressed and incorporated in the viral particles. Immunization of ferrets with beta-propiolactone-inactivated recombinant virus particles elicited protective RABV antibody titers, and animals immunized with a combination of CDV attachment protein- and fusion protein-expressing recombinant viruses were protected from lethal CDV challenge. However, animals that were immunized with only a RABV expressing the attachment protein of CDV vaccine strain Onderstepoort succumbed to infection with a more recent wild-type strain, indicating that immune responses to the more conserved fusion protein contribute to protection against heterologous CDV strains. IMPORTANCE Rabies virus and canine distemper virus (CDV) cause high mortality rates and death in many carnivores. While rabies vaccines are inactivated and thus have an excellent safety profile and high stability, live-attenuated CDV vaccines can retain residual virulence in highly susceptible species. Here we generated recombinant inactivated rabies viruses that carry one of the CDV glycoproteins on their surface. Ferrets immunized twice with a mix of recombinant rabies viruses carrying the CDV fusion and attachment glycoproteins were protected from lethal CDV challenge, whereas all animals that received recombinant rabies viruses carrying only the CDV attachment protein according to the same immunization scheme died. Irrespective of the CDV antigens used, all animals developed protective titers against rabies virus, illustrating that a bivalent rabies virus-based vaccine against CDV induces protective immune responses against both pathogens. PMID:28148801

  3. Assessing the risk of CMV reactivation and reconstitution of antiviral immune response post bone marrow transplantation by the QuantiFERON-CMV-assay and real time PCR.

    PubMed

    Krawczyk, Adalbert; Ackermann, Jessica; Goitowski, Birgit; Trenschel, Rudolf; Ditschkowski, Markus; Timm, Jörg; Ottinger, Hellmut; Beelen, Dietrich W; Grüner, Nico; Fiedler, Melanie

    CMV reactivation is a major cause of severe complications in allogeneic hematopoietic stem cell transplant (HSCT) recipients. The risk of CMV reactivation depends on the serostatus (+/-) of the donor (D) and recipient (R). The reconstitution of CMV-specific T-cell responses after transplantation is crucial for the control of CMV reactivation. The study aimed to determine the cellular immune status correlating with protection from high-level CMV viremia (>5000 copies/ml) and disease. We monitored CMV-specific cellular immune responses in 9 high-risk (D-/R+), 14 intermediate risk (D+/R+) and 3 low risk individuals (D+/R-), and 8 CMV negative controls (D-/R-). Interferon- γ (IFN-γ) levels as a marker for the CD8+ T-cell response were determined by the QuantiFERON-CMV-assay and compared to viral loads determined by PCR. Early CMV reactivation was detected in all high-risk and 13/14 intermediate risk individuals. High-level viremia was detected in 5/7 high and 7/14 intermediate risk patients. Reconstitution of the CMV-specific cellular immune response started from 3 months after transplantation and resulted in protection against CMV reactivation. Re-establishing of CMV-specific T-cell immune responses with IFN- γ levels >8.9 IU/ml is crucial for protection from high-level CMV viremia. Monitoring of HSCT-recipients with the QuantiFERON-CMV-assay might be of great benefit to optimize antiviral treatment. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Immune responses and protection after DNA vaccination against Toxoplasma gondii calcium-dependent protein kinase 2 (TgCDPK2)

    PubMed Central

    Chen, Kai; Wang, Jin-Lei; Huang, Si-Yang; Yang, Wen-Bin; Zhu, Wei-Ning; Zhu, Xing-Quan

    2017-01-01

    Toxoplasma gondii, an intracellular zoonotic protozoan parasite, is possibly the most widespread parasite of warm-blooded animals and can cause serious public health problems and economic losses worldwide. TgCDPK2, a member of the T. gondii calcium-dependent protein kinase family, was recently identified as an essential regulator for viable cyst development in T. gondii. In the present study, we evaluated the protective immunity induced by DNA vaccination based on a recombinant eukaryotic plasmid, pVAX-TgCDPK2, against acute toxoplasmosis in mice. BALB/c mice were intramuscularly immunized with pVAX-TgCDPK2 plasmid and then challenged by infection with the highly virulent RH strain of T. gondii. The specific immune responses and protective efficacy against T. gondii were analyzed by cytokine and serum antibody measurements, lymphocyte proliferation assays, flow cytometric on lymphocytes and the survival time of mice after challenge. Our results showed that mice immunized with pVAX-TgCDPK2 could elicit special humoral and cellular responses, with higher levels of IgG antibody, and increased levels of Th1-type cytokines IFN-γ, IL-12(p70), and CD3 + CD4 + CD8 − and CD3 + CD8 + CD4 − T cells, and had a prolonged survival time (14.0 ± 2.32 days) compared to control mice. These results demonstrate that pVAX-TgCDPK2 is a potential vaccine candidate against acute toxoplasmosis. PMID:29119944

  5. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Chimpanzee adenovirus vaccine generates acute and durable protective immunity against ebolavirus challenge.

    PubMed

    Stanley, Daphne A; Honko, Anna N; Asiedu, Clement; Trefry, John C; Lau-Kilby, Annie W; Johnson, Joshua C; Hensley, Lisa; Ammendola, Virginia; Abbate, Adele; Grazioli, Fabiana; Foulds, Kathryn E; Cheng, Cheng; Wang, Lingshu; Donaldson, Mitzi M; Colloca, Stefano; Folgori, Antonella; Roederer, Mario; Nabel, Gary J; Mascola, John; Nicosia, Alfredo; Cortese, Riccardo; Koup, Richard A; Sullivan, Nancy J

    2014-10-01

    Ebolavirus disease causes high mortality, and the current outbreak has spread unabated through West Africa. Human adenovirus type 5 vectors (rAd5) encoding ebolavirus glycoprotein (GP) generate protective immunity against acute lethal Zaire ebolavirus (EBOV) challenge in macaques, but fail to protect animals immune to Ad5, suggesting natural Ad5 exposure may limit vaccine efficacy in humans. Here we show that a chimpanzee-derived replication-defective adenovirus (ChAd) vaccine also rapidly induced uniform protection against acute lethal EBOV challenge in macaques. Because protection waned over several months, we boosted ChAd3 with modified vaccinia Ankara (MVA) and generated, for the first time, durable protection against lethal EBOV challenge.

  7. 45 CFR 61.16 - Immunity.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Immunity. 61.16 Section 61.16 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION HEALTHCARE INTEGRITY AND PROTECTION DATA BANK... Information by the Healthcare Integrity and Protection Data Bank § 61.16 Immunity. Individuals, entities or...

  8. 45 CFR 61.16 - Immunity.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 1 2012-10-01 2012-10-01 false Immunity. 61.16 Section 61.16 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION HEALTHCARE INTEGRITY AND PROTECTION DATA BANK... Information by the Healthcare Integrity and Protection Data Bank § 61.16 Immunity. Individuals, entities or...

  9. 45 CFR 61.16 - Immunity.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 1 2011-10-01 2011-10-01 false Immunity. 61.16 Section 61.16 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION HEALTHCARE INTEGRITY AND PROTECTION DATA BANK... Information by the Healthcare Integrity and Protection Data Bank § 61.16 Immunity. Individuals, entities or...

  10. A novel vaccine p846 encoding Rv3615c, Mtb10.4, and Rv2660c elicits robust immune response and alleviates lung injury induced by Mycobacterium infection.

    PubMed

    Kong, Hongmei; Dong, Chunsheng; Xiong, Sidong

    2014-01-01

    Development of effective anti-tuberculosis (TB) vaccines is one of the important steps to improve control of TB. Cell-mediated immune response significantly affects the control of M. tuberculosis infection. Thus, vaccines able to elicit strong cellular immune response hold special advantages against TB. In this study, three well-defined mycobacterial antigens (Rv3615c, Mtb10.4 [Rv0228], and Rv2660c) were engineered as a novel triple-antigen fusion DNA vaccine p846. The p846 vaccine consists of a high density of CD4(+) and CD8(+) T-cell epitopes. Intramuscular immunization of p846 induced robust T cells mediated immune response comparable to that of bacillus Calmette-Guérin (BCG) vaccination but more effective than that of individual antigen vaccination. After mycobacterial challenge, p846 immunization decreased bacterial burden at least 15-fold compared with individual antigen-based vaccination. Notably, the lungs of mice immunized with p846 exhibited fewer inflammatory cell infiltrates and less damage than those of control group mice. Our data demonstrate that the potential of p846 vaccine to protect against TB and the feasibility of this design strategy for further TB vaccine development.

  11. Evolution of lactation: nutrition v. protection with special reference to five mammalian species.

    PubMed

    McClellan, Holly L; Miller, Susan J; Hartmann, Peter E

    2008-12-01

    The evolutionary origin of the mammary gland has been difficult to establish because little knowledge can be gained on the origin of soft tissue organs from fossil evidence. One approach to resolve the origin of lactation has compared the anatomy of existing primitive mammals to skin glands, whilst another has examined the metabolic and molecular synergy between mammary gland development and the innate immune system. We have reviewed the physiology of lactation in five mammalian species with special reference to these theories. In all species, milk fulfils dual functions of providing protection and nutrition to the young and, furthermore, within species the quality and quantity of milk are highly conserved despite maternal malnutrition or illness. There are vast differences in birth weight, milk production, feeding frequency, macronutrient concentration, growth rate and length of lactation between rabbits, quokkas (Setonix brachyurus), pigs, cattle and humans. The components that protect the neonate against infection do so without causing inflammation. Many protective components are not unique to the mammary gland and are shared with the innate immune system. In contrast, many of the macronutrients in milk are unique to the mammary gland, have evolved from components of the innate immune system, and have either retained or developed multiple functions including the provision of nourishment and protection of the hatchling/neonate. Thus, there is a strong argument to suggest that the mammary gland evolved from the inflammatory response; however, the extensive protection that has developed in milk to actively avoid triggering inflammation seems to be a contradiction.

  12. Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity

    PubMed Central

    Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo

    2011-01-01

    Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073

  13. Evaluation of humoral and cell-mediated inducible immunity to Haemophilus ducreyi in an animal model of chancroid.

    PubMed Central

    Desjardins, M; Filion, L G; Robertson, S; Kobylinski, L; Cameron, D W

    1996-01-01

    To study the mechanisms of inducible immunity to Haemophilus ducreyi infection in the temperature-dependent rabbit model of chancroid, we conducted passive immunization experiments and characterized the inflammatory infiltrate of chancroidal lesions. Polyclonal immunoglobulin G was purified from immune sera raised against H. ducreyi 35000 whole-cell lysate or a pilus preparation and from naive control rabbits. Rabbits were passively immunized with 24 or 48 mg of purified polyclonal immunoglobulin G intravenously, followed 24 h after infusion by homologous titered infectious challenge. Despite titratable antibody, no significant difference in infection or disease was observed. We then evaluated the immunohistology of lesions produced by homologous-strain challenge in sham-immunized rabbits and those protectively vaccinated by pilus preparation immunization. Immunohistochemical stains for CD5 and CD4 T-lymphocyte markers were performed on lesion sections 4, 10, 15, and 21 days from infection. Lesions of pilus preparation vaccinees compared with those of controls had earlier infiltration with significantly more T lymphocytes (CD5+) and with a greater proportion of CD4+ T lymphocytes at day 4 (33% +/- 55% versus 9.7% +/- 2%; P = 0.002), corroborating earlier sterilization (5.0 +/- 2 versus 13.7 +/- 0.71 days; P < 0.001) and lesion resolution. Intraepithelial challenge of pilus-vaccinated rabbits with 100 micrograms of the pilus preparation alone produced indurated lesions within 48 h with lymphoid and plasmacytoid infiltration, edema, and extravasation of erythrocytes. We conclude that passive immunization may not confer a vaccine effect in this model and that active vaccination with a pilus preparation induces a delayed-type hypersensitivity skin test response and confers protection through cell-mediated immunity seen as an amplified lymphocytic infiltrate and accelerated maturation of the T-lymphocyte response. PMID:8613391

  14. Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.

    PubMed

    Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier

    2009-03-23

    Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

  15. Innate Immunity and Breast Milk.

    PubMed

    Cacho, Nicole Theresa; Lawrence, Robert M

    2017-01-01

    Human milk is a dynamic source of nutrients and bioactive factors; unique in providing for the human infant's optimal growth and development. The growing infant's immune system has a number of developmental immune deficiencies placing the infant at increased risk of infection. This review focuses on how human milk directly contributes to the infant's innate immunity. Remarkable new findings clarify the multifunctional nature of human milk bioactive components. New research techniques have expanded our understanding of the potential for human milk's effect on the infant that will never be possible with milk formulas. Human milk microbiome directly shapes the infant's intestinal microbiome, while the human milk oligosaccharides drive the growth of these microbes within the gut. New techniques such as genomics, metabolomics, proteomics, and glycomics are being used to describe this symbiotic relationship. An expanded role for antimicrobial proteins/peptides within human milk in innate immune protection is described. The unique milieu of enhanced immune protection with diminished inflammation results from a complex interaction of anti-inflammatory and antioxidative factors provided by human milk to the intestine. New data support the concept of mucosal-associated lymphoid tissue and its contribution to the cellular content of human milk. Human milk stem cells (hMSCs) have recently been discovered. Their direct role in the infant for repair and regeneration is being investigated. The existence of these hMSCs could prove to be an easily harvested source of multilineage stem cells for the study of cancer and tissue regeneration. As the infant's gastrointestinal tract and immune system develop, there is a comparable transition in human milk over time to provide fewer immune factors and more calories and nutrients for growth. Each of these new findings opens the door to future studies of human milk and its effect on the innate immune system and the developing infant.

  16. Immunogenicity and Protective Efficacy of the DAR-901 Booster Vaccine in a Murine Model of Tuberculosis

    PubMed Central

    Lahey, Timothy; Laddy, Dominick; Hill, Krystal; Schaeffer, Jacqueline; Hogg, Alison; Keeble, James; Dagg, Belinda; Ho, Mei Mei; Arbeit, Robert D.; von Reyn, C. Fordham

    2016-01-01

    Background The development of a novel tuberculosis vaccine is a leading global health priority. SRL172, an inactivated, whole-cell mycobacterial vaccine, was safe, immunogenic and reduced the incidence of culture-confirmed tuberculosis in a phase III trial in HIV-infected and BCG immunized adults in Tanzania. Here we describe the immunogenicity and protective efficacy of DAR-901, a booster vaccine against tuberculosis manufactured from the same seed strain using a new scalable method. Methods We evaluated IFN-γ responses by ELISpot and antibody responses by enzyme linked immunosorbent assay in C57BL/6 and BALB/c mice after three doses of DAR-901. In an aerosol challenge model, we evaluated the protective efficacy of the DAR-901 booster in C57BL/6 mice primed with BCG and boosted with two doses of DAR-901 at 4 dosage levels in comparison with homologous BCG boost. Results DAR-901 vaccination elicited IFN-γ responses to mycobacterial antigen preparations derived from both DAR-901 and Mycobacterium tuberculosis. DAR-901 immunization enhanced antibody responses to DAR-901 but not Mycobacterium tuberculosis lysate or purified protein derivative. Among animals primed with BCG, boosting with DAR-901 at 1 mg provided greater protection against aerosol challenge than a homologous BCG boost (lungs P = 0.036, spleen P = 0.028). Conclusions DAR-901 induces cellular and humoral immunity and boosts protection from M. tuberculosis compared to a homologous BCG boost. PMID:27997597

  17. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    PubMed

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  18. HPV16 seropositivity and subsequent HPV16 infection risk in a naturally infected population: comparison of serological assays.

