The Complement System in Dialysis: A Forgotten Story?

PubMed Central

Poppelaars, Felix; Faria, Bernardo; Gaya da Costa, Mariana; Franssen, Casper F. M.; van Son, Willem J.; Berger, Stefan P.; Daha, Mohamed R.; Seelen, Marc A.

2018-01-01

Significant advances have lead to a greater understanding of the role of the complement system within nephrology. The success of the first clinically approved complement inhibitor has created renewed appreciation of complement-targeting therapeutics. Several clinical trials are currently underway to evaluate the therapeutic potential of complement inhibition in renal diseases and kidney transplantation. Although, complement has been known to be activated during dialysis for over four decades, this area of research has been neglected in recent years. Despite significant progress in biocompatibility of hemodialysis (HD) membranes and peritoneal dialysis (PD) fluids, complement activation remains an undesired effect and relevant issue. Short-term effects of complement activation include promoting inflammation and coagulation. In addition, long-term complications of dialysis, such as infection, fibrosis and cardiovascular events, are linked to the complement system. These results suggest that interventions targeting the complement system in dialysis could improve biocompatibility, dialysis efficacy, and long-term outcome. Combined with the clinical availability to safely target complement in patients, the question is not if we should inhibit complement in dialysis, but when and how. The purpose of this review is to summarize previous findings and provide a comprehensive overview of the role of the complement system in both HD and PD. PMID:29422906

Ecological momentary assessment: what it is and why it is a method of the future in clinical psychopharmacology

PubMed Central

Moskowitz, Debbie S.; Young, Simon N.

2006-01-01

Current methods of assessment in clinical psychopharmacology have several serious disadvantages, particularly for the study of social functioning. We aimed to review the strengths and weaknesses of current methods used in clinical psychopharmacology and to compare them with a group of methods, developed by personality/social psychologists, termed ecological momentary assessment (EMA), which permit the research participant to report on symptoms, affect and behaviour close in time to experience and which sample many events or time periods. EMA has a number of advantages over more traditional methods for the assessment of patients in clinical psychopharmacological studies. It can both complement and, in part, replace existing methods. EMA methods will permit more sensitive assessments and will enable more wide-ranging and detailed measurements of mood and behaviour. These types of methods should be adopted more widely by clinical psychopharmacology researchers. PMID:16496031

Current status of matrix-assisted laser desorption ionisation-time of flight mass spectrometry in the clinical microbiology laboratory.

PubMed

Kok, Jen; Chen, Sharon C A; Dwyer, Dominic E; Iredell, Jonathan R

2013-01-01

The integration of matrix-assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-TOF MS) into many clinical microbiology laboratories has revolutionised routine pathogen identification. MALDI-TOF MS complements and has good potential to replace existing phenotypic identification methods. Results are available in a more clinically relevant timeframe, particularly in bacteraemic septic shock. Novel applications include strain typing and the detection of antimicrobial resistance, but these are not widely used. This review discusses the technical aspects, current applications, and limitations of MALDI-TOF MS.

Integrating cell biology and proteomic approaches in plants.

PubMed

Takáč, Tomáš; Šamajová, Olga; Šamaj, Jozef

2017-10-03

Significant improvements of protein extraction, separation, mass spectrometry and bioinformatics nurtured advancements of proteomics during the past years. The usefulness of proteomics in the investigation of biological problems can be enhanced by integration with other experimental methods from cell biology, genetics, biochemistry, pharmacology, molecular biology and other omics approaches including transcriptomics and metabolomics. This review aims to summarize current trends integrating cell biology and proteomics in plant science. Cell biology approaches are most frequently used in proteomic studies investigating subcellular and developmental proteomes, however, they were also employed in proteomic studies exploring abiotic and biotic stress responses, vesicular transport, cytoskeleton and protein posttranslational modifications. They are used either for detailed cellular or ultrastructural characterization of the object subjected to proteomic study, validation of proteomic results or to expand proteomic data. In this respect, a broad spectrum of methods is employed to support proteomic studies including ultrastructural electron microscopy studies, histochemical staining, immunochemical localization, in vivo imaging of fluorescently tagged proteins and visualization of protein-protein interactions. Thus, cell biological observations on fixed or living cell compartments, cells, tissues and organs are feasible, and in some cases fundamental for the validation and complementation of proteomic data. Validation of proteomic data by independent experimental methods requires development of new complementary approaches. Benefits of cell biology methods and techniques are not sufficiently highlighted in current proteomic studies. This encouraged us to review most popular cell biology methods used in proteomic studies and to evaluate their relevance and potential for proteomic data validation and enrichment of purely proteomic analyses. We also provide examples of representative studies combining proteomic and cell biology methods for various purposes. Integrating cell biology approaches with proteomic ones allow validation and better interpretation of proteomic data. Moreover, cell biology methods remarkably extend the knowledge provided by proteomic studies and might be fundamental for the functional complementation of proteomic data. This review article summarizes current literature linking proteomics with cell biology. Copyright © 2017 Elsevier B.V. All rights reserved.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Recent insights into C3 glomerulopathy

PubMed Central

Barbour, Thomas D.; Pickering, Matthew C.; Cook, H. Terence

2013-01-01

‘C3 glomerulopathy’ is a recent disease classification comprising several rare types of glomerulonephritis (GN), including dense deposit disease (DDD), C3 glomerulonephritis (C3GN) and CFHR5 nephropathy. These disorders share the key histological feature of isolated complement C3 deposits in the glomerulus. A common aetiology involving dysregulation of the alternative pathway (AP) of complement has been elucidated in the past decade, with genetic defects and/or autoantibodies able to be identified in a proportion of patients. We review the clinical and histological features of C3 glomerulopathy, relating these to underlying molecular mechanisms. The role of uncontrolled C3 activation in pathogenesis is emphasized, with important lessons from animal models. Methods, advantages and limitations of gene testing in the assessment of individuals or families with C3 glomerulopathy are discussed. While no therapy has yet been shown consistently effective, clinical evaluation of agents targeting specific components of the complement system is ongoing. However, limits to current knowledge regarding the natural history and the appropriate timing and duration of proposed therapies need to be addressed. PMID:23479095

Split luciferase complementation assay for the analysis of G protein-coupled receptor ligand response in Saccharomyces cerevisiae.

PubMed

Fukutani, Yosuke; Ishii, Jun; Kondo, Akihiko; Ozawa, Takeaki; Matsunami, Hiroaki; Yohda, Masafumi

2017-06-01

The budding yeast Saccharomyces cerevisiae is equipped with G protein-coupled receptors (GPCR). Because the yeast GPCR signaling mechanism is partly similar to that of the mammalian system, S. cerevisiae can be used for a host of mammalian GPCR expression and ligand-mediated activation assays. However, currently available yeast systems require several hours to observe the responses because they depend on the expression of reporter genes. In this study, we attempted to develop a simple GPCR assay system using split luciferase and β-arrestin, which are independent of the endogenous S. cerevisiae GPCR signaling pathways. We applied the split luciferase complementation assay method to S. cerevisiae and found that it can be used to analyze the ligand response of the human somatostatin receptor in S. cerevisiae. On the contrary, the response of the pheromone receptor Ste2 was not observed by the assay. Thus, the split luciferase complementation should be free from the effect of the endogenous GPCR signaling. Biotechnol. Bioeng. 2017;114: 1354-1361. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The Production of Complement Clauses in Children with Language Impairment

ERIC Educational Resources Information Center

Steel, Gillian; Rose, Miranda; Eadie, Patricia

2016-01-01

Purpose: The purpose of this research was to provide a comprehensive description of complement-clause production in children with language impairment. Complement clauses were examined with respect to types of complement structure produced, verb use, and both semantic and syntactic accuracy. Method: A group of 17 children with language impairment…

An enzyme-mediated protein-fragment complementation assay for substrate screening of sortase A.

PubMed

Li, Ning; Yu, Zheng; Ji, Qun; Sun, Jingying; Liu, Xiao; Du, Mingjuan; Zhang, Wei

2017-04-29

Enzyme-mediated protein conjugation has gained great attention recently due to the remarkable site-selectivity and mild reaction condition affected by the nature of enzyme. Among all sorts of enzymes reported, sortase A from Staphylococcus aureus (SaSrtA) is the most popular enzyme due to its selectivity and well-demonstrated applications. Position scanning has been widely applied to understand enzyme substrate specificity, but the low throughput of chemical synthesis of peptide substrates and analytical methods (HPLC, LC-ESI-MS) have been the major hurdle to fully decode enzyme substrate profile. We have developed a simple high-throughput substrate profiling method to reveal novel substrates of SaSrtA 7M, a widely used hyperactive peptide ligase, by modified protein-fragment complementation assay (PCA). A small library targeting the LPATG motif recognized by SaSrtA 7M was generated and screened against proteins carrying N-terminal glycine. Using this method, we have confirmed all currently known substrates of the enzyme, and moreover identified some previously unknown substrates with varying activities. The method provides an easy, fast and highly-sensitive way to determine substrate profile of a peptide ligase in a high-throughput manner. Copyright © 2017 Elsevier Inc. All rights reserved.

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

Polymeric Packaging for Fully Implantable Wireless Neural Microsensors

PubMed Central

Aceros, Juan; Yin, Ming; Borton, David A.; Patterson, William R.; Bull, Christopher; Nurmikko, Arto V.

2014-01-01

We present polymeric packaging methods used for subcutaneous, fully implantable, broadband, and wireless neurosensors. A new tool for accelerated testing and characterization of biocompatible polymeric packaging materials and processes is described along with specialized test units to simulate our fully implantable neurosensor components, materials and fabrication processes. A brief description of the implantable systems is presented along with their current encapsulation methods based on polydimethylsiloxane (PDMS). Results from in-vivo testing of multiple implanted neurosensors in swine and non-human primates are presented. Finally, a novel augmenting polymer thin film material to complement the currently employed PDMS is introduced. This thin layer coating material is based on the Plasma Enhanced Chemical Vapor Deposition (PECVD) process of Hexamethyldisiloxane (HMDSO) and Oxygen (O2). PMID:23365999

Effective implementation of the weak Galerkin finite element methods for the biharmonic equation

DOE PAGES

Mu, Lin; Wang, Junping; Ye, Xiu

2017-07-06

The weak Galerkin (WG) methods have been introduced in [11, 12, 17] for solving the biharmonic equation. The purpose of this paper is to develop an algorithm to implement the WG methods effectively. This can be achieved by eliminating local unknowns to obtain a global system with significant reduction of size. In fact this reduced global system is equivalent to the Schur complements of the WG methods. The unknowns of the Schur complement of the WG method are those defined on the element boundaries. The equivalence of theWG method and its Schur complement is established. The numerical results demonstrate themore » effectiveness of this new implementation technique.« less

Effective implementation of the weak Galerkin finite element methods for the biharmonic equation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mu, Lin; Wang, Junping; Ye, Xiu

The weak Galerkin (WG) methods have been introduced in [11, 12, 17] for solving the biharmonic equation. The purpose of this paper is to develop an algorithm to implement the WG methods effectively. This can be achieved by eliminating local unknowns to obtain a global system with significant reduction of size. In fact this reduced global system is equivalent to the Schur complements of the WG methods. The unknowns of the Schur complement of the WG method are those defined on the element boundaries. The equivalence of theWG method and its Schur complement is established. The numerical results demonstrate themore » effectiveness of this new implementation technique.« less

Targeting complement-mediated immunoregulation for cancer immunotherapy.

PubMed

Kolev, Martin; Markiewski, Maciej M

2018-06-01

Complement was initially discovered as an assembly of plasma proteins "complementing" the cytolytic activity of antibodies. However, our current knowledge places this complex system of several plasma proteins, receptors, and regulators in the center of innate immunity as a bridge between the initial innate responses and adaptive immune reactions. Consequently, complement appears to be pivotal for elimination of pathogens, not only as an early response defense, but by directing the subsequent adaptive immune response. The discovery of functional intracellular complement and its roles in cellular metabolism opened novel avenues for research and potential therapeutic implications. The recent studies demonstrating immunoregulatory functions of complement in the tumor microenvironment and the premetastatic niche shifted the paradigm on our understanding of functions of the complement system in regulating immunity. Several complement proteins, through their interaction with cells in the tumor microenvironment and in metastasis-targeted organs, contribute to modulating tumor growth, antitumor immunity, angiogenesis, and therefore, the overall progression of malignancy and, perhaps, responsiveness of cancer to different therapies. Here, we focus on recent progress in our understanding of immunostimulatory vs. immunoregulatory functions of complement and potential applications of these findings to the design of novel therapies for cancer patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

The renaissance of complement therapeutics

PubMed Central

Ricklin, Daniel; Mastellos, Dimitrios C.; Reis, Edimara S.; Lambris, John D.

2018-01-01

The increasing number of clinical conditions that involve a pathological contribution from the complement system — many of which affect the kidneys — has spurred a regained interest in therapeutic options to modulate this host defence pathway. Molecular insight, technological advances, and the first decade of clinical experience with the complement-specific drug eculizumab, have contributed to a growing confidence in therapeutic complement inhibition. More than 20 candidate drugs that target various stages of the complement cascade are currently being evaluated in clinical trials, and additional agents are in preclinical development. Such diversity is clearly needed in view of the complex and distinct involvement of complement in a wide range of clinical conditions, including rare kidney disorders, transplant rejection and haemodialysis-induced inflammation. The existing drugs cannot be applied to all complement-driven diseases, and each indication has to be assessed individually. Alongside considerations concerning optimal points of intervention and economic factors, patient stratification will become essential to identify the best complement-specific therapy for each individual patient. This Review provides an overview of the therapeutic concepts, targets and candidate drugs, summarizes insights from clinical trials, and reflects on existing challenges for the development of complement therapeutics for kidney diseases and beyond. PMID:29199277

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

Optical 1's and 2's complement devices using lithium-niobate-based waveguide

NASA Astrophysics Data System (ADS)

Pal, Amrindra; Kumar, Santosh; Sharma, Sandeep

2016-12-01

Optical 1's and 2's complement devices are proposed with the help of lithium-niobate-based Mach-Zehnder interferometers. It has a powerful capability of switching an optical signal from one port to the other port with the help of an electrical control signal. The paper includes the optical conversion scheme using sets of optical switches. 2's complement is common in computer systems and is used in binary subtraction and logical manipulation. The operation of the circuits is studied theoretically and analyzed through numerical simulations. The truth table of these complement methods is verified with the beam propagation method and MATLAB® simulation results.

O1.6. INCREASED COMPLEMENT FACTORS C3 AND C4 IN SCHIZOPHRENIA AND THE EARLY STAGES OF PSYCHOSIS: IMPLICATIONS FOR CLINICAL SYMPTOMATOLOGY AND CORTICAL THICKNESS

PubMed Central

Cropley, Vanessa; Laskaris, Liliana; Zalesky, Andrew; Weickert, Cynthia Shannon; Biase, Maria Di; Chana, Gursharan; Baune, Bernhard; Bousman, Chad; Nelson, Barnaby; McGorry, Patrick D; Everall, Ian; Pantelis, Christos

2018-01-01

Abstract Background The complement system - a key component of the innate immune system, has been proposed to contribute to the pathogenesis of schizophrenia. Recently, complement C4 was associated with increased risk of schizophrenia, and in a mouse model, developmentally-timed synaptic pruning. These observations have led to proposals that abnormal activation of the complement system might contribute to the development of schizophrenia by disrupting synaptic pruning during key developmental periods. However, despite renewed interest in the complement system in schizophrenia it remains unclear whether peripheral complement levels differ in cases compared to controls, change over the course of illness and whether they are associated with current symptomatology and brain cortical thickness. This study aimed to: i) investigate whether peripheral complement protein levels are altered at different stages of illness, and ii) identify patterns among complement protein levels that predict clinical symptoms and grey matter thickness across the cortex. Methods Complement factors C1q, C3 and C4 were quantified in 183 participants [n=83 Healthy Controls (HC), n=10 Ultra-High Risk (UHR) for psychosis, n=40 First Episode Psychosis (FEP), n=50 Chronic schizophrenia] using Multiplex ELISA. Permutation-based t-tests were used to assess between-group differences in complement protein levels at each of the three illness stages, relative to age- and gender-matched healthy controls. Canonical correlation analysis was used to identify patterns of complement protein levels that correlated with clinical symptoms and regional thickness across the cortex. Results C3 and C4 were significantly increased in FEP and UHR patients, whereas only C4 was significantly increased in chronic patients. A molecular pattern of increased C4 and decreased C3 was associated with positive and negative symptom severity in the pooled patient sample. Increased C4 levels alone, or decreased C3 levels alone, did not correlate with symptom severity as strongly as the pattern of increased C4 in combination with decreased C3. Preliminary canonical correlation analyses revealed that, in healthy controls, a molecular pattern characterised by increased C3 and decreased C4 was associated with relatively thinner paracentral, inferior parietal and inferior temporal cortices, but relatively thicker insular, in the left hemisphere. In the pooled patient group, a trend for increased C3 in combination with decreased C1q was associated with relatively thinner left lateral occipital cortex and pars orbitalis but relatively thicker pars opercularis and precuneus. Discussion Our findings indicate that peripheral complement concentration is particularly increased early and preceding psychosis and its imbalance may be associated with symptom severity and variation in regional grey matter thickness across the cortex.

Mathematical and computational approaches can complement experimental studies of host-pathogen interactions.

PubMed

Kirschner, Denise E; Linderman, Jennifer J

2009-04-01

In addition to traditional and novel experimental approaches to study host-pathogen interactions, mathematical and computer modelling have recently been applied to address open questions in this area. These modelling tools not only offer an additional avenue for exploring disease dynamics at multiple biological scales, but also complement and extend knowledge gained via experimental tools. In this review, we outline four examples where modelling has complemented current experimental techniques in a way that can or has already pushed our knowledge of host-pathogen dynamics forward. Two of the modelling approaches presented go hand in hand with articles in this issue exploring fluorescence resonance energy transfer and two-photon intravital microscopy. Two others explore virtual or 'in silico' deletion and depletion as well as a new method to understand and guide studies in genetic epidemiology. In each of these examples, the complementary nature of modelling and experiment is discussed. We further note that multi-scale modelling may allow us to integrate information across length (molecular, cellular, tissue, organism, population) and time (e.g. seconds to lifetimes). In sum, when combined, these compatible approaches offer new opportunities for understanding host-pathogen interactions.

Progress and trends in complement therapeutics.

PubMed

Ricklin, Daniel; Lambris, John D

2013-01-01

The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.

Progress and Trends in Complement Therapeutics.

PubMed

Ricklin, Daniel; Lambris, John D

2013-01-01

The past few years have proven to be a highly successful and exciting period for the field of complement-directed drug discovery and development. Driven by promising experiences with the first marketed complement drugs, increased knowledge about the involvement of complement in health and disease, and improvements in structural and analytical techniques as well as animal models of disease, the field has seen a surge in creative approaches to therapeutically intervene at various stages of the cascade. An impressive panel of compounds that show promise in clinical trials is meanwhile being lined up in the pipelines of both small biotechnology and big pharmaceutical companies. Yet with this new focus on complement-targeted therapeutics, important questions concerning target selection, point and length of intervention, safety, and drug delivery emerge. In view of the diversity of the clinical disorders involving abnormal complement activity or regulation, which include both acute and chronic diseases and affect a wide range of organs, diverse yet specifically tailored therapeutic approaches may be needed to shift complement back into balance. This chapter highlights the key changes in the field that shape our current perception of complement-targeted drugs and provides a brief overview of recent strategies and emerging trends. Selected examples of complement-related diseases and inhibitor classes are highlighted to illustrate the diversity and creativity in field.

Complement factor H family proteins in their non-canonical role as modulators of cellular functions.

PubMed

Józsi, Mihály; Schneider, Andrea E; Kárpáti, Éva; Sándor, Noémi

2018-01-04

Complement factor H is a major regulator of the alternative pathway of the complement system. The factor H-related proteins are less characterized, but recent data indicate that they rather promote complement activation. These proteins have some common ligands with factor H and have both overlapping and distinct functions depending on domain composition and the degree of conservation of amino acid sequence. Factor H and some of the factor H-related proteins also appear in a non-canonical function that is beyond their role in the modulation of complement activation. This review covers our current understanding on this emerging role of factor H family proteins in modulating the activation and function of various cells by binding to receptors or receptor ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.

Luciferase Protein Complementation Assays for Bioluminescence Imaging of Cells and Mice

PubMed Central

Luker, Gary D.; Luker, Kathryn E.

2015-01-01

Summary Protein fragment complementation assays (PCAs) with luciferase reporters currently are the preferred method for detecting and quantifying protein-protein interactions in living animals. At the most basic level, PCAs involve fusion of two proteins of interest to enzymatically inactive fragments of luciferase. Upon association of the proteins of interest, the luciferase fragments are capable of reconstituting enzymatic activity to generate luminescence in vivo. In addition to bi-molecular luciferase PCAs, unimolecular biosensors for hormones, kinases, and proteases also have been developed using target peptides inserted between inactive luciferase fragments. Luciferase PCAs offer unprecedented opportunities to quantify dynamics of protein-protein interactions in intact cells and living animals, but successful use of luciferase PCAs in cells and mice involves careful consideration of many technical factors. This chapter discusses the design of luciferase PCAs appropriate for animal imaging, including construction of reporters, incorporation of reporters into cells and mice, imaging techniques, and data analysis. PMID:21153371

Exopolysaccharides Isolated from Hydrothermal Vent Bacteria Can Modulate the Complement System

PubMed Central

Courtois, Anthony; Berthou, Christian; Guézennec, Jean

2014-01-01

The complement system is involved in the defence against bacterial infection, or in the elimination of tumour cells. However, disturbances in this system contributes to the pathogenesis of various inflammatory diseases. The efficiency of therapeutic anti-tumour antibodies is enhanced when the complement system is stimulated. In contrast, cancer cells are able to inhibit the complement system and thus proliferate. Some marine molecules are currently being developed as new drugs for use in humans. Among them, known exopolyssacharides (EPSs) generally originate from fungi, but few studies have been performed on bacterial EPSs and even fewer on EPSs extracted from deep-sea hydrothermal vent microbes. For use in humans, these high molecular weight EPSs must be depolymerised. Furthermore, the over-sulphation of EPSs can modify their biological activity. The aim of this study was to investigate the immunodulation of the complement system by either native or over-sulphated low molecular weight EPSs isolated from vent bacteria in order to find pro or anti-activators of complement. PMID:24736648

Keeping It All Going-Complement Meets Metabolism.

PubMed

Kolev, Martin; Kemper, Claudia

2017-01-01

The complement system is an evolutionary old and crucial component of innate immunity, which is key to the detection and removal of invading pathogens. It was initially discovered as a liver-derived sentinel system circulating in serum, the lymph, and interstitial fluids that mediate the opsonization and lytic killing of bacteria, fungi, and viruses and the initiation of the general inflammatory responses. Although work performed specifically in the last five decades identified complement also as a critical instructor of adaptive immunity-indicating that complement's function is likely broader than initially anticipated-the dominant opinion among researchers and clinicians was that the key complement functions were in principle defined. However, there is now a growing realization that complement activity goes well beyond "classic" immune functions and that this system is also required for normal (neuronal) development and activity and general cell and tissue integrity and homeostasis. Furthermore, the recent discovery that complement activation is not confined to the extracellular space but occurs within cells led to the surprising understanding that complement is involved in the regulation of basic processes of the cell, particularly those of metabolic nature-mostly via novel crosstalks between complement and intracellular sensor, and effector, pathways that had been overlooked because of their spatial separation. These paradigm shifts in the field led to a renaissance in complement research and provide new platforms to now better understand the molecular pathways underlying the wide-reaching effects of complement functions in immunity and beyond. In this review, we will cover the current knowledge about complement's emerging relationship with the cellular metabolism machinery with a focus on the functional differences between serum-circulating versus intracellularly active complement during normal cell survival and induction of effector functions. We will also discuss how taking a closer look into the evolution of key complement components not only made the functional connection between complement and metabolism rather "predictable" but how it may also give clues for the discovery of additional roles for complement in basic cellular processes.

Relations between Mental Verb and False Belief Understanding in Cantonese-Speaking Children

ERIC Educational Resources Information Center

Cheung, Him; Chen, Hsuan-Chih; Yeung, William

2009-01-01

Previous research has shown that linguistic forms that codify mental contents bear a specific relation with children's false belief understanding. These forms include mental verbs and their following complements, yet the two have not been considered separately. The current study examined the roles of mental verb semantics and the complement syntax…

Solving the Schroedinger Equation of Atoms and Molecules without Analytical Integration Based on the Free Iterative-Complement-Interaction Wave Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakatsuji, H.; Nakashima, H.; Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University, Nishikyo-ku, Kyoto 615-8510

2007-12-14

A local Schroedinger equation (LSE) method is proposed for solving the Schroedinger equation (SE) of general atoms and molecules without doing analytic integrations over the complement functions of the free ICI (iterative-complement-interaction) wave functions. Since the free ICI wave function is potentially exact, we can assume a flatness of its local energy. The variational principle is not applicable because the analytic integrations over the free ICI complement functions are very difficult for general atoms and molecules. The LSE method is applied to several 2 to 5 electron atoms and molecules, giving an accuracy of 10{sup -5} Hartree in total energy.more » The potential energy curves of H{sub 2} and LiH molecules are calculated precisely with the free ICI LSE method. The results show the high potentiality of the free ICI LSE method for developing accurate predictive quantum chemistry with the solutions of the SE.« less

Capsule Endoscopy in the Assessment of Obscure Gastrointestinal Bleeding: An Economic Analysis

PubMed Central

Palimaka, S; Blackhouse, Gord; Goeree, Ron

2015-01-01

Background Small-bowel capsule endoscopy is a tool used to visualize the small bowel to identify the location of bleeds in obscure gastrointestinal bleeding (OGIB). Capsule endoscopy is currently funded in Ontario in cases where there has been a failure to identify a source of bleeding via conventional diagnostic procedures. In Ontario, capsule endoscopy is a diagnostic option for patients whose findings on esophagogastroduodenoscopy, colonoscopy, and push enteroscopy have been negative (i.e., the source of bleeding was not found). Objectives This economic analysis aims to estimate the budget impact of different rates of capsule endoscopy use as a complement to push enteroscopy procedures in patients aged 18 years and older. Data Sources Population-based administrative databases for Ontario were used to identify patients receiving push enteroscopy and small-bowel capsule endoscopy in the fiscal years 2008 to 2012. Review Methods A systematic literature search was performed to identify economic evaluations of capsule endoscopy for the investigation of OGIB. Studies were assessed for their methodological quality and their applicability to the Ontarian setting. An original budget impact analysis was performed using data from Ontarian administrative sources and published literature. The budget impact was estimated for different levels of use of capsule endoscopy as a complement to push enteroscopy due to the uncertain clinical utility of the capsule based on current clinical evidence. The analysis was conducted from the provincial public payer perspective. Results With varying rates of capsule endoscopy use, the budgetary impact spans from savings of $510,000,1 when no (0%) push enteroscopy procedures are complemented with capsule endoscopy, to $2,036,000, when all (100%) push enteroscopy procedures are complemented with capsule endoscopy. A scenario where 50% of push enteroscopy procedures are complemented with capsule endoscopy (expected use based on expert opinion) would result in additional expenditure of about $763,000. Limitations In the literature on OGIB, estimates of rebleeding rates after endoscopic procedures or spontaneous cessation rates are unreliable, with a lack of data. Rough estimates from expert consultation can provide an indication of expected additional use of capsule endoscopy; however, a wide range of capsule uses was explored. Conclusions The budgetary impact in the first year in Ontario of capsule endoscopy use to complement push enteroscopy procedures ranges from $510,000 in savings to an additional expenditure of $2,036,000 (at 0% and 100% push enteroscopy procedures complemented, respectively). The expected scenario of 50% of push enteroscopy procedures likely to benefit from the use of capsule endoscopy, based on expert opinion, would result in additional expenditures of $763,000 in the first year. PMID:26355732

A complementation assay for in vivo protein structure/function analysis in Physcomitrella patens (Funariaceae)

DOE PAGES

Scavuzzo-Duggan, Tess R.; Chaves, Arielle M.; Roberts, Alison W.

2015-07-14

Here, a method for rapid in vivo functional analysis of engineered proteins was developed using Physcomitrella patens. A complementation assay was designed for testing structure/function relationships in cellulose synthase (CESA) proteins. The components of the assay include (1) construction of test vectors that drive expression of epitope-tagged PpCESA5 carrying engineered mutations, (2) transformation of a ppcesa5 knockout line that fails to produce gametophores with test and control vectors, (3) scoring the stable transformants for gametophore production, (4) statistical analysis comparing complementation rates for test vectors to positive and negative control vectors, and (5) analysis of transgenic protein expression by Westernmore » blotting. The assay distinguished mutations that generate fully functional, nonfunctional, and partially functional proteins. In conclusion, compared with existing methods for in vivo testing of protein function, this complementation assay provides a rapid method for investigating protein structure/function relationships in plants.« less

Scinticisternography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paris, A. Jr.; Caleel, G.T.