    PubMed

    Lin, Shih-Wen; Ghosh, Arpita; Porras, Carolina; Markt, Sarah C; Rodriguez, Ana Cecilia; Schiffman, Mark; Wacholder, Sholom; Kemp, Troy J; Pinto, Ligia A; Gonzalez, Paula; Wentzensen, Nicolas; Esser, Mark T; Matys, Katie; Meuree, Ariane; Quint, Wim; van Doorn, Leen-Jan; Herrero, Rolando; Hildesheim, Allan; Safaeian, Mahboobeh

    2013-01-01

    Several serological assays have been developed to detect antibodies elicited against infections with oncogenic human papillomavirus (HPV) type 16. The association between antibody levels measured by various assays and subsequent HPV infection risk may differ. We compared HPV16-specific antibody levels previously measured by a virus-like particle (VLP)-based direct enzyme-linked immunoassay (ELISA) with levels measured by additional assays and evaluated the protection against HPV16 infection conferred at different levels of the assays. Replicate enrollment serum aliquots from 388 unvaccinated women in the control arm of the Costa Rica HPV vaccine trial were measured for HPV16 seropositivity using three serological assays: a VLP-based direct ELISA; a VLP-based competitive Luminex immunoassay (cLIA); and a secreted alkaline phosphatase protein neutralization assay (SEAP-NA). We assessed the association of assay seropositivity and risk of subsequent HPV16 infection over four years of follow-up by calculating sampling-adjusted odds ratios (OR) and HPV16 seropositivity based on standard cutoff from the cLIA was significantly associated with protection from subsequent HPV16 infection (OR = 0.48, CI = 0.27-0.86, compared with seronegatives). Compared with seronegatives, the highest seropositive tertile antibody levels from the direct ELISA (OR = 0.53, CI = 0.28-0.90) as well as the SEAP-NA (OR = 0.20, CI = 0.06, 0.64) were also significantly associated with protection from HPV16 infection. Enrollment HPV16 seropositivity by any of the three serological assays evaluated was associated with protection from subsequent infection, although cutoffs for immune protection were different. We defined the assays and seropositivity levels after natural infection that better measure and translate to protective immunity.

  19. bioA mutant of Mycobacterium tuberculosis shows severe growth defect and imparts protection against tuberculosis in guinea pigs

    PubMed Central

    Kar, Ritika; Nangpal, Prachi; Mathur, Shubhita; Singh, Swati

    2017-01-01

    Owing to the devastation caused by tuberculosis along with the unsatisfactory performance of the Bacillus Calmette–Guérin (BCG) vaccine, a more efficient vaccine than BCG is required for the global control of tuberculosis. A number of studies have demonstrated an essential role of biotin biosynthesis in the growth and survival of several microorganisms, including mycobacteria, through deletion of the genes involved in de novo biotin biosynthesis. In this study, we demonstrate that a bioA mutant of Mycobacterium tuberculosis (MtbΔbioA) is highly attenuated in the guinea pig model of tuberculosis when administered aerogenically as well as intradermally. Immunization with MtbΔbioA conferred significant protection in guinea pigs against an aerosol challenge with virulent M. tuberculosis, when compared with the unvaccinated animals. Booster immunization with MtbΔbioA offered no advantage over a single immunization. These experiments demonstrate the vaccinogenic potential of the attenuated M. tuberculosis bioA mutant against tuberculosis. PMID:28658275

  20. Lung dendritic cells imprint T cell lung homing and promote lung immunity through the chemokine receptor CCR4

    PubMed Central

    Strassner, James P.

    2013-01-01

    T cell trafficking into the lung is critical for lung immunity, but the mechanisms that mediate T cell lung homing are not well understood. Here, we show that lung dendritic cells (DCs) imprint T cell lung homing, as lung DC–activated T cells traffic more efficiently into the lung in response to inhaled antigen and at homeostasis compared with T cells activated by DCs from other tissues. Consequently, lung DC–imprinted T cells protect against influenza more effectively than do gut and skin DC–imprinted T cells. Lung DCs imprint the expression of CCR4 on T cells, and CCR4 contributes to T cell lung imprinting. Lung DC–activated, CCR4-deficient T cells fail to traffic into the lung as efficiently and to protect against influenza as effectively as lung DC–activated, CCR4-sufficient T cells. Thus, lung DCs imprint T cell lung homing and promote lung immunity in part through CCR4. PMID:23960189

  1. PREFERENTIAL SECRETION OF INDUCIBLE HSP70 BY VITILIGO MELANOCYTES UNDER STRESS

    PubMed Central

    Mosenson, Jeffrey A.; Flood, Kelsey; Klarquist, Jared; Eby, Jonathan M.; Koshoffer, Amy; Boissy, Raymond E.; Overbeck, Andreas; C.Tung, Rebecca; Poole, I. Caroline Le

    2014-01-01

    SUMMARY Inducible HSP70 (HSP70i) chaperones peptides from stressed cells, protecting them from apoptosis. Upon extracellular release, HSP70i serves an adjuvant function, enhancing immune responses to bound peptides. We questioned whether HSP70i differentially protects control and vitiligo melanocytes from stress and subsequent immune responses. We compared expression of HSP70i in skin samples, evaluated the viability of primary vitiligo and control melanocytes exposed to bleaching phenols, and measured secreted HSP70i. We determined whether HSP70i traffics to melanosomes to contact immunogenic proteins by cell fractionation, western blotting, electron microscopy and confocal microscopy. Viability of vitiligo and control melanocytes was equally affected under stress. However, vitiligo melanocytes secreted increased amounts of HSP70i in response to MBEH, corroborating with aberrant HSP70i expression in patient skin. Intracellular HSP70i colocalized with melanosomes, and more so in response to MBEH in vitiligo melanocytes. Thus whereas either agent is cytotoxic to melanocytes, MBEH preferentially induces immune responses to melanocytes. PMID:24354861

  2. Adenovirus vector-induced immune responses in nonhuman primates: responses to prime boost regimens.

    PubMed

    Tatsis, Nia; Lasaro, Marcio O; Lin, Shih-Wen; Haut, Larissa H; Xiang, Zhi Q; Zhou, Dongming; Dimenna, Lauren; Li, Hua; Bian, Ang; Abdulla, Sarah; Li, Yan; Giles-Davis, Wynetta; Engram, Jessica; Ratcliffe, Sarah J; Silvestri, Guido; Ertl, Hildegund C; Betts, Michael R

    2009-05-15

    In the phase IIb STEP trial an HIV-1 vaccine based on adenovirus (Ad) vectors of the human serotype 5 (AdHu5) not only failed to induce protection but also increased susceptibility to HIV-1 infection in individuals with preexisting neutralizing Abs against AdHu5. The mechanisms underlying the increased HIV-1 acquisition rates have not yet been elucidated. Furthermore, it remains unclear if the lack of the vaccine's efficacy reflects a failure of the concept of T cell-mediated protection against HIV-1 or a product failure of the vaccine. Here, we compared two vaccine regimens based on sequential use of AdHu5 vectors or two different chimpanzee-derived Ad vectors in rhesus macaques that were AdHu5 seropositive or seronegative at the onset of vaccination. Our results show that heterologous booster immunizations with the chimpanzee-derived Ad vectors induced higher T and B cell responses than did repeated immunizations with the AdHu5 vector, especially in AdHu5-preexposed macaques.

  3. Immunogenicity of T7 bacteriophage nanoparticles displaying G-H loop of foot-and-mouth disease virus (FMDV).

    PubMed

    Xu, Hai; Bao, Xi; Lu, Yu; Liu, Yamei; Deng, Bihua; Wang, Yiwei; Xu, Yue; Hou, Jibo

    2017-06-01

    Foot-and-mouth disease (FMD) is a highly contagious disease of cloven-hoofed animals that causes severe economic losses worldwide. The G-H loop of the FMDV VP1 structural protein is the major neutralizing antigenic site. However, a fully protective G-H loop peptide vaccine requires the addition of promiscuous Th sites from a source outside VP1. Thus, we demonstrated the potential of T7 bacteriophage based nanoparticles displaying a genetically fused G-H loop peptide (T7-GH) as a FMDV vaccine candidate. Recombinant T7-GH phage was constructed by inserting the G-H loop coding region into the T7 Select 415-1b vector. Purified T7-GH phage nanoparticles were analyzed by SDS-PAGE, Western blot and Dot-ELISA. Pigs seronegative for FMDV exposure were immunized with T7-GH nanoparticles along with the adjuvant Montanide ISA206, and two commercially available FMDV vaccines (InactVac and PepVac). Humoral and cellular immune responses, as well as protection against virulent homologous virus challenge were assessed following single dose immunization. Pigs immunized T7-GH developed comparable anti-VP1 antibody titers to PepVac, although lower LPBE titers than was induced by InactVac. Antigen specific lymphocyte proliferation was detected in T7-GH group similar to that of PepVac group, however, weaker than InactVac group. Pigs immunized with T7-GH developed a neutralizing antibody response stronger than PepVac, but weaker than InactVac. Furthermore, 80% (4/5) of T7-GH immunized pigs were protected from challenge with virulent homologous virus. These findings demonstrate that the T7-GH phage nanoparticles were effective in eliciting antigen specific immune responses in pigs, highlighting the value of such an approach in the research and development of FMDV vaccines. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Innate and Adaptive Immune Responses during Acute M. tuberculosis Infection in Adult Household Contacts in Kampala, Uganda

    PubMed Central

    Mahan, C. Scott; Zalwango, Sarah; Thiel, Bonnie A.; Malone, LaShaunda L.; Chervenak, Keith A.; Baseke, Joy; Dobbs, Dennis; Stein, Catherine M.; Mayanja, Harriet; Joloba, Moses; Whalen, Christopher C.; Boom, W. Henry

    2012-01-01

    Contacts of active pulmonary tuberculosis (TB) patients are at risk for Mycobacterium tuberculosis (MTB) infection. Because most infections are controlled, studies during MTB infection provide insight into protective immunity. We compared immune responses of adult household contacts that did and did not convert the tuberculin skin test (TST). Innate and adaptive immune responses were measured by whole blood assay. Responses of TST converters (TSTC) were compared with persistently TST negative contacts (PTST–) and contacts who were TST+ at baseline (TST+). TLR-2, TLR-4, and IFN-γR responses to IFN-γ did not differ between the groups, nor did γδ T cell responses. T cell responses to MTB antigens differed markedly among TSTC, PTST–, and TST+ contacts. Thus, no differences in innate responses were found among the three household contact groups. However, adaptive T cell responses to MTB antigens did differ before and during MTB infection among PTST–, TSTC, and TST+ contacts. PMID:22492155

  5. Enhanced efficacy and reduced toxicity of multifactorial adjuvants compared with unitary adjuvants as cancer vaccines.

    PubMed

    Ahonen, Cory L; Wasiuk, Anna; Fuse, Shinichiro; Turk, Mary Jo; Ernstoff, Marc S; Suriawinata, Arief A; Gorham, James D; Kedl, Ross M; Usherwood, Edward J; Noelle, Randolph J

    2008-03-15

    Identification of Toll-like receptors (TLRs) and their ligands, and tumor necrosis factor-tumor necrosis factor receptor (TNF-TNFR) pairs have provided the first logical, hypothesis-based strategies to molecularly concoct adjuvants to elicit potent cell-mediated immunity via activation of innate and adaptive immunity. However, isolated activation of one immune pathway in the absence of others can be toxic, ineffective, and detrimental to long-term, protective immunity. Effective engineered vaccines must include agents that trigger multiple immunologic pathways. Here, we report that combinatorial use of CD40 and TLR agonists as a cancer vaccine, compared with monotherapy, elicits high frequencies of self-reactive CD8(+) T cells, potent tumor-specific CD8(+) memory, CD8(+) T cells that efficiently infiltrate the tumor-burdened target organ; therapeutic efficacy; heightened ratios of CD8(+) T cells to FoxP3(+) cells at the tumor site; and reduced hepatotoxicity. These findings provide intelligent strategies for the formulation of multifactorial vaccines to achieve maximal efficacy in cancer vaccine trials in humans.

  6. Human T lymphotropic virus type II infection and humoral responses to pneumococcal polysaccharide and tetanus toxoid vaccines.

    PubMed

    Jarvis, Gary A; Janoff, Edward N; Cheng, Hui; Devita, Deborah; Fasching, Claudine; McCulloch, Charles E; Murphy, Edward L

    2005-04-15

    Infection with human T lymphotropic virus type II (HTLV-II) has been linked to an increased incidence of bacterial pneumonia. To determine whether HTLV-II infection is associated with impaired humoral immune responses, we immunized a cohort of HTLV-II-infected subjects and matched uninfected control subjects with 23-valent pneumococcal polysaccharide and tetanus toxoid vaccines. The pneumococcal polysaccharide vaccine elicited comparable and significant increases in concentrations of IgG against all 5 serotypes tested at 1 and 6 months after immunization in both groups. The avidity and opsonophagocytic functions of the anticapsular IgG were similar. The concentrations of tetanus toxoid-specific IgG also increased comparably and significantly over time in both groups. Thus, HTLV-II-infected persons develop robust humoral responses to potentially protective polysaccharide and protein vaccines.

  7. Comparative analysis of the immune responses induced by native versus recombinant versions of the ASP-based vaccine against the bovine intestinal parasite Cooperia oncophora.

    PubMed

    González-Hernández, Ana; Borloo, Jimmy; Peelaers, Iris; Casaert, Stijn; Leclercq, Georges; Claerebout, Edwin; Geldhof, Peter

    2018-01-01

    The protective capacities of a native double-domain activation-associated secreted protein (ndd-ASP)-based vaccine against the cattle intestinal nematode Cooperia oncophora has previously been demonstrated. However, protection analysis upon vaccination with a recombinantly produced antigen has never been performed. Therefore, the aim of the current study was to test the protective potential of a Pichia-produced double-domain ASP (pdd-ASP)-based vaccine against C. oncophora. Additionally, we aimed to compare the cellular and humoral mechanisms underlying the vaccine-induced responses by the native (ndd-ASP) and recombinant vaccines. Immunisation of cattle with the native C. oncophora vaccine conferred significant levels of protection after an experimental challenge infection, whereas the recombinant vaccine did not. Moreover, vaccination with ndd-ASP resulted in a higher proliferation of CD4-T cells both systemically and in the small intestinal mucosa when compared with animals vaccinated with the recombinant antigen. In terms of humoral response, although both native and recombinant vaccines induced similar levels of antibodies, animals vaccinated with the native vaccine were able to raise antibodies with greater specificity towards ndd-ASP in comparison with antibodies raised by vaccination with the recombinant vaccine, suggesting a differential immune recognition towards the ndd-ASP and pdd-ASP. Finally, the observation that animals displaying antibodies with higher percentages of recognition towards ndd-ASP also exhibited the lowest egg counts suggests a potential relationship between antibody specificity and protection. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  8. Immunization with LJM11 salivary protein protects against infection with Leishmania braziliensis in the presence of Lutzomyia longipalpis saliva.