1975-03-01

Scinticisternography is a physiologic method of evaluating the cerebrospinal fluid spaces and dynamics, and complements radiographic techniques. Improvements in radiopharmaceutical agents and in imaging devices have made the procedure almost a routine part of examination of patients with neurologic disease. It is particularly valuable for patients with hydrocephalus, for whom accurate identification of the cause of dementia opens the possibility of correction by a shunting procedure. The danger of radiation damage with currently accepted dosage is slight, and the risk of meningitis can be minimized if proper precautions are observed.

Parasitic scabies mites and associated bacteria joining forces against host complement defence.

PubMed

Swe, P M; Reynolds, S L; Fischer, K

2014-11-01

Scabies is a ubiquitous and contagious skin disease caused by the parasitic mite Sarcoptes scabiei Epidemiological studies have identified scabies as a causative agent for secondary skin infections caused by Staphylococcus aureus and Streptococcus pyogenes. This is an important notion, as such bacterial infections can lead to serious downstream life-threatening complications. As the complement system is the first line of host defence that confronts invading pathogens, both the mite and bacteria produce a large array of molecules that inhibit the complement cascades. It is hypothesised that scabies mite complement inhibitors may play an important role in providing a favourable micro-environment for the establishment of secondary bacterial infections. This review aims to bring together the current literature on complement inhibition by scabies mites and bacteria associated with scabies and to discuss the proposed molecular link between scabies and bacterial co-infections. © 2014 John Wiley & Sons Ltd.

Hybrid Particle-Element Simulation of Impact on Composite Orbital Debris Shields

NASA Technical Reports Server (NTRS)

Fahrenthold, Eric P.

2004-01-01

This report describes the development of new numerical methods and new constitutive models for the simulation of hypervelocity impact effects on spacecraft. The research has included parallel implementation of the numerical methods and material models developed under the project. Validation work has included both one dimensional simulations, for comparison with exact solutions, and three dimensional simulations of published hypervelocity impact experiments. The validated formulations have been applied to simulate impact effects in a velocity and kinetic energy regime outside the capabilities of current experimental methods. The research results presented here allow for the expanded use of numerical simulation, as a complement to experimental work, in future design of spacecraft for hypervelocity impact effects.

Complement in autoimmune diseases.

PubMed

Vignesh, Pandiarajan; Rawat, Amit; Sharma, Madhubala; Singh, Surjit

2017-02-01

The complement system is an ancient and evolutionary conserved element of the innate immune mechanism. It comprises of more than 20 serum proteins most of which are synthesized in the liver. These proteins are synthesized as inactive precursor proteins which are activated by appropriate stimuli. The activated forms of these proteins act as proteases and cleave other components successively in amplification pathways leading to exponential generation of final effectors. Three major pathways of complement pathways have been described, namely the classical, alternative and lectin pathways which are activated by different stimuli. However, all the 3 pathways converge on Complement C3. Cleavage of C3 and C5 successively leads to the production of the membrane attack complex which is final common effector. Excessive and uncontrolled activation of the complement has been implicated in the host of autoimmune diseases. But the complement has also been bemusedly described as the proverbial "double edged sword". On one hand, complement is the final effector of tissue injury in autoimmune diseases and on the other, deficiencies of some components of the complement can result in autoimmune diseases. Currently available tools such as enzyme based immunoassays for functional assessment of complement pathways, flow cytometry, next generation sequencing and proteomics-based approaches provide an exciting opportunity to study this ancient yet mysterious element of innate immunity. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of the complement inhibitory function of rhesus rhadinovirus complement control protein (RCP).

PubMed

Okroj, Marcin; Mark, Linda; Stokowska, Anna; Wong, Scott W; Rose, Nicola; Blackbourn, David J; Villoutreix, Bruno O; Spiller, O Brad; Blom, Anna M

2009-01-02

Rhesus rhadinovirus (RRV) is currently the closest known, fully sequenced homolog of human Kaposi sarcoma-associated herpesvirus. Both these viruses encode complement inhibitors as follows: Kaposi sarcoma-associated herpesvirus-complement control protein (KCP) and RRV-complement control protein (RCP). Previously we characterized in detail the functional properties of KCP as a complement inhibitor. Here, we performed comparative analyses for two variants of RCP protein, encoded by RRV strains H26-95 and 17577. Both RCP variants and KCP inhibited human and rhesus complement when tested in hemolytic assays measuring all steps of activation via the classical and the alternative pathway. RCP variants from both RRV strains supported C3b and C4b degradation by factor I and decay acceleration of the classical C3 convertase, similar to KCP. Additionally, the 17577 RCP variant accelerated decay of the alternative C3 convertase, which was not seen for KCP. In contrast to KCP, RCP showed no affinity to heparin and is the first described complement inhibitor in which the binding site for C3b/C4b does not interact with heparin. Molecular modeling shows a structural disruption in the region of RCP that corresponds to the KCP-heparin-binding site. This makes RRV a superior model for future in vivo investigations of complement evasion, as RCP does not play a supportive role in viral attachment as KCP does.

Myasthenia gravis: the role of complement at the neuromuscular junction.

PubMed

Howard, James F

2018-01-01

Generalized myasthenia gravis (gMG) is a rare autoimmune disorder characterized by skeletal muscle weakness caused by disrupted neurotransmission at the neuromuscular junction (NMJ). Approximately 74-88% of patients with gMG have acetylcholine receptor (AChR) autoantibodies. Complement plays an important role in innate and antibody-mediated immunity, and activation and amplification of complement results in the formation of membrane attack complexes (MACs), lipophilic proteins that damage cell membranes. The role of complement in gMG has been demonstrated in animal models and patients. Studies in animals lacking specific complement proteins have confirmed that MAC formation is required to induce experimental autoimmune MG (EAMG) and NMJ damage. Complement inhibition in EAMG models can prevent disease induction and reverse its progression. Patients with anti-AChR + MG have autoantibodies and MACs present at NMJs. Damaged NMJs are associated with more severe disease, fewer AChRs, and MACs in synaptic debris. Current MG therapies do not target complement directly. Eculizumab is a humanized monoclonal antibody that inhibits cleavage of complement protein C5, preventing MAC formation. Eculizumab treatment improved symptoms compared with placebo in a phase II study in patients with refractory gMG. Direct complement inhibition could preserve NMJ physiology and muscle function in patients with anti-AChR + gMG. © 2017 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals Inc. on behalf of The New York Academy of Sciences.

Factor H-related proteins.

PubMed

Józsi, Mihály; Meri, Seppo

2014-01-01

Factor H-related proteins (CFHRs) are plasma glycoproteins related in structure and antigenicity to each other and to the complement inhibitory protein factor H. Such proteins are found in most mammals but their number and domain composition vary. This chapter summarizes our current knowledge on the human factor H-related proteins. In contrast to factor H, they have no strong complement inhibitory activity, although for some of them regulatory or complement modulatory activity has been reported. A common feature of CFHRs is that they bind to the C3b component of complement. Novel links between CFHRs and various diseases (C3 glomerulopathies, atypical hemolytic uremic syndrome and age-related macular degeneration) have been revealed in recent years, but we are still far from understanding their biological function.

Targeting the complement system for the management of retinal inflammatory and degenerative diseases.

PubMed

Xu, Heping; Chen, Mei

2016-09-15

The retina, an immune privileged tissue, has specialized immune defense mechanisms against noxious insults that may exist in diseases such as age-related macular degeneration (AMD), diabetic retinopathy (DR), uveoretinitis and glaucoma. The defense system consists of retinal innate immune cells (including microglia, perivascular macrophages, and a small population of dendritic cells) and the complement system. Under normal aging conditions, retinal innate immune cells and the complement system undergo a low-grade activation (parainflammation) which is important for retinal homeostasis. In disease states such as AMD and DR, the parainflammatory response is dysregulated and develops into detrimental chronic inflammation. Complement activation in the retina is an important part of chronic inflammation and may contribute to retinal pathology in these disease states. Here, we review the evidence that supports the role of uncontrolled or dysregulated complement activation in various retinal degenerative and angiogenic conditions. We also discuss current strategies that are used to develop complement-based therapies for retinal diseases such as AMD. The potential benefits of complement inhibition in DR, uveoretinitis and glaucoma are also discussed, as well as the need for further research to better understand the mechanisms of complement-mediated retinal damage in these disease states. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Validation and Verification (V and V) Testing on Midscale Flame Resistant (FR) Test Method

DTIC Science & Technology

2016-12-16

Method for Evaluation of Flame Resistant Clothing for Protection against Fire Simulations Using an Instrumented Manikin. Validation and...complement (not replace) the capabilities of the ASTM F1930 Standard Test Method for Evaluation of Flame Resistant Clothing for Protection against Fire ...Engineering Center (NSRDEC) to complement the ASTM F1930 Standard Test Method for Evaluation of Flame Resistant Clothing for Protection against Fire

A Graphical Teaching Tool for Understanding Two's Complement.

ERIC Educational Resources Information Center

Luck, Carlos L.

As part of the Electrical Engineering program at the Univesity of Southern Maine, students are typically introduced to Two's Complement algebra and representation, a method to include negative numbers in the binary representation of integers that is widely used in microprocessors and related digital systems. The traditional, procedural method to…

Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway.

PubMed

Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine; Garred, Peter

2017-01-01

The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition molecules that bind specific patterns on microbial surfaces, a group of associated proteases that initiates the complement cascade, and a group of proteins that interact in proteolytic complexes or the terminal pore-forming complex. In addition, various regulatory proteins are important for controlling the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system. Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination.

Experimental Methods for Protein Interaction Identification and Characterization

NASA Astrophysics Data System (ADS)

Uetz, Peter; Titz, Björn; Cagney, Gerard

There are dozens of methods for the detection of protein-protein interactions but they fall into a few broad categories. Fragment complementation assays such as the yeast two-hybrid (Y2H) system are based on split proteins that are functionally reconstituted by fusions of interacting proteins. Biophysical methods include structure determination and mass spectrometric (MS) identification of proteins in complexes. Biochemical methods include methods such as far western blotting and peptide arrays. Only the Y2H and protein complex purification combined with MS have been used on a larger scale. Due to the lack of data it is still difficult to compare these methods with respect to their efficiency and error rates. Current data does not favor any particular method and thus multiple experimental approaches are necessary to maximally cover the interactome of any target cell or organism.

Validation studies and proficiency testing.

PubMed

Ankilam, Elke; Heinze, Petra; Kay, Simon; Van den Eede, Guy; Popping, Bert

2002-01-01

Genetically modified organisms (GMOs) entered the European food market in 1996. Current legislation demands the labeling of food products if they contain <1% GMO, as assessed for each ingredient of the product. To create confidence in the testing methods and to complement enforcement requirements, there is an urgent need for internationally validated methods, which could serve as reference methods. To date, several methods have been submitted to validation trials at an international level; approaches now exist that can be used in different circumstances and for different food matrixes. Moreover, the requirement for the formal validation of methods is clearly accepted; several national and international bodies are active in organizing studies. Further validation studies, especially on the quantitative polymerase chain reaction methods, need to be performed to cover the rising demand for new extraction methods and other background matrixes, as well as for novel GMO constructs.

Site-targeted complement inhibition by a complement receptor 2-conjugated inhibitor (mTT30) ameliorates post-injury neuropathology in mouse brains.

PubMed

Rich, Megan C; Keene, Chesleigh N; Neher, Miriam D; Johnson, Krista; Yu, Zhao-Xue; Ganivet, Antoine; Holers, V Michael; Stahel, Philip F

2016-03-23

Intracerebral complement activation after severe traumatic brain injury (TBI) leads to a cascade of neuroinflammatory pathological sequelae that propagate host-mediated secondary brain injury and adverse outcomes. There are currently no specific pharmacological agents on the market to prevent or mitigate the development of secondary cerebral insults after TBI. A novel chimeric CR2-fH compound (mTT30) provides targeted inhibition of the alternative complement pathway at the site of tissue injury. This experimental study was designed to test the neuroprotective effects of mTT30 in a mouse model of closed head injury. The administration of 500 μg mTT30 i.v. at 1 h, 4 h and 24 h after head injury attenuated complement C3 deposition in injured brains, reduced the extent of neuronal cell death, and decreased post-injury microglial activation, compared to vehicle-injected placebo controls. These data imply that site-targeted alternative pathway complement inhibition may represent a new promising therapeutic avenue for the future management of severe TBI. Copyright © 2016. Published by Elsevier Ireland Ltd.

Beaconless Pointing for Deep-Space Optical Communication

NASA Technical Reports Server (NTRS)

Swank, Aaron J.; Aretskin-Hariton, Eliot; Le, Dzu K.; Sands, Obed S.; Wroblewski, Adam

2016-01-01

Free space optical communication is of interest to NASA as a complement to existing radio frequency communication methods. The potential for an increase in science data return capability over current radio-frequency communications is the primary objective. Deep space optical communication requires laser beam pointing accuracy on the order of a few microradians. The laser beam pointing approach discussed here operates without the aid of a terrestrial uplink beacon. Precision pointing is obtained from an on-board star tracker in combination with inertial rate sensors and an outgoing beam reference vector. The beaconless optical pointing system presented in this work is the current approach for the Integrated Radio and Optical Communication (iROC) project.

Spatial correlation of auroral zone geomagnetic variations

NASA Astrophysics Data System (ADS)

Jackel, B. J.; Davalos, A.

2016-12-01

Magnetic field perturbations in the auroral zone are produced by a combination of distant ionospheric and local ground induced currents. Spatial and temporal structure of these currents is scientifically interesting and can also have a significant influence on critical infrastructure.Ground-based magnetometer networks are an essential tool for studying these phenomena, with the existing complement of instruments in Canada providing extended local time coverage. In this study we examine the spatial correlation between magnetic field observations over a range of scale lengths. Principal component and canonical correlation analysis are used to quantify relationships between multiple sites. Results could be used to optimize network configurations, validate computational models, and improve methods for empirical interpolation.

Concurrent error detecting codes for arithmetic processors

NASA Technical Reports Server (NTRS)

Lim, R. S.

1979-01-01

A method of concurrent error detection for arithmetic processors is described. Low-cost residue codes with check-length l and checkbase m = 2 to the l power - 1 are described for checking arithmetic operations of addition, subtraction, multiplication, division complement, shift, and rotate. Of the three number representations, the signed-magnitude representation is preferred for residue checking. Two methods of residue generation are described: the standard method of using modulo m adders and the method of using a self-testing residue tree. A simple single-bit parity-check code is described for checking the logical operations of XOR, OR, and AND, and also the arithmetic operations of complement, shift, and rotate. For checking complement, shift, and rotate, the single-bit parity-check code is simpler to implement than the residue codes.

Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway

PubMed Central

Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine; Garred, Peter

2017-01-01

The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition molecules that bind specific patterns on microbial surfaces, a group of associated proteases that initiates the complement cascade, and a group of proteins that interact in proteolytic complexes or the terminal pore-forming complex. In addition, various regulatory proteins are important for controlling the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system. Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination. PMID:28553281

The potential of task shifting selected maternal interventions to auxiliary midwives in Myanmar: a mixed-method study.

PubMed

Than, Kyu Kyu; Tin, Khaing Nwe; La, Thazin; Thant, Kyaw Soe; Myint, Theingi; Beeson, James G; Luchters, Stanley; Morgan, Alison

2018-01-03

An estimated 282 women die for every 100,000 live births in Myanmar, most due to preventable causes. Auxiliary Midwives (AMWs) in Myanmar are responsible for providing a package of care during pregnancy and childbirth to women in rural hard to reach areas where skilled birth attendants (Midwives) are not accessible. This study aims to examine the role of AMWs in Myanmar and to assess the current practices of three proposed essential maternal interventions (oral supplement distribution to pregnant women; administration of misoprostol to prevent postpartum haemorrhage; management of puerperal sepsis with oral antibiotics) in order to facilitate a formal integration of these tasks to AMWs in Myanmar. A mixed methods study was conducted in Magwe Region, Myanmar involving a survey of 262 AMWs, complemented by 15 focus group discussions with midwives (MWs), AMWs, mothers and community members, and 10 key informant interviews with health care providers at different levels within the health care system. According to current government policy, AMWs are responsible for identifying pregnant women, screening for danger signs and facilitating early referral, provision of counselling on nutrition and birth preparedness for women in hard-to-reach areas. AMWs also assist at normal deliveries and help MWs provide immunization services. In practice, they also provide oral supplements to pregnant women (84%), provide antibiotics to mothers during the puerperium (43%), and provide misoprostol to prevent postpartum haemorrhage (41%). The current practices of AMWs demonstrate the potential for task shifting on selected essential maternal interventions. However, to integrate these interventions into formal practice they must be complemented with appropriate training, clear guidelines on drug use, systematic recording and reporting, supportive monitoring and supervision and a clear political commitment towards task shifting. With the current national government's commitment towards one AMW in one village, this study highlights the potential for shifting specific maternal lifesaving tasks to AMWs.

Covalent Chemical 5'-Functionalization of RNA with Diazo Reagents.

PubMed

Gampe, Christian M; Hollis-Symynkywicz, Micah; Zécri, Frédéric

2016-08-22

Functionalization of RNA at the 5'-terminus is important for analytical and therapeutic purposes. Currently, these RNAs are synthesized de novo starting with a chemically functionalized 5'-nucleotide, which is incorporated into RNA using chemical synthesis or biochemical techniques. Methods for direct chemical modification of native RNA would provide an attractive alternative but are currently underexplored. Herein, we report that diazo compounds can be used to selectively alkylate the 5'-phosphate of ribo(oligo)nucleotides to give RNA labelled through a native phosphate ester bond. We applied this method to functionalize oligonucleotides with biotin and an orthosteric inhibitor of the eukaryotic initiation factor 4E (eIF4E), an enzyme involved in mRNA recognition. The modified RNA binds to eIF4E, demonstrating the utility of this labelling technique to modulate biological activity of RNA. This method complements existing techniques and may be used to chemically introduce a broad range of functional handles at the 5'-end of RNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Crank Nicolson Time Integrator for EMPHASIS.

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGregor, Duncan Alisdair Odum; Love, Edward; Kramer, Richard Michael Jack

2018-03-01

We investigate the use of implicit time integrators for finite element time domain approxi- mations of Maxwell's equations in vacuum. We discretize Maxwell's equations in time using Crank-Nicolson and in 3D space using compatible finite elements. We solve the system by taking a single step of Newton's method and inverting the Eddy-Current Schur complement allowing for the use of standard preconditioning techniques. This approach also generalizes to more complex material models that can include the Unsplit PML. We present verification results and demonstrate performance at CFL numbers up to 1000.

Intestinal Microbiota and Its Relationship with Necrotizing Enterocolitis

PubMed Central

Patel, Ravi Mangal; Denning, Patricia W.

2015-01-01

Necrotizing enterocolitis is a leading cause of morbidity and mortality in infants born prematurely. After birth, the neonatal gut must acquire a healthy complement of commensal bacteria. Disruption or delay of this critical process, leading to deficient or abnormal microbial colonization of the gut, has been implicated as key risk factor in the pathogenesis of NEC. Conversely, a beneficial complement of commensal intestinal microbiota may protect the immature gut from inflammation and injury. Interventions aimed at providing or restoring a healthy complement of commensal bacteria, such as probiotic therapy, are currently the most promising treatment to prevent NEC. Shifting the balance of intestinal microbiota from a pathogenic to protective complement of bacteria can protect the gut from inflammation and subsequent injury that leads to NEC. Herein, we review the relationship of intestinal microbiota and NEC in preterm infants. PMID:25992911

Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

PubMed

Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

2017-05-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

PubMed Central

Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

2017-01-01

The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

Dynamics and reproductive effects of complement factors in the spontaneous abortion model of CBA/J×DBA/2 mice.

PubMed

Takeshita, Ai; Kusakabe, Ken Takeshi; Hiyama, Masato; Kuniyoshi, Nobue; Kondo, Tomohiro; Kano, Kiyoshi; Kiso, Yasuo; Okada, Toshiya

2014-05-01

The complement system is one component of innate immunity that could participate in fetal loss. We have already reported that adipsin, a complement activator in the alternative pathway, is stably expressed in the placenta and that an increase in this expression is related to spontaneous abortion. However, complement inhibitor Crry was concurrently expressed in the placenta, and the role of complement factors during pregnancy was not clear. In the present study, we examined the endogenous regulation of complement factors in placenta and serum by using another model mouse for spontaneous abortion and studied the effect of exogenous complement disruption on pregnancy. Compared to control mice, the CBA/J×DBA/2 model mice had higher expression levels of adipsin in the placenta and serum. Adipsin and complement C3 were localized in the metrial gland and labyrinth regions, and both positive reactive ranges were limited in the maternal blood current in normal implantation sites. These results suggest that extrauterine adipsin hematogenously reaches the placenta, activates complement C3, and promotes destruction of the feto-maternal barrier in aborted implantation sites. Crry was consistently expressed in the placenta and serum and reduced in the resorption sites of CBA/J×DBA/2 mice as compared to normal sites. Injection of recombinant adipsin increased the resorption rate and changed the expression of Th-type cytokines toward a Th1 bias. The present study indicates that adipsin could induce the fetal loss that accompanies the Th1 bias and may be a crucial cause of spontaneous abortion. In addition, the local expression of Crry prevents complement activation in placenta in response to a systemic increase of adipsin. Copyright © 2014 Elsevier GmbH. All rights reserved.

The “curved lead pathway” method to enable a single lead to reach any two intracranial targets

NASA Astrophysics Data System (ADS)

Ding, Chen-Yu; Yu, Liang-Hong; Lin, Yuan-Xiang; Chen, Fan; Lin, Zhang-Ya; Kang, De-Zhi

2017-01-01

Deep brain stimulation is an effective way to treat movement disorders, and a powerful research tool for exploring brain functions. This report proposes a “curved lead pathway” method for lead implantation, such that a single lead can reach in sequence to any two intracranial targets. A new type of stereotaxic system for implanting a curved lead to the brain of human/primates was designed, the auxiliary device needed for this method to be used in rat/mouse was fabricated and verified in rat, and the Excel algorithm used for automatically calculating the necessary parameters was implemented. This “curved lead pathway” method of lead implantation may complement the current method, make lead implantation for multiple targets more convenient, and expand the experimental techniques of brain function research.

Novel roles of complement in renal diseases and their therapeutic consequences.

PubMed

Wada, Takehiko; Nangaku, Masaomi

2013-09-01

The complement system functions as a part of the innate immune system. Inappropriate activation of the complement pathways has a deleterious effect on kidneys. Recent advances in complement research have provided new insights into the pathogenesis of glomerular and tubulointerstitial injury associated with complement activation. A new disease entity termed 'C3 glomerulopathy' has recently been proposed and is characterized by isolated C3 deposition in glomeruli without positive staining for immunoglobulins. Genetic and functional studies have demonstrated that several different mutations and disease variants, as well as the generation of autoantibodies, are potentially associated with its pathogenesis. The data from comprehensive analyses suggest that complement dysregulation can also be associated with hemolytic uremic syndrome and more common glomerular diseases, such as IgA nephropathy and diabetic kidney disease. In addition, animal studies utilizing genetically modified mice have begun to elucidate the molecular pathomechanisms associated with the complement system. From a diagnostic point of view, a noninvasive, MRI-based method for detecting C3 has recently been developed to serve as a novel tool for diagnosing complement-mediated kidney diseases. While novel therapeutic tools related to complement regulation are emerging, studies evaluating the precise roles of the complement system in kidney diseases will still be useful for developing new therapeutic approaches.

Elevated Properdin and Enhanced Complement Activation in First-Degree Relatives of South Asian Subjects With Type 2 Diabetes

PubMed Central

Somani, Riyaz; Richardson, Victoria R.; Standeven, Kristina F.; Grant, Peter J.; Carter, Angela M.

2012-01-01

OBJECTIVE Emerging data implicate activation of the complement cascade in the pathogenesis of type 2 diabetes. The objective of the current study was to evaluate the relationships between components of the complement system, metabolic risk factors, and family history of type 2 diabetes in healthy South Asians. RESEARCH DESIGN AND METHODS We recruited 119 healthy, first-degree relatives of South Asian subjects with type 2 diabetes (SARs) and 119 age- and sex-matched, healthy South Asian control subjects (SACs). Fasting blood samples were taken for measurement of complement factors and standard metabolic risk factors. RESULTS SARs were characterized by significantly higher properdin (mean concentration 12.6 [95% CI 12.2–13.1] mg/L vs. SACs 10.1 [9.7–10.5] mg/L, P < 0.0001), factor B (187.4 [180.1–195.0] mg/L vs. SACs 165.0 [158.0–172.2] mg/L, P < 0.0001), and SC5b-9 (92.0 [86.1–98.3] ng/mL vs. SACs 75.3 [71.9–78.9] ng/mL, P < 0.0001) and increased homeostasis model assessment of insulin resistance (2.86 [2.61–3.13] vs. SACs 2.31 [2.05–2.61], P = 0.007). C-reactive protein did not differ between SARs and SACs (P = 0.17). In subgroup analysis of 25 SARs and 25 SACs with normal oral glucose tolerance tests, properdin, factor B, and SC5b-9 remained significantly elevated in SARs. CONCLUSIONS Increased properdin and complement activation are associated with a family history of type 2 diabetes in South Asians independent of insulin resistance, and predate the development of impaired fasting glucose and impaired glucose tolerance. Properdin and SC5b-9 may be novel biomarkers for future risk of type 2 diabetes in this high-risk population and warrant further investigation. PMID:22338105

Nondestructive chemical imaging of wood at the micro-scale: advanced technology to complement macro-scale evaluations

Treesearch

Barbara L. Illman; Julia Sedlmair; Miriam Unger; Carol Hirschmugl

2013-01-01

Chemical images help understanding of wood properties, durability, and cell wall deconstruction for conversion of lignocellulose to biofuels, nanocellulose and other value added chemicals in forest biorefineries. We describe here a new method for nondestructive chemical imaging of wood and wood-based materials at the micro-scale to complement macro-scale methods based...

Simple method to distinguish between primary and secondary C3 deficiencies.

PubMed

Pereira de Carvalho Florido, Marlene; Ferreira de Paula, Patrícia; Isaac, Lourdes

2003-03-01

Due to the increasing numbers of reported clinical cases of complement deficiency in medical centers, clinicians are now more aware of the role of the complement system in the protection against infections caused by microorganisms. Therefore, clinical laboratories are now prepared to perform a number of diagnostic tests of the complement system other than the standard 50% hemolytic component assay. Deficiencies of alternative complement pathway proteins are related to severe and recurrent infections; and the application of easy, reliable, and low-cost methods for their detection and distinction are always welcome, notably in developing countries. When activation of the alternative complement pathway is evaluated in hemolytic agarose plates, some but not all human sera cross-react to form a late linear lysis. Since the formation of this linear lysis is dependent on C3 and factor B, it is possible to use late linear lysis to routinely screen for the presence of deficiencies of alternative human complement pathway proteins such as factor B. Furthermore, since linear lysis is observed between normal human serum and primary C3-deficient serum but not between normal human serum and secondary C3-deficient serum caused by the lack of factor H or factor I, this assay may also be used to discriminate between primary and secondary C3 deficiencies.

Complement inhibition in pre-clinical models of periodontitis and prospects for clinical application.

PubMed

Hajishengallis, George; Hajishengallis, Evlambia; Kajikawa, Tetsuhiro; Wang, Baomei; Yancopoulou, Despina; Ricklin, Daniel; Lambris, John D

2016-06-01

Periodontitis is a dysbiotic inflammatory disease leading to the destruction of the tooth-supporting tissues. Current therapies are not always effective and this prevalent oral disease continues to be a significant health and economic burden. Early clinical studies have associated periodontitis with elevated complement activity. Consistently, subsequent genetic and pharmacological studies in rodents have implicated the central complement component C3 and downstream signaling pathways in periodontal host-microbe interactions that promote dysbiosis and inflammatory bone loss. This review discusses these mechanistic advances and moreover focuses on the compstatin family of C3 inhibitors as a novel approach to treat periodontitis. In this regard, local application of the current lead analog Cp40 was recently shown to block both inducible and naturally occurring periodontitis in non-human primates. These promising results from non-human primate studies and the parallel development of Cp40 for clinical use highlight the feasibility for developing an adjunctive, C3-targeted therapy for human periodontitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Applications of stable isotope analysis in the trophic ecology studies of cephalopods].

PubMed

Li, Yun-Kai; Gong, Yi; Chen, Xin-Jun

2014-05-01

Cephalopods play an important role in marine food webs, however, knowledge about their complex life history, especially their feeding ecology, remains limited. With the rapidly increasing use of stable isotope analysis (SIA) in ecology, it becomes a powerful tool and complement of traditional methods for investigating the trophic ecology and migration patterns of invertebrates. Here, after summarizing the current methods for trophic ecology investigation of cephalopods, applications of SIA in studying the trophic ecology of cephalopods were reviewed, including the key issues such as standardization of available tissues for SIA analyzing, diet shift and migration patterns of cephalopods, with the aim of advancing its application in the biology of cephalopods in the future.

[Music therapy as a part of complex healing].

PubMed

Sliwka, Agnieszka; Jarosz, Anna; Nowobilski, Roman

2006-10-01

Music therapy is a method which takes the adventage of therapeutic influence of musie on psychological and somatic sphere of the human body. Its therapeutic properties are more and more used. Current scientific research have proved its modifying influence on vegetative, circulatory, respiratory and endocrine systems. Works devoted to the effects of musie on the patients' psychological sphere have also confirmed that it reduces psychopathologic symptoms (anxiety and depression), improves self-rating, influences quality and disorders of sleep, reduces pain, improves moral immunity and patients' openness, readiness, co-operation in treatment process. Music therapy is treated as a method which complements conventional treatment and makes up part of an integral whole together with physiotherapy, kinesitherapy and recuperation.

Complement-Mediated Enhancement of Monocyte Adhesion to Endothelial Cells by HLA Antibodies, and Blockade by a Specific Inhibitor of the Classical Complement Cascade, TNT003

PubMed Central

Valenzuela, Nicole M.; Thomas, Kimberly A.; Mulder, Arend; Parry, Graham C.; Panicker, Sandip; Reed, Elaine F.

2017-01-01

Background Antibody-mediated rejection (AMR) of most solid organs is characterized by evidence of complement activation and/or intragraft macrophages (C4d + and CD68+ biopsies). We previously demonstrated that crosslinking of HLA I by antibodies triggered endothelial activation and monocyte adhesion. We hypothesized that activation of the classical complement pathway at the endothelial cell surface by HLA antibodies would enhance monocyte adhesion through soluble split product generation, in parallel with direct endothelial activation downstream of HLA signaling. Methods Primary human aortic endothelial cells (HAEC) were stimulated with HLA class I antibodies in the presence of intact human serum complement. C3a and C5a generation, endothelial P-selectin expression, and adhesion of human primary and immortalized monocytes (Mono Mac 6) were measured. Alternatively, HAEC or monocytes were directly stimulated with purified C3a or C5a. Classical complement activation was inhibited by pretreatment of complement with an anti-C1s antibody (TNT003). Results Treatment of HAEC with HLA antibody and human complement increased the formation of C3a and C5a. Monocyte recruitment by human HLA antibodies was enhanced in the presence of intact human serum complement or purified C3a or C5a. Specific inhibition of the classical complement pathway using TNT003 or C1q-depleted serum significantly reduced adhesion of monocytes in the presence of human complement. Conclusions Despite persistent endothelial viability in the presence of HLA antibodies and complement, upstream complement anaphylatoxin production exacerbates endothelial exocytosis and leukocyte recruitment. Upstream inhibition of classical complement may be therapeutic to dampen mononuclear cell recruitment and endothelial activation characteristic of microvascular inflammation during AMR. PMID:28640789

Relations between mental verb and false belief understanding in Cantonese-speaking children.

PubMed

Cheung, Him; Chen, Hsuan-Chih; Yeung, William

2009-10-01

Previous research has shown that linguistic forms that codify mental contents bear a specific relation with children's false belief understanding. These forms include mental verbs and their following complements, yet the two have not been considered separately. The current study examined the roles of mental verb semantics and the complement syntax in children's false belief understanding. Independent tasks were used to measure verb meaning, complements, and false belief understanding such that the verbs in question were present only in the verb meaning test, and no linguistic devices biased toward false belief were used in the false belief test. We focused on (a) some mental verbs that obligatorily affirm or negate what follows and (b) sentential complements, the content of which is to be evaluated against the mind of another person, not reality. Results showed that only (a) predicted false belief understanding in a group of Cantonese-speaking 4-year-olds, controlling for nonverbal intelligence and general language ability. In particular, children's understanding of the strong nonfactive semantics of the Cantonese verbs /ji5-wai4/ ("falsely think") predicted false belief understanding most strongly. The current findings suggest that false belief understanding is specifically related to the comprehension of mental verbs that entail false thought in their semantics.

High effective inverse dynamics modelling for dual-arm robot

NASA Astrophysics Data System (ADS)

Shen, Haoyu; Liu, Yanli; Wu, Hongtao

2018-05-01

To deal with the problem of inverse dynamics modelling for dual arm robot, a recursive inverse dynamics modelling method based on decoupled natural orthogonal complement is presented. In this model, the concepts and methods of Decoupled Natural Orthogonal Complement matrices are used to eliminate the constraint forces in the Newton-Euler kinematic equations, and the screws is used to express the kinematic and dynamics variables. On this basis, the paper has developed a special simulation program with symbol software of Mathematica and conducted a simulation research on the a dual-arm robot. Simulation results show that the proposed method based on decoupled natural orthogonal complement can save an enormous amount of CPU time that was spent in computing compared with the recursive Newton-Euler kinematic equations and the results is correct and reasonable, which can verify the reliability and efficiency of the method.

Re-engineering bacteria for ethanol production

DOEpatents

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

A New Method of Random Environmental Walking for Assessing Behavioral Preferences for Different Lighting Applications

PubMed Central

Patching, Geoffrey R.; Rahm, Johan; Jansson, Märit; Johansson, Maria

2017-01-01

Accurate assessment of people’s preferences for different outdoor lighting applications is increasingly considered important in the development of new urban environments. Here a new method of random environmental walking is proposed to complement current methods of assessing urban lighting applications, such as self-report questionnaires. The procedure involves participants repeatedly walking between different lighting applications by random selection of a lighting application and preferred choice or by random selection of a lighting application alone. In this manner, participants are exposed to all lighting applications of interest more than once and participants’ preferences for the different lighting applications are reflected in the number of times they walk to each lighting application. On the basis of an initial simulation study, to explore the feasibility of this approach, a comprehensive field test was undertaken. The field test included random environmental walking and collection of participants’ subjective ratings of perceived pleasantness (PP), perceived quality, perceived strength, and perceived flicker of four lighting applications. The results indicate that random environmental walking can reveal participants’ preferences for different lighting applications that, in the present study, conformed to participants’ ratings of PP and perceived quality of the lighting applications. As a complement to subjectively stated environmental preferences, random environmental walking has the potential to expose behavioral preferences for different lighting applications. PMID:28337163

Innovating Training through Immersive Environments: Generation Y, Exploratory Learning, and Serious Games

NASA Technical Reports Server (NTRS)

Gendron, Gerald

2012-01-01

Over the next decade, those entering Service and Joint Staff positions within the military will come from a different generation than the current leadership. They will come from Generation Y and have differing preferences for learning. Immersive learning environments like serious games and virtual world initiatives can complement traditional training methods to provide a better overall training program for staffs. Generation Y members desire learning methods which are relevant and interactive, regardless of whether they are delivered over the internet or in person. This paper focuses on a project undertaken to assess alternative training methods to teach special operations staffs. It provides a summary of the needs analysis used to consider alternatives and to better posture the Department of Defense for future training development.

Annual banned-substance review: analytical approaches in human sports drug testing.

PubMed

Thevis, Mario; Kuuranne, Tiia; Geyer, Hans; Schänzer, Wilhelm

2010-04-01

The annual update of the list of prohibited substances and doping methods as issued by the World Anti-Doping Agency (WADA) allows the implementation of most recent considerations of performance manipulation and emerging therapeutics into human sports doping control programmes. The annual banned-substance review for human doping controls critically summarizes recent innovations in analytical approaches that support the efforts of convicting cheating athletes by improved or newly established methods that focus on known as well as newly outlawed substances and doping methods. In the current review, literature published between October 2008 and September 2009 reporting on new and/or enhanced procedures and techniques for doping analysis, as well as aspects relevant to the doping control arena, was considered to complement the 2009 annual banned-substance review.

Assessment of exposure to the Penicillium glabrum complex in cork industry using complementing methods.

PubMed

Viegas, Carla; Sabino, Raquel; Botelho, Daniel; dos Santos, Mateus; Gomes, Anita Quintal

2015-09-01

Cork oak is the second most dominant forest species in Portugal and makes this country the world leader in cork export. Occupational exposure to Chrysonilia sitophila and the Penicillium glabrum complex in cork industry is common, and the latter fungus is associated with suberosis. However, as conventional methods seem to underestimate its presence in occupational environments, the aim of our study was to see whether information obtained by polymerase chain reaction (PCR), a molecular-based method, can complement conventional findings and give a better insight into occupational exposure of cork industry workers. We assessed fungal contamination with the P. glabrum complex in three cork manufacturing plants in the outskirts of Lisbon using both conventional and molecular methods. Conventional culturing failed to detect the fungus at six sampling sites in which PCR did detect it. This confirms our assumption that the use of complementing methods can provide information for a more accurate assessment of occupational exposure to the P. glabrum complex in cork industry.

Complement-fixing properties of antinuclear antibodies distinguish drug-induced lupus from systemic lupus erythematosus.

PubMed

Rubin, R L; Teodorescu, M; Beutner, E H; Plunkett, R W

2004-01-01

The immunofluorescence antinuclear antibody (ANA) test has been widely used to monitor autoimmune disease, but its value for diagnostic purposes is compromised by low specificity and high prevalence in disease-free individuals. The capacity of autoantibodies to fix serum complement proteins when bound to antigen is an important effector function because this property is associated with acute and chronic inflammatory processes. The current study evaluates the complement-fixing properties of antinuclear antibodies (CANA) in three well-defined and clinically-related patient groups: systemic lupus erythematosus (SLE), drug-induced lupus (DIL) and drug-induced autoimmunity (DIA). Of 20 patients diagnosed with SLE, 90% displayed complement-fixing ANA while this feature was present in only two of 18 patients with DIL and no patients with DIA without associated disease even though the mean ANA titres were similar among these patient groups. CANA was significantly correlated with anti-Sm activity. Because SLE but not DIL or DIA can be a life-threatening disease associated with complement consumption in vivo, these results demonstrate that measurement of CANA is a diagnostically useful tool and may have immunopathologic implications.

Prediction of inflammatory responses induced by biomaterials in contact with human blood using protein fingerprint from plasma.

PubMed

Engberg, Anna E; Nilsson, Per H; Huang, Shan; Fromell, Karin; Hamad, Osama A; Mollnes, Tom Eirik; Rosengren-Holmberg, Jenny P; Sandholm, Kerstin; Teramura, Yuji; Nicholls, Ian A; Nilsson, Bo; Ekdahl, Kristina N

2015-01-01

Inappropriate complement activation is often responsible for incompatibility reactions that occur when biomaterials are used. Complement activation is therefore a criterion included in legislation regarding biomaterials testing. However, no consensus is yet available regarding appropriate complement-activation-related test parameters. We examined protein adsorption in plasma and complement activation/cytokine release in whole blood incubated with well-characterized polymers. Strong correlations were found between the ratio of C4 to its inhibitor C4BP and generation of 10 (mainly pro-inflammatory) cytokines, including IL-17, IFN-γ, and IL-6. The levels of complement activation products correlated weakly (C3a) or not at all (C5a, sC5b-9), confirming their poor predictive values. We have demonstrated a direct correlation between downstream biological effects and the proteins initially adhering to an artificial surface after contact with blood. Consequently, we propose the C4/C4BP ratio as a robust, predictor of biocompatibility with superior specificity and sensitivity over the current gold standard. Copyright © 2014 Elsevier Ltd. All rights reserved.

Monitoring tooth profile faults in epicyclic gearboxes using synchronously averaged motor currents: Mathematical modeling and experimental validation

NASA Astrophysics Data System (ADS)

Ottewill, J. R.; Ruszczyk, A.; Broda, D.

2017-02-01

Time-varying transmission paths and inaccessibility can increase the difficulty in both acquiring and processing vibration signals for the purpose of monitoring epicyclic gearboxes. Recent work has shown that the synchronous signal averaging approach may be applied to measured motor currents in order to diagnose tooth faults in parallel shaft gearboxes. In this paper we further develop the approach, so that it may also be applied to monitor tooth faults in epicyclic gearboxes. A low-degree-of-freedom model of an epicyclic gearbox which incorporates the possibility of simulating tooth faults, as well as any subsequent tooth contact loss due to these faults, is introduced. By combining this model with a simple space-phasor model of an induction motor it is possible to show that, in theory, tooth faults in epicyclic gearboxes may be identified from motor currents. Applying the synchronous averaging approach to experimentally recorded motor currents and angular displacements recorded from a shaft mounted encoder, validate this finding. Comparison between experiments and theory highlight the influence of operating conditions, backlash and shaft couplings on the transient response excited in the currents by the tooth fault. The results obtained suggest that the method may be a viable alternative or complement to more traditional methods for monitoring gearboxes. However, general observations also indicate that further investigations into the sensitivity and robustness of the method would be beneficial.

Predicting Essential Genes and Proteins Based on Machine Learning and Network Topological Features: A Comprehensive Review

PubMed Central

Zhang, Xue; Acencio, Marcio Luis; Lemke, Ney

2016-01-01

Essential proteins/genes are indispensable to the survival or reproduction of an organism, and the deletion of such essential proteins will result in lethality or infertility. The identification of essential genes is very important not only for understanding the minimal requirements for survival of an organism, but also for finding human disease genes and new drug targets. Experimental methods for identifying essential genes are costly, time-consuming, and laborious. With the accumulation of sequenced genomes data and high-throughput experimental data, many computational methods for identifying essential proteins are proposed, which are useful complements to experimental methods. In this review, we show the state-of-the-art methods for identifying essential genes and proteins based on machine learning and network topological features, point out the progress and limitations of current methods, and discuss the challenges and directions for further research. PMID:27014079

Lipidomics from an analytical perspective.

PubMed

Sandra, Koen; Sandra, Pat

2013-10-01

The global non-targeted analysis of various biomolecules in a variety of sample sources gained momentum in recent years. Defined as the study of the full lipid complement of cells, tissues and organisms, lipidomics is currently evolving out of the shadow of the more established omics sciences including genomics, transcriptomics, proteomics and metabolomics. In analogy to the latter, lipidomics has the potential to impact on biomarker discovery, drug discovery/development and system knowledge, amongst others. The tools developed by lipid researchers in the past, complemented with the enormous advancements made in recent years in mass spectrometry and chromatography, and the implementation of sophisticated (bio)-informatics tools form the basis of current lipidomics technologies. Copyright © 2013 Elsevier Ltd. All rights reserved.

C1q-targeted inhibition of the classical complement pathway prevents injury in a novel mouse model of acute motor axonal neuropathy.

PubMed

McGonigal, Rhona; Cunningham, Madeleine E; Yao, Denggao; Barrie, Jennifer A; Sankaranarayanan, Sethu; Fewou, Simon N; Furukawa, Koichi; Yednock, Ted A; Willison, Hugh J

2016-03-02

Guillain-Barré syndrome (GBS) is an autoimmune disease that results in acute paralysis through inflammatory attack on peripheral nerves, and currently has limited, non-specific treatment options. The pathogenesis of the acute motor axonal neuropathy (AMAN) variant is mediated by complement-fixing anti-ganglioside antibodies that directly bind and injure the axon at sites of vulnerability such as nodes of Ranvier and nerve terminals. Consequently, the complement cascade is an attractive target to reduce disease severity. Recently, C5 complement component inhibitors that block the formation of the membrane attack complex and subsequent downstream injury have been shown to be efficacious in an in vivo anti-GQ1b antibody-mediated mouse model of the GBS variant Miller Fisher syndrome (MFS). However, since gangliosides are widely expressed in neurons and glial cells, injury in this model was not targeted exclusively to the axon and there are currently no pure mouse models for AMAN. Additionally, C5 inhibition does not prevent the production of early complement fragments such as C3a and C3b that can be deleterious via their known role in immune cell and macrophage recruitment to sites of neuronal damage. In this study, we first developed a new in vivo transgenic mouse model of AMAN using mice that express complex gangliosides exclusively in neurons, thereby enabling specific targeting of axons with anti-ganglioside antibodies. Secondly, we have evaluated the efficacy of a novel anti-C1q antibody (M1) that blocks initiation of the classical complement cascade, in both the newly developed anti-GM1 antibody-mediated AMAN model and our established MFS model in vivo. Anti-C1q monoclonal antibody treatment attenuated complement cascade activation and deposition, reduced immune cell recruitment and axonal injury, in both mouse models of GBS, along with improvement in respiratory function. These results demonstrate that neutralising C1q function attenuates injury with a consequent neuroprotective effect in acute GBS models and promises to be a useful new target for human therapy.

Sublytic complement protects prostate cancer cells from tumour necrosis factor-α-induced cell death.

PubMed

Liu, L; Li, W; Li, Z; Kirschfink, M

2012-08-01

Inflammation is a critical component of tumour progression. Although complement and tumour necrosis factor (TNF)-α potentially exert significant anti-tumour effects, both mediators may also promote tumour progression. It has been demonstrated that sublytic complement confers resistance on tumour cells not only against lytic complement, but also other danger molecules such as perforin. In low concentrations, TNF promotes survival of malignant cells rather than exerting cytotoxic activity. In this study, we tested if sublytic complement is able to interfere with TNF-mediated tumour cell killing. Our results demonstrate that either subcytotoxic concentrations of TNF or sublytic complement rescue prostate carcinoma cells (DU145) from TNF-α-mediated cell death. Upon pretreatment with low-dose TNF-α, but not upon pre-exposure to sublytic complement, TNF resistance was associated with the down-regulation of TNF receptor 1 (TNF-R1) expression. Complement-induced protection against TNF-mediated apoptosis accompanied the induction of anti-apoptotic proteins [B cell leukaemia/lymphoma (Bcl)-2 and Bcl-xL] at an early stage followed by inhibition of the TNF-induced decrease in the amount of Bcl-2 and Bcl-xL. Cell protection also accompanied the inhibition of caspase-8 activation, poly (ADP-ribose) polymerase (PARP)-1 cleavage and the activation of nuclear factor (NF)-κB. Our data extend our current view on the induction of tumour cell resistance against cytotoxic mediators supporting the role of the tumour microenvironment in mediating protection against the anti-cancer immune response. © 2012 The Authors. Clinical and Experimental Immunology © 2012 British Society for Immunology.

Molecular characterization of the rhesus rhadinovirus (RRV) ORF4 gene and the RRV complement control protein it encodes.

PubMed

Mark, Linda; Spiller, O Brad; Okroj, Marcin; Chanas, Simon; Aitken, Jim A; Wong, Scott W; Damania, Blossom; Blom, Anna M; Blackbourn, David J

2007-04-01

The diversity of viral strategies to modulate complement activation indicates that this component of the immune system has significant antiviral potential. One example is the Kaposi's sarcoma-associated herpesvirus (KSHV) complement control protein (KCP), which inhibits progression of the complement cascade. Rhesus rhadinovirus (RRV), like KSHV, is a member of the subfamily Gammaherpesvirinae and currently provides the only in vivo model of KSHV pathobiology in primates. In the present study, we characterized the KCP homologue encoded by RRV, RRV complement control protein (RCP). Two strains of RRV have been sequenced to date (H26-95 and 17577), and the RCPs they encode differ substantially in structure: RCP from strain H26-95 has four complement control protein (CCP) domains, whereas RCP from strain 17577 has eight CCP domains. Transcriptional analyses of the RCP gene (ORF4, referred to herein as RCP) in infected rhesus macaque fibroblasts mapped the ends of the transcripts of both strains. They revealed that H26-95 encodes a full-length, unspliced RCP transcript, while 17577 RCP generates a full-length unspliced mRNA and two alternatively spliced transcripts. Western blotting confirmed that infected cells express RCP, and immune electron microscopy disclosed this protein on the surface of RRV virions. Functional studies of RCP encoded by both RRV strains revealed their ability to suppress complement activation by the classical (antibody-mediated) pathway. These data provide the foundation for studies into the biological significance of gammaherpesvirus complement regulatory proteins in a tractable, non-human primate model.

Molecular Characterization of the Rhesus Rhadinovirus (RRV) ORF4 Gene and the RRV Complement Control Protein It Encodes▿

PubMed Central

Mark, Linda; Spiller, O. Brad; Okroj, Marcin; Chanas, Simon; Aitken, Jim A.; Wong, Scott W.; Damania, Blossom; Blom, Anna M.; Blackbourn, David J.

2007-01-01

The diversity of viral strategies to modulate complement activation indicates that this component of the immune system has significant antiviral potential. One example is the Kaposi's sarcoma-associated herpesvirus (KSHV) complement control protein (KCP), which inhibits progression of the complement cascade. Rhesus rhadinovirus (RRV), like KSHV, is a member of the subfamily Gammaherpesvirinae and currently provides the only in vivo model of KSHV pathobiology in primates. In the present study, we characterized the KCP homologue encoded by RRV, RRV complement control protein (RCP). Two strains of RRV have been sequenced to date (H26-95 and 17577), and the RCPs they encode differ substantially in structure: RCP from strain H26-95 has four complement control protein (CCP) domains, whereas RCP from strain 17577 has eight CCP domains. Transcriptional analyses of the RCP gene (ORF4, referred to herein as RCP) in infected rhesus macaque fibroblasts mapped the ends of the transcripts of both strains. They revealed that H26-95 encodes a full-length, unspliced RCP transcript, while 17577 RCP generates a full-length unspliced mRNA and two alternatively spliced transcripts. Western blotting confirmed that infected cells express RCP, and immune electron microscopy disclosed this protein on the surface of RRV virions. Functional studies of RCP encoded by both RRV strains revealed their ability to suppress complement activation by the classical (antibody-mediated) pathway. These data provide the foundation for studies into the biological significance of gammaherpesvirus complement regulatory proteins in a tractable, non-human primate model. PMID:17287274

Modification of the Microtiter Reading Mirror for Use in the Standardized Micro Complement Fixation Test

PubMed Central

Hui, Gabriel W. K.

1971-01-01

Modification of the Microtiter reading mirror used in the standardized diagnostic complement fixation method permits convenient estimation of the results in per cent hemolysis by direct visual comparison with the hemolytic standards. Images PMID:5564678

Language and False-Belief Task Performance in Children With Autism Spectrum Disorder.

PubMed

Jeffrey Farrar, M; Seung, Hye Kyeung; Lee, Hyeonjin

2017-07-12

Language is related to false-belief (FB) understanding in both typically developing children and children with autism spectrum disorder (ASD). The current study examined the role of complementation and general language in FB understanding. Of interest was whether language plays similar or different roles in the groups' FB performance. Participants were 16 typically developing children (mean age = 5.0 years; mental age = 6.7) and 18 with ASD (mean age = 7.3 years; mental age = 8.3). Children were administered FB and language tasks (say- and think-complements), receptive and expressive vocabulary tests, and relative clauses. When mental age and receptive and expressive vocabulary were used as separate covariates, the typical control group outperformed the children with ASD in FB task performance. Chi-square analyses indicated that passing both complementation tasks was linked to the FB understanding of children with ASD. Children with ASD who passed FB tasks all passed say- and think-complement tasks. However, some children in the control group were able to pass the FB tasks, even if they failed the say- and think-complement tasks. The results indicate that children with ASD relied more on complement understanding to pass FB than typically developing children. Results are discussed regarding the developmental pathways for FB understanding.

Field-aligned electric currents and their measurement by the incoherent backscatter technique

NASA Technical Reports Server (NTRS)

Bauer, P.; Cole, K. D.; Lejeume, G.

1975-01-01

Field aligned electric currents flow in the magnetosphere in many situations of fundamental geophysical interest. It is shown here that the incoherent backscatter technique can be used to measure these currents when the plasma line can be observed. The technique provides a ground based means of measuring these currents which complements the rocket and satellite ones.

Artificial Intelligence in Autonomous Telescopes

NASA Astrophysics Data System (ADS)

Mahoney, William; Thanjavur, Karun

2011-03-01

Artificial Intelligence (AI) is key to the natural evolution of today's automated telescopes to fully autonomous systems. Based on its rapid development over the past five decades, AI offers numerous, well-tested techniques for knowledge based decision making essential for real-time telescope monitoring and control, with minimal - and eventually no - human intervention. We present three applications of AI developed at CFHT for monitoring instantaneous sky conditions, assessing quality of imaging data, and a prototype for scheduling observations in real-time. Closely complementing the current remote operations at CFHT, we foresee further development of these methods and full integration in the near future.

Kupffer cell complement receptor clearance function and host defense.

PubMed

Loegering, D J

1986-01-01

Kupffer cells are well known to be important for normal host defense function. The development of methods to evaluate the in vivo function of specific receptors on Kupffer cells has made it possible to assess the role of these receptors in host defense. The rationale for studying complement receptors is based on the proposed important role of these receptors in host defense and on the observation that the hereditary deficiency of a complement receptor is associated with recurrent severe bacterial infections. The studies reviewed here demonstrate that forms of injury that are associated with depressed host defense including thermal injury, hemorrhagic shock, trauma, and surgery also cause a decrease in complement receptor clearance function. This decrease in Kupffer cell receptor clearance function was shown not to be the result of depressed hepatic blood flow or depletion of complement components. Complement receptor function was also depressed following the phagocytosis of particulates that are known to depress Kupffer cell host defense function. Endotoxemia and bacteremia also were associated with a depression of complement receptor function. Complement receptor function was experimentally depressed in uninjured animals by the phagocytosis of IgG-coated erythrocytes. There was a close association between the depression of complement receptor clearance function and increased susceptibility to the lethal effects of endotoxin and bacterial infection. These studies support the hypotheses that complement receptors on Kupffer cells are important for normal host defense and that depression of the function of these receptors impairs host defense.

Factor H: A Complement Regulator in Health and Disease, and a Mediator of Cellular Interactions

PubMed Central

Kopp, Anne; Hebecker, Mario; Svobodová, Eliška; Józsi, Mihály

2012-01-01

Complement is an essential part of innate immunity as it participates in host defense against infections, disposal of cellular debris and apoptotic cells, inflammatory processes and modulation of adaptive immune responses. Several soluble and membrane-bound regulators protect the host from the potentially deleterious effects of uncontrolled and misdirected complement activation. Factor H is a major soluble regulator of the alternative complement pathway, but it can also bind to host cells and tissues, protecting them from complement attack. Interactions of factor H with various endogenous ligands, such as pentraxins, extracellular matrix proteins and DNA are important in limiting local complement-mediated inflammation. Impaired regulatory as well as ligand and cell recognition functions of factor H, caused by mutations or autoantibodies, are associated with the kidney diseases: atypical hemolytic uremic syndrome and dense deposit disease and the eye disorder: age-related macular degeneration. In addition, factor H binds to receptors on host cells and is involved in adhesion, phagocytosis and modulation of cell activation. In this review we discuss current concepts on the physiological and pathophysiological roles of factor H in light of new data and recent developments in our understanding of the versatile roles of factor H as an inhibitor of complement activation and inflammation, as well as a mediator of cellular interactions. A detailed knowledge of the functions of factor H in health and disease is expected to unravel novel therapeutic intervention possibilities and to facilitate the development or improvement of therapies. PMID:24970127

An extended set of yeast-based functional assays accurately identifies human disease mutations

PubMed Central

Sun, Song; Yang, Fan; Tan, Guihong; Costanzo, Michael; Oughtred, Rose; Hirschman, Jodi; Theesfeld, Chandra L.; Bansal, Pritpal; Sahni, Nidhi; Yi, Song; Yu, Analyn; Tyagi, Tanya; Tie, Cathy; Hill, David E.; Vidal, Marc; Andrews, Brenda J.; Boone, Charles; Dolinski, Kara; Roth, Frederick P.

2016-01-01

We can now routinely identify coding variants within individual human genomes. A pressing challenge is to determine which variants disrupt the function of disease-associated genes. Both experimental and computational methods exist to predict pathogenicity of human genetic variation. However, a systematic performance comparison between them has been lacking. Therefore, we developed and exploited a panel of 26 yeast-based functional complementation assays to measure the impact of 179 variants (101 disease- and 78 non-disease-associated variants) from 22 human disease genes. Using the resulting reference standard, we show that experimental functional assays in a 1-billion-year diverged model organism can identify pathogenic alleles with significantly higher precision and specificity than current computational methods. PMID:26975778

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

Studies of ionic current rectification using polyethyleneimines coated glass nanopipettes.

PubMed

Liu, Shujuan; Dong, Yitong; Zhao, Wenbo; Xie, Xiang; Ji, Tianrong; Yin, Xiaohong; Liu, Yun; Liang, Zhongwei; Momotenko, Dmitry; Liang, Dehai; Girault, Hubert H; Shao, Yuanhua

2012-07-03

The modification of glass nanopipettes with polyethyleneimines (PEIs) has been successfully achieved by a relatively simple method, and the smallest tip opening is around 3 nm. Thus, in a much wider range of glass pipettes with radii from several nanometers to a few micrometers, the ion current rectification (ICR) phenomenon has been observed. The influences of different KCl concentrations, pH values, and tip radii on the ICR are investigated in detail. The sizes of PEIs have been determined by dynamic light scattering, and the effect of the sizes of PEIs for the modification, especially for a few nanometer-pipettes in radii, is also discussed. These findings systemically confirm and complement the theoretical model and provide a platform for possible selectively molecular detection and mimic biological ion channels.

The role of simulation in neurosurgery.