    PubMed

    Cunha, Jurema M; Abbehusen, Melissa; Suarez, Martha; Valenzuela, Jesus; Teixeira, Clarissa R; Brodskyn, Cláudia I

    2018-01-01

    Leishmania is transmitted in the presence of sand fly saliva. Protective immunity generated by saliva has encouraged identification of a vector salivary-based vaccine. Previous studies have shown that immunization with LJM11, a salivary protein from Lutzomyia longipalpis, is able to induce a Th1 immune response and protect mice against bites of Leishmania major-infected Lutzomyia longipalpis. Here, we further investigate if immunization with LJM11 recombinant protein is able to confer cross-protection against infection with Leishmania braziliensis associated with salivary gland sonicate (SGS) from Lutzomyia intermedia or Lu. longipalpis. Mice immunized with LJM11 protein exhibited an increased production of anti-LJM11 IgG, IgG1 and IgG2a and a DTH response characterized by an inflammatory infiltrate with the presence of CD4 + IFN-γ + T cells. LJM11-immunized mice were intradermally infected in the ear with L. braziliensis in the presence of Lu. longipalpis or Lu. intermedia SGS. A significant reduction of parasite numbers in the ear and lymph node in the group challenged with L. braziliensis plus Lu. longipalpis SGS was observed, but not when the challenge was performed with L. braziliensis plus Lu. intermedia SGS. A higher specific production of IFN-γ and absence of IL-10 by lymph node cells were only observed in LJM11 immunized mice after infection. After two weeks, a similar frequency of CD4 + IFN-γ + T cells was detected in LJM11 and BSA groups challenged with L. braziliensis plus Lu. longipalpis SGS, suggesting that early events possibly triggered by immunization are essential for protection against Leishmania infection. Our findings support the specificity of saliva-mediated immune responses and reinforce the importance of identifying cross-protective salivary antigens. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Does a monovalent inactivated human rotavirus vaccine induce heterotypic immunity?

    PubMed Central

    Jiang, Baoming; Wang, Yuhuan; Glass, Roger I.

    2013-01-01

    There is substantial evidence for broad cross-reactive immunity and heterotypic protection among human rotavirus strains in children with natural infection or with monovalent Rotarix vaccination. In this commentary, we addressed this same topic by testing sera of guinea pigs and gnotobiotic piglets that were intramuscularly immunized with an inactivated human rotavirus vaccine and also demonstrated a broad cross-protective immunity among human rotavirus strains. Our findings from a single human strain in animal studies bode well for a low cost and efficacious inactivated vaccine to protect children against rotavirus disease throughout the world. PMID:23744507

  10. BacMam virus-based surface display of the infectious bronchitis virus (IBV) S1 glycoprotein confers strong protection against virulent IBV challenge in chickens.

    PubMed

    Zhang, Jie; Chen, Xiao-Wei; Tong, Tie-Zhu; Ye, Yu; Liao, Ming; Fan, Hui-Ying

    2014-02-03

    Avian infectious bronchitis virus (IBV) is associated with production inefficiencies in domestic fowl, and causes massive economic losses to the poultry industry worldwide. Progress has been made in designing novel and efficient candidate vaccines to control IBV infection. BacMam virus, a modified baculovirus mediating transgene expression under the control of a mammalian promoter, has emerged as a versatile and safe vector during vaccine development. In previous work, we generated the BacMam virus Ac-CMV-S1, which expressed the S1 glycoprotein of IBV-M41. We showed that Ac-CMV-S1 induced excellent cellular immunity, but did not confer adequate protection in chickens compared with the conventional inactivated vaccine. In the current study, we generated an improved BacMam virus, BV-Dual-S1. This virus displayed the S1 glycoprotein on the baculovirus envelope, and was capable of expressing it in mammalian cells. BV-Dual-S1 elicited stronger humoral and cell-mediated immune responses, and showed greater capacity for induction of cytotoxic T lymphocyte responses, compared with Ac-CMV-S1 in specific pathogen-free chickens. A significant difference was not observed for protection rates between chickens immunized with BV-Dual-S1 (83%) or inactivated vaccine (89%) following challenge with virulent IBV-M41. Our findings show that the protective efficacy of BV-Dual-S1 could be significantly enhanced by baculovirus display technology. BacMam virus-based surface display strategies could serve as effective tools in designing vaccines against IB and other infectious diseases. Copyright © 2013. Published by Elsevier Ltd.

  11. Nasal and skin delivery of IC31(®)-adjuvanted recombinant HSV-2 gD protein confers protection against genital herpes.

    PubMed

    Wizel, Benjamin; Persson, Josefine; Thörn, Karolina; Nagy, Eszter; Harandi, Ali M

    2012-06-19

    Genital herpes caused by herpes simplex virus type 2 (HSV-2) remains the leading cause of genital ulcers worldwide. Given the disappointing results of the recent genital herpes vaccine trials in humans, development of novel vaccine strategies capable of eliciting protective mucosal and systemic immune responses to HSV-2 is urgently required. Here we tested the ability of the adjuvant IC31(®) in combination with HSV-2 glycoprotein D (gD) used through intranasal (i.n.), intradermal (i.d.), or subcutaneous (s.c.) immunization routes for induction of protective immunity against genital herpes infection in C57BL/6 mice. Immunization with gD plus IC31(®) through all three routes of immunization developed elevated gD-specific serum antibody responses with HSV-2 neutralizing activity. Whereas the skin routes promoted the induction of a mixed IgG2c/IgG1 isotype profile, the i.n. route only elicited IgG1 antibodies. All immunization routes were able to induce gD-specific IgG antibody responses in the vaginas of mice immunized with IC31(®)-adjuvanted gD. Although specific lymphoproliferative responses were observed in splenocytes from mice of most groups vaccinated with IC31(®)-adjuvanted gD, only i.d. immunization resulted in a significant splenic IFN-γ response. Further, immunization with gD plus IC31(®) conferred 80-100% protection against an otherwise lethal vaginal HSV-2 challenge with amelioration of viral replication and disease severity in the vagina. These results warrant further exploration of IC31(®) for induction of protective immunity against genital herpes and other sexually transmitted infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Immune protection duration and efficacy stability of DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 against coccidiosis.

    PubMed

    Song, Xiaokai; Zhao, Xiaofang; Xu, Lixin; Yan, Ruofeng; Li, Xiangrui

    2017-04-01

    In our previous study, an effective DNA vaccine encoding Eimeria tenella TA4 and chicken IL-2 was constructed. In the present study, the immunization dose of the DNA vaccine pVAX1.0-TA4-IL-2 was further optimized. With the optimized dose, the dynamics of antibodies induced by the DNA vaccine was determined using indirect ELISA. To evaluate the immune protection duration of the DNA vaccine, two-week-old chickens were intramuscularly immunized twice and the induced efficacy was evaluated by challenging with E. tenella at 5, 9, 13, 17 and 21weeks post the last immunization (PLI) separately. To evaluate the efficacy stability of the DNA vaccine, two-week-old chickens were immunized with 3 batches of the DNA vaccine, and the induced efficacy was evaluated by challenging with E. tenella. The results showed that the optimal dose was 25μg. The induced antibody level persisted until 10weeks PPI. For the challenge time of 5 and 9weeks PLI, the immunization resulted in ACIs of 182.28 and 162.23 beyond 160, showing effective protection. However, for the challenge time of 13, 17 and 21weeks PLI, the immunization resulted in ACIs below 160 which means poor protection. Therefore, the immune protection duration of the DNA vaccination was at least 9weeks PLI. DNA immunization with three batches DNA vaccine resulted in ACIs of 187.52, 191.57 and 185.22, which demonstrated that efficacies of the three batches DNA vaccine were effective and stable. Overall, our results indicate that DNA vaccine pVAX1.0-TA4-IL-2 has the potential to be developed as effective vaccine against coccidiosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

    PubMed

    Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

    2006-03-06

    Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

  14. Governmental Immunity for Public Education: A Shield of Legal Protection.

    ERIC Educational Resources Information Center

    Aitken, Joan E.

    The American tradition of sovereign immunity and the Eleventh Amendment of the United States Constitution have provided certain legal protection to government personnel, including leaders of public elementary, secondary, and post-secondary institutions, but the concept of governmental immunity may be difficult to understand as it applies to…

  15. Influenza Vaccine Effectiveness in the Elderly Based on Administrative Databases: Change in Immunization Habit as a Marker for Bias

    PubMed Central

    Hottes, Travis S.; Skowronski, Danuta M.; Hiebert, Brett; Janjua, Naveed Z.; Roos, Leslie L.; Van Caeseele, Paul; Law, Barbara J.; De Serres, Gaston

    2011-01-01

    Background Administrative databases provide efficient methods to estimate influenza vaccine effectiveness (IVE) against severe outcomes in the elderly but are prone to intractable bias. This study returns to one of the linked population databases by which IVE against hospitalization and death in the elderly was first assessed. We explore IVE across six more recent influenza seasons, including periods before, during, and after peak activity to identify potential markers for bias. Methods and Findings Acute respiratory hospitalization and all-cause mortality were compared between immunized/non-immunized community-dwelling seniors ≥65years through administrative databases in Manitoba, Canada between 2000-01 and 2005-06. IVE was compared during pre-season/influenza/post-season periods through logistic regression with multivariable adjustment (age/sex/income/residence/prior influenza or pneumococcal immunization/medical visits/comorbidity), stratification based on prior influenza immunization history, and propensity scores. Analysis during pre-season periods assessed baseline differences between immunized and unimmunized groups. The study population included ∼140,000 seniors, of whom 50–60% were immunized annually. Adjustment for key covariates and use of propensity scores consistently increased IVE. Estimates were paradoxically higher pre-season and for all-cause mortality vs. acute respiratory hospitalization. Stratified analysis showed that those twice consecutively and currently immunized were always at significantly lower hospitalization/mortality risk with odds ratios (OR) of 0.60 [95%CI0.48–0.75] and 0.58 [0.53–0.64] pre-season and 0.77 [0.69–0.86] and 0.71 [0.66–0.77] during influenza circulation, relative to the consistently unimmunized. Conversely, those forgoing immunization when twice previously immunized were always at significantly higher hospitalization/mortality risk with OR of 1.41 [1.14–1.73] and 2.45 [2.21–2.72] pre-season and 1.21 [1.03–1.43] and 1.78 [1.61–1.96] during influenza circulation. Conclusions The most pronounced IVE estimates were paradoxically observed pre-season, indicating bias tending to over-estimate vaccine protection. Change in immunization habit from that of the prior two years may be a marker for this bias in administrative data sets; however, no analytic technique explored could adjust for its influence. Improved methods to achieve valid interpretation of protection in the elderly are needed. PMID:21818350

  16. Immunization with Live Attenuated Leishmania donovani Centrin−/− Parasites Is Efficacious in Asymptomatic Infection

    PubMed Central

    Ismail, Nevien; Kaul, Amit; Bhattacharya, Parna; Gannavaram, Sreenivas; Nakhasi, Hira L.

    2017-01-01

    Currently, there is no vaccine against visceral leishmaniasis (VL). Toward developing an effective vaccine, we have reported extensively on the immunogenicity of live attenuated LdCentrin−/− mutants in naive animal models. In VL endemic areas, asymptomatic carriers outnumber symptomatic cases of VL and are considered to be a reservoir of infection. Vaccination of asymptomatic cases represents a viable strategy to eliminate VL. Immunological correlates of protection thus derived might have limited applicability in conditions where the immunized host has prior exposure to virulent infection. To examine whether LdCen−/− parasites can induce protective immunity in experimental hosts that have low-level parasitemia from a previous exposure mimicking an asymptomatic condition, we infected C57Bl/6 mice with wild-type Leishmania donovani parasites expressing LLO epitope (LdWTLLO 103, i.v.). After 3 weeks, the mice with low levels of parasitemia were immunized with LdCen−/− parasites expressing 2W epitope (LdCen−/−2W 3 × 106 i.v.) to characterize the immune responses in the same host. Antigen experienced CD4+ T cells from the asymptomatic (LdWTLLO infected) LdCen−/−2W immunized, and other control groups were enriched using LLO- and 2W-specific tetramers, followed by Flow cytometric analysis. Our analysis showed that comparable CD4+ T cell proliferation and CD4+ memory T cell responses (TCM) represented by CD62Lhi, CCR7+, and IL-7R+ T cell populations were induced with LdCen−/−2W in both asymptomatic and naive animals that received LdCen−/− immunization. Upon restimulation with peptide, TCM cells differentiated into effector T cells and there was no significant difference in the recall response in animals with asymptomatic infection. Following virulent challenge, comparable reduction in splenic parasite burden was observed in both asymptomatic and naive LdCen−/− immunized animals concomitant with the development of multifunctional CD4+ and CD8+ T cells. Further, LdCen−/−2W immunization resulted in complete clearance of the preexisting asymptomatic infection (LdWTLLO). Our results demonstrate that LdCen−/−2W immunization could be efficacious for use in asymptomatic VL individuals. Further, immunization with LdCen−/− could help in reducing the parasite burden in the asymptomatic cases and aid in controlling the VL in endemic areas. PMID:29312315

  17. T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models

    PubMed Central

    Watson, Alan M.; Klimstra, William B.

    2017-01-01

    The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus. PMID:28398253

  18. T Cell-Mediated Immunity towards Yellow Fever Virus and Useful Animal Models.

    PubMed

    Watson, Alan M; Klimstra, William B

    2017-04-11

    The 17D line of yellow fever virus vaccines is among the most effective vaccines ever created. The humoral and cellular immunity elicited by 17D has been well characterized in humans. Neutralizing antibodies have long been known to provide protection against challenge with a wild-type virus. However, a well characterized T cell immune response that is robust, long-lived and polyfunctional is also elicited by 17D. It remains unclear whether this arm of immunity is protective following challenge with a wild-type virus. Here we introduce the 17D line of yellow fever virus vaccines, describe the current state of knowledge regarding the immunity directed towards the vaccines in humans and conclude with a discussion of animal models that are useful for evaluating T cell-mediated immune protection to yellow fever virus.