PubMed

Rehder, Roberta; Abd-El-Barr, Muhammad; Hooten, Kristopher; Weinstock, Peter; Madsen, Joseph R; Cohen, Alan R

2016-01-01

In an era of residency duty-hour restrictions, there has been a recent effort to implement simulation-based training methods in neurosurgery teaching institutions. Several surgical simulators have been developed, ranging from physical models to sophisticated virtual reality systems. To date, there is a paucity of information describing the clinical benefits of existing simulators and the assessment strategies to help implement them into neurosurgical curricula. Here, we present a systematic review of the current models of simulation and discuss the state-of-the-art and future directions for simulation in neurosurgery. Retrospective literature review. Multiple simulators have been developed for neurosurgical training, including those for minimally invasive procedures, vascular, skull base, pediatric, tumor resection, functional neurosurgery, and spine surgery. The pros and cons of existing systems are reviewed. Advances in imaging and computer technology have led to the development of different simulation models to complement traditional surgical training. Sophisticated virtual reality (VR) simulators with haptic feedback and impressive imaging technology have provided novel options for training in neurosurgery. Breakthrough training simulation using 3D printing technology holds promise for future simulation practice, proving high-fidelity patient-specific models to complement residency surgical learning.

A Normalization-Free and Nonparametric Method Sharpens Large-Scale Transcriptome Analysis and Reveals Common Gene Alteration Patterns in Cancers.

PubMed

Li, Qi-Gang; He, Yong-Han; Wu, Huan; Yang, Cui-Ping; Pu, Shao-Yan; Fan, Song-Qing; Jiang, Li-Ping; Shen, Qiu-Shuo; Wang, Xiao-Xiong; Chen, Xiao-Qiong; Yu, Qin; Li, Ying; Sun, Chang; Wang, Xiangting; Zhou, Jumin; Li, Hai-Peng; Chen, Yong-Bin; Kong, Qing-Peng

2017-01-01

Heterogeneity in transcriptional data hampers the identification of differentially expressed genes (DEGs) and understanding of cancer, essentially because current methods rely on cross-sample normalization and/or distribution assumption-both sensitive to heterogeneous values. Here, we developed a new method, Cross-Value Association Analysis (CVAA), which overcomes the limitation and is more robust to heterogeneous data than the other methods. Applying CVAA to a more complex pan-cancer dataset containing 5,540 transcriptomes discovered numerous new DEGs and many previously rarely explored pathways/processes; some of them were validated, both in vitro and in vivo , to be crucial in tumorigenesis, e.g., alcohol metabolism ( ADH1B ), chromosome remodeling ( NCAPH ) and complement system ( Adipsin ). Together, we present a sharper tool to navigate large-scale expression data and gain new mechanistic insights into tumorigenesis.

Microinjection of cytoplasm as a test of complementation in Paramecium

PubMed Central

1982-01-01

Mutants in Paramecium tetraurelia, unable to generate action potentials, have been isolated as cells which show no backward swimming in response to ionic stimulation. These "pawn" mutants belong to at least three complementation groups designated pwA, pwB, and pwC. We have found that microinjection of cytoplasm from a wild-type donor into a pawn recipient of any of the three complementation groups restores the ability of the pawn to generate action potentials and hence swim backward. In addition, the cytoplasm from a pawn cannot restore a recipient of the same complementation group, but that from a pawn of a different group can. Electrophysiological analysis had demonstrated that the restoration of backward swimming is not due to a simple addition of ions but represents a profound change in the excitable membrane of the recipient pawn cells. Using known pawn mutants and those which had previously been unclassified, we have been able to establish a perfect concordance of genetic complementation and complementation by cytoplasmic transfer through microinjection. This method has been used to classify pawn mutants that are sterile or hard- to-mate and to examine the ability of cytoplasms from different species of ciliated protozoa to restore the ability to swim backward in the pawn mutants of P. tetraurelia. A cell homogenate has also been fractionated by centrifugation to further purify the active components. These results demonstrate that transfer of cytoplasm between cells by microinjection can be a valid and systematic method to classify mutants. This test is simpler to perform than the genetic complementation test and can be used under favorable conditions in mutants that are sterile and in cells of different species. PMID:7061597

Single nucleotide variations: Biological impact and theoretical interpretation

PubMed Central

Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

2014-01-01

Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

Improved Battery State Estimation Using Novel Sensing Techniques

NASA Astrophysics Data System (ADS)

Abdul Samad, Nassim

Lithium-ion batteries have been considered a great complement or substitute for gasoline engines due to their high energy and power density capabilities among other advantages. However, these types of energy storage devices are still yet not widespread, mainly because of their relatively high cost and safety issues, especially at elevated temperatures. This thesis extends existing methods of estimating critical battery states using model-based techniques augmented by real-time measurements from novel temperature and force sensors. Typically, temperature sensors are located near the edge of the battery, and away from the hottest core cell regions, which leads to slower response times and increased errors in the prediction of core temperatures. New sensor technology allows for flexible sensor placement at the cell surface between cells in a pack. This raises questions about the optimal locations of these sensors for best observability and temperature estimation. Using a validated model, which is developed and verified using experiments in laboratory fixtures that replicate vehicle pack conditions, it is shown that optimal sensor placement can lead to better and faster temperature estimation. Another equally important state is the state of health or the capacity fading of the cell. This thesis introduces a novel method of using force measurements for capacity fade estimation. Monitoring capacity is important for defining the range of electric vehicles (EVs) and plug-in hybrid electric vehicles (PHEVs). Current capacity estimation techniques require a full discharge to monitor capacity. The proposed method can complement or replace current methods because it only requires a shallow discharge, which is especially useful in EVs and PHEVs. Using the accurate state estimation accomplished earlier, a method for downsizing a battery pack is shown to effectively reduce the number of cells in a pack without compromising safety. The influence on the battery performance (e.g. temperature, utilization, capacity fade, and cost) while downsizing and shifting the nominal operating SOC is demonstrated via simulations. The contributions in this thesis aim to make EVs, HEVs and PHEVs less costly while maintaining safety and reliability as more people are transitioning towards more environmentally friendly means of transportation.

An Overview of Computational Aeroacoustic Modeling at NASA Langley

NASA Technical Reports Server (NTRS)

Lockard, David P.

2001-01-01

The use of computational techniques in the area of acoustics is known as computational aeroacoustics and has shown great promise in recent years. Although an ultimate goal is to use computational simulations as a virtual wind tunnel, the problem is so complex that blind applications of traditional algorithms are typically unable to produce acceptable results. The phenomena of interest are inherently unsteady and cover a wide range of frequencies and amplitudes. Nonetheless, with appropriate simplifications and special care to resolve specific phenomena, currently available methods can be used to solve important acoustic problems. These simulations can be used to complement experiments, and often give much more detailed information than can be obtained in a wind tunnel. The use of acoustic analogy methods to inexpensively determine far-field acoustics from near-field unsteadiness has greatly reduced the computational requirements. A few examples of current applications of computational aeroacoustics at NASA Langley are given. There remains a large class of problems that require more accurate and efficient methods. Research to develop more advanced methods that are able to handle the geometric complexity of realistic problems using block-structured and unstructured grids are highlighted.

Discovery of potential protein biomarkers of lung adenocarcinoma in bronchoalveolar lavage fluid by SWATH MS data-independent acquisition and targeted data extraction.

PubMed

Ortea, I; Rodríguez-Ariza, A; Chicano-Gálvez, E; Arenas Vacas, M S; Jurado Gámez, B

2016-04-14

Lung cancer currently ranks as the neoplasia with the highest global mortality rate. Although some improvements have been introduced in recent years, new advances in diagnosis are required in order to increase survival rates. New mildly invasive endoscopy-based diagnostic techniques include the collection of bronchoalveolar lavage fluid (BALF), which is discarded after using a portion of the fluid for standard pathological procedures. BALF proteomic analysis can contribute to clinical practice with more sensitive biomarkers, and can complement cytohistological studies by aiding in the diagnosis, prognosis, and subtyping of lung cancer, as well as the monitoring of treatment response. The range of quantitative proteomics methodologies used for biomarker discovery is currently being broadened with the introduction of data-independent acquisition (DIA) analysis-related approaches that address the massive quantitation of the components of a proteome. Here we report for the first time a DIA-based quantitative proteomics study using BALF as the source for the discovery of potential lung cancer biomarkers. The results have been encouraging in terms of the number of identified and quantified proteins. A panel of candidate protein biomarkers for adenocarcinoma in BALF is reported; this points to the activation of the complement network as being strongly over-represented and suggests this pathway as a potential target for lung cancer research. In addition, the results reported for haptoglobin, complement C4-A, and glutathione S-transferase pi are consistent with previous studies, which indicates that these proteins deserve further consideration as potential lung cancer biomarkers in BALF. Our study demonstrates that the analysis of BALF proteins by liquid chromatography-tandem mass spectrometry (LC-MS/MS), combining a simple sample pre-treatment and SWATH DIA MS, is a useful method for the discovery of potential lung cancer biomarkers. Bronchoalveolar lavage fluid (BALF) analysis can contribute to clinical practice with more sensitive biomarkers, thus complementing cytohistological studies in order to aid in the diagnosis, prognosis, and subtyping of lung cancer, as well as the monitoring of treatment response. Here we report a panel of candidate protein biomarkers for adenocarcinoma in BALF. Forty-four proteins showed a fold-change higher than 3.75 among adenocarcinoma patients compared with controls. This report is the first DIA-based quantitative proteomics study to use bronchoalveolar lavage fluid (BALF) as a matrix for discovering potential biomarkers. The results are encouraging in terms of the number of identified and quantified proteins, demonstrating that the analysis of BALF proteins by a SWATH approach is a useful method for the discovery of potential biomarkers of pulmonary diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Hybrid switch for resonant power converters

DOEpatents

Lai, Jih-Sheng; Yu, Wensong

2014-09-09

A hybrid switch comprising two semiconductor switches connected in parallel but having different voltage drop characteristics as a function of current facilitates attainment of zero voltage switching and reduces conduction losses to complement reduction of switching losses achieved through zero voltage switching in power converters such as high-current inverters.

The Documentation of Current Affairs in Public Libraries

ERIC Educational Resources Information Center

Smith, Gerry M.

1971-01-01

Current affairs phenomena are inadequately treated by the mass media. Primary materials produced by pressure groups is a valuable complement. Larger public libraries could perform a useful service in making some of the material more widely available. This article explains why and how it should be done. (2 references) (Author/NH)

Targeted journal curation as a method to improve data currency at the Comparative Toxicogenomics Database

PubMed Central

Davis, Allan Peter; Johnson, Robin J.; Lennon-Hopkins, Kelley; Sciaky, Daniela; Rosenstein, Michael C.; Wiegers, Thomas C.; Mattingly, Carolyn J.

2012-01-01

The Comparative Toxicogenomics Database (CTD) is a public resource that promotes understanding about the effects of environmental chemicals on human health. CTD biocurators read the scientific literature and manually curate a triad of chemical–gene, chemical–disease and gene–disease interactions. Typically, articles for CTD are selected using a chemical-centric approach by querying PubMed to retrieve a corpus containing the chemical of interest. Although this technique ensures adequate coverage of knowledge about the chemical (i.e. data completeness), it does not necessarily reflect the most current state of all toxicological research in the community at large (i.e. data currency). Keeping databases current with the most recent scientific results, as well as providing a rich historical background from legacy articles, is a challenging process. To address this issue of data currency, CTD designed and tested a journal-centric approach of curation to complement our chemical-centric method. We first identified priority journals based on defined criteria. Next, over 7 weeks, three biocurators reviewed 2425 articles from three consecutive years (2009–2011) of three targeted journals. From this corpus, 1252 articles contained relevant data for CTD and 52 752 interactions were manually curated. Here, we describe our journal selection process, two methods of document delivery for the biocurators and the analysis of the resulting curation metrics, including data currency, and both intra-journal and inter-journal comparisons of research topics. Based on our results, we expect that curation by select journals can (i) be easily incorporated into the curation pipeline to complement our chemical-centric approach; (ii) build content more evenly for chemicals, genes and diseases in CTD (rather than biasing data by chemicals-of-interest); (iii) reflect developing areas in environmental health and (iv) improve overall data currency for chemicals, genes and diseases. Database URL: http://ctdbase.org/ PMID:23221299

Targeted organ generation using Mixl1-inducible mouse pluripotent stem cells in blastocyst complementation.

PubMed

Kobayashi, Toshihiro; Kato-Itoh, Megumi; Nakauchi, Hiromitsu

2015-01-15

Generation of functional organs from patients' own cells is one of the ultimate goals of regenerative medicine. As a novel approach to creation of organs from pluripotent stem cells (PSCs), we employed blastocyst complementation in organogenesis-disabled animals and successfully generated PSC-derived pancreas and kidneys. Blastocyst complementation, which exploits the capacity of PSCs to participate in forming chimeras, does not, however, exclude contribution of PSCs to the development of tissues-including neural cells or germ cells-other than those specifically targeted by disabling of organogenesis. This fact provokes ethical controversy if human PSCs are to be used. In this study, we demonstrated that forced expression of Mix-like protein 1 (encoded by Mixl1) can be used to guide contribution of mouse embryonic stem cells to endodermal organs after blastocyst injection. We then succeeded in applying this method to generate functional pancreas in pancreatogenesis-disabled Pdx1 knockout mice using a newly developed tetraploid-based organ-complementation method. These findings hold promise for targeted organ generation from patients' own PSCs in livestock animals.

A comparison of machine learning and Bayesian modelling for molecular serotyping.

PubMed

Newton, Richard; Wernisch, Lorenz

2017-08-11

Streptococcus pneumoniae is a human pathogen that is a major cause of infant mortality. Identifying the pneumococcal serotype is an important step in monitoring the impact of vaccines used to protect against disease. Genomic microarrays provide an effective method for molecular serotyping. Previously we developed an empirical Bayesian model for the classification of serotypes from a molecular serotyping array. With only few samples available, a model driven approach was the only option. In the meanwhile, several thousand samples have been made available to us, providing an opportunity to investigate serotype classification by machine learning methods, which could complement the Bayesian model. We compare the performance of the original Bayesian model with two machine learning algorithms: Gradient Boosting Machines and Random Forests. We present our results as an example of a generic strategy whereby a preliminary probabilistic model is complemented or replaced by a machine learning classifier once enough data are available. Despite the availability of thousands of serotyping arrays, a problem encountered when applying machine learning methods is the lack of training data containing mixtures of serotypes; due to the large number of possible combinations. Most of the available training data comprises samples with only a single serotype. To overcome the lack of training data we implemented an iterative analysis, creating artificial training data of serotype mixtures by combining raw data from single serotype arrays. With the enhanced training set the machine learning algorithms out perform the original Bayesian model. However, for serotypes currently lacking sufficient training data the best performing implementation was a combination of the results of the Bayesian Model and the Gradient Boosting Machine. As well as being an effective method for classifying biological data, machine learning can also be used as an efficient method for revealing subtle biological insights, which we illustrate with an example.

Neutrophil extracellular traps can activate alternative complement pathways.

PubMed

Wang, H; Wang, C; Zhao, M-H; Chen, M

2015-09-01

The interaction between neutrophils and activation of alternative complement pathway plays a pivotal role in the pathogenesis of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). ANCAs activate primed neutrophils to release neutrophil extracellular traps (NETs), which have recently gathered increasing attention in the development of AAV. The relationship between NETs and alternative complement pathway has not been elucidated. The current study aimed to investigate the relationship between NETs and alternative complement pathway. Detection of components of alternative complement pathway on NETs in vitro was assessed by immunostain and confocal microscopy. Complement deposition on NETs were detected after incubation with magnesium salt ethyleneglycol tetraacetic acid (Mg-EGTA)-treated human serum. After incubation of serum with supernatants enriched in ANCA-induced NETs, levels of complement components in supernatants were measured by enzyme-linked immunosorbent assay (ELISA). Complement factor B (Bb) and properdin deposited on NETs in vitro. The deposition of C3b and C5b-9 on NETs incubated with heat-inactivated normal human serum (Hi-NHS) or EGTA-treated Hi-NHS (Mg-EGTA-Hi-NHS) were significantly less than that on NETs incubated with NHS or EGTA-treated NHS (Mg-EGTA-NHS). NETs induced by ANCA could activate the alternative complement cascade in the serum. In the presence of EGTA, C3a, C5a and SC5b-9 concentration decreased from 800·42 ± 244·81 ng/ml, 7·68 ± 1·50 ng/ml, 382·15 ± 159·75 ng/ml in the supernatants enriched in ANCA induced NETs to 479·07 ± 156·2 ng/ml, 4·86 ± 1·26 ng/ml, 212·65 ± 44·40 ng/ml in the supernatants of DNase I-degraded NETs (P < 0·001, P = 0·008, P < 0·001, respectively). NETs could activate the alternative complement pathway, and might thus participate in the pathogenesis of AAV. © 2015 British Society for Immunology.

Protection by meningococcal outer membrane protein PorA-specific antibodies and a serogroup B capsular polysaccharide-specific antibody in complement-sufficient and C6-deficient infant rats.

PubMed

Toropainen, Maija; Saarinen, Leena; Vidarsson, Gestur; Käyhty, Helena

2006-05-01

The relative contributions of antibody-induced complement-mediated bacterial lysis and antibody/complement-mediated phagocytosis to host immunity against meningococcal infections are currently unclear. Further, the in vivo effector functions of antibodies may vary depending on their specificity and Fc heavy-chain isotype. In this study, a mouse immunoglobulin G2a (mIgG2a) monoclonal antibody (MN12H2) to meningococcal outer membrane protein PorA (P1.16), its human IgG subclass derivatives (hIgG1 to hIgG4), and an mIgG2a monoclonal antibody (Nmb735) to serogroup B capsular polysaccharide (B-PS) were evaluated for passive protection against meningococcal serogroup B strain 44/76-SL (B:15:P1.7,16) in an infant rat infection model. Complement component C6-deficient (PVG/c-) rats were used to assess the importance of complement-mediated bacterial lysis for protection. The PorA-specific parental mIgG2a and the hIgG1 to hIgG3 derivatives all induced efficient bactericidal activity in vitro in the presence of human or infant rat complement and augmented bacterial clearance in complement-sufficient HsdBrlHan:WIST rats, while the hIgG4 was unable to do so. In C6-deficient PVG/c- rats, lacking complement-mediated bacterial lysis, the augmentation of bacterial clearance by PorA-specific mIgG2a and hIgG1 antibodies was impaired compared to that in the syngeneic complement-sufficient PVG/c+ rat strain. This was in contrast to the case for B-PS-specific mIgG2a, which conferred similar protective activity in both rat strains. These data suggest that while anti-B-PS antibody can provide protection in the infant rats without membrane attack complex formation, the protection afforded by anti-PorA antibody is more dependent on the activation of the whole complement pathway and subsequent bacterial lysis.

Preeclampsia in autologous and oocyte donation pregnancy: is there a different pathophysiology?

PubMed

Lashley, Lisa E E L O; Buurma, Aletta; Swings, Godelieve M J S; Eikmans, Michael; Anholts, Jacqueline D H; Bakker, Jaap A; Claas, Frans H J

2015-06-01

Oocyte donation (OD) is a specific method of artificial reproductive technology that is accompanied by a higher risk of preeclampsia during pregnancy. The pathophysiological mechanism underlying preeclampsia in OD pregnancies is thought to differ from preeclampsia in autologous pregnancies. As preeclampsia in autologous pregnancies is suggested to be associated with complement activation, we studied C4d deposition, circulating complement components and placental complement regulatory proteins in preeclamptic OD pregnancies. Women with uncomplicated and preeclamptic pregnancies after OD or spontaneous conception were selected. We stained the placentas for C4d, marker for complement activation, measured complement factors C1q, C3 and C4 in maternal sera and quantified the placental mRNA expression of complement regulatory proteins CD46, CD55 and CD59. A significantly (p < 0.03) higher incidence of C4d deposition was observed in placentas from women with preeclampsia compared with uncomplicated pregnancies, both OD and autologous. The level of complement factors in serum did not differ between the groups. Children born in the autologous preeclampsia group were significantly lower in birth weight (p < 10th percentile) compared with the preeclamptic OD group. In addition, the placental mRNA expression level of complement regulatory proteins was significantly lower in uncomplicated and preeclamptic OD compared with the autologous pregnancies. In line with autologous preeclampsia pregnancies, there is excessive activation of complement in preeclamptic OD pregnancies. However, in contrast to autologous pregnancies this is not associated with counterbalancing upregulation of complement regulatory proteins. Furthermore, C4d deposition in OD pregnancies is not related to the severity of preeclampsia, suggesting another trigger or regulatory mechanism of placental C4d deposition in preeclamptic OD pregnancies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Generating a Generation of Proteasome Inhibitors: From Microbial Fermentation to Total Synthesis of Salinosporamide A (Marizomib) and Other Salinosporamides

PubMed Central

Potts, Barbara C.; Lam, Kin S.

2010-01-01

The salinosporamides are potent proteasome inhibitors among which the parent marine-derived natural product salinosporamide A (marizomib; NPI-0052; 1) is currently in clinical trials for the treatment of various cancers. Methods to generate this class of compounds include fermentation and natural products chemistry, precursor-directed biosynthesis, mutasynthesis, semi-synthesis, and total synthesis. The end products range from biochemical tools for probing mechanism of action to clinical trials materials; in turn, the considerable efforts to produce the target molecules have expanded the technologies used to generate them. Here, the full complement of methods is reviewed, reflecting remarkable contributions from scientists of various disciplines over a period of 7 years since the first publication of the structure of 1. PMID:20479958

Crosslinked Aspartic Acids as Helix-Nucleating Templates.

PubMed

Zhao, Hui; Liu, Qi-Song; Geng, Hao; Tian, Yuan; Cheng, Min; Jiang, Yan-Hong; Xie, Ming-Sheng; Niu, Xiao-Gang; Jiang, Fan; Zhang, Ya-Ou; Lao, Yuan-Zhi; Wu, Yun-Dong; Xu, Nai-Han; Li, Zi-Gang

2016-09-19

Described is a facile helix-nucleating template based on a tethered aspartic acid at the N-terminus [terminal aspartic acid (TD)]. The nucleating effect of the template is subtly influenced by the substituent at the end of the side-chain-end tether as indicated by circular dichroism, nuclear magnetic resonance, and molecular dynamics simulations. Unlike most nucleating strategies, the N-terminal amine is preserved, thus enabling further modification. Peptidomimetic estrogen receptor modulators (PERMs) constructed using this strategy show improved therapeutic properties. The current strategy can be regarded as a good complement to existing helix-stabilizing methods. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Domino-hydroformylation/aldol condensation catalysis: highly selective synthesis of α,β-unsaturated aldehydes from olefins.

PubMed

Fang, Xianjie; Jackstell, Ralf; Franke, Robert; Beller, Matthias

2014-10-06

A general and highly chemo-, regio-, and stereoselective synthesis of α,β-unsaturated aldehydes by a domino hydroformylation/aldol condensation reaction has been developed. A variety of olefins and aromatic aldehydes were efficiently converted into various substituted α,β-unsaturated aldehydes in good to excellent yields in the presence of a rhodium phosphine/acid-base catalyst system. In view of the easy availability of the substrates, the high atom-efficiency, the excellent selectivity, and the mild conditions, this method is expected to complement current methodologies for the preparation of α,β-unsaturated aldehydes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Study on recognition technology of complementary image

NASA Astrophysics Data System (ADS)

Liu, Chengxiang; Hu, Xuejuan; Jian, Yaobo; Zhang, Li

2006-11-01

Complementation image is often used as a guard technology in the trademark and paper currency. The key point of recognizing this kind of images is judging the complementary effect of complementation printing. The perspective images are usually not clear and legible, so it is difficult to recognize them. In this paper, a new method is proposed. Firstly, capture the image by reflex. Secondly, find the same norm to man-made pair printing. Lastly, judge the true and false of paper currency by the complementary effect of complementation printing. This is the purpose of inspecting the false. Theoretic analysis and simulation results reveal that the effect of man-made pair printing is good, the method has advantages such as simplicity, high calculating speed, and good robust to different RMB. The experiment results reveal that the conclusion is reasonable, and demonstrates that this approach is effective.

A fast method for detecting Cryptosporidium parvum oocysts in real world samples

NASA Astrophysics Data System (ADS)

Stewart, Shona; McClelland, Lindy; Maier, John

2005-04-01

Contamination of drinking water with pathogenic microorganisms such as Cryptosporidium has become an increasing concern in recent years. Cryptosporidium oocysts are particularly problematic, as infections caused by this organism can be life threatening in immunocompromised patients. Current methods for monitoring and analyzing water are often laborious and require experts to conduct. In addition, many of the techniques require very specific reagents to be employed. These factors add considerable cost and time to the analytical process. Raman spectroscopy provides specific molecular information on samples, and offers advantages of speed, sensitivity and low cost over current methods of water monitoring. Raman spectroscopy is an optical method that has demonstrated the capability to identify and differentiate microorganisms at the species and strain levels. In addition, this technique has exhibited sensitivities down to the single organism detection limit. We have employed Raman spectroscopy and Raman Chemical Imaging, in conjunction with chemometric techniques, to detect small numbers of oocysts in the presence of interferents derived from real-world water samples. Our investigations have also indicated that Raman Chemical Imaging may provide chemical and physiological information about an oocyst sample which complements information provided by the traditional methods. This work provides evidence that Raman imaging is a useful technique for consideration in the water quality industry.

A Complex Network Approach to Stylometry

PubMed Central

Amancio, Diego Raphael

2015-01-01

Statistical methods have been widely employed to study the fundamental properties of language. In recent years, methods from complex and dynamical systems proved useful to create several language models. Despite the large amount of studies devoted to represent texts with physical models, only a limited number of studies have shown how the properties of the underlying physical systems can be employed to improve the performance of natural language processing tasks. In this paper, I address this problem by devising complex networks methods that are able to improve the performance of current statistical methods. Using a fuzzy classification strategy, I show that the topological properties extracted from texts complement the traditional textual description. In several cases, the performance obtained with hybrid approaches outperformed the results obtained when only traditional or networked methods were used. Because the proposed model is generic, the framework devised here could be straightforwardly used to study similar textual applications where the topology plays a pivotal role in the description of the interacting agents. PMID:26313921

Soot volume fraction fields in unsteady axis-symmetric flames by continuous laser extinction technique.

PubMed

Kashif, Muhammad; Bonnety, Jérôme; Guibert, Philippe; Morin, Céline; Legros, Guillaume

2012-12-17

A Laser Extinction Method has been set up to provide two-dimensional soot volume fraction field time history at a tunable frequency up to 70 Hz inside an axis-symmetric diffusion flame experiencing slow unsteady phenomena preserving the symmetry. The use of a continuous wave laser as the light source enables this repetition rate, which is an incremental advance in the laser extinction technique. The technique is shown to allow a fine description of the soot volume fraction field in a flickering flame exhibiting a 12.6 Hz flickering phenomenon. Within this range of repetition rate, the technique and its subsequent post-processing require neither any method for time-domain reconstruction nor any correction for energy intrusion. Possibly complemented by such a reconstruction method, the technique should support further soot volume fraction database in oscillating flames that exhibit characteristic times relevant to the current efforts in the validation of soot processes modeling.

Geometry and Dynamics for Markov Chain Monte Carlo

NASA Astrophysics Data System (ADS)

Barp, Alessandro; Briol, François-Xavier; Kennedy, Anthony D.; Girolami, Mark

2018-03-01

Markov Chain Monte Carlo methods have revolutionised mathematical computation and enabled statistical inference within many previously intractable models. In this context, Hamiltonian dynamics have been proposed as an efficient way of building chains which can explore probability densities efficiently. The method emerges from physics and geometry and these links have been extensively studied by a series of authors through the last thirty years. However, there is currently a gap between the intuitions and knowledge of users of the methodology and our deep understanding of these theoretical foundations. The aim of this review is to provide a comprehensive introduction to the geometric tools used in Hamiltonian Monte Carlo at a level accessible to statisticians, machine learners and other users of the methodology with only a basic understanding of Monte Carlo methods. This will be complemented with some discussion of the most recent advances in the field which we believe will become increasingly relevant to applied scientists.

Computer-Assisted Learning Applications in Health Educational Informatics: A Review.

PubMed

Shaikh, Faiq; Inayat, Faisal; Awan, Omer; Santos, Marlise D; Choudhry, Adnan M; Waheed, Abdul; Kajal, Dilkash; Tuli, Sagun

2017-08-10

Computer-assisted learning (CAL) as a health informatics application is a useful tool for medical students in the era of expansive knowledge bases and the increasing need for and the consumption of automated and interactive systems. As the scope and breadth of medical knowledge expand, the need for additional learning outside of lecture hours is becoming increasingly important. CAL can be an impactful adjunct to conventional methods that currently exist in the halls of learning. There is an increasing body of literature that suggests that CAL should be a commonplace and the recommended method of learning for medical students. Factors such as technical issues that hinder the performance of CAL are also evaluated. We conclude by encouraging the use of CAL by medical students as a highly beneficial method of learning that complements and enhances lectures and provides intuitive, interactive modulation of a self-paced curriculum based on the individual's academic abilities.

The lectin pathway in renal disease: old concept and new insights.

PubMed

Gaya da Costa, Mariana; Poppelaars, Felix; Berger, Stefan P; Daha, Mohamed R; Seelen, Marc A

2018-04-26

The complement system is composed of a network of at least 40 proteins, which significantly contributes to health and disease. The lectin pathway (LP) is one of three pathways that can activate the complement system. Next to protection of the host against pathogens, the LP has been shown to play a crucial role in multiple renal diseases as well as during renal replacement therapy. Therefore, several complement-targeted drugs are currently being explored in clinical trials. Among these complement inhibitors, specific LP inhibitors are also being tested in renal abnormalities such as in immunoglobulin A nephropathy and lupus nephritis. Using various in vitro models, Yaseen et al. (Lectin pathway effector enzyme mannan-binding lectin-associated serine protease-2 can activate native complement component 3 (C3) in absence of C4 and/or C2. FASEB J 2017; 31: 2210-2219) showed that Mannan-associated serine protease2 can directly activate C3 thereby bypassing C2 and C4 in the activation of the LP. These new findings broaden our understanding of the mechanisms of complement activation and could potentially impact our strategies to inhibit the LP in renal diseases. In support of these findings, we present data of human renal biopsies, demonstrating the occurrence of the LP bypass mechanism in vivo. In conclusion, this review provides a detailed overview of the LP and clarifies the recently described bypass mechanism and its relevance. Finally, we speculate on the role of the C4 bypass mechanism in other renal diseases.

Molecular mechanisms of inflammation and tissue injury after major trauma-is complement the "bad guy"?

PubMed Central

2011-01-01

Trauma represents the leading cause of death among young people in industrialized countries. Recent clinical and experimental studies have brought increasing evidence for activation of the innate immune system in contributing to the pathogenesis of trauma-induced sequelae and adverse outcome. As the "first line of defense", the complement system represents a potent effector arm of innate immunity, and has been implicated in mediating the early posttraumatic inflammatory response. Despite its generic beneficial functions, including pathogen elimination and immediate response to danger signals, complement activation may exert detrimental effects after trauma, in terms of mounting an "innocent bystander" attack on host tissue. Posttraumatic ischemia/reperfusion injuries represent the classic entity of complement-mediated tissue damage, adding to the "antigenic load" by exacerbation of local and systemic inflammation and release of toxic mediators. These pathophysiological sequelae have been shown to sustain the systemic inflammatory response syndrome after major trauma, and can ultimately contribute to remote organ injury and death. Numerous experimental models have been designed in recent years with the aim of mimicking the inflammatory reaction after trauma and to allow the testing of new pharmacological approaches, including the emergent concept of site-targeted complement inhibition. The present review provides an overview on the current understanding of the cellular and molecular mechanisms of complement activation after major trauma, with an emphasis of emerging therapeutic concepts which may provide the rationale for a "bench-to-bedside" approach in the design of future pharmacological strategies. PMID:22129197

Cloning Mice and Men: Prohibiting the Use of iPS Cells for Human Reproductive Cloning

PubMed Central

Lo, Bernard; Parham, Lindsay; Alvarez-Buylla, Arturo; Cedars, Marcelle; Conklin, Bruce; Fisher, Susan; Gates, Elena; Giudice, Linda; Halme, Dina Gould; Hershon, William; Kriegstein, Arnold; Kwok, Pui-Yan; Wagner, Richard

2014-01-01

The use of iPSCs and tetraploid complementation for human reproductive cloning would raise profound ethical objections. Professional standards and laws that ban human reproductive cloning by somatic cell nuclear transfer should be revised to also forbid it by other methods, such as iPSCs via tetraploid complementation. PMID:20085739

A scalable double-barcode sequencing platform for characterization of dynamic protein-protein interactions.

PubMed

Schlecht, Ulrich; Liu, Zhimin; Blundell, Jamie R; St Onge, Robert P; Levy, Sasha F

2017-05-25

Several large-scale efforts have systematically catalogued protein-protein interactions (PPIs) of a cell in a single environment. However, little is known about how the protein interactome changes across environmental perturbations. Current technologies, which assay one PPI at a time, are too low throughput to make it practical to study protein interactome dynamics. Here, we develop a highly parallel protein-protein interaction sequencing (PPiSeq) platform that uses a novel double barcoding system in conjunction with the dihydrofolate reductase protein-fragment complementation assay in Saccharomyces cerevisiae. PPiSeq detects PPIs at a rate that is on par with current assays and, in contrast with current methods, quantitatively scores PPIs with enough accuracy and sensitivity to detect changes across environments. Both PPI scoring and the bulk of strain construction can be performed with cell pools, making the assay scalable and easily reproduced across environments. PPiSeq is therefore a powerful new tool for large-scale investigations of dynamic PPIs.

SAM Companion Documents

EPA Pesticide Factsheets

SAM Companion Documents and Sample Collection Procedures provide information intended to complement the analytical methods listed in Selected Analytical Methods for Environmental Remediation and Recovery (SAM).

Complement research in the 18th-21st centuries: Progress comes with new technology.

PubMed

Sim, R B; Schwaeble, W; Fujita, T

2016-10-01

The complement system has been studied for about 120 years. Progress in defining this large and complex system has been dependent on the research technologies available, but since the introduction of protein chromatography, electrophoresis, and antibody-based assay methods in the 1950s and 60s, and sequencing of proteins and DNA in the 70s and 80s, there has been very rapid accumulation of data. With more recent improvements in 3D structure determination (nmr and X-ray crystallography), the structures of most of the complement proteins have now been solved. Complement research since 1990 has been greatly stimulated by the discoveries of the multiple proteins in the lectin pathway, the strong association of Factor H, C3, Factor B allelic variants with adult macular degeneration and atypical haemolytic uremic syndrome, and the introduction of the anti-C5 monoclonal antibody as a therapy for paroxysmal nocturnal hemoglobinuria and atypical haemolytic uremic syndrome. Potential new roles for complement in tissue development and the search for novel therapeutics suggest a very active future for complement research. Copyright © 2016 Elsevier GmbH. All rights reserved.

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

PubMed

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.

Portmanteau Constructions, Phrase Structure, and Linearization.

PubMed

Chan, Brian Hok-Shing

2015-01-01

In bilingual code-switching which involves language-pairs with contrasting head-complement orders (i.e., head-initial vs. head-final), a head may be lexicalized from both languages with its complement sandwiched in the middle. These so-called "portmanteau" sentences (Nishimura, 1985, 1986; Sankoff et al., 1990, etc.) have been attested for decades, but they had never received a systematic, formal analysis in terms of current syntactic theory before a few recent attempts (Hicks, 2010, 2012). Notwithstanding this lack of attention, these structures are in fact highly relevant to theories of linearization and phrase structure. More specifically, they challenge binary-branching (Kayne, 1994, 2004, 2005) as well as the Antisymmetry hypothesis (ibid.). Not explained by current grammatical models of code-switching, including the Equivalence Constraint (Poplack, 1980), the Matrix Language Frame Model (Myers-Scotton, 1993, 2002, etc.), and the Bilingual Speech Model (Muysken, 2000, 2013), the portmanteau construction indeed looks uncommon or abnormal, defying any systematic account. However, the recurrence of these structures in various datasets and constraints on them do call for an explanation. This paper suggests an account which lies with syntax and also with the psycholinguistics of bilingualism. Assuming that linearization is a process at the Sensori-Motor (SM) interface (Chomsky, 2005, 2013), this paper sees that word order is not fixed in a syntactic tree but it is set in the production process, and much information of word order rests in the processor, for instance, outputting a head before its complement (i.e., head-initial word order) or the reverse (i.e., head-final word order). As for the portmanteau construction, it is the output of bilingual speakers co-activating two sets of head-complement orders which summon the phonetic forms of the same word in both languages. Under this proposal, the underlying structure of a portmanteau construction is as simple as an XP in which a head X merges with its complement YP and projects an XP (i.e., X YP → [XP X YP]).

Portmanteau Constructions, Phrase Structure, and Linearization

PubMed Central

Chan, Brian Hok-Shing

2015-01-01

In bilingual code-switching which involves language-pairs with contrasting head-complement orders (i.e., head-initial vs. head-final), a head may be lexicalized from both languages with its complement sandwiched in the middle. These so-called “portmanteau” sentences (Nishimura, 1985, 1986; Sankoff et al., 1990, etc.) have been attested for decades, but they had never received a systematic, formal analysis in terms of current syntactic theory before a few recent attempts (Hicks, 2010, 2012). Notwithstanding this lack of attention, these structures are in fact highly relevant to theories of linearization and phrase structure. More specifically, they challenge binary-branching (Kayne, 1994, 2004, 2005) as well as the Antisymmetry hypothesis (ibid.). Not explained by current grammatical models of code-switching, including the Equivalence Constraint (Poplack, 1980), the Matrix Language Frame Model (Myers-Scotton, 1993, 2002, etc.), and the Bilingual Speech Model (Muysken, 2000, 2013), the portmanteau construction indeed looks uncommon or abnormal, defying any systematic account. However, the recurrence of these structures in various datasets and constraints on them do call for an explanation. This paper suggests an account which lies with syntax and also with the psycholinguistics of bilingualism. Assuming that linearization is a process at the Sensori-Motor (SM) interface (Chomsky, 2005, 2013), this paper sees that word order is not fixed in a syntactic tree but it is set in the production process, and much information of word order rests in the processor, for instance, outputting a head before its complement (i.e., head-initial word order) or the reverse (i.e., head-final word order). As for the portmanteau construction, it is the output of bilingual speakers co-activating two sets of head-complement orders which summon the phonetic forms of the same word in both languages. Under this proposal, the underlying structure of a portmanteau construction is as simple as an XP in which a head X merges with its complement YP and projects an XP (i.e., X YP → [XP X YP]). PMID:26733894

Development and Use of a Serum Bactericidal Assay Using Pooled Human Complement To Assess Responses to a Meningococcal Group A Conjugate Vaccine in African Toddlers

PubMed Central

Lynn, Freyja; Mocca, Brian; Borrow, Ray; Findlow, Helen; Hassan-King, Musa; Preziosi, Marie-Pierre; Idoko, Olubukola; Sow, Samba; Kulkarni, Prasad; LaForce, F. Marc

2014-01-01

A meningococcal group A polysaccharide (PS) conjugate vaccine (PsA-TT) has been developed for African countries affected by epidemic meningitis caused by Neisseria meningitidis. Complement-mediated serum bactericidal antibody (SBA) assays are used to assess protective immune responses to meningococcal vaccination. Human complement (hC′) was used in early studies demonstrating antibody-mediated protection against disease, but it is difficult to obtain and standardize. We developed and evaluated a method for sourcing hC′ and then used the SBA assay with hC′ (hSBA) to measure bactericidal responses to PsA-TT vaccination in 12- to 23-month-old African children. Sera with active complement from 100 unvaccinated blood donors were tested for intrinsic bactericidal activity, SBA titer using rabbit complement (rSBA), and anti-group A PS antibody concentration. Performance criteria and pooling strategies were examined and then verified by comparisons of three independently prepared hC′ lots in two laboratories. hSBA titers of clinical trial sera were then determined using this complement sourcing method. Two different functional antibody tests were necessary for screening hC′. hSBA titers determined using three independent lots of pooled hC′ were within expected assay variation among lots and between laboratories. In African toddlers, PsA-TT elicited higher hSBA titers than meningococcal polysaccharide or Hib vaccines. PsA-TT immunization or PS challenge of PsA-TT-primed subjects resulted in vigorous hSBA memory responses, and titers persisted in boosted groups for over a year. Quantifying SBA using pooled hC′ is feasible and showed that PsA-TT was highly immunogenic in African toddlers. PMID:24671551

Where to restore ecological connectivity? Detecting barriers and quantifying restoration benefits.

PubMed

McRae, Brad H; Hall, Sonia A; Beier, Paul; Theobald, David M

2012-01-01

Landscape connectivity is crucial for many ecological processes, including dispersal, gene flow, demographic rescue, and movement in response to climate change. As a result, governmental and non-governmental organizations are focusing efforts to map and conserve areas that facilitate movement to maintain population connectivity and promote climate adaptation. In contrast, little focus has been placed on identifying barriers-landscape features which impede movement between ecologically important areas-where restoration could most improve connectivity. Yet knowing where barriers most strongly reduce connectivity can complement traditional analyses aimed at mapping best movement routes. We introduce a novel method to detect important barriers and provide example applications. Our method uses GIS neighborhood analyses in conjunction with effective distance analyses to detect barriers that, if removed, would significantly improve connectivity. Applicable in least-cost, circuit-theoretic, and simulation modeling frameworks, the method detects both complete (impermeable) barriers and those that impede but do not completely block movement. Barrier mapping complements corridor mapping by broadening the range of connectivity conservation alternatives available to practitioners. The method can help practitioners move beyond maintaining currently important areas to restoring and enhancing connectivity through active barrier removal. It can inform decisions on trade-offs between restoration and protection; for example, purchasing an intact corridor may be substantially more costly than restoring a barrier that blocks an alternative corridor. And it extends the concept of centrality to barriers, highlighting areas that most diminish connectivity across broad networks. Identifying which modeled barriers have the greatest impact can also help prioritize error checking of land cover data and collection of field data to improve connectivity maps. Barrier detection provides a different way to view the landscape, broadening thinking about connectivity and fragmentation while increasing conservation options.

Where to Restore Ecological Connectivity? Detecting Barriers and Quantifying Restoration Benefits

PubMed Central

McRae, Brad H.; Hall, Sonia A.; Beier, Paul; Theobald, David M.

2012-01-01

Landscape connectivity is crucial for many ecological processes, including dispersal, gene flow, demographic rescue, and movement in response to climate change. As a result, governmental and non-governmental organizations are focusing efforts to map and conserve areas that facilitate movement to maintain population connectivity and promote climate adaptation. In contrast, little focus has been placed on identifying barriers—landscape features which impede movement between ecologically important areas—where restoration could most improve connectivity. Yet knowing where barriers most strongly reduce connectivity can complement traditional analyses aimed at mapping best movement routes. We introduce a novel method to detect important barriers and provide example applications. Our method uses GIS neighborhood analyses in conjunction with effective distance analyses to detect barriers that, if removed, would significantly improve connectivity. Applicable in least-cost, circuit-theoretic, and simulation modeling frameworks, the method detects both complete (impermeable) barriers and those that impede but do not completely block movement. Barrier mapping complements corridor mapping by broadening the range of connectivity conservation alternatives available to practitioners. The method can help practitioners move beyond maintaining currently important areas to restoring and enhancing connectivity through active barrier removal. It can inform decisions on trade-offs between restoration and protection; for example, purchasing an intact corridor may be substantially more costly than restoring a barrier that blocks an alternative corridor. And it extends the concept of centrality to barriers, highlighting areas that most diminish connectivity across broad networks. Identifying which modeled barriers have the greatest impact can also help prioritize error checking of land cover data and collection of field data to improve connectivity maps. Barrier detection provides a different way to view the landscape, broadening thinking about connectivity and fragmentation while increasing conservation options. PMID:23300719

Nanoscale Optical Imaging and Spectroscopy from Visible to Mid-Infrared

DTIC Science & Technology

2015-11-13

field characterization of nanoscale materials, it also complements the near- field scanning optical microscope currently available in the PI’s lab...field scanning optical microscope currently available in the PI’s lab. This equipment will begin making major impacts on at least three current DoD...SECURITY CLASSIFICATION OF: 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 13. SUPPLEMENTARY NOTES 12. DISTRIBUTION AVAILIBILITY STATEMENT 6

Cloning mice and men: prohibiting the use of iPS cells for human reproductive cloning.

PubMed

Lo, Bernard; Parham, Lindsay; Alvarez-Buylla, Arturo; Cedars, Marcelle; Conklin, Bruce; Fisher, Susan; Gates, Elena; Giudice, Linda; Halme, Dina Gould; Hershon, William; Kriegstein, Arnold; Kwok, Pui-Yan; Wagner, Richard

2010-01-08

The use of iPSCs and tetraploid complementation for human reproductive cloning would raise profound ethical objections. Professional standards and laws that ban human reproductive cloning by somatic cell nuclear transfer should be revised to also forbid it by other methods, such as iPSCs via tetraploid complementation. Copyright 2010 Elsevier Inc. All rights reserved.

Complement dependent cytotoxicity (CDC) activity of a humanized anti Lewis-Y antibody: FACS-based assay versus the 'classical' radioactive method -- qualification, comparison and application of the FACS-based approach.

PubMed

Nechansky, A; Szolar, O H J; Siegl, P; Zinoecker, I; Halanek, N; Wiederkum, S; Kircheis, R

2009-05-01

The fully humanized Lewis-Y carbohydrate specific monoclonal antibody (mAb) IGN311 is currently tested in a passive immunotherapy approach in a clinical phase I trail and therefore regulatory requirements demand qualified assays for product analysis. To demonstrate the functionality of its Fc-region, the capacity of IGN311 to mediate complement dependent cytotoxicity (CDC) against human breast cancer cells was evaluated. The "classical" radioactive method using chromium-51 and a FACS-based assay were established and qualified according to ICH guidelines. Parameters evaluated were specificity, response function, bias, repeatability (intra-day precision), intermediate precision (operator-time different), and linearity (assay range). In the course of a fully nested design, a four-parameter logistic equation was identified as appropriate calibration model for both methods. For the radioactive assay, the bias ranged from -6.1% to -3.6%. The intermediate precision for future means of duplicate measurements revealed values from 12.5% to 15.9% and the total error (beta-expectation tolerance interval) of the method was found to be <40%. For the FACS-based assay, the bias ranged from -8.3% to 0.6% and the intermediate precision for future means of duplicate measurements revealed values from 4.2% to 8.0%. The total error of the method was found to be <25%. The presented data demonstrate that the FACS-based CDC is more accurate than the radioactive assay. Also, the elimination of radioactivity and the 'real-time' counting of apoptotic cells further justifies the implementation of this method which was subsequently applied for testing the influence of storage at 4 degrees C and 25 degrees C ('stability testing') on the potency of IGN311 drug product. The obtained results demonstrate that the qualified functional assay represents a stability indicating test method.

Single-cell proteomics: potential implications for cancer diagnostics.

PubMed

Gavasso, Sonia; Gullaksen, Stein-Erik; Skavland, Jørn; Gjertsen, Bjørn T

2016-01-01

Single-cell proteomics in cancer is evolving and promises to provide more accurate diagnoses based on detailed molecular features of cells within tumors. This review focuses on technologies that allow for collection of complex data from single cells, but also highlights methods that are adaptable to routine cancer diagnostics. Current diagnostics rely on histopathological analysis, complemented by mutational detection and clinical imaging. Though crucial, the information gained is often not directly transferable to defined therapeutic strategies, and predicting therapy response in a patient is difficult. In cancer, cellular states revealed through perturbed intracellular signaling pathways can identify functional mutations recurrent in cancer subsets. Single-cell proteomics remains to be validated in clinical trials where serial samples before and during treatment can reveal excessive clonal evolution and therapy failure; its use in clinical trials is anticipated to ignite a diagnostic revolution that will better align diagnostics with the current biological understanding of cancer.

Biosensor-based microRNA detection: techniques, design, performance, and challenges.

PubMed

Johnson, Blake N; Mutharasan, Raj

2014-04-07

The current state of biosensor-based techniques for amplification-free microRNA (miRNA) detection is critically reviewed. Comparison with non-sensor and amplification-based molecular techniques (MTs), such as polymerase-based methods, is made in terms of transduction mechanism, associated protocol, and sensitivity. Challenges associated with miRNA hybridization thermodynamics which affect assay selectivity and amplification bias are briefly discussed. Electrochemical, electromechanical, and optical classes of miRNA biosensors are reviewed in terms of transduction mechanism, limit of detection (LOD), time-to-results (TTR), multiplexing potential, and measurement robustness. Current trends suggest that biosensor-based techniques (BTs) for miRNA assay will complement MTs due to the advantages of amplification-free detection, LOD being femtomolar (fM)-attomolar (aM), short TTR, multiplexing capability, and minimal sample preparation requirement. Areas of future importance in miRNA BT development are presented which include focus on achieving high measurement confidence and multiplexing capabilities.

Detection and manipulation of phosphoinositides.

PubMed

Idevall-Hagren, Olof; De Camilli, Pietro

2015-06-01

Phosphoinositides (PIs) are minor components of cell membranes, but play key roles in cell function. Recent refinements in techniques for their detection, together with imaging methods to study their distribution and changes, have greatly facilitated the study of these lipids. Such methods have been complemented by the parallel development of techniques for the acute manipulation of their levels, which in turn allow bypassing the long-term adaptive changes implicit in genetic perturbations. Collectively, these advancements have helped elucidate the role of PIs in physiology and the impact of the dysfunction of their metabolism in disease. Combining methods for detection and manipulation enables the identification of specific roles played by each of the PIs and may eventually lead to the complete deconstruction of the PI signaling network. Here, we review current techniques used for the study and manipulation of cellular PIs and also discuss advantages and disadvantages associated with the various methods. This article is part of a Special Issue entitled Phosphoinositides. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection and manipulation of phosphoinositides☆

PubMed Central

Idevall-Hagren, Olof; Camilli, Pietro De

2016-01-01

Phosphoinositides (PIs) are minor components of cell membranes, but play key roles in cell function. Recent refinements in techniques for their detection, together with imaging methods to study their distribution and changes, have greatly facilitated the study of these lipids. Such methods have been complemented by the parallel development of techniques for the acute manipulation of their levels, which in turn allow bypassing the long-term adaptive changes implicit in genetic perturbations. Collectively, these advancements have helped elucidate the role of PIs in physiology and the impact of the dysfunction of their metabolism in disease. Combining methods for detection and manipulation enables the identification of specific roles played by each of the PIs and may eventually lead to the complete deconstruction of the PI signaling network. Here, we review current techniques used for the study and manipulation of cellular PIs and also discuss advantages and disadvantages associated with the various methods. This article is part of a Special Issue entitled Phosphoinositides. PMID:25514766

Challenges in quantitative crystallographic characterization of 3D thin films by ACOM-TEM.

PubMed

Kobler, A; Kübel, C

2017-02-01

Automated crystal orientation mapping for transmission electron microscopy (ACOM-TEM) has become an easy to use method for the investigation of crystalline materials and complements other TEM methods by adding local crystallographic information over large areas. It fills the gap between high resolution electron microscopy and electron back scatter diffraction in terms of spatial resolution. Recent investigations showed that spot diffraction ACOM-TEM is a quantitative method with respect to sample parameters like grain size, twin density, orientation density and others. It can even be used in combination with in-situ tensile or thermal testing. However, there are limitations of the current method. In this paper we discuss some of the challenges and discuss solutions, e.g. we present an ambiguity filter that reduces the number of pixels with a '180° ambiguity problem'. For that an ACOM-TEM tilt series of nanocrystalline Pd thin films with overlapping crystallites was acquired and analyzed. Copyright © 2017. Published by Elsevier B.V.

Method of monaural localization of the acoustic source direction from the standpoint of the active perception theory

NASA Astrophysics Data System (ADS)

Gai, V. E.; Polyakov, I. V.; Krasheninnikov, M. S.; Koshurina, A. A.; Dorofeev, R. A.

2017-01-01

Currently, the scientific and educational center of the “Transport” of NNSTU performs work on the creation of the universal rescue vehicle. This vehicle is a robot, and intended to reduce the number of human victims in accidents on offshore oil platforms. An actual problem is the development of a method for determining the location of a person overboard in low visibility conditions, when a traditional vision is not efficient. One of the most important sensory robot systems is the acoustic sensor system, because it is omnidirectional and does not require finding of an acoustic source in visibility scope. Features of the acoustic sensor robot system can complement the capabilities of the video sensor in the solution of the problem of localization of a person or some event in the environment. This paper describes the method of determination of the direction of the acoustic source using just one microphone. The proposed method is based on the active perception theory.

Efficient solution of 3D electromagnetic eddy-current problems within the finite volume framework of OpenFOAM

NASA Astrophysics Data System (ADS)

Beckstein, Pascal; Galindo, Vladimir; Vukčević, Vuko

2017-09-01

Eddy-current problems occur in a wide range of industrial and metallurgical applications where conducting material is processed inductively. Motivated by realising coupled multi-physics simulations, we present a new method for the solution of such problems in the finite volume framework of foam-extend, an extended version of the very popular OpenFOAM software. The numerical procedure involves a semi-coupled multi-mesh approach to solve Maxwell's equations for non-magnetic materials by means of the Coulomb gauged magnetic vector potential A and the electric scalar potential ϕ. The concept is further extended on the basis of the impressed and reduced magnetic vector potential and its usage in accordance with Biot-Savart's law to achieve a very efficient overall modelling even for complex three-dimensional geometries. Moreover, we present a special discretisation scheme to account for possible discontinuities in the electrical conductivity. To complement our numerical method, an extensive validation is completing the paper, which provides insight into the behaviour and the potential of our approach.

Efficiency estimation method of three-wired AC to DC line transfer

NASA Astrophysics Data System (ADS)

Solovev, S. V.; Bardanov, A. I.

2018-05-01

The development of power semiconductor converters technology expands the scope of their application to medium voltage distribution networks (6-35 kV). Particularly rectifiers and inverters of appropriate power capacity complement the topology of such voltage level networks with the DC links and lines. The article presents a coefficient that allows taking into account the increase of transmission line capacity depending on the parameters of it. The application of the coefficient is presented by the example of transfer three-wired AC line to DC in various methods. Dependences of the change in the capacity from the load power factor of the line and the reactive component of the resistance of the transmission line are obtained. Conclusions are drawn about the most efficient ways of converting a three-wired AC line to direct current.

Donor Brain Death Exacerbates Complement-Dependent Ischemia Reperfusion Injury in Transplanted Hearts

PubMed Central

Atkinson, Carl; Floerchinger, Bernhard; Qiao, Fei; Casey, Sarah; Williamson, Tucker; Moseley, Ellen; Stoica, Serban; Goddard, Martin; Ge, Xupeng; Tullius, Stefan G.; Tomlinson, Stephen

2013-01-01

Background Brain death (BD) can immunologically prime the donor organ and is thought to lead to exacerbated ischemia reperfusion injury (IRI) post-transplantation. Using a newly developed mouse model of BD, we investigated the effect of donor BD on post transplant cardiac IRI. We further investigated the therapeutic effect of a targeted complement inhibitor in recipients of BD donor hearts, and addressed the clinical relevance of these studies by analysis of human heart biopsies from BD and domino (living) donors. Methods and Results Hearts from living or brain dead donor C57BL/6 mice were transplanted into C57BL/6 or BALB/c recipients. Recipient mice were treated with the complement inhibitor CR2-Crry or vehicle control (n=6). Isografts were analyzed 48 hours post-transplant for injury, inflammation and complement deposition, and allografts monitored for graft survival. Human cardiac biopsies were analyzed for complement deposition and inflammatory cell infiltration. In the murine model, donor BD exacerbated IRI and graft rejection as demonstrated by increased myocardial injury, serum cardiac troponin, cellular infiltration, inflammatory chemokine and cytokine levels, complement deposition, and decreased graft survival. CR2-Crry treatment of recipients significantly reduced all measured outcomes in grafts from both BD and living donors compared to controls. Analysis of human samples documented the relevance of our experimental findings and revealed exacerbated complement deposition and inflammation in grafts from BD donors compared to grafts from living donors. Conclusions BD exacerbates post-transplant cardiac IRI in mice and humans, and decreases survival of mouse allografts. Further, targeted complement inhibition in recipient mice ameliorates BD-exacerbated IRI. PMID:23443736

Antibodies to PcpA and PhtD protect mice against Streptococcus pneumoniae by a macrophage- and complement-dependent mechanism.

PubMed

Visan, Lucian; Rouleau, Nicolas; Proust, Emilie; Peyrot, Loïc; Donadieu, Arnaud; Ochs, Martina

2018-02-01

Currently marketed Streptococcus pneumoniae (Spn) vaccines, which contain polysaccharide capsular antigens from the most common Spn serotypes, have substantially reduced pneumococcal disease rates but have limited coverage. A trivalent pneumococcal protein vaccine containing pneumococcal choline-binding protein A (PcpA), pneumococcal histidine triad protein D (PhtD), and detoxified pneumolysin is being developed to provide broader, cross-serotype protection. Antibodies against detoxified pneumolysin protect against bacterial pneumonia by neutralizing Spn-produced pneumolysin, but how anti-PhtD and anti-PcpA antibodies protect against Spn has not been established. Here, we used a murine passive protection sepsis model to investigate the mechanism of protection by anti-PhtD and anti-PcpA antibodies. Depleting complement using cobra venom factor eliminated protection by anti-PhtD and anti-PcpA monoclonal antibodies (mAbs). Consistent with a requirement for complement, complement C3 deposition on Spn in vitro was enhanced by anti-PhtD and anti-PcpA mAbs and by sera from PhtD- and PcpA-immunized rabbits and humans. Moreover, in the presence of complement, anti-PhtD and anti-PcpA mAbs increased uptake of Spn by human granulocytes. Depleting neutrophils using anti-Ly6G mAbs, splenectomy, or a combination of both did not affect passive protection against Spn, whereas depleting macrophages using clodronate liposomes eliminated protection. These results suggest anti-PhtD and anti-PcpA antibodies induced by pneumococcal protein vaccines protect against Spn by a complement- and macrophage-dependent opsonophagocytosis.

MISR Current Project Quality

Atmospheric Science Data Center

2016-11-25

... may contain parameters at varying quality levels.   ORGANIZATION MISR Products are divided into four groups, Level 1, Level 2 ... are provided both to complement Standard Product quality information and to satisfy those who order the ancillary products. ARP ...

OBPR Free Flyer draft roadmap overview

NASA Technical Reports Server (NTRS)

Israelsson, Ulf

2005-01-01

OBPR Free Flyer Roadmap Purpose is to describe the OBPR research which is enabled by a free flying spacecraft capability To illustrate how research performed on free flying spacecrafts complement current and planned OBPR ISS activities.