  19. Cellular and Humoral Immunity Protect against Vaginal Zika Virus Infection in Mice.

    PubMed

    Scott, Jason M; Lebratti, Tania J; Richner, Justin M; Jiang, Xiaoping; Fernandez, Estefania; Zhao, Haiyan; Fremont, Daved H; Diamond, Michael S; Shin, Haina

    2018-01-17

    Zika virus (ZIKV), which can cause devastating disease in fetuses of infected pregnant women, can be transmitted by mosquito inoculation and sexual routes. Little is known about immune protection against sexually transmitted ZIKV. In this study, we show that previous infection through intravaginal or subcutaneous routes with a contemporary Brazilian strain of ZIKV can protect against subsequent intravaginal challenge with a homologous strain. Both routes of inoculation induced high titers of ZIKV-specific and neutralizing antibody in serum and the vaginal lumen. Virus-specific T cells were recruited to and retained in the female reproductive tract after intravaginal and subcutaneous ZIKV infection. Studies in mice with genetic or acquired deficiencies in B and/or T cells demonstrated that both lymphocyte populations redundantly protect against intravaginal challenge in ZIKV-immune animals. Passive transfer of ZIKV immune IgG or T cells significantly limited intravaginal infection of naïve mice, although antibody more effectively prevented dissemination throughout the reproductive tract. Collectively, our experiments begin to establish the immune correlates of protection against intravaginal ZIKV infection, which should inform vaccination strategies in non-pregnant and pregnant women. IMPORTANCE The recent ZIKV epidemic resulted in devastating outcomes in fetuses and may affect reproductive health. Unlike other flaviviruses, ZIKV can be spread by sexual contact as well as a mosquito vector. While previous studies have identified correlates of protection for mosquito-mediated infection, few have focused on immunity against sexual transmission. As exposure to ZIKV via mosquito bite has likely occurred to many living in endemic areas, our study addresses whether this route of infection can protect against subsequent sexual exposure. We demonstrate that subcutaneous ZIKV infection can protect against subsequent vaginal infection by generating both local antiviral T cell and antibody responses. Our research begins to define the immune correlates of protection for ZIKV infection in the vagina and provides a foundation for testing ZIKV vaccines against sexual transmission. Copyright © 2018 American Society for Microbiology.

  20. Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

    PubMed Central

    Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

    2011-01-01

    Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

  1. Evaluation of the Newcastle Disease Virus F and HN Proteins in Protective Immunity by Using a Recombinant Avian Paramyxovirus Type 3 Vector in Chickens▿

    PubMed Central

    Kumar, Sachin; Nayak, Baibaswata; Collins, Peter L.; Samal, Siba K.

    2011-01-01

    Newcastle disease virus (NDV) belongs to serotype 1 of the avian paramyxoviruses (APMV-1) and causes severe disease in chickens. Current live attenuated NDV vaccines are not fully satisfactory. An alternative is to use a viral vector vaccine that infects chickens but does not cause disease. APMV serotype 3 infects a wide variety of avian species but does not cause any apparent disease in chickens. In this study, we constructed a reverse-genetics system for recovery of infectious APMV-3 strain Netherlands from cloned cDNAs. Two recombinant viruses, rAPMV3-F and rAPMV3-HN, were generated expressing the NDV fusion (F) and hemagglutinin-neuraminidase (HN) proteins, respectively, from added genes. These viruses were used to immunize 2-week-old chickens by the oculonasal route in order to evaluate the contribution of each protein to the induction of NDV-specific neutralizing antibodies and protective immunity. Each virus induced high titers of NDV-specific hemagglutination inhibition and serum neutralizing antibodies, but the response to F protein was greater. Protective immunity was evaluated by challenging the immunized birds 21 days later with virulent NDV via the oculonasal, intramuscular, or intravenous route. With oculonasal or intramuscular challenge, all three recombinant viruses (rAPMV3, rAPMV3-F, and rAPMV3-HN) were protective, while all unvaccinated birds succumbed to death. These results indicated that rAPMV3 alone can provide cross-protection against NDV challenge. However, with intravenous challenge, birds immunized with rAPMV3 were not protected, whereas birds immunized with rAPMV3-F alone or in combination with rAPMV3-HN were completely protected, and birds immunized with rAPMV3-HN alone were partially protected. These results indicate that the NDV F and HN proteins are independent neutralization and protective antigens, but the contribution by F is greater. rAMPV3 represents an avirulent vaccine vector that can be used against NDV and other poultry pathogens. PMID:21525340

  2. CHRONOVAC VOYAGEUR: A study of the immune response to yellow fever vaccine among infants previously immunized against measles.

    PubMed

    Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel

    2017-10-27

    For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27days. The absence of protective antibodies against yellow fever was observed only among infants who received both vaccines simultaneously. These results may support a revision of current vaccination recommendations concerning the administration of these two live attenuated vaccines either on the same day or at least 28days apart. Our findings show no statistically significant difference if the interval between both vaccines is more than 24 h, but the immune response seems to be reduced when the two vaccines are given at the same time. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Hepatitis B immunization in a low-incidence province of Canada: comparing alternative strategies.

    PubMed

    Wiebe, T; Fergusson, P; Horne, D; Shanahan, M; Macdonald, A; Heise, L; Roos, L L

    1997-01-01

    This study provides a comparative cost-effectiveness analysis of three universal immunization programs for hepatitis B virus (HBV). Using three theoretical cohorts of infants, 10-year-olds, and 12-year-olds, a universal immunization program was compared with a prenatal screening/newborn immunization program involving testing of prepartum women and immunization of newborns of HBsAg-positive mothers. A Markov long-term outcome model used Manitoba data to estimate costs and health outcomes across the lifespan. The model was based on an HBV incidence rate of 19/100,000 and a discount rate of 5% and incorporated the most recent treatment advances (interferon therapy). Cost-effectiveness was calculated as the ratio of dollars spent per year of life saved, with costs determined from the perspective of a third-party payer. The universal infant-immunization program, although not cost-saving, was associated with a low, economically attractive cost-effectiveness ratio of $15,900 (Canadian) per year of life saved, a figure substantially lower than the ratios of $97,600 and $184,800 (Canadian) associated with the universal programs for 10- and 12-year-olds, respectively. Cost-effectiveness ratios were found to be sensitive to changes in immunization costs, HBV incidence rates, and the rate at which protective antibody levels are lost over time: If these variables move in the directions suggested by current trends, the authors anticipate an increasing economic appeal of universal programs well into the future. A universal program of HBV immunization for infants appears to be economically practical in regions where HBV infection rates are low and stable.

  4. Effective Protection Induced by a Monovalent DNA Vaccine against Dengue Virus (DV) Serotype 1 and a Bivalent DNA Vaccine against DV1 and DV2 in Mice.

    PubMed

    Zheng, Xiaoyan; Chen, Hui; Wang, Ran; Fan, Dongying; Feng, Kaihao; Gao, Na; An, Jing

    2017-01-01

    Dengue virus (DV) is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.

  5. Protection of chickens against H9N2 avian influenza virus challenge with recombinant Lactobacillus plantarum expressing conserved antigens.

    PubMed

    Yang, Wen-Tao; Yang, Gui-Lian; Shi, Shao-Hua; Liu, Yu-Ying; Huang, Hai-Bin; Jiang, Yan-Long; Wang, Jian-Zhong; Shi, Chun-Wei; Jing, Yu-Bei; Wang, Chun-Feng

    2017-06-01

    Avian influenza virus (AIV) is spreading worldwide and is a serious threat to the health of poultry and humans. In many countries, low pathogenic AIVs, such as H9N2, have become an enormous economic burden on the commercial poultry industry because they cause mild respiratory disease and decrease egg production. A recombinant Lactobacillus plantarum NC8 strain expressing NP-M1-DCpep from H9N2 AIV has been studied in a mouse model. However, it remains unknown whether this L. plantarum strain can induce an immune response and provide protection against H9N2 AIV in chickens. In this study, chickens that were orally vaccinated with NC8-pSIP409-NP-M1-DCpep exhibited significantly increased T cell-mediated immune responses and mucosal sIgA and IgG levels, which provided protection against H9N2 AIV challenge. More importantly, compared with oral administration of NC8-pSIP409-NP-M1-DCpep, intranasal administration induced stronger immune responses and provided effective protection against challenge with the H9N2 virus by reducing body weight loss, lung virus titers, and throat pathology. Taken together, these findings suggest that L. plantarum expressing NP-M1-DCpep has potential as a vaccine to combat H9N2 AIV infection.

  6. Anti-pathogen protection versus survival costs mediated by an ectosymbiont in an ant host.

    PubMed

    Konrad, Matthias; Grasse, Anna V; Tragust, Simon; Cremer, Sylvia

    2015-01-22

    The fitness effects of symbionts on their hosts can be context-dependent, with usually benign symbionts causing detrimental effects when their hosts are stressed, or typically parasitic symbionts providing protection towards their hosts (e.g. against pathogen infection). Here, we studied the novel association between the invasive garden ant Lasius neglectus and its fungal ectosymbiont Laboulbenia formicarum for potential costs and benefits. We tested ants with different Laboulbenia levels for their survival and immunity under resource limitation and exposure to the obligate killing entomopathogen Metarhizium brunneum. While survival of L. neglectus workers under starvation was significantly decreased with increasing Laboulbenia levels, host survival under Metarhizium exposure increased with higher levels of the ectosymbiont, suggesting a symbiont-mediated anti-pathogen protection, which seems to be driven mechanistically by both improved sanitary behaviours and an upregulated immune system. Ants with high Laboulbenia levels showed significantly longer self-grooming and elevated expression of immune genes relevant for wound repair and antifungal responses (β-1,3-glucan binding protein, Prophenoloxidase), compared with ants carrying low Laboulbenia levels. This suggests that the ectosymbiont Laboulbenia formicarum weakens its ant host by either direct resource exploitation or the costs of an upregulated behavioural and immunological response, which, however, provides a prophylactic protection upon later exposure to pathogens. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  7. A Promising Listeria-Vectored Vaccine Induces Th1-Type Immune Responses and Confers Protection Against Tuberculosis.

    PubMed

    Yin, Yuelan; Lian, Kai; Zhao, Dan; Tao, Chengwu; Chen, Xiang; Tan, Weijun; Wang, Xiaobo; Xu, Zhengzhong; Hu, Maozhi; Rao, Yan; Zhou, Xiaohui; Pan, Zhiming; Zhang, Xiaoming; Jiao, Xin'an

    2017-01-01

    Deaths associated with tuberculosis (TB) is rising and accounted for 1.4 million deaths in 2015 many of which were due to drug-resistant bacteria. Vaccines represent an important medical intervention, but the current Bacilli Calmette-Guerin (BCG) vaccine is not ideal for the protection of teenagers and adults. Therefore, a safe and effective vaccine is urgently needed. In this study, we designed a novel vaccine using an attenuated Listeria monocytogenes strain carrying fusion antigen FbpB-ESAT-6 (rLM) and characterized its safety and protective efficacy against Mycobacterium tuberculosis ( M.tb ) infection in mice. Compared to the wild type strain yzuLM4 and parental strain LMΔ actA/plcB (LM1-2), the virulence of rLM was significantly reduced as judged by its infectious kinetics and LD 50 dose. Further characterization of intravenous immunization showed that prime-boost vaccination significantly increased the levels of Th1 cytokines (IFN-γ, IL-17, and IL-6), and enhanced cytotoxic T lymphocyte (CTL) CTLs activity, suggesting that rLM could elicit potent Th1/Th17 responses. More importantly, rLM significantly conferred the protection against M.tb H37Rv challenge. Collectively, our findings indicated that rLM is a novel and useful tool to prevent M.tb infection, and can be potentially be used to boost BCG-primed immunity.

  8. Active immunizations with peptide-DC vaccines and passive transfer with antibodies protect neutropenic mice against disseminated candidiasis.

    PubMed

    Xin, Hong

    2016-01-04

    We previously report that peptide-pulsed dendritic cell (DC) vaccination, which targeting two peptides (Fba and Met6) expressed on the cell surface of Candida albicans, can induce high degree of protection against disseminated candidiasis in immunocompetent mice. Passive transfer of immune sera from the peptide immunized mice or peptide-related monoclonal antibodies demonstrated that protection was medicated by peptide-specific antibodies. In this study the efficacy of active and passive immunization against disseminated candidiasis was tested in mice with cyclophosphamide-induced neutropenia. Peptide-DC vaccines were given to mice prior to induction of neutropenia. We show active immunization with either Fba or Met6 peptide-DC vaccine significantly improved the survival and reduced the fungal burden of disseminated candidiasis in those immunocompromised mice. Importantly, we show that administration of two protective monoclonal antibodies also protect neutropenic mice against the disease, implying possibility of developing a successful passive immunotherapy strategy to treat the disease and protect against disseminated candidiasis. The results of this study are crucial as they address the fundamental questions as to whether the synthetic peptide vaccine induced immunity protects the host during a neutropenic episode. We anticipate that this peptide-vaccine study will serve as the foundation of future investigations into new peptide vaccines comprised of cell surface peptides from other medically important Candida species, as well as other fungi. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Vaccine and Monoclonal Antibody That Enhance Mouse Resistance to Candidiasis ▿

    PubMed Central

    Xin, Hong; Cutler, Jim E.

    2011-01-01

    Previously we showed that antibodies specific for the glycan β-1,2-mannotriose [β-(Man)3] on the cell surface of Candida albicans protect mice against disseminated candidiasis (H. Xin, S. Dziadek, D. R. Bundle, and J. E. Cutler, Proc. Natl. Acad. Sci. U. S. A. 105:13526–13531, 2008). Furthermore, six 14-mer peptides that are within the N-terminal portion of C. albicans wall proteins were conjugated to the glycan in an attempt to create immunogenic glycopeptide conjugates. By a dendritic cell (DC)-based immunization approach, all were immunogenic and three of the six conjugates induced a high degree of protection in mice. Interestingly, whereas all six peptides induced antibody responses when used alone to pulse DCs for subsequent immunizations, three peptides induced protection, and one in particular, peptide Fba (derived from fructose-bisphosphate aldolase), induced robust protective responses and is the focus of the current work. Fba peptide is not restricted by the major histocompatibility complex class II (MHC-II), as it induced anti-Fba antibodies in mice of different H-2 haplotypes and in rabbits. Furthermore, the peptide induced protection against disease caused by different C. albicans strains. Partial protection was achieved when alum was used in place of DCs for Fba immunizations. The passive transfer of immune sera from Fba-vaccinated mice, but not immune serum preabsorbed with fungal cells, conferred protection in naïve mice. This result, along with our finding that a monoclonal antibody specific for the peptide, E2-9 (IgM), protected mice against candidiasis, provide strong evidence that antibodies contribute to protection. Our work demonstrates the utility of cell wall peptides alone or as glycopeptides in vaccines designed for the induction of immunity against candidiasis and monoclonal antibodies as a rapid immunoprotective approach against the disease. PMID:21832099

  10. CXCR6 is a marker for protective antigen-specific cells in the lungs after intranasal immunization against Mycobacterium tuberculosis.

    PubMed

    Lee, Lian Ni; Ronan, Edward O; de Lara, Catherine; Franken, Kees L M C; Ottenhoff, Tom H M; Tchilian, Elma Z; Beverley, Peter C L

    2011-08-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT6(1-20) peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment.

  11. CXCR6 Is a Marker for Protective Antigen-Specific Cells in the Lungs after Intranasal Immunization against Mycobacterium tuberculosis▿

    PubMed Central

    Lee, Lian Ni; Ronan, Edward O.; de Lara, Catherine; Franken, Kees L. M. C.; Ottenhoff, Tom H. M.; Tchilian, Elma Z.; Beverley, Peter C. L.

    2011-01-01

    Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT61–20 peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment. PMID:21628524

  12. Mucosal immunization: a review of strategies and challenges.

    PubMed

    Patel, Hinal; Yewale, Chetan; Rathi, Mohan N; Misra, Ambikanandan

    2014-01-01

    The vast majority of pathogens enter the human body via the mucosal surfaces of the gastrointestinal, respiratory, and urogenital tracts, where they initiate mucosal infections that lead to systemic infections. Despite strong evidence that a good mucosal immune response can effectively prevent systemic infection too, only a few mucosal vaccines are available due to their low efficiency. Most current immunization techniques involve systemic injection, but they are ineffective to induce immunization at a mucosal site. It is a great challenge to target a mucosal compartment that can induce protective immunity at mucosal sites as well as systemic sites. A better understanding of cellular and molecular factors involved in the regulation of mucosal immunity will aid in the design of safer mucosal vaccines that elicit the desired protective immunity against infectious diseases such as HIV. The development of mucosal vaccines, whether for prevention of infectious diseases or for immunotherapy, requires antigen delivery and adjuvant systems that can effectively present vaccine or immunotherapeutic antigens to the mucosal sites. In this review, we examine the mechanism of mucosal protection, induction of mucosal immune response, types of vaccines, current status of marketed vaccines, and novel strategies for protection against infections and for treatment of inflammatory disorders. Additionally, we offer perspectives on future challenges and research directions.

  13. Biochemical and immunological mechanisms by which sickle cell trait protects against malaria.

    PubMed

    Gong, Lauren; Parikh, Sunil; Rosenthal, Philip J; Greenhouse, Bryan

    2013-09-11

    Sickle cell trait (HbAS) is the best-characterized genetic polymorphism known to protect against falciparum malaria. Although the protective effect of HbAS against malaria is well known, the mechanism(s) of protection remain unclear. A number of biochemical and immune-mediated mechanisms have been proposed, and it is likely that multiple complex mechanisms are responsible for the observed protection. Increased evidence for an immune component of protection as well as novel mechanisms, such as enhanced tolerance to disease mediated by HO-1 and reduced parasitic growth due to translocation of host micro-RNA into the parasite, have recently been described. A better understanding of relevant mechanisms will provide valuable insight into the host-parasite relationship, including the role of the host immune system in protection against malaria.

  14. Biochemical and immunological mechanisms by which sickle cell trait protects against malaria

    PubMed Central

    2013-01-01

    Sickle cell trait (HbAS) is the best-characterized genetic polymorphism known to protect against falciparum malaria. Although the protective effect of HbAS against malaria is well known, the mechanism(s) of protection remain unclear. A number of biochemical and immune-mediated mechanisms have been proposed, and it is likely that multiple complex mechanisms are responsible for the observed protection. Increased evidence for an immune component of protection as well as novel mechanisms, such as enhanced tolerance to disease mediated by HO-1 and reduced parasitic growth due to translocation of host micro-RNA into the parasite, have recently been described. A better understanding of relevant mechanisms will provide valuable insight into the host-parasite relationship, including the role of the host immune system in protection against malaria. PMID:24025776

  15. Identification of immune signatures predictive of clinical protection from malaria

    PubMed Central

    2017-01-01

    Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual’s malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone. PMID:29065113

  16. Antigenic relatedness between glycoproteins of human respiratory syncytial virus subgroups A and B: evaluation of the contributions of F and G glycoproteins to immunity.

    PubMed Central

    Johnson, P R; Olmsted, R A; Prince, G A; Murphy, B R; Alling, D W; Walsh, E E; Collins, P L

    1987-01-01

    The degree of antigenic relatedness between human respiratory syncytial virus (RSV) subgroups A and B was estimated from antibody responses induced in cotton rats by respiratory tract infection with RSV. Glycoprotein-specific enzyme-linked immunosorbent assays of antibody responses induced by RSV infection demonstrated that the F glycoproteins of subgroups A and B were antigenically closely related (relatedness, R approximately 50%), whereas the G glycoproteins were only distantly related (R approximately 5%). Intermediate levels of antigenic relatedness (R approximately 25%) were seen in neutralizing antibodies from cotton rats infected with RSV of the two subgroups. Immunity against the F glycoprotein of subgroup A, induced by vaccinia-A2-F, conferred a high level of protection which was of comparable magnitude against challenge by RSV of either subgroup. In comparison, immunity against the G glycoprotein of subgroup A, induced by vaccinia-A2-G, conferred less complete, but significant, protection. Importantly, in vaccinia-A2-G-immunized animals, suppression of homologous challenge virus replication was significantly greater (13-fold) than that observed for the heterologous virus. PMID:3305988

  17. Pathogenicty and immune prophylaxis of cag pathogenicity island gene knockout homogenic mutants

    PubMed Central

    Lin, Huan-Jian; Xue, Jing; Bai, Yang; Wang, Ji-De; Zhang, Ya-Li; Zhou, Dian-Yuan

    2004-01-01

    AIM: To clarify the role of cag pathogenicity island (cagPAI) of Helicobacter pylori (H pylori) in the pathogenicity and immune prophylaxis of H pylori infection. METHODS: Three pairs of H pylori including 3 strains of cagPAI positive wildtype bacteria and their cagPAI knockout homogenic mutants were utilized. H pylori binding to the gastric epithelial cells was analyzed by flow cytometry assays. Apoptosis of gastric epithelial cells induced by H pylori was determined by ELISA assay. Prophylaxis effect of the wildtype and mutant strains was compared by immunization with the sonicate of the bacteria into mice model. RESULTS: No difference was found in the apoptasis between cagPAI positive and knockout H pylori strains in respective of the ability in the binding to gastric epithelial cells as well as the induction of apoptosis. Both types of the bacteria were able to protect the mice from the infection of H pylori after immunization, with no difference between them regarding to the protection rate as well as the stimulation of the proliferation of splenocytes of the mice. CONCLUSION: The role of cagPAI in the pathogenicity and prophylaxis of H pylori infection remains to be cleared. PMID:15484302

  18. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    PubMed

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  19. Medical Versus Nonmedical Immunization Exemptions for Child Care and School Attendance.

    PubMed

    2016-09-01

    Routine childhood immunizations against infectious diseases are an integral part of our public health infrastructure. They provide direct protection to the immunized individual and indirect protection to children and adults unable to be immunized via the effect of community immunity. All 50 states, the District of Columbia, and Puerto Rico have regulations requiring proof of immunization for child care and school attendance as a public health strategy to protect children in these settings and to secondarily serve as a mechanism to promote timely immunization of children by their caregivers. Although all states and the District of Columbia have mechanisms to exempt school attendees from specific immunization requirements for medical reasons, the majority also have a heterogeneous collection of regulations and laws that allow nonmedical exemptions from childhood immunizations otherwise required for child care and school attendance. The American Academy of Pediatrics (AAP) supports regulations and laws requiring certification of immunization to attend child care and school as a sound means of providing a safe environment for attendees and employees of these settings. The AAP also supports medically indicated exemptions to specific immunizations as determined for each individual child. The AAP views nonmedical exemptions to school-required immunizations as inappropriate for individual, public health, and ethical reasons and advocates for their elimination. Copyright © 2016 by the American Academy of Pediatrics.

  20. Persistence of measles neutralizing antibody related to vaccine and natural infection acquired before HIV infection.

    PubMed

    Isa, M B; Pavan, J V; Sicilia Don, P; Grutadauria, S; Martinez, L C; Giordano, M O; Masachessi, G; Barril, P A; Nates, S V

    2014-08-01

    Little is known about long-lasting measles protective immunity when exposure to wild-type or vaccine measles virus precedes HIV infection. The results obtained suggest that measles immunity wanes and the lowest measles geometric mean titres (GMT) were significantly associated with measles vaccine-induced immunity in individuals that later developed HIV infection (86% prevalence, GMT 164 mIU/ml) compared to naturally induced immunity in HIV-infected adults (100% prevalence, GMT 340 mIU/ml, P = 0·0082) or non-HIV infected adults (100%, GMT 724 mIU/ml, P = 0·0001), and vaccine-induced immunity in non-HIV-infected adults (100%, GMT 347 mIU/ml, P = 0·017). The study was conducted in an area without wild-type virus circulation since 2000. The absence of virus circulating may alter the paradigm of lifelong immunity to measles virus after vaccination. As the proportion of HIV-infected individuals possessing only vaccine-induced immunity continues to grow, checking the status of measles immunity in this group is strongly recommended.

  1. Comparative performance of a licensed anthrax vaccine versus electroporation based delivery of a PA encoding DNA vaccine in rhesus macaques.

    PubMed

    Livingston, Brian D; Little, Stephen F; Luxembourg, Alain; Ellefsen, Barry; Hannaman, Drew

    2010-01-22

    DNA vaccination is a promising immunization strategy that could be applied in the development of vaccines for a variety of prophylactic and therapeutic indications. Utilizing anthrax protective antigen as a model antigen, we demonstrate that electroporation mediated delivery enhanced the immunogenicity of DNA vaccines in nonhuman primates over 100-fold as compared to conventional intramuscular injection. Two administrations of a DNA vaccine with electroporation elicited anthrax toxin neutralizing antibody responses in 100% of rhesus macaques. Toxin neutralizing antibodies were sustained for the nearly 1-year study duration and were correlated with protection against subsequent lethal Bacillus anthracis spore challenge. Collectively, electroporation mediated DNA vaccination conferred protection comparable to that observed following vaccination with an FDA approved anthrax vaccine.

  2. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    PubMed

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

    2014-11-04

    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Enhancement of immunogenic response and protection in model rats by CSTM nanoparticles anticaries DNA vaccine.

    PubMed

    Li, Hongjiao; Lu, Yiming; Xiang, Jingjie; Jiang, Hailong; Zhong, Yanqiang; Lu, Ying

    2016-06-01

    To construct anticaries DNA vaccine and evaluate its ability to elicit mucosal and systemic immune responses in rats. wapA fragment was cloned into pVAX1 plasmid to generate pVAX1-wapA. The pVAX1-wapA/trimethyl chitosan nanoparticles were prepared by complex coacervation method. Significantly higher specific IgG antibody titers were observed in rats immunized with nanoparticles compared with rats immunized with naked pVAX1-wapA. Anti-WapA IgA and IgG antibody levels after intranasal immunization were significantly higher than those following intramuscular delivery of nanoparticles or naked pVAX1-wapA. Furthermore, fewer enamel, slight dentin and dentin moderate lesions were observed in rats immunized with nanoparticles. The results implicate WapA as an excellent candidate for anticaries vaccine development and nanoparticles as an effective delivery system.

  4. Protection of rats against dental caries by passive immunization with hen-egg-yolk antibody (IgY).

    PubMed

    Otake, S; Nishihara, Y; Makimura, M; Hatta, H; Kim, M; Yamamoto, T; Hirasawa, M

    1991-03-01

    Hen-egg-yolk antibody (IgY) was prepared against Streptococcus mutans MT8148 serotype c that was cultivated in medium containing sucrose, and it was used in passive caries-immunity studies. Specific pathogen-free rats infected with S. mutans MT8148 (c) and fed with a cariogenic diet containing more than 2% immune yolk powder developed significantly lower caries scores than did the ones infected with the same strain and fed with a diet containing only control yolk powder obtained from non-immunized hens. Similar results were obtained in an experiment with rats infected with S. mutans JC-2 (c) strain. Rats provided a diet supplemented with 0.5% immune water-soluble protein fraction containing S. mutans-specific IgY and challenged with S. mutans MT8148 exhibited significantly fewer caries lesions, compared with control rats on the normal diet.

  5. Immunization of Mice with Formalin-Inactivated Spores from Avirulent Bacillus cereus Strains Provides Significant Protection from Challenge with Bacillus anthracis Ames

    PubMed Central

    Vergis, James M.; Cote, Christopher K.; Bozue, Joel; Alem, Farhang; Ventura, Christy L.; Welkos, Susan L.

    2013-01-01

    Bacillus anthracis spores are the infectious form of the organism for humans and animals. However, the approved human vaccine in the United States is derived from a vegetative culture filtrate of a toxigenic, nonencapsulated B. anthracis strain that primarily contains protective antigen (PA). Immunization of mice with purified spore proteins and formalin-inactivated spores (FIS) from a nonencapsulated, nontoxigenic B. anthracis strain confers protection against B. anthracis challenge when PA is also administered. To investigate the capacity of the spore particle to act as a vaccine without PA, we immunized mice subcutaneously with FIS from nontoxigenic, nonencapsulated B. cereus strain G9241 pBCXO1−/pBC210− (dcG9241), dcG9241 ΔbclA, or 569-UM20 or with exosporium isolated from dcG9241. FIS vaccination provided significant protection of mice from intraperitoneal or intranasal challenge with spores of the virulent B. anthracis Ames or Ames ΔbclA strain. Immunization with dcG9241 ΔbclA FIS, which are devoid of the immunodominant spore protein BclA, provided greater protection from challenge with either Ames strain than did immunization with FIS from BclA-producing strains. In addition, we used prechallenge immune antisera to probe a panel of recombinant B. anthracis Sterne spore proteins to identify novel immunogenic vaccine candidates. The antisera were variably reactive with BclA and with 10 other proteins, four of which were previously tested as vaccine candidates. Overall our data show that immunization with FIS from nontoxigenic, nonencapsulated B. cereus strains provides moderate to high levels of protection of mice from B. anthracis Ames challenge and that neither PA nor BclA is required for this protection. PMID:23114705

  6. The sickle-cell trait modifies the intensity and specificity of the immune response against P. falciparum malaria and leads to acquired protective immunity.

    PubMed

    Bayoumi, R A

    1987-03-01

    It is proposed that the in vivo mechanism of protection against falciparum malaria in individuals of the Hb AS genotype is not due solely to the adverse influence of Hb AS erythrocytes on the intraerythrocytic growth and development of P. falciparum. Instead, the simple physiological effect of Hb S on parasite growth appears to trigger an in vivo process of enhancement of the intensity and/or specificity of the host immune response, leading to acquired protective immunity, in a process simulating vaccination. Testing the hypothesis may lead to the identification of plasmodial antigens that induce protective responses in the human host and distinguish them from non-protective, immunosuppressive or decoy antigens that promote parasite survival. This may ultimately help in the selection of candidate antigens for a malaria blood-stage vaccine.

  7. Parasite genetics and the immune host: recombination between antigenic types of Eimeria maxima as an entrée to the identification of protective antigens.

    PubMed

    Blake, Damer P; Hesketh, Patricia; Archer, Andrew; Carroll, Fionnadh; Smith, Adrian L; Shirley, Martin W

    2004-11-01

    The genomes of protozoan parasites encode thousands of gene products and identification of the subset that stimulates a protective immune response is a daunting task. Most screens for vaccine candidates identify molecules by capacity to induce immune responses rather than protection. This paper describes the core findings of a strategy developed with the coccidial parasite Eimeria maxima to rationally identify loci within its genome that encode immunoprotective antigens. Our strategy uses a novel combination of parasite genetics, DNA fingerprinting, drug-resistance and strain-specific immunity and centres on two strains of E. maxima that each induce a lethal strain-specific protective immune response in the host and show a differential response to anti-Eimeria chemotherapy. Through classical mating studies with these strains we have demonstrated that loci encoding molecules stimulating strain-specific protective immunity or resistance to the anti-coccidial drug robenidine segregate independently. Furthermore, passage of populations of recombinant parasites in the face of killing in the immune host was accompanied by the elimination of some polymorphic DNA markers defining the parent strain used to immunise the host. Consideration of the numbers of parasites recombinant for the two traits implicates very few antigen-encoding loci. Our data provide a potential strategy to identify putative antigen-encoding loci in other parasites.