Engineered Fc variant antibodies with enhanced ability to recruit complement and mediate effector functions

PubMed Central

Moore, Gregory L; Chen, Hsing; Karki, Sher

2010-01-01

Engineering the antibody Fc region to enhance the cytotoxic activity of therapeutic antibodies is currently an active area of investigation. The contribution of complement to the mechanism of action of some antibodies that target cancers and pathogens makes a compelling case for its optimization. Here we describe the generation of a series of Fc variants with enhanced ability to recruit complement. Variants enhanced the cytotoxic potency of an anti-CD20 antibody up to 23-fold against tumor cells in CDC assays, and demonstrated a correlated increase in C1q binding affinity. Complementenhancing substitutions combined additively, and in one case synergistically, with substitutions previously engineered for improved binding to Fc gamma receptors. The engineered combinations provided a range of effector function activities, including simultaneously enhanced CDC, ADCC, and phagocytosis. Variants were also effective at boosting the effector function of antibodies targeting the antigens CD40 and CD19, in the former case enhancing CDC over 600-fold, and in the latter case imparting complement-mediated activity onto an IgG1 antibody that was otherwise incapable of it. This work expands the toolkit of modifications for generating monoclonal antibodies with improved therapeutic potential and enables the exploration of optimized synergy between Fc gamma receptors and complement pathways for the destruction of tumors and infectious pathogens. PMID:20150767

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

A Procedure for Structural Weight Estimation of Single Stage to Orbit Launch Vehicles (Interim User's Manual)

NASA Technical Reports Server (NTRS)

Martinovic, Zoran N.; Cerro, Jeffrey A.

2002-01-01

This is an interim user's manual for current procedures used in the Vehicle Analysis Branch at NASA Langley Research Center, Hampton, Virginia, for launch vehicle structural subsystem weight estimation based on finite element modeling and structural analysis. The process is intended to complement traditional methods of conceptual and early preliminary structural design such as the application of empirical weight estimation or application of classical engineering design equations and criteria on one dimensional "line" models. Functions of two commercially available software codes are coupled together. Vehicle modeling and analysis are done using SDRC/I-DEAS, and structural sizing is performed with the Collier Research Corp. HyperSizer program.

On-Board Entry Trajectory Planning Expanded to Sub-orbital Flight

NASA Technical Reports Server (NTRS)

Lu, Ping; Shen, Zuojun

2003-01-01

A methodology for on-board planning of sub-orbital entry trajectories is developed. The algorithm is able to generate in a time frame consistent with on-board environment a three-degree-of-freedom (3DOF) feasible entry trajectory, given the boundary conditions and vehicle modeling. This trajectory is then tracked by feedback guidance laws which issue guidance commands. The current trajectory planning algorithm complements the recently developed method for on-board 3DOF entry trajectory generation for orbital missions, and provides full-envelope autonomous adaptive entry guidance capability. The algorithm is validated and verified by extensive high fidelity simulations using a sub-orbital reusable launch vehicle model and difficult mission scenarios including failures and aborts.

Targeted complement inhibition as a promising strategy for preventing inflammatory complications in hemodialysis

PubMed Central

DeAngelis, Robert A.; Reis, Edimara S.; Ricklin, Daniel; Lambris, John D.

2012-01-01

Hemodialysis is the most common method used to remove waste and hazardous products of metabolism in patients suffering from renal failure. Hundreds of thousands of people with end-stage renal disease undergo hemodialysis treatment in the United States each year. Strikingly, the 5-year survival rate for all dialysis patients is only 35%. Most of the patients succumb to cardiovascular disease that is exacerbated by the chronic induction of inflammation caused by contact of the blood with the dialysis membrane. The complement system, a strong mediator of pro-inflammatory networks, is a key contributor to such biomaterial-induced inflammation. Though only evaluated in experimental ex vivo settings, specific targeting of complement activation during hemodialysis has uncovered valuable information that points towards the therapeutic use of complement inhibitors as means to control the unwelcomed inflammatory responses and consequent pathologies in hemodialysis patients. PMID:22964235

A comprehensive strategy for the subtyping of patients with Fanconi anaemia: conclusions from the Spanish Fanconi Anemia Research Network

PubMed Central

Casado, José Antonio; Callén, Elsa; Jacome, Ariana; Río, Paula; Castella, Maria; Lobitz, Stephan; Ferro, Teresa; Muñoz, Arturo; Sevilla, Julián; Cantalejo, Ángeles; Cela, Elena; Cervera, José; Sánchez‐Calero, Jesús; Badell, Isabel; Estella, Jesús; Dasí, Ángeles; Olivé, Teresa; Ortega, Juan José; Rodriguez‐Villa, Antonia; Tapia, María; Molinés, Antonio; Madero, Luis; Segovia, José C; Neveling, Kornelia; Kalb, Reinhard; Schindler, Detlev; Hanenberg, Helmut; Surrallés, Jordi; Bueren, Juan A

2007-01-01

Background Fanconi anaemia is a heterogeneous genetic disease, where 12 complementation groups have been already described. Identifying the complementation group in patients with Fanconi anaemia constitutes a direct procedure to confirm the diagnosis of the disease and is required for the recruitment of these patients in gene therapy trials. Objective To determine the subtype of Fanconi anaemia patients in Spain, a Mediterranean country with a relatively high population (23%) of Fanconi anaemia patients belonging to the gypsy race. Methods Most patients could be subtyped by retroviral complementation approaches in peripheral blood T cells, although some mosaic patients were subtyped in cultured skin fibroblasts. Other approaches, mainly based on western blot analysis and generation of nuclear RAD51 and FANCJ foci, were required for the subtyping of a minor number of patients. Results and conclusions From a total of 125 patients included in the Registry of Fanconi Anaemia, samples from 102 patients were available for subtyping analyses. In 89 cases the subtype could be determined and in 8 cases exclusions of common complementation groups were made. Compared with other international studies, a skewed distribution of complementation groups was observed in Spain, where 80% of the families belonged to the Fanconi anaemia group A (FA‐A) complementation group. The high proportion of gypsy patients, all of them FA‐A, and the absence of patients with FA‐C account for this characteristic distribution of complementation groups. PMID:17105750

Preparation of Low Molecular Weight Chondroitin Sulfates, Screening of a High Anti-Complement Capacity of Low Molecular Weight Chondroitin Sulfate and Its Biological Activity Studies in Attenuating Osteoarthritis.

PubMed

Li, Lian; Li, Yan; Feng, Danyang; Xu, Linghua; Yin, Fengxin; Zang, Hengchang; Liu, Chunhui; Wang, Fengshan

2016-10-11

Chondroitin sulfate (CS) plays important roles in the complement system. However, the CS structure is complicated due to different sources and the number and positions of sulfate groups. The objective of this study was to prepare different low molecular weight chondroitin sulfates (LMWCSs) and to investigate the biological activity in anti-complement capacity. A series of LMWCSs was prepared from different sources and characterized by ultraviolet-visible (UV) spectroscopy, high-performance liquid chromatography (HPLC), size exclusion chromatography-multiangle laser light scattering (SEC-MALLS) and nuclear magnetic resonance (NMR) spectroscopy. Hemolytic, anti-complement 3 deposition capacity and cell viability assays were carried out to investigate the biological activities in vitro. The results showed that LMWCS prepared from shark cartilage with the oxidative degradation method (LMWCS-S-O) had the best anti-complement capacity. LMWCS-S-O could inhibit the alternative pathway of the complement system and protect chondrocytes from cell death. The attenuating effect of LMWCS-S-O on Osteoarthritis (OA) was investigated by destabilization of the medial meniscus (DMM) model in vivo. Functional wind-up, histological and C5b-9 analyses were used to evaluate the treatment effect on the OA model. In vivo results showed that LMWCS-S-O could attenuate OA. LMWCS-S-O with a high content of ΔDi-2,6diS and ΔDi-6S could be used for attenuating OA through regulating the complement system.

Cold activation of complement for monitoring the response to interferon in patients with chronic hepatitis C.

PubMed

Akahane, Y; Miyazaki, Y; Naitoh, S; Takeda, K; Tsuda, F; Okamoto, H; Itoh, K; Miyakawa, Y; Mayumi, M

1996-02-01

Because of its specific association with hepatitis C virus (HCV) infection, the cold activation of complement is an easy and inexpensive indicator of HCV viremia. It was evaluated for eligibility as a marker of response to interferon in patients with hepatitis C. The cold activation of complement was determined by the loss or decrease of hemolytic activity with the microtitration method in sera that had been stored at 4 degrees C overnight. We observed the loss of hemolytic activity by the cold activation of complement in 236 (72%) and a decrease in 56 (17%) of 327 sera from patients with HCV-associated chronic liver disease, which was much more (p < 0.001) that in 1 (1%) and 13 (14%), respectively, of 49 sera from patients with chronic liver disease associated with hepatitis B virus infection. Interferon-alpha (total dose 516 x 10(6) units) or interferon-alpha 2b (774 x 10(6) units) was given to 67 patients with chronic hepatitis C, of whom 56 had the cold activation of complement. The response to interferon was evaluated by the clearance of serum HCV RNA at 6 months after the completion of therapy. The cold activation of complement disappeared in 18 patients, of whom 15 (86%) responded. It persisted or fluctuated in the remaining 38 patients, only six (16%) of whom responded to interferon (p < 0.001). The cold activation of complement once disappeared at the completion of interferon and then reappeared in patients who relapsed after completing interferon therapy. These results indicate that the cold activation of complement may be associated with the presence of HCV in blood and a lower rate of durable response after completion of interferon therapy.

Trichinella spiralis Paramyosin Binds to C8 and C9 and Protects the Tissue-Dwelling Nematode from Being Attacked by Host Complement

PubMed Central

Zhang, Zhifei; Yang, Jing; Wei, Junfei; Yang, Yaping; Chen, Xiaoqin; Zhao, Xi; Gu, Yuan; Cui, Shijuan; Zhu, Xinping

2011-01-01

Background Paramyosin is a thick myofibrillar protein found exclusively in invertebrates. Evidence suggested that paramyosin from helminths serves not only as a structural protein but also as an immunomodulatory agent. We previously reported that recombinant Trichinella spiralis paramyosin (Ts-Pmy) elicited a partial protective immunity in mice. In this study, the ability of Ts-Pmy to bind host complement components and protect against host complement attack was investigated. Methods and Findings In this study, the transcriptional and protein expression levels of Ts-Pmy were determined in T. spiralis newborn larva (NBL), muscle larva (ML) and adult worm developmental stages by RT-PCR and western blot analysis. Expression of Ts-Pmy at the outer membrane was observed in NBL and adult worms using immunogold electron microscopy and immunofluorescence staining. Functional analysis revealed that recombinant Ts-Pmy(rTs-Pmy) strongly bound to complement components C8 and C9 and inhibited the polymerization of C9 during the formation of the membrane attack complex (MAC). rTs-Pmy also inhibited the lysis of rabbit erythrocytes (ER) elicited by an alternative pathway-activated complement from guinea pig serum. Inhibition of native Ts-Pmy on the surface of NBL with a specific antiserum reduced larvae viability when under the attack of complement in vitro. In vivo passive transfer of anti-Ts-Pmy antiserum and complement-treated larvae into mice also significantly reduced the number of larvae that developed to ML. Conclusion These studies suggest that the outer membrane form of T. spiralis paramyosin plays an important role in the evasion of the host complement attack. PMID:21750743

Effect of Nanoparticles on Complement System in Cell Culture Model

DTIC Science & Technology

2006-09-15

case complement activation considerably differs between nanoparticles , being the highest in case of fullerene, ferric oxide and aluminium oxide ... oxide (CdO; 1 µm), manganese oxide (MnO2; 1-2 µm), and tungsten (W; 27 µm) were assessed. Additionally the effects of nanoparticles coated with...using in vitro system. Obtained results indicate that: 1. Nanoparticles toxicity in vitro can’t be measured using methods which were designed

A rapid microtiter plate serum bactericidal assay method for determining serum complement-mediated killing of Mannheimia haemolytica.

PubMed

Ayalew, Sahlu; Confer, Anthony W; Shrestha, Binu; Payton, Mark E

2012-05-01

In this study, we describe a rapid microtiter serum bactericidal assay (RMSBA) that can be used to measure the functionality of immune sera. It quantifies bactericidal activity of immune sera in the presence of complement against a homologous bacterium, M. haemolytica in this case. There is high correlation between data from RMSBA and standard complement-mediated bacterial killing assay (r=0.756; p<0.0001). The RMSBA activity of sera can be generated in less than 5 h instead of overnight incubation. RMSBA costs substantially less in terms of time, labor, and resources and is highly reproducible. Copyright © 2012 Elsevier B.V. All rights reserved.

The Mexican consensus on irritable bowel syndrome.

PubMed

Carmona-Sánchez, R; Icaza-Chávez, M E; Bielsa-Fernández, M V; Gómez-Escudero, O; Bosques-Padilla, F; Coss-Adame, E; Esquivel-Ayanegui, F; Flores-Rendón, Á R; González-Martínez, M A; Huerta-Iga, F; López-Colombo, A; Méndez-Gutiérrez, T H; Noble-Lugo, A; Nogueira-de Rojas, J R; Raña-Garibay, R H; Remes-Troche, J M; Roesch-Dietlen, F; Schmulson, M J; Soto-Pérez, J C; Tamayo, J L; Uscanga, L F; Valdovinos, M Á; Valerio-Ureña, J; Zavala-Solares, M R

2016-01-01

Since the publication in 2009 of the Guidelines on the Diagnosis and Treatment of Irritable Bowel Syndrome of the Asociación Mexicana de Gastroenterología (2009 Guidelines), there have been significant advances in our knowledge of the epidemiology, pathophysiology, diagnosis, and treatment of this disease. To present a consensus review of the most current knowledge of IBS, updating the 2009 Guidelines by incorporating new internationally published scientific evidence, with a special interest in Mexican studies. The PubMed literature from January 2009 to March 2015 was reviewed and complemented through a manual search. Articles in English and Spanish were included and preference was given to consensuses, guidelines, systematic reviews, and meta-analyses. Statements referring to the different aspects of the disease were formulated and voted upon by 24 gastroenterologists employing the Delphi method. Once a consensus on each statement was reached, the quality of evidence and strength of recommendation were determined through the GRADE system. Forty-eight statements were formulated, updating the information on IBS and adding the complementary data that did not appear in the 2009 Guidelines regarding the importance of exercise and diet, diagnostic strategies, and current therapy alternatives that were analyzed with more stringent scientific vigor or that emerged within the last 5 years. We present herein a consensus review of the most relevant advances in the study of IBS, updating and complementing the 2009 Guidelines. Several studies conducted in Mexico were included. Copyright © 2016 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

The Murine Factor H-Related Protein FHR-B Promotes Complement Activation.

PubMed

Cserhalmi, Marcell; Csincsi, Ádám I; Mezei, Zoltán; Kopp, Anne; Hebecker, Mario; Uzonyi, Barbara; Józsi, Mihály

2017-01-01

Factor H-related (FHR) proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH). While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3), and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM) extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.

Scabies Mite Peritrophins Are Potential Targets of Human Host Innate Immunity

PubMed Central

Holt, Deborah C.; Kemp, Dave J.; Fischer, Katja

2011-01-01

Background Pruritic scabies lesions caused by Sarcoptes scabiei burrowing in the stratum corneum of human skin facilitate opportunistic bacterial infections. Emerging resistance to current therapeutics emphasizes the need to identify novel targets for protective intervention. We have characterized several protein families located in the mite gut as crucial factors for host-parasite interactions. Among these multiple proteins inhibit human complement, presumably to avoid complement-mediated damage of gut epithelial cells. Peritrophins are major components of the peritrophic matrix often found in the gut of arthropods. We hypothesized that a peritrophin, if abundant in the scabies mite gut, could be an activator of complement. Methodology/Principal Findings A novel full length scabies mite peritrophin (SsPTP1) was identified in a cDNA library from scabies mites. The amino acid sequence revealed four putative chitin binding domains (CBD). Recombinant expression of one CBD of the highly repetitive SsPTP1 sequence as TSP-hexaHis-fusion protein resulted in soluble protein, which demonstrated chitin binding activity in affinity chromatography assays. Antibodies against a recombinant SsPTP1 fragment were used to immunohistochemically localize native SsPTP1 in the mite gut and in fecal pellets within the upper epidermis, co-localizing with serum components such as host IgG and complement. Enzymatic deglycosylation confirmed strong N- and O-glycosylation of the native peritrophin. Serum incubation followed by immunoblotting with a monoclonal antibody against mannan binding lectin (MBL), the recognition molecule of the lectin pathway of human complement activation, indicated that MBL may specifically bind to glycosylated SsPTP1. Conclusions/Significance This study adds a new aspect to the accumulating evidence that complement plays a major role in scabies mite biology. It identifies a novel peritrophin localized in the mite gut as a potential target of the lectin pathway of the complement cascade. These initial findings indicate a novel role of scabies mite peritrophins in triggering a host innate immune response within the mite gut. PMID:21980545

Taking Sides: An Integrative Review of the Impact of Laterality and Polarity on Efficacy of Therapeutic Transcranial Direct Current Stimulation for Anomia in Chronic Poststroke Aphasia

PubMed Central

Sandars, Margaret; Cloutman, Lauren; Woollams, Anna M.

2016-01-01

Anomia is a frequent and persistent symptom of poststroke aphasia, resulting from damage to areas of the brain involved in language production. Cortical neuroplasticity plays a significant role in language recovery following stroke and can be facilitated by behavioral speech and language therapy. Recent research suggests that complementing therapy with neurostimulation techniques may enhance functional gains, even amongst those with chronic aphasia. The current review focuses on the use of transcranial Direct Current Stimulation (tDCS) as an adjunct to naming therapy for individuals with chronic poststroke aphasia. Our survey of the literature indicates that combining therapy with anodal (excitatory) stimulation to the left hemisphere and/or cathodal (inhibitory) stimulation to the right hemisphere can increase both naming accuracy and speed when compared to the effects of therapy alone. However, the benefits of tDCS as a complement to therapy have not been yet systematically investigated with respect to site and polarity of stimulation. Recommendations for future research to help determine optimal protocols for combined therapy and tDCS are outlined. PMID:26819777

Methods for assessing the quality of data in public health information systems: a critical review.

PubMed

Chen, Hong; Yu, Ping; Hailey, David; Wang, Ning

2014-01-01

The quality of data in public health information systems can be ensured by effective data quality assessment. In order to conduct effective data quality assessment, measurable data attributes have to be precisely defined. Then reliable and valid measurement methods for data attributes have to be used to measure each attribute. We conducted a systematic review of data quality assessment methods for public health using major databases and well-known institutional websites. 35 studies were eligible for inclusion in the study. A total of 49 attributes of data quality were identified from the literature. Completeness, accuracy and timeliness were the three most frequently assessed attributes of data quality. Most studies directly examined data values. This is complemented by exploring either data users' perception or documentation quality. However, there are limitations of current data quality assessment methods: a lack of consensus on attributes measured; inconsistent definition of the data quality attributes; a lack of mixed methods for assessing data quality; and inadequate attention to reliability and validity. Removal of these limitations is an opportunity for further improvement.

Introduction to the Special Series: Current Directions for Measuring Parenting Constructs to Inform Prevention Science.

PubMed

Lindhiem, Oliver; Shaffer, Anne

2017-04-01

Parenting behaviors are multifaceted and dynamic and therefore challenging to quantify. Measurement methods have critical implications for study results, particularly for prevention trials designed to modify parenting behaviors. Although multiple approaches can complement one another and contribute to a more complete understanding of prevention trials, the assumptions and implications of each approach are not always clearly addressed. Greater attention to the measurement of complex constructs such as parenting is needed to advance the field of prevention science. This series examines the challenges of measuring changes in parenting behaviors in the context of prevention trials. All manuscripts in the special series address measurement issues and make practical recommendations for prevention researchers. Manuscripts in this special series include (1) empirical studies that demonstrate novel measurement approaches, (2) re-analyses of prevention trial outcome data directly comparing and contrasting two or more methods, and (3) a statistical primer and practical guide to analyzing proportion data.

Model study of imaging myocardial infarction by intracardiac electrical impedance tomography.

PubMed

Li, Ying; Rao, Liyun; Ling, Yuesheng; He, Renjie; Khoury, Dirar S

2008-01-01

Electrical impedance tomography (EIT) detects tissue composition inside a medium by determining its resistive properties, and uses various electrode configurations to pass a small electric current and measure corresponding potential. We investigated the feasibility of reconstructing scarred tissue inside the heart wall by employing EIT on the basis of a catheter carrying a plurality of electrodes and placed inside the blood-filled heart cavity. We built a computer model of the biological medium, and reconstructed the resistivity distribution using the finite element method and Tikhonov regularization. The results established the successful implementation of the numeric methods and the possibility of localizing and quantifying scarred myocardium. Novel application of EIT from inside the heart cavity could be useful during catheterization and may complement other diagnostic modalities. Further research is necessary to assess the impact of several factors on the accuracy of the reconstruction and include number of electrodes, catheter location, and scar size.

Dynamic nuclear polarization methods in solids and solutions to explore membrane proteins and membrane systems.

PubMed

Cheng, Chi-Yuan; Han, Songi

2013-01-01

Membrane proteins regulate vital cellular processes, including signaling, ion transport, and vesicular trafficking. Obtaining experimental access to their structures, conformational fluctuations, orientations, locations, and hydration in membrane environments, as well as the lipid membrane properties, is critical to understanding their functions. Dynamic nuclear polarization (DNP) of frozen solids can dramatically boost the sensitivity of current solid-state nuclear magnetic resonance tools to enhance access to membrane protein structures in native membrane environments. Overhauser DNP in the solution state can map out the local and site-specific hydration dynamics landscape of membrane proteins and lipid membranes, critically complementing the structural and dynamics information obtained by electron paramagnetic resonance spectroscopy. Here, we provide an overview of how DNP methods in solids and solutions can significantly increase our understanding of membrane protein structures, dynamics, functions, and hydration in complex biological membrane environments.

‘Someday it will be the norm’: physician perspectives on the utility of genome sequencing for patient care in the MedSeq Project

PubMed Central

Vassy, Jason L; Christensen, Kurt D; Slashinski, Melody J; Lautenbach, Denise M; Raghavan, Sridharan; Robinson, Jill Oliver; Blumenthal-Barby, Jennifer; Feuerman, Lindsay Zausmer; Lehmann, Lisa Soleymani; Murray, Michael F; Green, Robert C; McGuire, Amy L

2015-01-01

Aim To describe practicing physicians’ perceived clinical utility of genome sequencing. Materials & methods We conducted a mixed-methods analysis of data from 18 primary care physicians and cardiologists in a study of the clinical integration of whole-genome sequencing. Physicians underwent brief genomics continuing medical education before completing surveys and semi-structured interviews. Results Physicians described sequencing as currently lacking clinical utility because of its uncertain interpretation and limited impact on clinical decision-making, but they expressed the idea that its clinical integration was inevitable. Potential clinical uses for sequencing included complementing other clinical information, risk stratification, motivating patient behavior change and pharmacogenetics. Conclusion Physicians given genomics continuing medical education use the language of both evidence-based and personalized medicine in describing the utility of genome-wide testing in patient care. PMID:25642274

Molecular toolbox for the identification of unknown genetically modified organisms.

PubMed

Ruttink, Tom; Demeyer, Rolinde; Van Gulck, Elke; Van Droogenbroeck, Bart; Querci, Maddalena; Taverniers, Isabel; De Loose, Marc

2010-03-01

Competent laboratories monitor genetically modified organisms (GMOs) and products derived thereof in the food and feed chain in the framework of labeling and traceability legislation. In addition, screening is performed to detect the unauthorized presence of GMOs including asynchronously authorized GMOs or GMOs that are not officially registered for commercialization (unknown GMOs). Currently, unauthorized or unknown events are detected by screening blind samples for commonly used transgenic elements, such as p35S or t-nos. If (1) positive detection of such screening elements shows the presence of transgenic material and (2) all known GMOs are tested by event-specific methods but are not detected, then the presence of an unknown GMO is inferred. However, such evidence is indirect because it is based on negative observations and inconclusive because the procedure does not identify the causative event per se. In addition, detection of unknown events is hampered in products that also contain known authorized events. Here, we outline alternative approaches for analytical detection and GMO identification and develop new methods to complement the existing routine screening procedure. We developed a fluorescent anchor-polymerase chain reaction (PCR) method for the identification of the sequences flanking the p35S and t-nos screening elements. Thus, anchor-PCR fingerprinting allows the detection of unique discriminative signals per event. In addition, we established a collection of in silico calculated fingerprints of known events to support interpretation of experimentally generated anchor-PCR GM fingerprints of blind samples. Here, we first describe the molecular characterization of a novel GMO, which expresses recombinant human intrinsic factor in Arabidopsis thaliana. Next, we purposefully treated the novel GMO as a blind sample to simulate how the new methods lead to the molecular identification of a novel unknown event without prior knowledge of its transgene sequence. The results demonstrate that the new methods complement routine screening procedures by providing direct conclusive evidence and may also be useful to resolve masking of unknown events by known events.

Application of Rapid Visco Analyser (RVA) viscograms and chemometrics for maize hardness characterisation.

PubMed

Guelpa, Anina; Bevilacqua, Marta; Marini, Federico; O'Kennedy, Kim; Geladi, Paul; Manley, Marena

2015-04-15

It has been established in this study that the Rapid Visco Analyser (RVA) can describe maize hardness, irrespective of the RVA profile, when used in association with appropriate multivariate data analysis techniques. Therefore, the RVA can complement or replace current and/or conventional methods as a hardness descriptor. Hardness modelling based on RVA viscograms was carried out using seven conventional hardness methods (hectoliter mass (HLM), hundred kernel mass (HKM), particle size index (PSI), percentage vitreous endosperm (%VE), protein content, percentage chop (%chop) and near infrared (NIR) spectroscopy) as references and three different RVA profiles (hard, soft and standard) as predictors. An approach using locally weighted partial least squares (LW-PLS) was followed to build the regression models. The resulted prediction errors (root mean square error of cross-validation (RMSECV) and root mean square error of prediction (RMSEP)) for the quantification of hardness values were always lower or in the same order of the laboratory error of the reference method. Copyright © 2014 Elsevier Ltd. All rights reserved.

Eliminating Factor H-Binding Activity of Borrelia burgdorferi CspZ Combined with Virus-Like Particle Conjugation Enhances Its Efficacy as a Lyme Disease Vaccine.

PubMed

Marcinkiewicz, Ashley L; Lieknina, Ilva; Kotelovica, Svetlana; Yang, Xiuli; Kraiczy, Peter; Pal, Utpal; Lin, Yi-Pin; Tars, Kaspars

2018-01-01

The spirochete Borrelia burgdorferi is the causative agent of Lyme disease, the most common tick-borne disease in the US and Europe. No potent human vaccine is currently available. The innate immune complement system is vital to host defense against pathogens, as complement activation on the surface of spirochetes results in bacterial killing. Complement system is inhibited by the complement regulator factor H (FH). To escape killing, B. burgdorferi produces an outer surface protein CspZ that binds FH to inhibit complement activation on the cell surface. Immunization with CspZ alone does not protect mice from infection, which we speculate is because FH-binding cloaks potentially protective epitopes. We modified CspZ by conjugating to virus-like particles (VLP-CspZ) and eliminating FH binding (modified VLP-CspZ) to increase immunogenicity. We observed greater bactericidal antibody titers in mice vaccinated with modified VLP-CspZ: A serum dilution of 1:395 (modified VLP-CspZ) vs 1:143 (VLP-CspZ) yielded 50% borreliacidal activity. Immunizing mice with modified VLP-CspZ cleared spirochete infection, as did passive transfer of elicited antibodies. This work developed a novel Lyme disease vaccine candidate by conjugating CspZ to VLP and eliminating FH-binding ability. Such a strategy of conjugating an antigen to a VLP and eliminating binding to the target ligand can serve as a general model for developing vaccines against other bacterial infectious agents.

Activated complement components and complement activator molecules on the surface of cell‐derived microparticles in patients with rheumatoid arthritis and healthy individuals

PubMed Central

Biró, Éva; Nieuwland, Rienk; Tak, Paul P; Pronk, Loes M; Schaap, Marianne C L; Sturk, Augueste; Hack, C Erik

2007-01-01

Objectives In vitro, microparticles can activate complement via the classical pathway. If demonstrable ex vivo, this mechanism may contribute to the pathogenesis of rheumatoid arthritis (RA). We therefore investigated the presence of activated complement components and complement activator molecules on the surface of cell‐derived microparticles of RA patients and healthy individuals. Methods Microparticles from synovial fluid (n = 8) and plasma (n = 9) of 10 RA patients and plasma of sex‐ and age‐matched healthy individuals (n = 10) were analysed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C‐reactive protein (CRP), serum amyloid P component (SAP), immunoglobulin (Ig) M, IgG). Results Microparticles with bound C1q, C4, and/or C3 were abundant in RA synovial fluid, while in RA and control plasma much lower levels were present. Microparticles with bound C1q correlated with those with bound C3 in synovial fluid (r = 0.961, p = 0.0001), and with those with bound C4 in plasma (RA: r = 0.908, p = 0.0007; control: r = 0.632, p = 0.0498), indicating classical pathway activation. In synovial fluid, microparticles with IgM and IgG correlated with those with C1q (r = 0.728, p = 0.0408; r = 0.952, p = 0.0003, respectively), and in plasma, microparticles with CRP correlated with those with C1q (RA: r = 0.903, p = 0.0021; control: r = 0.683, p = 0.0296), implicating IgG and IgM in the classical pathway activation in RA synovial fluid, and CRP in the low level classical pathway activation in plasma. Conclusions This study demonstrates the presence of bound complement components and activator molecules on microparticles ex vivo, and supports their role in low grade complement activation in plasma and increased complement activation in RA synovial fluid. PMID:17261534

New Methods May Reduce Needs, Can't Replace Laboratory Animals

ERIC Educational Resources Information Center

Leeper, E. M.