  8. The 17D-204 Vaccine Strain-Induced Protection against Virulent Yellow Fever Virus Is Mediated by Humoral Immunity and CD4+ but not CD8+ T Cells.

    PubMed

    Watson, Alan M; Lam, L K Metthew; Klimstra, William B; Ryman, Kate D

    2016-07-01

    A gold standard of antiviral vaccination has been the safe and effective live-attenuated 17D-based yellow fever virus (YFV) vaccines. Among more than 500 million vaccinees, only a handful of cases have been reported in which vaccinees developed a virulent wild type YFV infection. This efficacy is presumed to be the result of both neutralizing antibodies and a robust T cell response. However, the particular immune components required for protection against YFV have never been evaluated. An understanding of the immune mechanisms that underlie 17D-based vaccine efficacy is critical to the development of next-generation vaccines against flaviviruses and other pathogens. Here we have addressed this question for the first time using a murine model of disease. Similar to humans, vaccination elicited long-term protection against challenge, characterized by high neutralizing antibody titers and a robust T cell response that formed long-lived memory. Both CD4+ and CD8+ T cells were polyfunctional and cytolytic. Adoptive transfer of immune sera or CD4+ T cells provided partial protection against YFV, but complete protection was achieved by transfer of both immune sera and CD4+ T cells. Thus, robust CD4+ T cell activity may be a critical contributor to protective immunity elicited by highly effective live attenuated vaccines.

  9. The 17D-204 Vaccine Strain-Induced Protection against Virulent Yellow Fever Virus Is Mediated by Humoral Immunity and CD4+ but not CD8+ T Cells

    PubMed Central

    Lam, L. K. Metthew; Klimstra, William B.

    2016-01-01

    A gold standard of antiviral vaccination has been the safe and effective live-attenuated 17D-based yellow fever virus (YFV) vaccines. Among more than 500 million vaccinees, only a handful of cases have been reported in which vaccinees developed a virulent wild type YFV infection. This efficacy is presumed to be the result of both neutralizing antibodies and a robust T cell response. However, the particular immune components required for protection against YFV have never been evaluated. An understanding of the immune mechanisms that underlie 17D-based vaccine efficacy is critical to the development of next-generation vaccines against flaviviruses and other pathogens. Here we have addressed this question for the first time using a murine model of disease. Similar to humans, vaccination elicited long-term protection against challenge, characterized by high neutralizing antibody titers and a robust T cell response that formed long-lived memory. Both CD4+ and CD8+ T cells were polyfunctional and cytolytic. Adoptive transfer of immune sera or CD4+ T cells provided partial protection against YFV, but complete protection was achieved by transfer of both immune sera and CD4+ T cells. Thus, robust CD4+ T cell activity may be a critical contributor to protective immunity elicited by highly effective live attenuated vaccines. PMID:27463517

  10. Skin-resident CD4+ T cells protect against Leishmania major by recruiting and activating inflammatory monocytes

    PubMed Central

    Glennie, Nelson D.; Volk, Susan W.

    2017-01-01

    Tissue-resident memory T cells are required for establishing protective immunity against a variety of different pathogens, although the mechanisms mediating protection by CD4+ resident memory T cells are still being defined. In this study we addressed this issue with a population of protective skin-resident, IFNγ-producing CD4+ memory T cells generated following Leishmania major infection. We previously found that resident memory T cells recruit circulating effector T cells to enhance immunity. Here we show that resident memory CD4+ T cells mediate the delayed-hypersensitivity response observed in immune mice and provide protection without circulating T cells. This protection occurs rapidly after challenge, and requires the recruitment and activation of inflammatory monocytes, which limit parasites by production of both reactive oxygen species and nitric oxide. Overall, these data highlight a novel role for tissue-resident memory cells in recruiting and activating inflammatory monocytes, and underscore the central role that skin-resident T cells play in immunity to cutaneous leishmaniasis. PMID:28419151

  11. Antibodies to the A27 protein of vaccinia virus neutralize and protect against infection but represent a minor component of Dryvax vaccine--induced immunity.

    PubMed

    He, Yong; Manischewitz, Jody; Meseda, Clement A; Merchlinsky, Michael; Vassell, Russell A; Sirota, Lev; Berkower, Ira; Golding, Hana; Weiss, Carol D

    2007-10-01

    The smallpox vaccine Dryvax, which consists of replication-competent vaccinia virus, elicits antibodies that play a major role in protection. Several vaccinia proteins generate neutralizing antibodies, but their importance for protection is unknown. We investigated the potency of antibodies to the A27 protein of the mature virion in neutralization and protection experiments and the contributions of A27 antibodies to Dryvax-induced immunity. Using a recombinant A27 protein (rA27), we confirmed that A27 contains neutralizing determinants and that vaccinia immune globulin (VIG) derived from Dryvax recipients contains reactivity to A27. However, VIG neutralization was not significantly reduced when A27 antibodies were removed, and antibodies elicited by an rA27 enhanced the protection conferred by VIG in passive transfer experiments. These findings demonstrate that A27 antibodies do not represent the major fraction of neutralizing activity in VIG and suggest that immunity may be augmented by vaccines and immune globulins that include strong antibody responses to A27.

  12. Concerted Activity of IgG1 Antibodies and IL-4/IL-25-Dependent Effector Cells Trap Helminth Larvae in the Tissues following Vaccination with Defined Secreted Antigens, Providing Sterile Immunity to Challenge Infection

    PubMed Central

    Hewitson, James P.; Filbey, Kara J.; Esser-von Bieren, Julia; Camberis, Mali; Schwartz, Christian; Murray, Janice; Reynolds, Lisa A.; Blair, Natalie; Robertson, Elaine; Harcus, Yvonne; Boon, Louis; Huang, Stanley Ching-Cheng; Yang, Lihua; Tu, Yizheng; Miller, Mark J.; Voehringer, David; Le Gros, Graham; Harris, Nicola; Maizels, Rick M.

    2015-01-01

    Over 25% of the world's population are infected with helminth parasites, the majority of which colonise the gastrointestinal tract. However, no vaccine is yet available for human use, and mechanisms of protective immunity remain unclear. In the mouse model of Heligmosomoides polygyrus infection, vaccination with excretory-secretory (HES) antigens from adult parasites elicits sterilising immunity. Notably, three purified HES antigens (VAL-1, -2 and -3) are sufficient for effective vaccination. Protection is fully dependent upon specific IgG1 antibodies, but passive transfer confers only partial immunity to infection, indicating that cellular components are also required. Moreover, immune mice show greater cellular infiltration associated with trapping of larvae in the gut wall prior to their maturation. Intra-vital imaging of infected intestinal tissue revealed a four-fold increase in extravasation by LysM+GFP+ myeloid cells in vaccinated mice, and the massing of these cells around immature larvae. Mice deficient in FcRγ chain or C3 complement component remain fully immune, suggesting that in the presence of antibodies that directly neutralise parasite molecules, the myeloid compartment may attack larvae more quickly and effectively. Immunity to challenge infection was compromised in IL-4Rα- and IL-25-deficient mice, despite levels of specific antibody comparable to immune wild-type controls, while deficiencies in basophils, eosinophils or mast cells or CCR2-dependent inflammatory monocytes did not diminish immunity. Finally, we identify a suite of previously uncharacterised heat-labile vaccine antigens with homologs in human and veterinary parasites that together promote full immunity. Taken together, these data indicate that vaccine-induced immunity to intestinal helminths involves IgG1 antibodies directed against secreted proteins acting in concert with IL-25-dependent Type 2 myeloid effector populations. PMID:25816012

  13. Immune Responses in Acute and Convalescent Patients with Mild, Moderate and Severe Disease during the 2009 Influenza Pandemic in Norway

    PubMed Central

    Mohn, Kristin G.-I.; Cox, Rebecca Jane; Tunheim, Gro; Berdal, Jan Erik; Hauge, Anna Germundsson; Jul-Larsen, Åsne; Peters, Bjoern; Oftung, Fredrik

    2015-01-01

    Increased understanding of immune responses influencing clinical severity during pandemic influenza infection is important for improved treatment and vaccine development. In this study we recruited 46 adult patients during the 2009 influenza pandemic and characterized humoral and cellular immune responses. Those included were either acute hospitalized or convalescent patients with different disease severities (mild, moderate or severe). In general, protective antibody responses increased with enhanced disease severity. In the acute patients, we found higher levels of TNF-α single-producing CD4+T-cells in the severely ill as compared to patients with moderate disease. Stimulation of peripheral blood mononuclear cells (PBMC) from a subset of acute patients with peptide T-cell epitopes showed significantly lower frequencies of influenza specific CD8+ compared with CD4+ IFN-γ T-cells in acute patients. Both T-cell subsets were predominantly directed against the envelope antigens (HA and NA). However, in the convalescent patients we found high levels of both CD4+ and CD8+ T-cells directed against conserved core antigens (NP, PA, PB, and M). The results indicate that the antigen targets recognized by the T-cell subsets may vary according to the phase of infection. The apparent low levels of cross-reactive CD8+ T-cells recognizing internal antigens in acute hospitalized patients suggest an important role for this T-cell subset in protective immunity against influenza. PMID:26606759

  14. Construction and immune effect of Haemophilus parasuis DNA vaccine encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in mice.

    PubMed

    Fu, Shulin; Zhang, Minmin; Ou, Jiwen; Liu, Huazhen; Tan, Chen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng

    2012-11-06

    Haemophilus parasuis, the causative agent of swine polyserositis, polyarthritis, and meningitis, is one of the most important bacterial diseases of pigs worldwide. The development of a vaccine against H. parasuis has been impeded due to the lack of induction of reliable cross-serotype protection. In this study the gapA gene that encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was shown to be present and highly conserved in various serotypes of H. parasuis and we constructed a novel DNA vaccine encoding GAPDH (pCgap) to evaluate the immune response and protective efficacy against infection with H. parasuis MD0322 serovar 4 or SH0165 serovar 5 in mice. A significant antibody response against GAPDH was generated following pCgap intramuscular immunization; moreover, antibodies to the pCgap DNA vaccine were bactericidal, suggesting that it was expressed in vivo. The gapA transcript was detected in muscle, liver, spleen, and kidney of the mice seven days post-vaccination. The IgG subclass (IgG1 and IgG2a) analysis indicated that the DNA vaccine induced both Th1 and Th2 immune responses, but the IgG1 response was greater than the IgG2a response. Moreover, the groups vaccinated with the pCgap vaccine exhibited 83.3% and 50% protective efficacy against the H. parasuis MD0322 serovar 4 or SH0165 serovar 5 challenges, respectively. The pCgap DNA vaccine provided significantly greater protective efficacy compared to the negative control groups or blank control groups (P<0.05 for both). Taken together, these findings indicate that the pCgap DNA vaccine provides a novel strategy against infection of H. parasuis and offer insight concerning the underlying immune mechanisms of a bacterial DNA vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Immunization against leishmaniasis by PLGA nanospheres loaded with an experimental autoclaved Leishmania major (ALM) and Quillaja saponins.

    PubMed

    Tafaghodi, M; Eskandari, M; Kharazizadeh, M; Khamesipour, A; Jaafari, M R

    2010-12-01

    Immune responses against the Leishmania antigens are not sufficient to protect against a leishmania challenge. Therefore these antigens need to be potentiated by various adjuvants and delivery systems. In this study, Poly (d,l-lactide-co-glycolide (PLGA) nanospheres as antigen delivery system and Quillaja saponins (QS) as immunoadjuvant have been used to enhance the immune response against autoclaved Leishmania major (ALM). PLGA nanospheres were prepared by a double-emulsion (W/O/W) technique. Particulate characteristics were studied by scanning electron microscopy and particle size analysis. Mean diameter for nanospheres loaded with ALM+QS was 294 ± 106 nm. BALB/c mice were immunized three times in 3-weeks intervals using ALM plus QS loaded nanospheres [(ALM+QS)PLGA], ALM encapsulated with PLGA nanospheres [(ALM)PLGA], (ALM)PLGA + QS, ALM + QS, ALM alone or PBS. The intensity of infection induced by L. major challenge was assessed by measuring size of footpad swelling. The strongest protection, showed by significantly (P < 0.05) smaller footpad, were observed in mice immunized with (ALM)PLGA. The (ALM+QS)PLGA group showed the least protection and highest swelling, while the (ALM)PLGA+QS, ALM+QS and ALM showed an intermediate protection with no significant difference. The mice immunized with ALM and ALM+QS showed the highest IgG2a/IgG1 ratio (P < 0.01), followed by (ALM)PLGA+QS. The highest IFN-γ and lowest IL-4 production was seen in (ALM)PLGA+QS, ALM+QS groups. The highest parasite burden was observed in (ALM)PLGA+QS and (ALM+QS)PLGA groups. It is concluded that PLGA nanospheres as a vaccine delivery system could increase the protective immune responses, but QS adjuvant has a reverse effect on protective immune responses and the least protective responses were seen in the presence of this adjuvant.

  16. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China

    PubMed Central

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%– vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage. PMID:25760670

  17. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.

    PubMed

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage.

  18. Klebsiella pneumoniae type 3 fimbria-mediated immunity to infection in the murine model of respiratory disease.

    PubMed

    Lavender, Heather; Jagnow, Jennifer J; Clegg, Steven

    2005-06-01

    Type 3 fimbriae are expressed by most strains of Klebsiella pneumoniae and facilitate adherence to the basement membrane of human respiratory tissues. The ability of these appendages to stimulate a protective immune response in vivo has not been investigated. A murine model of acute pneumonia was used to determine whether the production of type 3 fimbria-specific antibodies correlated with protection against infection by K. pneumoniae. Purified fimbriae from several strains were used to immunize mice prior to challenge with a virulent strain. The immunized mice produced high titers of specific antibody and this was associated with protection against challenge with a low dose of bacteria that was lethal in unimmunized animals. However, challenge with a high number of bacteria resulted in no protection against infection.

  19. Cellular Self-Defense: How Cell-Autonomous Immunity Protects Against Pathogens

    PubMed Central

    Randow, Felix; MacMicking, John D.; James, Leo C.

    2013-01-01

    Our prevailing view of vertebrate host defense is strongly shaped by the notion of a specialized set of immune cells as sole guardians of antimicrobial resistance. Yet this view greatly underestimates a capacity for most cell lineages—the majority of which fall outside the traditional province of the immune system—to defend themselves against infection. This ancient and ubiquitous form of host protection is termed cell-autonomous immunity and operates across all three domains of life. Here, we discuss the organizing principles that govern cellular self-defense and how intracellular compartmentalization has shaped its activities to provide effective protection against a wide variety of microbial pathogens. PMID:23661752

  20. Cellular self-defense: how cell-autonomous immunity protects against pathogens.

    PubMed

    Randow, Felix; MacMicking, John D; James, Leo C

    2013-05-10

    Our prevailing view of vertebrate host defense is strongly shaped by the notion of a specialized set of immune cells as sole guardians of antimicrobial resistance. Yet this view greatly underestimates a capacity for most cell lineages-the majority of which fall outside the traditional province of the immune system-to defend themselves against infection. This ancient and ubiquitous form of host protection is termed cell-autonomous immunity and operates across all three domains of life. Here, we discuss the organizing principles that govern cellular self-defense and how intracellular compartmentalization has shaped its activities to provide effective protection against a wide variety of microbial pathogens.

  1. Anthrax vaccine recipients lack antibody against the loop neutralizing determinant: A protective neutralizing epitope from Bacillus anthracis protective antigen.

    PubMed

    Oscherwitz, Jon; Quinn, Conrad P; Cease, Kemp B

    2015-05-11

    Epitope-focused immunogens can elicit antibody against the loop neutralizing determinant (LND), a neutralizing epitope found within the 2β2-2β3 loop of protective antigen (PA), which can protect rabbits from high-dose inhalation challenge with Bacillus anthracis Ames strain. Interestingly, data suggests that this epitope is relatively immunosilent in rabbits and non-human primates immunized with full length PA. To determine whether the LND is immunosilent among humans vaccinated with PA, we screened antisera from AVA- or placebo-vaccinees from a clinical trial for antibody reactive with the LND. AVA-vaccinee sera had significant PA-specific antibody compared to placebo-vaccinee sera; however, sera from the two cohorts were indistinguishable with regard to the frequency of individuals with antibody specific for the LND. AVA-vaccinees have a low frequency of antibody reactive with the LND. As with rabbits and non-human primates, the elicitation of LND-specific antibody in humans appears to require immunization with an epitope-focused vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Protective immune response against Toxoplasma gondii elicited by a novel yeast-based vaccine with microneme protein 16.

    PubMed

    Wang, Long-Jiang; Xiao, Ting; Xu, Chao; Li, Jin; Liu, Gong-Zhen; Yin, Kun; Cui, Yong; Wei, Qing-Kuan; Huang, Bing-Cheng; Sun, Hui

    2018-06-22

    Toxoplasma gondii is an obligate intracellular protozoan that can invade all eukaryotic cells and infect all warm-blood animals, causing the important zoonosis toxoplasmosis. Invasion of host cells is the key step necessary for T. gondii to complete its life cycle and microneme proteins play an important role in attachment and invasion of host cells. Microneme protein 16 (TgMIC16) is a new protective protein in T. gondii and belongs to transmembrane microneme proteins (TM-MIC). The TM-MICs are released onto the parasite's surface as complexes capable of interacting with host cell receptors. In the present study, we expressed the TgMIC16 protein on the surface of Saccharomyce cerevisiae (pCTCON2-TgMIC16/EBY100) and evaluated it as a potential vaccine for BALB/c mice against challenge infection with the RH strain of T. gondii. We immunized BALB/c mice both orally and intraperitoneally. After three immunizations, the immune response was evaluated by measuring antibody levels, lymphocyte proliferative responses, percentages of CD4 + and CD8 + T lymphocytes, cytokine production, and the survival times of challenged mice. The results showed that the pCTCON2-TgMIC16/EBY100 vaccine stimulated humoral and cellular immune responses. In addition, mice immunized with the pCTCON2-TgMIC16/EBY100 vaccine showed increased survival times compared with non-immunized controls. In summary, TgMIC16 displayed on the cell surface of S. cerevisiae could be used as potential vaccine against toxoplasmosis. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Role of pro-inflammatory cytokine IL-17 in Leishmania pathogenesis and in protective immunity by Leishmania vaccines.

    PubMed

    Banerjee, Antara; Bhattacharya, Parna; Joshi, Amritanshu B; Ismail, Nevien; Dey, Ranadhir; Nakhasi, Hira L

    2016-11-01

    The clinical outcome of Leishmania pathogenesis ranges from active skin lesions to fatal visceral dissemination and severely impaired T cell immunity. It is well established that a strong Th1 immune response is protective against cutaneous forms of the disease, however a mixed Th1/Th2 response is most commonly observed against visceral infections as evident from previous studies. Aside from Th1/Th2 cytokines, the pro-inflammatory IL-17 cytokine family plays an important role in the clearance of intracellular pathogens. In Leishmania induced skin lesions, IL-17 produced by Th17 cells is shown to exacerbate the disease, suggesting a role in pathogenesis. However, a protective role for IL-17 is indicated by the expansion of IL-17 producing cells in vaccine-induced immunity. In human visceral leishmaniasis (VL) it has been demonstrated that IL-17 and IL-22 are associated with protection against re-exposure to Leishmania, which further suggests the involvement of IL-17 in vaccine induced protective immunity. Although there is no vaccine against any form of leishmaniasis, the development of genetically modified live attenuated parasites as vaccine candidates prove to be promising, as they successfully induce a robust protective immune response in various animal models. However, the role of IL-17 producing cells and Th17 cells in response to these vaccine candidates remains unexplored. In this article, we review the role of IL-17 in Leishmania pathogenesis and the potential impact on vaccine induced immunity, with a special focus on live attenuated Leishmania parasites. Published by Elsevier Inc.

  4. Plant-derived H7 VLP vaccine elicits protective immune response against H7N9 influenza virus in mice and ferrets.

    PubMed

    Pillet, S; Racine, T; Nfon, C; Di Lenardo, T Z; Babiuk, S; Ward, B J; Kobinger, G P; Landry, N

    2015-11-17

    In March 2013, the Chinese Centre for Disease Control and Prevention confirmed the first reported case of human infection with an avian influenza A H7N9 virus. Infection with this virus often caused severe pneumonia and acute respiratory distress syndrome resulting in a case fatality rate >35%. The risk of pandemic highlighted, once again, the need for a more rapid and scalable vaccine response capability. Here, we describe the rapid (19 days) development of a plant-derived VLP vaccine based on the hemagglutinin sequence of influenza H7N9 A/Hangzhou/1/2013. The immunogenicity of the H7 VLP vaccine was assessed in mice and ferrets after one or two intramuscular dose(s) with and without adjuvant (alum or GLA-SE™). In ferrets, we also measured H7-specific cell-mediated immunity. The mice and ferrets were then challenged with H7N9 A/Anhui/1/2013 influenza virus. A single immunization with the adjuvanted vaccine elicited a strong humoral response and protected mice against an otherwise lethal challenge. Two doses of unadjuvanted vaccine significantly increased humoral response and resulted in 100% protection with significant reduction of clinical signs leading to nearly asymptomatic infections. In ferrets, a single immunization with the alum-adjuvanted H7 VLP vaccine induced strong humoral and CMI responses with antigen-specific activation of CD3(+) T cells. Compared to animals injected with placebo, ferrets vaccinated with alum-adjuvanted vaccine displayed no weight loss during the challenge. Moreover, the vaccination significantly reduced the viral load in lungs and nasal washes 3 days after the infection. This candidate plant-made H7 vaccine therefore induced protective responses after either one adjuvanted or two unadjuvanted doses. Studies are currently ongoing to better characterize the immune response elicited by the plant-derived VLP vaccines. Regardless, these data are very promising for the rapid production of an immunogenic and protective vaccine against this potentially pandemic virus. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Immunization of a wild koala population with a recombinant Chlamydia pecorum Major Outer Membrane Protein (MOMP) or Polymorphic Membrane Protein (PMP) based vaccine: New insights into immune response, protection and clearance.

    PubMed

    Desclozeaux, Marion; Robbins, Amy; Jelocnik, Martina; Khan, Shahneaz Ali; Hanger, Jon; Gerdts, Volker; Potter, Andrew; Polkinghorne, Adam; Timms, Peter

    2017-01-01

    We assessed the effects of two different single-dose anti-Chlamydia pecorum (C. pecorum) vaccines (containing either Major Outer Membrane Protein (3MOMP) or Polymorphic Membrane Protein (Pmp) as antigens) on the immune response of a group of wild koalas. Both vaccines elicited a systemic humoral response as seen by the production of anti-chlamydial IgG antibodies in more than 90% of vaccinated koalas. A mucosal immune response was also observed, with an increase in Chlamydia-specific mucosal IgG and/or IgA antibodies in some koalas post-vaccination. Both vaccines elicited a cell-mediated immune response as measured by the production of the cytokines IFN-γ and IL-17 post-vaccination. To determine the level of protection provided by the vaccines under natural conditions we assessed C. pecorum infection loads and chlamydial disease status of all vaccinated koalas pre- and post-vaccination, compared to a non-vaccinated cohort from the same habitat. The MOMP vaccinated koalas that were infected on the day of vaccination showed significant clearance of their infection at 6 months post-vaccination. In contrast, the number of new infections in the PMP vaccine was similar to the control group, with some koalas progressing to disease. Genotyping of the ompA gene from the C. pecorum strains infecting the vaccinated animals, identified genetic variants of ompA-F genotype and a new genotype ompA-O. We found that those animals that were the least well protected became infected with strains of C. pecorum not covered by the vaccine. In conclusion, a single dose vaccine formulated with either recombinant PmpG or MOMP can elicit both cell-mediated and humoral (systemic and mucosal) immune responses, with the MOMP vaccine showing clearance of infection in all infected koalas. Although the capability of our vaccines to stimulate an adaptive response and be protective needs to be fully evaluated, this work illustrates the necessity to combine epitopes most relevant to a large panel of variable strains with an efficient adjuvant.

  6. Induction of Protective Immune Responses Against Schistosomiasis haematobium in Hamsters and Mice Using Cysteine Peptidase-Based Vaccine

    PubMed Central

    Tallima, Hatem; Dalton, John P.; El Ridi, Rashika

    2015-01-01

    One of the major lessons we learned from the radiation-attenuated cercariae vaccine studies is that protective immunity against schistosomiasis is dependent on the induction of T helper (Th)1-/Th2-related immune responses. Since most schistosome larval and adult-worm-derived molecules used for vaccination uniformly induce a polarized Th1 response, it was essential to include a type 2 immune response-inducing molecule, such as cysteine peptidases, in the vaccine formula. Here, we demonstrate that a single subcutaneous injection of Syrian hamsters with 200 μg active papain, 1 h before percutaneous exposure to 150 cercariae of Schistosoma haematobium, led to highly significant (P < 0.005) reduction of >50% in worm burden and worm egg counts in intestine. Immunization of hamsters with 20 μg recombinant glyceraldehyde 3-phosphate dehydrogenase (rSG3PDH) and 20 μg 2-cys peroxiredoxin-derived peptide in a multiple antigen peptide construct (PRX MAP) together with papain (20 μg/hamster), as adjuvant led to considerable (64%) protection against challenge S. haematobium infection, similar to the levels reported with irradiated cercariae. Cysteine peptidases-based vaccination was also effective in protecting outbred mice against a percutaneous challenge infection with S. haematobium cercariae. In two experiments, a mixture of Schistosoma mansoni cathepsin B1 (SmCB1) and Fasciola hepatica cathepsin L1 (FhCL1) led to highly significant (P < 0.005) reduction of 70% in challenge S. haematobium worm burden and 60% reduction in liver egg counts. Mice vaccinated with SmCB1/FhCL1/rSG3PDH mixture and challenged with S. haematobium cercariae 3 weeks after the second immunization displayed highly significant (P < 0.005) reduction of 72% in challenge worm burden and no eggs in liver of 8–10 mice/group, as compared to unimmunized mice, associated with production of a mixture of type 1- and type 2-related cytokines and antibody responses. PMID:25852696

  7. Experimental Vaccine Induces Th1-driven Immune Responses and Resistance to Neisseria gonorrhoeae Infection in a Murine Model

    PubMed Central

    Liu, Yingru; Hammer, Laura A.; Liu, Wensheng; Hobbs, Marcia M.; Zielke, Ryszard A.; Sikora, Aleksandra E.; Jerse, Ann E.; Egilmez, Nejat K.; Russell, Michael W.

    2017-01-01

    Female mice were immunized intravaginally with gonococcal outer membrane vesicles (OMV) plus microencapsulated IL-12, and challenged using an established model of genital infection with Neisseria gonorrhoeae. Whereas sham-immunized and control animals cleared the infection in 10–13 days, those immunized with OMV plus IL-12 cleared infection with homologous gonococcal strains in 6–9 days. Significant protection was also seen after challenge with antigenically distinct strains of N. gonorrhoeae, and protective anamnestic immunity persisted for at least 6 months after immunization. Serum and vaginal IgG and IgA antibodies were generated against antigens expressed by homologous and heterologous strains. Iliac lymph node CD4+ T cells secreted IFNγ, but not IL-4, in response to immunization, and produced IL-17 in response to challenge regardless of immunization. Antigens recognized by immunized mouse serum included several shared between gonococcal strains, including two identified by immunoproteomics approaches as EF-Tu and PotF3. Experiments with immunodeficient mice showed that protective immunity depended upon IFNγ and B cells, presumably to generate antibodies. The results demonstrated that immunity to gonococcal infection can be induced by immunization with a non-living gonococcal antigen, and suggest that efforts to develop a human vaccine should focus on strategies to generate Th1-driven immune responses in the genital tract. PMID:28272393

  8. A retrospective analysis of the Alzheimer's disease vaccine progress - The critical need for new development strategies.

    PubMed

    Marciani, Dante J

    2016-06-01

    The promising results obtained with aducanumab and solanezumab against Alzheimer's disease (AD) strengthen the vaccine approach to prevent AD, despite of the many clinical setbacks. It has been problematic to use conjugated peptides with Th1/Th2 adjuvants to induce immune responses against conformational epitopes formed by Aβ oligomers, which is critical to induce protective antibodies. Hence, vaccination should mimic natural immunity by using whole or if possible conjugated antigens, but biasing the response to Th2 with anti-inflammatory adjuvants. Also, selection of the carrier and cross-linking agents is important to prevent suppression of the immune response against the antigen. That certain compounds having phosphorylcholine or fucose induce a sole Th2 immunity would allow antigens with T-cell epitopes without inflammatory autoimmune reactions to be used. Another immunization method is DNA vaccines combined with antigenic ones, which favors the clonal selection and expansion of high affinity antibodies needed for immune protection, but this also requires Th2 immunity. Since AD transgenic mouse models have limited value for immunogen selection as shown by the clinical studies, screening may require the use of validated antibodies and biophysical methods to identify the antigens that would be most likely recognized by the human immune system and thus capable to stimulate a protective antibody response. To induce an anti-Alzheimer's disease protective immunity and prevent possible damage triggered by antigens having B-cell epitopes-only, whole antigens might be used; while inducing Th2 immunity with sole anti-inflammatory fucose-based adjuvants. This approach would avert a damaging systemic inflammatory immunity and the suppression of immunoresponse against the antigen because of carrier and cross-linkers; immune requirements that extend to DNA vaccines. © 2016 International Society for Neurochemistry.

  9. Immunoregulatory activity by daucosterol, a beta-sitosterol glycoside, induces protective Th1 immune response against disseminated Candidiasis in mice.