1976-01-01

Discusses the symposium between the scientific community and the animal welfare community in which the consensus was absolute: new laboratory methods can complement but not replace intact animals. (LS)

A Review and Analysis of Remote Sensing Capability for Air Quality Measurements as a Potential Decision Support Tool Conducted by the NASA DEVELOP Program

NASA Technical Reports Server (NTRS)

Ross, A.; Richards, A.; Keith, K.; Frew, C.; Boseck, J.; Sutton, S.; Watts, C.; Rickman, D.

2007-01-01

This project focused on a comprehensive utilization of air quality model products as decision support tools (DST) needed for public health applications. A review of past and future air quality measurement methods and their uncertainty, along with the relationship of air quality to national and global public health, is vital. This project described current and future NASA satellite remote sensing and ground sensing capabilities and the potential for using these sensors to enhance the prediction, prevention, and control of public health effects that result from poor air quality. The qualitative uncertainty of current satellite remotely sensed air quality, the ground-based remotely sensed air quality, the air quality/public health model, and the decision making process is evaluated in this study. Current peer-reviewed literature suggests that remotely sensed air quality parameters correlate well with ground-based sensor data. A satellite remote-sensed and ground-sensed data complement is needed to enhance the models/tools used by policy makers for the protection of national and global public health communities

European Union funded project on the development of a whole complement deficiency screening ELISA-A story of success and an exceptional manager: Mohamed R. Daha.

PubMed

Würzner, Reinhard; Tedesco, Francesco; Garred, Peter; Mollnes, Tom Eirik; Truedsson, Lennart; Turner, Malcolm W; Sommarin, Yngve; Wieslander, Jörgen; Sim, Robert B

2015-11-01

A whole complement ELISA-based assay kit, primarily designed to screen for deficiencies in components of the complement system was developed during a European Union grant involving more than a dozen European scientists and a small-medium enterprise company (Wieslab, which later merged into Eurodiagnostica). The consortium was led by Prof. Mohamed R. Daha who had already guided a preceding European grant which prepared the ground for this endeavor to create a novel and sophisticated complement measurement tool. The final result of the grant was a scientific publication (Seelen et al., 2005, J. Immunol. Methods 296, 187-198) and a commercially available complement deficiency screening kit, WIESLAB(®) Complement system Screen. Thereafter, the group decided to carry on with a grant, located at Innsbruck Medical University, and supported by royalties and unrestricted educational grants from Eurodiagnostica, Malmö, entitled "Search for Applications for WIESLAB(®) Complement system Screen (SAW)" with the aim to look for further applications of this assay. During the latter project the group organized several scientific meetings aimed at evaluating the use of the assay as well as developing further branches of its platform. A look back over almost two decades reveals a great story of excellent research which was also commercially successful, fulfilling the aims of European Union grants. It is also a story of ageless friendship, only possible due to the vision and guidance of an exceptional manager: Moh Daha. Copyright © 2015 Elsevier Ltd. All rights reserved.

Preparation of Low Molecular Weight Chondroitin Sulfates, Screening of a High Anti-Complement Capacity of Low Molecular Weight Chondroitin Sulfate and Its Biological Activity Studies in Attenuating Osteoarthritis

PubMed Central

Li, Lian; Li, Yan; Feng, Danyang; Xu, Linghua; Yin, Fengxin; Zang, Hengchang; Liu, Chunhui; Wang, Fengshan

2016-01-01

Chondroitin sulfate (CS) plays important roles in the complement system. However, the CS structure is complicated due to different sources and the number and positions of sulfate groups. The objective of this study was to prepare different low molecular weight chondroitin sulfates (LMWCSs) and to investigate the biological activity in anti-complement capacity. A series of LMWCSs was prepared from different sources and characterized by ultraviolet-visible (UV) spectroscopy, high-performance liquid chromatography (HPLC), size exclusion chromatography-multiangle laser light scattering (SEC-MALLS) and nuclear magnetic resonance (NMR) spectroscopy. Hemolytic, anti-complement 3 deposition capacity and cell viability assays were carried out to investigate the biological activities in vitro. The results showed that LMWCS prepared from shark cartilage with the oxidative degradation method (LMWCS-S-O) had the best anti-complement capacity. LMWCS-S-O could inhibit the alternative pathway of the complement system and protect chondrocytes from cell death. The attenuating effect of LMWCS-S-O on Osteoarthritis (OA) was investigated by destabilization of the medial meniscus (DMM) model in vivo. Functional wind-up, histological and C5b-9 analyses were used to evaluate the treatment effect on the OA model. In vivo results showed that LMWCS-S-O could attenuate OA. LMWCS-S-O with a high content of ΔDi-2,6diS and ΔDi-6S could be used for attenuating OA through regulating the complement system. PMID:27727159

The in vivo mechanism of action of CD20 monoclonal antibodies depends on local tumor burden

PubMed Central

Boross, Peter; Jansen, J.H. Marco; de Haij, Simone; Beurskens, Frank J.; van der Poel, Cees E.; Bevaart, Lisette; Nederend, Maaike; Golay, Josée; van de Winkel, Jan G.J.; Parren, Paul W.H.I.; Leusen, Jeanette H.W.

2011-01-01

Background CD20 monoclonal antibodies are widely used in clinical practice. Antibody-dependent cellular cytotoxicity, complement-dependent cytotoxicity and direct cell death have been suggested to be important effector functions for CD20 antibodies. However, their specific contributions to the in vivo mechanism of action of CD20 immunotherapy have not been well defined. Design and Methods Here we studied the in vivo mechanism of action of type I (rituximab and ofatumumab) and type II (HuMab-11B8) CD20 antibodies in a peritoneal, syngeneic, mouse model with EL4-CD20 cells using low and high tumor burden. Results Interestingly, we observed striking differences in the in vivo mechanism of action of CD20 antibodies dependent on tumor load. In conditions of low tumor burden, complement was sufficient for tumor killing both for type I and type II CD20 antibodies. In contrast, in conditions of high tumor burden, activating FcγR (specifically FcγRIII), active complement and complement receptor 3 were all essential for tumor killing. Our data suggest that complement-enhanced antibody-dependent cellular cytotoxicity may critically affect tumor killing by CD20 antibodies in vivo. The type II CD20 antibody 11B8, which is a poor inducer of complement activation, was ineffective against high tumor burden. Conclusions Tumor burden affects the in vivo mechanism of action of CD20 antibodies. Low tumor load can be eliminated by complement alone, whereas elimination of high tumor load requires multiple effector mechanisms. PMID:21880632

Evolutionary Analysis of Heterochromatin Protein Compatibility by Interspecies Complementation in Saccharomyces

PubMed Central

Zill, Oliver A.; Scannell, Devin R.; Kuei, Jeffrey; Sadhu, Meru; Rine, Jasper

2012-01-01

The genetic bases for species-specific traits are widely sought, but reliable experimental methods with which to identify functionally divergent genes are lacking. In the Saccharomyces genus, interspecies complementation tests can be used to evaluate functional conservation and divergence of biological pathways or networks. Silent information regulator (SIR) proteins in S. bayanus provide an ideal test case for this approach because they show remarkable divergence in sequence and paralog number from those found in the closely related S. cerevisiae. We identified genes required for silencing in S. bayanus using a genetic screen for silencing-defective mutants. Complementation tests in interspecies hybrids identified an evolutionarily conserved Sir-protein-based silencing machinery, as defined by two interspecies complementation groups (SIR2 and SIR3). However, recessive mutations in S. bayanus SIR4 isolated from this screen could not be complemented by S. cerevisiae SIR4, revealing species-specific functional divergence in the Sir4 protein despite conservation of the overall function of the Sir2/3/4 complex. A cladistic complementation series localized the occurrence of functional changes in SIR4 to the S. cerevisiae and S. paradoxus branches of the Saccharomyces phylogeny. Most of this functional divergence mapped to sequence changes in the Sir4 PAD. Finally, a hemizygosity modifier screen in the interspecies hybrids identified additional genes involved in S. bayanus silencing. Thus, interspecies complementation tests can be used to identify (1) mutations in genetically underexplored organisms, (2) loci that have functionally diverged between species, and (3) evolutionary events of functional consequence within a genus. PMID:22923378

'Florida Radiance' strawberry

USDA-ARS?s Scientific Manuscript database

'Florida Radiance' strawberry (Fragaria xananassa Duch.) is a new strawberry cultivar released by the University of Florida. It appears to be a good cultivar to complement the current commercial cultivar 'Strawberry Festival' during the early part of the production season as its yields are higher wh...

Motivational Design in Information Literacy Instruction

ERIC Educational Resources Information Center

Hess, Amanda Nichols

2015-01-01

Motivational design theory complements instructional design theory and, when used together, both principles can affect learning, knowledge acquisition, and knowledge retention. In information literacy instruction, motivational design exists throughout the appropriate standards documents. However, there is limited current research on the best…

Gender Development

ERIC Educational Resources Information Center

Owen Blakemore, Judith E.; Berenbaum, Sheri A.; Liben, Lynn S.

2008-01-01

This new text offers a unique developmental focus on gender. Gender development is examined from infancy through adolescence, integrating biological, socialization, and cognitive perspectives. The book's current empirical focus is complemented by a lively and readable style that includes anecdotes about children's everyday experiences. The book's…

Cellulose Synthesis in Agrobacterium tumefaciens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alan R. White; Ann G. Matthysse

2004-07-31

We have cloned the celC gene and its homologue from E. coli, yhjM, in an expression vector and expressed the both genes in E. coli; we have determined that the YhjM protein is able to complement in vitro cellulose synthesis by extracts of A. tumefaciens celC mutants, we have purified the YhjM protein product and are currently examining its enzymatic activity; we have examined whole cell extracts of CelC and various other cellulose mutants and wild type bacteria for the presence of cellulose oligomers and cellulose; we have examined the ability of extracts of wild type and cellulose mutants includingmore » CelC to incorporate UDP-14C-glucose into cellulose and into water-soluble, ethanol-insoluble oligosaccharides; we have made mutants which synthesize greater amounts of cellulose than the wild type; and we have examined the role of cellulose in the formation of biofilms by A. tumefaciens. In addition we have examined the ability of a putative cellulose synthase gene from the tunicate Ciona savignyi to complement an A. tumefaciens celA mutant. The greatest difference between our knowledge of bacterial cellulose synthesis when we started this project and current knowledge is that in 1999 when we wrote the original grant very few bacteria were known to synthesize cellulose and genes involved in this synthesis were sequenced only from Acetobacter species, A. tumefaciens and Rhizobium leguminosarum. Currently many bacteria are known to synthesize cellulose and genes that may be involved have been sequenced from more than 10 species of bacteria. This additional information has raised the possibility of attempting to use genes from one bacterium to complement mutants in another bacterium. This will enable us to examine the question of which genes are responsible for the three dimensional structure of cellulose (since this differs among bacterial species) and also to examine the interactions between the various proteins required for cellulose synthesis. We have carried out one preliminary experiment of this type and have successfully complemented an A. tumefaciens CelC mutant with the homologous gene (yhjM) from E. coli.« less

Using Data Assimilation Methods of Prediction of Solar Activity

NASA Technical Reports Server (NTRS)

Kitiashvili, Irina N.; Collins, Nancy S.

2017-01-01

The variable solar magnetic activity known as the 11-year solar cycle has the longest history of solar observations. These cycles dramatically affect conditions in the heliosphere and the Earth's space environment. Our current understanding of the physical processes that make up global solar dynamics and the dynamo that generates the magnetic fields is sketchy, resulting in unrealistic descriptions in theoretical and numerical models of the solar cycles. The absence of long-term observations of solar interior dynamics and photospheric magnetic fields hinders development of accurate dynamo models and their calibration. In such situations, mathematical data assimilation methods provide an optimal approach for combining the available observational data and their uncertainties with theoretical models in order to estimate the state of the solar dynamo and predict future cycles. In this presentation, we will discuss the implementation and performance of an Ensemble Kalman Filter data assimilation method based on the Parker migratory dynamo model, complemented by the equation of magnetic helicity conservation and long-term sunspot data series. This approach has allowed us to reproduce the general properties of solar cycles and has already demonstrated a good predictive capability for the current cycle, 24. We will discuss further development of this approach, which includes a more sophisticated dynamo model, synoptic magnetogram data, and employs the DART Data Assimilation Research Testbed.

Numerical Modelling of Foundation Slabs with use of Schur Complement Method

NASA Astrophysics Data System (ADS)

Koktan, Jiří; Brožovský, Jiří

2017-10-01

The paper discusses numerical modelling of foundation slabs with use of advanced numerical approaches, which are suitable for parallel processing. The solution is based on the Finite Element Method with the slab-type elements. The subsoil is modelled with use of Winklertype contact model (as an alternative a multi-parameter model can be used). The proposed modelling approach uses the Schur Complement method to speed-up the computations of the problem. The method is based on a special division of the analyzed model to several substructures. It adds some complexity to the numerical procedures, especially when subsoil models are used inside the finite element method solution. In other hand, this method makes possible a fast solution of large models but it introduces further problems to the process. Thus, the main aim of this paper is to verify that such method can be successfully used for this type of problem. The most suitable finite elements will be discussed, there will be also discussion related to finite element mesh and limitations of its construction for such problem. The core approaches of the implementation of the Schur Complement Method for this type of the problem will be also presented. The proposed approach was implemented in the form of a computer program, which will be also briefly introduced. There will be also presented results of example computations, which prove the speed-up of the solution - there will be shown important speed-up of solution even in the case of on-parallel processing and the ability of bypass size limitations of numerical models with use of the discussed approach.

Synthesis meets theory: Past, present and future of rational chemistry

NASA Astrophysics Data System (ADS)

Fianchini, Mauro

2017-11-01

Chemical synthesis has its roots in the empirical approach of alchemy. Nonetheless, the birth of the scientific method, the technical and technological advances (exploiting revolutionary discoveries in physics) and the improved management and sharing of growing databases greatly contributed to the evolution of chemistry from an esoteric ground into a mature scientific discipline during these last 400 years. Furthermore, thanks to the evolution of computational resources, platforms and media in the last 40 years, theoretical chemistry has added to the puzzle the final missing tile in the process of "rationalizing" chemistry. The use of mathematical models of chemical properties, behaviors and reactivities is nowadays ubiquitous in literature. Theoretical chemistry has been successful in the difficult task of complementing and explaining synthetic results and providing rigorous insights when these are otherwise unattainable by experiment. The first part of this review walks the reader through a concise historical overview on the evolution of the "model" in chemistry. Salient milestones have been highlighted and briefly discussed. The second part focuses more on the general description of recent state-of-the-art computational techniques currently used worldwide by chemists to produce synergistic models between theory and experiment. Each section is complemented by key-examples taken from the literature that illustrate the application of the technique discussed therein.

A Novel Model to Simulate Flexural Complements in Compliant Sensor Systems

PubMed Central

Tang, Hongyan; Zhang, Dan; Guo, Sheng; Qu, Haibo

2018-01-01

The main challenge in analyzing compliant sensor systems is how to calculate the large deformation of flexural complements. Our study proposes a new model that is called the spline pseudo-rigid-body model (spline PRBM). It combines dynamic spline and the pseudo-rigid-body model (PRBM) to simulate the flexural complements. The axial deformations of flexural complements are modeled by using dynamic spline. This makes it possible to consider the nonlinear compliance of the system using four control points. Three rigid rods connected by two revolute (R) pins with two torsion springs replace the three lines connecting the four control points. The kinematic behavior of the system is described using Lagrange equations. Both the optimization and the numerical fitting methods are used for resolving the characteristic parameters of the new model. An example is given of a compliant mechanism to modify the accuracy of the model. The spline PRBM is important in expanding the applications of the PRBM to the design and simulation of flexural force sensors. PMID:29596377

Effects of Pectic Polysaccharides Isolated from Leek on the Production of Reactive Oxygen and Nitrogen Species by Phagocytes

PubMed Central

Nikolova, Mariana; Ambrozova, Gabriela; Kratchanova, Maria; Denev, Petko; Kussovski, Veselin; Ciz, Milan

2013-01-01

Abstract The current survey investigates the effect of four polysaccharides isolated from fresh leek or alcohol insoluble substances (AIS) of leek on the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) from phagocytes. The ability of the polysaccharides to activate serum complement was also investigated. Despite the lack of antioxidant activity, the pectic polysaccharides significantly decreased the production of ROS by human neutrophils. Polysaccharides isolated from AIS markedly activated RAW 264.7 macrophages for RNS production in a concentration-dependent manner. The Western blot analysis revealed that this effect was due to the stimulation of the inducible nitric oxide synthase protein expression of macrophages. The polysaccharides extracted from AIS with water showed the ability to fix serum complement, especially through the alternative pathway. It was found that the polysaccharide that has the highest complement-fixing effect is characterized by the highest content of uronic acids and the highest molecular weight. PMID:23905651

The Fanconi anemia pathway requires FAA phosphorylation and FAA/FAC nuclear accumulation

PubMed Central

Yamashita, Takayuki; Kupfer, Gary M.; Naf, Dieter; Suliman, Ahmed; Joenje, Hans; Asano, Shigetaka; D’Andrea, Alan D.

1998-01-01

Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with at least eight complementation groups (A–H). Two FA genes, corresponding to complementation groups A and C, have been cloned, but the function of the FAA and FAC proteins remains unknown. We have recently shown that the FAA and FAC proteins bind and form a nuclear complex. In the current study, we analyzed the FAA and FAC proteins in normal lymphoblasts and lymphoblasts from multiple FA complementation groups. In contrast to normal controls, FA cells derived from groups A, B, C, E, F, G, and H were defective in the formation of the FAA/FAC protein complex, the phosphorylation of the FAA protein, and the accumulation of the FAA/FAC protein complex in the nucleus. These biochemical events seem to define a signaling pathway required for the maintenance of genomic stability and normal hematopoiesis. Our results support the idea that multiple gene products cooperate in the FA Pathway. PMID:9789045

Measuring Security Effectiveness and Efficiency at U.S. Commercial Airports

DTIC Science & Technology

2013-03-01

formative program evaluation and policy analysis to investigate current airport security programs. It identifies innovative public administration and...policy-analysis tools that could provide potential benefits to airport security . These tools will complement the System Based Risk Management framework if

World Epidemiology Review, Number 79

DTIC Science & Technology

1977-02-09

currently in the same situation, paying tribute to the mentioned helminthiasis as a result of the basic influence of three factors: arrival of... helminthiasis in other states and, as a complement, to those actually infected locally and representing native threats, who are liable to increase the

Quantitative assessment of cellular uptake and cytosolic access of antibody in living cells by an enhanced split GFP complementation assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Ji-sun; Choi, Dong-Ki; Park, Seong-wook

Considering the number of cytosolic proteins associated with many diseases, development of cytosol-penetrating molecules from outside of living cells is highly in demand. To gain access to the cytosol after cellular uptake, cell-penetrating molecules should be released from intermediate endosomes prior to the lysosomal degradation. However, it is very challenging to distinguish the pool of cytosolic-released molecules from those trapped in the endocytic vesicles. Here we describe a method to directly demonstrate the cytosolic localization and quantification of cytosolic amount of a cytosol-penetrating IgG antibody, TMab4, based on enhanced split GFP complementation system. We generated TMab4 genetically fused with onemore » GFP fragment and separately established HeLa cells expressing the other GFP fragment in the cytosol such that the complemented GFP fluorescence is observed only when extracellular-treated TMab4 reaches the cytosol after cellular internalization. The high affinity interactions between streptavidin-binding peptide 2 and streptavidin was employed as respective fusion partners of GFP fragments to enhance the sensitivity of GFP complementation. With this method, cytosolic concentration of TMab4 was estimated to be about 170 nM after extracellular treatment of HeLa cells with 1 μM TMab4 for 6 h. We also found that after cellular internalization into living cells, nearly 1.3–4.3% of the internalized TMab4 molecules escaped into the cytosol from the endocytic vesicles. Our enhanced split GFP complementation assay provides a useful tool to directly quantify cytosolic amount of cytosol-penetrating agents and allows cell-based high-throughput screening for cytosol-penetrating agents with increased endosomal-escaping activity.« less

Quantitative assessment of cellular uptake and cytosolic access of antibody in living cells by an enhanced split GFP complementation assay.

PubMed

Kim, Ji-sun; Choi, Dong-Ki; Park, Seong-wook; Shin, Seung-Min; Bae, Jeomil; Kim, Dong-Myung; Yoo, Tae Hyeon; Kim, Yong-Sung

2015-11-27

Considering the number of cytosolic proteins associated with many diseases, development of cytosol-penetrating molecules from outside of living cells is highly in demand. To gain access to the cytosol after cellular uptake, cell-penetrating molecules should be released from intermediate endosomes prior to the lysosomal degradation. However, it is very challenging to distinguish the pool of cytosolic-released molecules from those trapped in the endocytic vesicles. Here we describe a method to directly demonstrate the cytosolic localization and quantification of cytosolic amount of a cytosol-penetrating IgG antibody, TMab4, based on enhanced split GFP complementation system. We generated TMab4 genetically fused with one GFP fragment and separately established HeLa cells expressing the other GFP fragment in the cytosol such that the complemented GFP fluorescence is observed only when extracellular-treated TMab4 reaches the cytosol after cellular internalization. The high affinity interactions between streptavidin-binding peptide 2 and streptavidin was employed as respective fusion partners of GFP fragments to enhance the sensitivity of GFP complementation. With this method, cytosolic concentration of TMab4 was estimated to be about 170 nM after extracellular treatment of HeLa cells with 1 μM TMab4 for 6 h. We also found that after cellular internalization into living cells, nearly 1.3-4.3% of the internalized TMab4 molecules escaped into the cytosol from the endocytic vesicles. Our enhanced split GFP complementation assay provides a useful tool to directly quantify cytosolic amount of cytosol-penetrating agents and allows cell-based high-throughput screening for cytosol-penetrating agents with increased endosomal-escaping activity. Copyright © 2015 Elsevier Inc. All rights reserved.

Atmospheric Balloon Swarms for Persistent In-Situ Measurements in Hurricanes

NASA Astrophysics Data System (ADS)

Meneghello, G.; Bewley, T.

2015-12-01

Real-time measurements within hurricanes are essential to improve forecasts, protect property and save lives. Current methods for obtaining in-situ data, including radar and satellite imagery as well as drop-sondes deployed from repeated aircraft flights above or even within the hurricane itself, are costly, dangerous and limited in duration or resolution. We demonstrate how a swarm of inexpensive, buoyancy-controlled, sensor-laden balloons can be deployed from altitude or from sea-level within a hurricane flow field, and coordinated autonomously in an energetically-efficient fashion to persistently and continuously monitor relevant properties (pressure, humidity, temperature, windspeed) of a hurricane for days at a time. Rather than fighting the gale-force winds in the storm, the strong, predictable stratification of these winds is leveraged to disperse the balloons into a favorable, time-evolving distribution and to follow the hurricane track as it moves. Certain target orbits of interest in the hurricane can be continuously sampled by some balloons, while other balloons make continuous sweeps between the eye and the spiral rain bands. We expect the acquired data to complement current measurement methods and to be instrumental in improving the numerical models' forecast skills.

Bimolecular fluorescence complementation: visualization of molecular interactions in living cells.

PubMed

Kerppola, Tom K

2008-01-01

A variety of experimental methods have been developed for the analysis of protein interactions. The majority of these methods either require disruption of the cells to detect molecular interactions or rely on indirect detection of the protein interaction. The bimolecular fluorescence complementation (BiFC) assay provides a direct approach for the visualization of molecular interactions in living cells and organisms. The BiFC approach is based on the facilitated association between two fragments of a fluorescent protein when the fragments are brought together by an interaction between proteins fused to the fragments. The BiFC approach has been used for visualization of interactions among a variety of structurally diverse interaction partners in many different cell types. It enables detection of transient complexes as well as complexes formed by a subpopulation of the interaction partners. It is essential to include negative controls in each experiment in which the interface between the interaction partners has been mutated or deleted. The BiFC assay has been adapted for simultaneous visualization of multiple protein complexes in the same cell and the competition for shared interaction partners. A ubiquitin-mediated fluorescence complementation assay has also been developed for visualization of the covalent modification of proteins by ubiquitin family peptides. These fluorescence complementation assays have a great potential to illuminate a variety of biological interactions in the future.

Challenges and opportunities of using liquid chromatography and mass spectrometry methods to develop complex vaccine antigens as pharmaceutical dosage forms.

PubMed

Hickey, John M; Sahni, Neha; Toth, Ronald T; Kumru, Ozan S; Joshi, Sangeeta B; Middaugh, C Russell; Volkin, David B

2016-10-01

Liquid chromatographic methods, combined with mass spectrometry, offer exciting and important opportunities to better characterize complex vaccine antigens including recombinant proteins, virus-like particles, inactivated viruses, polysaccharides, and protein-polysaccharide conjugates. The current abilities and limitations of these physicochemical methods to complement traditional in vitro and in vivo vaccine potency assays are explored in this review through the use of illustrative case studies. Various applications of these state-of-the art techniques are illustrated that include the analysis of influenza vaccines (inactivated whole virus and recombinant hemagglutinin), virus-like particle vaccines (human papillomavirus and hepatitis B), and polysaccharide linked to protein carrier vaccines (pneumococcal). Examples of utilizing these analytical methods to characterize vaccine antigens in the presence of adjuvants, which are often included to boost immune responses as part of the final vaccine dosage form, are also presented. Some of the challenges of using chromatographic and LC-MS as physicochemical assays to routinely test complex vaccine antigens are also discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

Autonomous aerial observations to extend and complement the Earth Observing System: a science-driven systems-oriented approach

NASA Astrophysics Data System (ADS)

Sandford, Stephen P.; Harrison, F. W.; Langford, John; Johnson, James W.; Qualls, Garry; Emmitt, David; Jones, W. Linwood; Shugart, Herman H., Jr.

2004-12-01

The current Earth observing capability depends primarily on spacecraft missions and ground-based networks to provide the critical on-going observations necessary for improved understanding of the Earth system. Aircraft missions play an important role in process studies but are limited to relatively short-duration flights. Suborbital observations have contributed to global environmental knowledge by providing in-depth, high-resolution observations that space-based and in-situ systems are challenged to provide; however, the limitations of aerial platforms - e.g., limited observing envelope, restrictions associated with crew safety and high cost of operations have restricted the suborbital program to a supporting role. For over a decade, it has been recognized that autonomous aerial observations could potentially be important. Advances in several technologies now enable autonomous aerial observation systems (AAOS) that can provide fundamentally new observational capability for Earth science and applications and thus lead scientists and engineers to rethink how suborbital assets can best contribute to Earth system science. Properly developed and integrated, these technologies will enable new Earth science and operational mission scenarios with long term persistence, higher-spatial and higher-temporal resolution at lower cost than space or ground based approaches. This paper presents the results of a science driven, systems oriented study of broad Earth science measurement needs. These needs identify aerial mission scenarios that complement and extend the current Earth Observing System. These aerial missions are analogous to space missions in their complexity and potential for providing significant data sets for Earth scientists. Mission classes are identified and presented based on science driven measurement needs in atmospheric, ocean and land studies. Also presented is a nominal concept of operations for an AAOS: an innovative set of suborbital assets that complements and augments current and planned space-based observing systems.

Diagnostic approaches for diabetic cardiomyopathy and myocardial fibrosis

PubMed Central

Maya, Lisandro; Villarreal, Francisco J.