    PubMed

    Lee, Jue-Hee; Lee, Ju Young; Park, Ji Hye; Jung, Hye Sil; Kim, Ju Sun; Kang, Sam Sik; Kim, Yeong Shik; Han, Yongmoon

    2007-05-10

    In the present study, we investigated immunomodulatory effect of daucosterol, a beta-sitosterol glycoside, against disseminated candidiasis caused by Candida albicans. Results showed that direct interaction of daucosterol with C. albicans yeast cells resulted in no growth-inhibition by in vitro susceptibility analysis. In contrast, mice given daucosterol (DS) intraperitoneally before intravenous challenge with live C. albicans yeast cells survived longer than DS-untreated control mice against disseminated candidiasis (P<0.05). By assessment of the fungal CFU in kidneys, DS-treated mice before the challenge developed about 81% fewer kidney CFU than untreated controls. This protection was removable by pretreatment of mice with anti-CD4+ antibody before the DS-treatment and challenge with the yeast. However, the protection was transferable by the CD4+ T cells from DS-treated mice not infected with the yeast. ELISA analysis revealed there were predominant production of IFNgamma and IL-2 cytokines as compared to IL-4, and IL-10 productions in DS-treated mice. By treatment of DS-given mice with anti-mouse IFNgamma, the protection was also abolished. Our studies show that DS protects mice against disseminated candidiasis by the CD4+ Th1 immune response.

  10. Activation of macrophage mediated host defense against Salmonella typhimurium by Morus alba L.

    PubMed Central

    Chang, BoYoon; Koo, BongSeong; Lee, HyeonCheol; Oh, Joa Sub; Kim, SungYeon

    2018-01-01

    Background The innate immune system plays a crucial role in the initiation and subsequent direction of adaptive immune responses, as well as in the removal of pathogens that have been targeted by an adaptive immune response. Objective Morus alba L. was reported to have immunostimulatory properties that might protect against infectious diseases. However, this possibility has not yet been explored. The present study investigated the protective and immune-enhancing ability of M. alba L. against infectious disease and the mechanisms involved. Design To investigate the immune-enhancing effects of M. alba L., we used a bacterial infection model. Results and discussions The lifespan of mice infected with a lethal dose of Salmonella typhimurium (1 × 107 colony forming units – CFU) was significantly extended when they were administered M. alba L. Furthermore, M. alba L. activated macrophages, monocytes, and neutrophils and induced Th1 cytokines (IL-12, IFN-γ, TNF-α) in mice infected with a sublethal dose (1 × 105 CFU) of S. typhimurium. M. alba L. significantly stimulated the uptake of bacteria into peritoneal macrophages as indicated by increased phagocytosis. Peritoneal macrophages derived from C3H/HeJ mice significantly inhibited M. alba L. induced NO production and TNF-α secretion compared with peritoneal macrophages derived from C3H/HeN mice. Conclusions These results suggest that the innate immune activity of M. alba L. against bacterial infection in mice occurs through activation of the TLR4 signaling pathway. PMID:29545736

  11. Activation of macrophage mediated host defense against Salmonella typhimurium by Morus alba L.

    PubMed

    Chang, BoYoon; Koo, BongSeong; Lee, HyeonCheol; Oh, Joa Sub; Kim, SungYeon

    2018-01-01

    The innate immune system plays a crucial role in the initiation and subsequent direction of adaptive immune responses, as well as in the removal of pathogens that have been targeted by an adaptive immune response. Morus alba L. was reported to have immunostimulatory properties that might protect against infectious diseases. However, this possibility has not yet been explored. The present study investigated the protective and immune-enhancing ability of M. alba L. against infectious disease and the mechanisms involved. To investigate the immune-enhancing effects of M. alba L., we used a bacterial infection model. The lifespan of mice infected with a lethal dose of Salmonella typhimurium (1 × 10 7 colony forming units - CFU) was significantly extended when they were administered M. alba L. Furthermore, M. alba L. activated macrophages, monocytes, and neutrophils and induced Th1 cytokines (IL-12, IFN-γ, TNF-α) in mice infected with a sublethal dose (1 × 10 5 CFU) of S. typhimurium . M. alba L. significantly stimulated the uptake of bacteria into peritoneal macrophages as indicated by increased phagocytosis. Peritoneal macrophages derived from C3H/HeJ mice significantly inhibited M. alba L. induced NO production and TNF-α secretion compared with peritoneal macrophages derived from C3H/HeN mice. These results suggest that the innate immune activity of M. alba L. against bacterial infection in mice occurs through activation of the TLR4 signaling pathway.

  12. Cell-mediated immune response and Th/Th cytokine profile of B-T constructs of F1 and V antigen of Yersinia pestis.

    PubMed

    Gupta, G; Khan, A A; Rao, D N

    2010-03-01

    Yersinia pestis, a Gram-negative bacterium, is the etiological agent of pneumonic and bubonic plague and still active in various regions of the world. Because plague is highly infectious and can readily spread by aerosolization, it poses a bioterrorism threat. The effective induction of mucosal as well as systemic immunity is an important attribute of an improved vaccine for plague. An alternative approach described here is the use of protective epitopes derived from immunodominant antigens (F1 and V) of Yersinia pestis. As T-cell immunity is also a major contributor of protection, microencapsulated B-T constructs of F1 and V antigen were used to immunize outbred and inbred mice through intranasal route, and lympho-proliferative response and cytokine profile of both Th(1) and Th(2) arms were measured in spleen, lamina propria and Peyer's patches. Three B-T constructs of F1 antigen and seven of V antigen showed significantly high T-cell response in terms of inducing systemic as well as mucosal response when compared to constituent peptides. These ten conjugates showed Th(1) cytokine profile whereas rest of the conjugates showed mixed Th(1)/Th(2) response. Four conjugates of V antigen showed high level of IL-10 production. In present study, microencapsulated B-T constructs after intranasal immunization generated systemic as well as mucosal immune response in all three sites, which offers an alternative approach for plague vaccine.

  13. Vesicular Stomatitis Virus-Vectored Multi-Antigen Tuberculosis Vaccine Limits Bacterial Proliferation in Mice following a Single Intranasal Dose

    PubMed Central

    Zhang, Ming; Dong, Chunsheng; Xiong, Sidong

    2017-01-01

    Tuberculosis (TB) remains a serious health problem worldwide, and an urgent need exists to improve or replace the available vaccine, Mycobacterium bovis bacillus Calmette-Guérin (BCG). Most vaccination protocols adapt two or three doses to induce long-term lasting immunity. Our previous study showed that the naked DNA encoding the triple-antigen fusion TFP846 (Rv3615c-Mtb10.4-Rv2660c) induced robust T cellular immune responses accompanying four inoculations against mycobacteria infection. However, a number of compliance issues exist in some areas lacking the appropriate medical infrastructure with multiple administrations. In this study, a novel vesicular stomatitis virus expressing TFP846 (VSV-846) was developed and the immune responses elicited by VSV-846 were evaluated. We observed that intranasal delivery of VSV-846 induced a potent antigen-specific T cell response following a single dose and VSV-846 efficiently controlled bacterial growth to levels ~10-fold lower than that observed in the mock group 6 weeks post-infection in BCG-infected mice. Importantly, mice immunized with VSV-846 provided long-term protection against mycobacteria infection compared with those receiving p846 or BCG immunization. Increased memory T cells were also observed in the spleens of VSV-846-vaccinated mice, which could be a potential mechanism associated with long-term protective immune response. These findings supported the use of VSV as an antigen delivery vector with the potential for TB vaccine development. PMID:28224119

  14. A genital tract peptide epitope vaccine targeting TLR-2 efficiently induces local and systemic CD8 + T cells and protects against herpes simplex virus type 2 challenge

    PubMed Central

    Dasgupta, G; Nesburn, AB; Wu, M; Zhu, X; Carpenter, D; Wechsler, SL; You, S; BenMohamed, L

    2015-01-01

    The next generation of needle-free mucosal vaccines is being rationally designed according to rules that govern the way in which the epitopes are recognized by and stimulate the genital mucosal immune system. We hypothesized that synthetic peptide epitopes extended with an agonist of Toll-like receptor 2 (TLR-2), that are abundantly expressed by dendritic and epithelial cells of the vaginal mucosa, would lead to induction of protective immunity against genital herpes. To test this hypothesis, we intravaginally (IVAG) immunized wild-type B6, TLR-2 (TLR2 −/−) or myeloid differentiation factor 88 deficient (MyD88 −/−) mice with a herpes simplex virus type 2 (HSV-2) CD8 + T-cell peptide epitope extended by a palmitic acid moiety (a TLR-2 agonist). IVAG delivery of the lipopeptide generated HSV-2-specific memory CD8 + cytotoxic T cells both locally in the genital tract draining lymph nodes and systemically in the spleen. Moreover, lipopeptide-immunized TLR2 −/− and MyD88 −/− mice developed significantly less HSV-specific CD8 + T-cell response, earlier death, faster disease progression, and higher vaginal HSV-2 titers compared to lipopeptide-immunized wild-type B6 mice. IVAG immunization with self-adjuvanting lipid-tailed peptides appears to be a novel mucosal vaccine approach, which has attractive practical and immunological features. PMID:19129756

  15. DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

    PubMed Central

    Dong, Li-Li; Tang, Ru; Zhai, Yu-Jia; Malla, Tejsu; Hu, Kai

    2017-01-01

    AIM To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK), when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future. PMID:29181304

  16. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  17. Pulmonary immunity and durable protection induced by the ID93/GLA-SE vaccine candidate against the hyper-virulent Korean Beijing Mycobacterium tuberculosis strain K.

    PubMed

    Cha, Seung Bin; Kim, Woo Sik; Kim, Jong-Seok; Kim, Hongmin; Kwon, Kee Woong; Han, Seung Jung; Cho, Sang-Nae; Coler, Rhea N; Reed, Steven G; Shin, Sung Jae

    2016-04-27

    The majority of tuberculosis (TB) vaccine candidates advanced to clinical trials have been evaluated preclinically using laboratory-adapted strains. However, it has been proposed that challenge with clinical isolates in preclinical vaccine testing could provide further and more practical validation. Here, we tested the ID93/GLA-SE TB vaccine candidate against the clinical Mycobacterium tuberculosis (Mtb) strain K (Mtb K) belonging to the Beijing family, the most prevalent Mtb strain in South Korea. Mice immunized with ID93/GLA-SE exhibited a significant reduction in bacteria and reduced lung inflammation against Mtb K when compared to non-immunized controls. In addition, we analyzed the immune responses in the lungs of ID93/GLA-SE-immunized mice, and showed that ID93/GLA-SE was able to elicit sustained Th1-biased immune responses including antigen-specific multifunctional CD4(+) T cell co-producing IFN-γ, TNF-α, and IL-2 as well as a high magnitude of IFN-γ response for up to 10 weeks post-challenge. Notably, further investigation of T cell subsets in the lung following challenge showed remarkable generation of CD8(+) central memory T cells by ID93/GLA-SE-immunization. Our findings showed that ID93/GLA-SE vaccine confers a high level of robust protection against the hypervirulent Mtb Beijing infection which was characterized by pulmonary Th1-polarized T-cell immune responses. These findings may also provide relevant information for potential utility of this vaccine candidate in East-Asian countries where the Beijing genotype is highly prevalent. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. The specificity of immune priming in silkworm, Bombyx mori, is mediated by the phagocytic ability of granular cells.

    PubMed

    Wu, Gongqing; Li, Mei; Liu, Yi; Ding, Ying; Yi, Yunhong

    2015-10-01

    In the past decade, the phenomenon of immune priming was documented in many invertebrates in a large number of studies; however, in most of these studies, behavioral evidence was used to identify the immune priming. The underlying mechanism and the degree of specificity of the priming response remain unclear. We studied the mechanism of immune priming in the larvae of the silkworm, Bombyx mori, and analyzed the specificity of the priming response using two closely related Gram-negative pathogenic bacteria (Photorhabdus luminescens TT01 and P. luminescens H06) and one Gram-positive pathogenic bacterium (Bacillus thuringiensis HD-1). Primed with heat-killed bacteria, the B. mori larvae were more likely to survive subsequent homologous exposure (the identical bacteria used in the priming and in the subsequent challenge) than heterologous (different bacteria used in the priming and subsequent exposure) exposure to live bacteria. This result indicated that the B. mori larvae possessed a strong immune priming response and revealed a degree of specificity to TT01, H06 and HD-1 bacteria. The degree of enhanced immune protection was positively correlated with the level of phagocytic ability of the granular cells and the antibacterial activity of the cell-free hemolymph. Moreover, the granular cells of the immune-primed larvae increased the phagocytosis of a previously encountered bacterial strain compared with other bacteria. Thus, the enhanced immune protection of the B. mori larvae after priming was mediated by the phagocytic ability of the granular cells and the antibacterial activity of the hemolymph; the specificity of the priming response was primarily attributed to the phagocytosis of bacteria by the granular cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Lactobacillus paracasei modulates the immune system of Galleria mellonella and protects against Candida albicans infection

    PubMed Central

    Rossoni, Rodnei Dennis; Fuchs, Beth Burgwyn; de Barros, Patrícia Pimentel; Velloso, Marisol dos Santos; Jorge, Antonio Olavo Cardoso; Junqueira, Juliana Campos; Mylonakis, Eleftherios

    2017-01-01

    Probiotics have been described as a potential strategy to control opportunistic infections due to their ability to stimulate the immune system. Using the non-vertebrate model host Galleria mellonella, we evaluated whether clinical isolates of Lactobacillus spp. are able to provide protection against Candida albicans infection. Among different strains of Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus fermentum, we verified that L. paracasei 28.4 strain had the greatest ability to prolong the survival of larvae infected with a lethal dose of C. albicans. We found that the injection of 107 cells/larvae of L. paracasei into G. mellonella larvae infected by C. albicans increased the survival of these insects compared to the control group (P = 0.0001). After that, we investigated the immune mechanisms involved in the protection against C. albicans infection, evaluating the number of hemocytes and the gene expression of antifungal peptides. We found that L. paracasei increased the hemocyte quantity (2.38 x 106 cells/mL) in relation to the control group (1.29 x 106 cells/mL), indicating that this strain is capable of raising the number of circulating hemocytes into the G. mellonella hemolymph. Further, we found that L. paracasei 28.4 upregulated genes that encode the antifungal peptides galiomicin and gallerymicin. In relation to the control group, L. paracasei 28.4 increased gene expression of galiomicin by 6.67-fold and 17.29-fold for gallerymicin. Finally, we verified that the prophylactic provision of probiotic led to a significant reduction of the number of fungal cells in G. mellonella hemolymph. In conclusion, L. paracasei 28.4 can modulate the immune system of G. mellonella and protect against candidiasis. PMID:28267809

  20. In vivo induction of a high-avidity, high-frequency cytotoxic T-lymphocyte response is associated with antiviral protective immunity.

    PubMed

    Sedlik, C; Dadaglio, G; Saron, M F; Deriaud, E; Rojas, M; Casal, S I; Leclerc, C

    2000-07-01

    Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8(+) cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8(+) class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8(+) T-cell epitopes, bound to 1-microm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503-7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4(+) T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies.

Top