2009-01-01

In diabetes mellitus, alterations in cardiac structure/function in the absence of ischemic heart disease, hypertension or other cardiac pathologies is termed diabetic cardiomyopathy. In the United States, the prevalence of diabetes mellitus continues to rise and the disease currently affects about 8% of the general population. Hence, it is imperative the use of appropriate diagnostic strategies for diabetic cardiomyopathy, which may help correctly identify the disease at early stages and implement suitable corrective therapies. Currently, there is no single diagnostic method for the identification of diabetic cardiomyopathy. Diabetic cardiomyopathy is known to induce changes in cardiac structure such as, myocardial hypertrophy, fibrosis and fat droplet deposition. Early changes in cardiac function are typically manifested as abnormal diastolic function that with time leads to loss of contractile function. Echocardiography based methods currently stands as the preferred diagnostic approach for diabetic cardiomyopathy, due to its wide availability and economical use. In addition to conventional techniques, magnetic resonance imaging and spectroscopy along with contrast agents are now leading new approaches in the diagnosis of myocardial fibrosis, and cardiac and hepatic metabolic changes. These strategies can be complemented with serum biomarkers so they can offer a clear picture as to diabetes-induced changes in cardiac structure/function even at very early stages of the disease. This review article intends to provide a summary of experimental and routine tools currently available to diagnose diabetic cardiomyopathy induced changes in cardiac structure/function. These tools can be reliably used in either experimental models of diabetes or for clinical applications. PMID:19595694

Management of diabetes and diabetes policies in Turkey

PubMed Central

2013-01-01

Background Diabetes and its complications are among the present and future challenges of the Turkish health care system. The objective of this paper is to discuss the current situation of diabetes and its management in Turkey with special emphasis on the changing policy environment. Methods A literature review in databases such as PUBMED was performed from 2000 to 2011. This synthesis was complemented by grey literature, personal communication and contact with national and provincial health authorities and experts in diabetes from Turkey. Results The literature review and expert consultations indicated a growing policy emphasis on diabetes. Both the public and private sectors, non-governmental organizations have initiated policy papers to shape the outlook of diabetes care in the future. This is in line with the current dynamics of the healthcare system. Conclusions Diabetes care will be high on the agenda in future. Evidence based policy-making is the key to implement the policies adopted so far and a supportive environment is needed. PMID:23597065

Post space mission lumbo-pelvic neuromuscular reconditioning: a European perspective.

PubMed

Evetts, Simon N; Caplan, Nick; Debuse, Dorothée; Lambrecht, Gunda; Damann, Volker; Petersen, Nora; Hides, Julie

2014-07-01

Long-duration exposure to the space environment causes physical adaptations that are deleterious to optimal functioning on Earth. Post-mission rehabilitation traditionally concentrates on regaining general muscle strength, neuromuscular control, and lumbo-pelvic stability. A particular problem is muscle imbalance caused by the hypertrophy of the flexor and atrophy of the extensor and local lumbo-pelvic muscles, increasing the risk of post-mission injury. A method currently used in European human spaceflight to aid post-mission recovery involves a motor control approach, focusing initially on teaching voluntary contraction of specific lumbo-pelvic muscles and optimizing spinal position, progressing to functional retraining in weight bearing positions. An alternative approach would be to use a Functional Readaptive Exercise Device to appropriately recruit this musculature, thus complementing current rehabilitation programs. Advances in post-mission recovery of this nature may both improve astronaut healthcare and aid terrestrial healthcare through more effective treatment of low back pain and accelerated post bed rest rehabilitation.

Words are not enough: nonword repetition as an indicator of arcuate fasciculus integrity during brain tumor resection.

PubMed

Sierpowska, Joanna; Gabarrós, Andreu; Fernandez-Coello, Alejandro; Camins, Àngels; Castañer, Sara; Juncadella, Montserrat; Morís, Joaquín; Rodríguez-Fornells, Antoni

2017-02-01

OBJECTIVE Subcortical electrical stimulation during brain surgery may allow localization of functionally crucial white matter fibers and thus tailoring of the tumor resection according to its functional limits. The arcuate fasciculus (AF) is a white matter bundle connecting frontal, temporal, and parietal cortical areas that is often disrupted by left brain lesions. It plays a critical role in several cognitive functions related to phonological processing, but current intraoperative monitoring methods do not yet allow mapping of this tract with sufficient precision. In the present study the authors aimed to test a new paradigm for the intraoperative monitoring of the AF. METHODS In this report, the authors studied 12 patients undergoing awake brain surgery for tumor resection with a related risk of AF damage. To preserve AF integrity and the cognitive processes sustained by this tract in the intraoperative context, the authors used real word repetition (WR) and nonword repetition (NWR) tasks as complements to standard picture naming. RESULTS Compared with the errors identified by WR or picture naming, the NWR task allowed the detection of subtle errors possibly related to AF alterations. Moreover, only 3 patients demonstrated phonological paraphasias in standard picture naming, and in 2 of these patients the paraphasias co-occurred with the total loss of WR and NWR ability. Before surgery, lesion volume predicted a patient's NWR performance. CONCLUSIONS The authors suggest that monitoring NWR intraoperatively may complement the standard naming tasks and could permit better preservation of the important language production functions subserved by the AF.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This manual of the Chemical Hazard Response Information System (CHRIS) has been developed to present current information and assist on-scene coordinators (OSC) on techniques, equipment, and systems that are available to combat and minimize the damage that can be expected when a hazardous chemical is discharged into navigable waters. The handbook describes the content and use of CHRIS and discusses the causes of accidental discharges of hazardous chemicals. It provides a quick reference guide to the selection of response methods and describes these methods in detail. The handbook is also complemented by an appendix containing a review of the state-of-the-artmore » response equipment and systems and a comprehensive catalogue of response equipment. In this handbook response methods are divided into two categories: cautionary and corrective. Cautionary responses, which should be promptly applied to preserve human and animal life, include restricting entry into the area affected by the discharge and use of the water polluted by the discharge, as well as evacuation of threatened areas. Corrective responses include methods of stopping or reducing a further discharge of the chemical, containment procedures, and methods of collection, recovery, and treatment. Methods of cleaning an affected shoreline and treatment of an exposed waterfront are also described.« less

Complement component C5a mediates hemorrhage-induced intestinal damage

PubMed Central

Fleming, Sherry D.; Phillips, Lauren M.; Lambris, John D.; Tsokos, George C.

2008-01-01

Background Complement has been implicated in the pathogenesis of intestinal damage and inflammation in multiple animal models. Although the exact mechanism is unknown, inhibition of complement prevents hemodynamic alterations in hemorrhage. Materials/Methods C57Bl/6, complement 5 deficient (C5−/−) and sufficient (C5+/+) mice were subjected to 25% blood loss. In some cases, C57Bl/6 mice were treated with C5a receptor antagonist (C5aRa) post-hemorrhage. Intestinal injury, leukotriene B4, and myeloperoxidase production were assessed for each treatment group of mice. Results Mice subjected to significant blood loss without major trauma develop intestinal inflammation and tissue damage within two hours. We report here that complement 5 (C5) deficient mice are protected from intestinal tissue damage when subjected to hemorrhage (Injury score = 0.36 compared to wildtype hemorrhaged animal injury score = 2.89; p<0.05). We present evidence that C5a represents the effector molecule because C57Bl/6 mice treated with a C5a receptor antagonist displayed limited intestinal injury (Injury score = 0.88), leukotriene B4 (13.16 pg/mg tissue) and myeloperoxidase (115.6 pg/mg tissue) production compared to hemorrhaged C57Bl/6 mice (p<0.05). Conclusion Complement activation is important in the development of hemorrhage-induced tissue injury and C5a generation is critical for tissue inflammation and damage. Thus, therapeutics targeting C5a may be useful therapeutics for hemorrhage-associated injury. PMID:18639891

23 CFR 511.311 - Real-time information program establishment.

Code of Federal Regulations, 2011 CFR

2011-04-01

... INFRASTRUCTURE MANAGEMENT REAL-TIME SYSTEM MANAGEMENT INFORMATION PROGRAM Real-Time System Management Information... operated by the State. In addition, the real-time information program shall complement current... 23 Highways 1 2011-04-01 2011-04-01 false Real-time information program establishment. 511.311...

23 CFR 511.311 - Real-time information program establishment.

Code of Federal Regulations, 2014 CFR

2014-04-01

... INFRASTRUCTURE MANAGEMENT REAL-TIME SYSTEM MANAGEMENT INFORMATION PROGRAM Real-Time System Management Information... operated by the State. In addition, the real-time information program shall complement current... 23 Highways 1 2014-04-01 2014-04-01 false Real-time information program establishment. 511.311...

23 CFR 511.311 - Real-time information program establishment.

Code of Federal Regulations, 2013 CFR

2013-04-01

... INFRASTRUCTURE MANAGEMENT REAL-TIME SYSTEM MANAGEMENT INFORMATION PROGRAM Real-Time System Management Information... operated by the State. In addition, the real-time information program shall complement current... 23 Highways 1 2013-04-01 2013-04-01 false Real-time information program establishment. 511.311...

23 CFR 511.311 - Real-time information program establishment.

Code of Federal Regulations, 2012 CFR

2012-04-01

... INFRASTRUCTURE MANAGEMENT REAL-TIME SYSTEM MANAGEMENT INFORMATION PROGRAM Real-Time System Management Information... operated by the State. In addition, the real-time information program shall complement current... 23 Highways 1 2012-04-01 2012-04-01 false Real-time information program establishment. 511.311...

21st Century Water Asset Accounting - Case Studies Report (WERF Report INFR6R12a)

EPA Science Inventory

America’s decaying water infrastructure presents significant financial and logistical challenges for water utilities. Green infrastructure has been gaining traction as a viable alternative and complement to traditional “grey” infrastructure for water management. Current accounti...

Student Development and Campus Ecology: A Rapprochement.

ERIC Educational Resources Information Center

Hurst, James C.

1987-01-01

Investigates campus ecology from several innovative perspectives, considering both theory and practice. Conceptualizes current functions of the student affairs administrator playing a key role in higher education and articulates how campus ecology and student development theories complement each other when applied through a systems approach to…

Regional gene mapping using mixed radiation hybrids and reverse chromosome painting.

PubMed

Lin, J Y; Bedford, J S

1997-11-01

We describe a new approach for low-resolution physical mapping using pooled DNA probe from mixed (non-clonal) populations of human-CHO cell hybrids and reverse chromosome painting. This mapping method is based on a process in which the human chromosome fragments bearing a complementing gene were selectively retained in a large non-clonal population of CHO-human hybrid cells during a series of 12- to 15-Gy gamma irradiations each followed by continuous growth selection. The location of the gene could then be identified by reverse chromosome painting on normal human metaphase spreads using biotinylated DNA from this population of "enriched" hybrid cells. We tested the validity of this method by correctly mapping the complementing human HPRT gene, whose location is well established. We then demonstrated the method's usefulness by mapping the chromosome location of a human gene which complemented the defect responsible for the hypersensitivity to ionizing radiation in CHO irs-20 cells. This method represents an efficient alternative to conventional concordance analysis in somatic cell hybrids where detailed chromosome analysis of numerous hybrid clones is necessary. Using this approach, it is possible to localize a gene for which there is no prior sequence or linkage information to a subchromosomal region, thus facilitating association with known mapping landmarks (e.g. RFLP, YAC or STS contigs) for higher-resolution mapping.

Battery Capacity Fading Estimation Using a Force-Based Incremental Capacity Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samad, Nassim A.; Kim, Youngki; Siegel, Jason B.

Traditionally health monitoring techniques in lithium-ion batteries rely on voltage and current measurements. A novel method of using a mechanical rather than electrical signal in the incremental capacity analysis (ICA) method is introduced in this paper. This method derives the incremental capacity curves based onmeasured force (ICF) instead of voltage (ICV). The force ismeasured on the surface of a cell under compression in a fixture that replicates a battery pack assembly and preloading. The analysis is performed on data collected from cycling encased prismatic Lithium-ion Nickel-Manganese-Cobalt Oxide (NMC) cells. For the NMC chemistry, the ICF method can complement or replacemore » the ICV method for the following reasons. The identified ICV peaks are centered around 40% of state of charge (SOC) while the peaks of the ICF method are centered around 70% of SOC indicating that the ICF can be used more often because it is more likely that an electric vehicle (EV) or a plug-in hybrid electric vehicle (PHEV) will traverse the 70% SOC range than the 40% SOC. In addition the Signal to Noise ratio (SNR) of the force signal is four times larger than the voltage signal using laboratory grade sensors. The proposed ICF method is shown to achieve 0.42% accuracy in capacity estimation during a low C-rate constant current discharge. Future work will investigate the application of the capacity estimation technique under charging and operation under high C-rates by addressing the transient behavior of force so that an online methodology for capacity estimation is developed.« less

Battery Capacity Fading Estimation Using a Force-Based Incremental Capacity Analysis

DOE PAGES

Samad, Nassim A.; Kim, Youngki; Siegel, Jason B.; ...

2016-05-27

Traditionally health monitoring techniques in lithium-ion batteries rely on voltage and current measurements. A novel method of using a mechanical rather than electrical signal in the incremental capacity analysis (ICA) method is introduced in this paper. This method derives the incremental capacity curves based onmeasured force (ICF) instead of voltage (ICV). The force ismeasured on the surface of a cell under compression in a fixture that replicates a battery pack assembly and preloading. The analysis is performed on data collected from cycling encased prismatic Lithium-ion Nickel-Manganese-Cobalt Oxide (NMC) cells. For the NMC chemistry, the ICF method can complement or replacemore » the ICV method for the following reasons. The identified ICV peaks are centered around 40% of state of charge (SOC) while the peaks of the ICF method are centered around 70% of SOC indicating that the ICF can be used more often because it is more likely that an electric vehicle (EV) or a plug-in hybrid electric vehicle (PHEV) will traverse the 70% SOC range than the 40% SOC. In addition the Signal to Noise ratio (SNR) of the force signal is four times larger than the voltage signal using laboratory grade sensors. The proposed ICF method is shown to achieve 0.42% accuracy in capacity estimation during a low C-rate constant current discharge. Future work will investigate the application of the capacity estimation technique under charging and operation under high C-rates by addressing the transient behavior of force so that an online methodology for capacity estimation is developed.« less

Plasma complement and vascular complement deposition in patients with coronary artery disease with and without inflammatory rheumatic diseases

PubMed Central

2017-01-01

Purpose Inflammatory rheumatic diseases (IRD) are associated with accelerated coronary artery disease (CAD), which may result from both systemic and vascular wall inflammation. There are indications that complement may be involved in the pathogenesis of CAD in Systemic Lupus Erythematosus (SLE) and Rheumatoid Arthritis (RA). This study aimed to evaluate the associations between circulating complement and complement activation products with mononuclear cell infiltrates (MCI, surrogate marker of vascular inflammation) in the aortic media and adventitia in IRDCAD and non-IRDCAD patients undergoing coronary artery bypass grafting (CABG). Furthermore, we compared complement activation product deposition patterns in rare aorta adventitial and medial biopsies from SLE, RA and non-IRD patients. Methods We examined plasma C3 (p-C3) and terminal complement complexes (p-TCC) in 28 IRDCAD (SLE = 3; RA = 25), 52 non-IRDCAD patients, and 32 IRDNo CAD (RA = 32) from the Feiring Heart Biopsy Study. Aortic biopsies taken from the CAD only patients during CABG were previously evaluated for adventitial MCIs. The rare aortic biopsies from 3 SLE, 3 RA and 3 non-IRDCAD were assessed for the presence of C3 and C3d using immunohistochemistry. Results IRDCAD patients had higher p-TCC than non-IRDCAD or IRDNo CAD patients (p<0.0001), but a similar p-C3 level (p = 0.42). Circulating C3 was associated with IRD duration (ρ, p-value: 0.46, 0.03). In multiple logistic regression analysis, IRD remained significantly related to the presence and size of MCI (p<0.05). C3 was present in all tissue samples. C3d was detected in the media of all patients and only in the adventitia of IRD patients (diffuse in all SLE and focal in one RA). Conclusion The independent association of IRD status with MCI and the observed C3d deposition supports the unique relationship between rheumatic disease, and, in particular, SLE with the complement system. Exaggerated systemic and vascular complement activation may accelerate CVD, serve as a CVD biomarker, and represent a target for new therapies. PMID:28362874

The European Drought Observatory (EDO): Current State and Future Directions

NASA Astrophysics Data System (ADS)

Vogt, Jürgen; Sepulcre, Guadalupe; Magni, Diego; Valentini, Luana; Singleton, Andrew; Micale, Fabio; Barbosa, Paulo

2013-04-01

Europe has repeatedly been affected by droughts, resulting in considerable ecological and economic damage and climate change studies indicate a trend towards increasing climate variability most likely resulting in more frequent drought occurrences also in Europe. Against this background, the European Commission's Joint Research Centre (JRC) is developing methods and tools for assessing, monitoring and forecasting droughts in Europe and develops a European Drought Observatory (EDO) to complement and integrate national activities with a European view. At the core of the European Drought Observatory (EDO) is a portal, including a map server, a metadata catalogue, a media-monitor and analysis tools. The map server presents Europe-wide up-to-date information on the occurrence and severity of droughts, which is complemented by more detailed information provided by regional, national and local observatories through OGC compliant web mapping and web coverage services. In addition, time series of historical maps as well as graphs of the temporal evolution of drought indices for individual grid cells and administrative regions in Europe can be retrieved and analysed. Current work is focusing on validating the available products, developing combined indicators, improving the functionalities, extending the linkage to additional national and regional drought information systems and testing options for medium-range probabilistic drought forecasting across Europe. Longer-term goals include the development of long-range drought forecasting products, the analysis of drought hazard and risk, the monitoring of drought impact and the integration of EDO in a global drought information system. The talk will provide an overview on the development and state of EDO, the different products, and the ways to include a wide range of stakeholders (i.e. European, national river basin, and local authorities) in the development of the system as well as an outlook on the future developments.

Understanding the relationships between the physical environment and physical activity in older adults: a systematic review of qualitative studies.

PubMed

Moran, Mika; Van Cauwenberg, Jelle; Hercky-Linnewiel, Rachel; Cerin, Ester; Deforche, Benedicte; Plaut, Pnina

2014-07-17

While physical activity (PA) provides many physical, social, and mental health benefits for older adults, they are the least physically active age group. Ecological models highlight the importance of the physical environment in promoting PA. However, results of previous quantitative research revealed inconsistencies in environmental correlates of older adults' PA that may be explained by methodological issues. Qualitative studies can inform and complement quantitative research on environment-PA relationships by providing insight into how and why the environment influences participants' PA behaviors. The current study aimed to provide a systematic review of qualitative studies exploring the potential impact of the physical environment on older adults' PA behaviors. A systematic search was conducted in databases of various disciplines, including: health, architecture and urban planning, transportation, and interdisciplinary databases. From 3,047 articles identified in the physical activity, initial search, 31 articles published from 1996 to 2012 met all inclusion criteria. An inductive content analysis was performed on the extracted findings to identify emerging environmental elements related to older adults' PA. The identified environmental elements were then grouped by study methodologies [indoor interviews (individual or focus groups) vs spatial methods (photo-voice, observations, walk-along interviews)]. This review provides detailed information about environmental factors that potentially influence older adults' PA behaviors. These factors were categorized into five themes: pedestrian infrastructure, safety, access to amenities, aesthetics, and environmental conditions. Environmental factors especially relevant to older adults (i.e., access to facilities, green open spaces and rest areas) tended to emerge more frequently in studies that combined interviews with spatial qualitative methods. Findings showed that qualitative research can provide in-depth information on environmental elements that influence older adults' PA. Future qualitative studies on the physical environment and older adults' PA would benefit from combining interviews with more spatially-oriented methods. Multidisciplinary mixed-methods studies are recommended to establish quantitative relationships complemented with in-depth qualitative information.

In Vitro Toxicity Assessment Technique for Volatile ...

EPA Pesticide Factsheets

The U.S. Environmental Protection Agency is tasked with evaluating the human health, environmental, and wildlife effects of over 80,000 chemicals registered for use in the environment and commerce. The challenge is that sparse chemical data exists; traditional toxicity testing methods are slow, costly, involve animal studies, and cannot keep up with a chemical registry that typically grows by at least 1000 chemicals every year. In recent years, High Throughput Screening (HTS) has been used in order to prioritize chemicals for traditional toxicity screening or to complement traditional toxicity studies. HTS is an in vitro approach of rapidly assaying a large number of chemicals for biochemical activity using robotics and automation. However, no method currently exists for screening volatile chemicals such as air pollutants in a HTS fashion. Additionally, significant uncertainty regarding in vitro to in in vivo extrapolation (IVIVE) remains. An approach to bridge the IVIVE gap and the current lack of ability to screen volatile chemicals in a HTS fashion is by using a probe molecule (PrM) technique. The proposed technique uses chemicals with empirical human pharmacokinetic data as PrMs to study toxicity of molecules with no known data for gas-phase analysis. We are currently studying the xenobiotic-metabolizing enzyme CYP2A6 using transfected BEAS-2B bronchial epithelial cell line. The CYP2A6 pathway activity is studied by the formation of cotinine from nicot

Plasma-based proteomics reveals immune response, complement and coagulation cascades pathway shifts in heat-stressed lactating dairy cows.

PubMed

Min, Li; Cheng, Jianbo; Zhao, Shengguo; Tian, He; Zhang, Yangdong; Li, Songli; Yang, Hongjian; Zheng, Nan; Wang, Jiaqi

2016-09-02

Heat stress (HS) has an enormous economic impact on the dairy industry. In recent years, many researchers have investigated changes in the gene expression and metabolomics profiles in dairy cows caused by HS. However, the proteomics profiles of heat-stressed dairy cows have not yet been completely elucidated. We compared plasma proteomics from HS-free and heat-stressed dairy cows using an iTRAQ labeling approach. After the depletion of high abundant proteins in the plasma, 1472 proteins were identified. Of these, 85 proteins were differentially abundant in cows exposed to HS relative to HS-free. Database searches combined with GO and KEGG pathway enrichment analyses revealed that many components of the complement and coagulation cascades were altered in heat-stressed cows compared with HS-free cows. Of these, many factors in the complement system (including complement components C1, C3, C5, C6, C7, C8, and C9, complement factor B, and factor H) were down-regulated by HS, while components of the coagulation system (including coagulation factors, vitamin K-dependent proteins, and fibrinogens) were up-regulated by HS. In conclusion, our results indicate that HS decreases plasma levels of complement system proteins, suggesting that immune function is impaired in dairy cows exposed to HS. Though many aspects of heat stress (HS) have been extensively researched, relatively little is known about the proteomics profile changes that occur during heat exposure. In this work, we employed a proteomics approach to investigate differential abundance of plasma proteins in HS-free and heat-stressed dairy cows. Database searches combined with GO and KEGG pathway enrichment analyses revealed that HS resulted in a decrease in complement components, suggesting that heat-stressed dairy cows have impaired immune function. In addition, through integrative analyses of proteomics and previous metabolomics, we showed enhanced glycolysis, lipid metabolic pathway shifts, and nitrogen repartitioning in dairy cows exposed to HS. Our findings expand our current knowledge on the effects of HS on plasma proteomics in dairy cows and offer a new perspective for future research. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation and reporting of enzyme immunoassay determinations of antibody to herpes simplex virus in sera and cerebrospinal fluid.

PubMed Central

Cremer, N E; Cossen, C K; Hanson, C V; Shell, G R

1982-01-01

Several methods for evaluating and reporting enzyme immunoassay (EIA) determinations of antibody to herpes simplex virus derived from one dilution of single serum samples were studied. An EIA ratio method for serological evidence of current infection from paired serum samples was also evaluated. Optical density (OD) of the reaction at a 1:100 serum dilution and estimated titers obtained by reference of the OD of the serum dilution to a standard curve were compared to the corresponding plotted EIA titer obtained by titration to endpoint. Neither the OD per se nor the estimated titer was completely predictive of the plotted titer (correlation coefficient [r] of 0.824 and 0.817, respectively), and they provided only a semiquantitative measurement of antibody concentration. For an antibody status report, however, OD would be sufficient if related to the cutoff value as an EIA index (OD of sample divided by cutoff OD for positive specimens). The OD of the EIA reaction at a single dilution (1:5) of cerebrospinal fluid, on the other hand, correlated quite well with the titer obtained by titration (r = 0.950). For serological diagnosis of current infection, the OD ratio of convalescence-phase/acute-phase sera was determined at several dilutions. A ratio of greater than or equal to 1.54 was calculated as a reliable index for a significant rise in antibody concentration and compatible with current infection. By determining the convalescent-phase/acute-phase serum ratio at two dilutions, 1:100 and 1:1,000, the EIA ratio method appeared to be a sensitive as or more sensitive than, complement fixation in diagnosing current infection. PMID:6284791

Report from the First CERT-RMM Users Group Workshop Series

DTIC Science & Technology

2012-04-01

deploy processes to support our programs – Benchmark our programs to determine current gaps – Complements current work in CMMI® and ISO 27001 19...benchmarking program performance through process analytics and Lean/Six Sigma activities to ensure Performance Excellence. • Provides ISO Standards...Office www.cmu.edu/ iso 29 Carnegie Mellon University • Est 1967 in Pittsburgh, PA • Global, private research university • Ranked 22nd • 15,000

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

Potential for Inclusion of Information Encountering within Information Literacy Models

ERIC Educational Resources Information Center

Erdelez, Sanda; Basic, Josipa; Levitov, Deborah D.

2011-01-01

Introduction: Information encountering (finding information while searching for some other information), is a type of opportunistic discovery of information that complements purposeful approaches to finding information. The motivation for this paper was to determine if the current models of information literacy instruction refer to information…

Metabolite profiling of fish skin mucus: a novel approach for minimally-invasive environmental exposure monitoring and surveillance

EPA Science Inventory

The application of 'omics tools to biologically based monitoring and surveillance of aquatic environments shows considerable promise for complementing chemical monitoring in ecological risk assessments. However, few of the current approaches offer the ability to sample ecological...

Emotion Processes in Knowledge Revision

ERIC Educational Resources Information Center

Trevors, Gregory J.; Kendeou, Panayiota; Butterfuss, Reese

2017-01-01

In recent years, a number of insights have been gained into the cognitive processes that explain how individuals overcome misconceptions and revise their previously acquired incorrect knowledge. The current study complements this line of research by investigating the moment-by-moment emotion processes that occur during knowledge revision using a…

Reading the 'Net--Books in Cyberspace.

ERIC Educational Resources Information Center

Foster, Janet

1999-01-01

Discusses electronic text collections, bookstores on the Web, reader advisories, cyber book reviews, and resources for librarians explaining how to locate online reading materials. Suggests that librarians can exploit online book resources to complement current collection-development strategies or use them as virtual reader's advisories. Cites 17…

Parent-Collected Behavioral Observations: An Empirical Comparison of Methods

ERIC Educational Resources Information Center

Nadler, Cy B.; Roberts, Mark W.

2013-01-01

Treatments for disruptive behaviors are often guided by parent reports on questionnaires, rather than by multiple methods of assessment. Professional observations and clinic analogs exist to complement questionnaires, but parents can also collect useful behavioral observations to inform and guide treatment. Two parent observation methods of child…

Theory, Method, and Triangulation in the Study of Street Children.

ERIC Educational Resources Information Center

Lucchini, Riccardo

1996-01-01

Describes how a comparative study of street children in Montevideo (Uruguay), Rio de Janeiro, and Mexico City contributes to a synergism between theory and method. Notes how theoretical approaches of symbolic interactionism, genetic structuralism, and habitus theory complement interview, participant observation, and content analysis methods;…

Global Network Alignment in the Context of Aging.

PubMed

Faisal, Fazle Elahi; Zhao, Han; Milenkovic, Tijana

2015-01-01

Analogous to sequence alignment, network alignment (NA) can be used to transfer biological knowledge across species between conserved network regions. NA faces two algorithmic challenges: 1) Which cost function to use to capture "similarities" between nodes in different networks? 2) Which alignment strategy to use to rapidly identify "high-scoring" alignments from all possible alignments? We "break down" existing state-of-the-art methods that use both different cost functions and different alignment strategies to evaluate each combination of their cost functions and alignment strategies. We find that a combination of the cost function of one method and the alignment strategy of another method beats the existing methods. Hence, we propose this combination as a novel superior NA method. Then, since human aging is hard to study experimentally due to long lifespan, we use NA to transfer aging-related knowledge from well annotated model species to poorly annotated human. By doing so, we produce novel human aging-related knowledge, which complements currently available knowledge about aging that has been obtained mainly by sequence alignment. We demonstrate significant similarity between topological and functional properties of our novel predictions and those of known aging-related genes. We are the first to use NA to learn more about aging.

High-throughput determination of RNA structure by proximity ligation.

PubMed

Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

2015-09-01

We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

Using Machine Learning to Predict MCNP Bias

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grechanuk, Pavel Aleksandrovi

For many real-world applications in radiation transport where simulations are compared to experimental measurements, like in nuclear criticality safety, the bias (simulated - experimental k eff) in the calculation is an extremely important quantity used for code validation. The objective of this project is to accurately predict the bias of MCNP6 [1] criticality calculations using machine learning (ML) algorithms, with the intention of creating a tool that can complement the current nuclear criticality safety methods. In the latest release of MCNP6, the Whisper tool is available for criticality safety analysts and includes a large catalogue of experimental benchmarks, sensitivity profiles,more » and nuclear data covariance matrices. This data, coming from 1100+ benchmark cases, is used in this study of ML algorithms for criticality safety bias predictions.« less

The status of preimplantation genetic diagnosis in Japan: a criticism.

PubMed

Munné, Santiago; Cohen, Jacques

2004-09-01

Advances in preimplantation genetic diagnosis (PGD) are occurring worldwide. New clinics specializing in this approach to the control of disease genes or imbalanced chromosome numbers in human preimplantation embryos continue to increase. One exception is Japan, where the Japanese Society of Obstetrics and Gynecology disapproves of this practice because it discriminates against people with genetic abnormalities. Yet, some doctors there wish to introduce this method to help their couples to improved forms of IVF. This paper stresses the rights of patients to have a healthy baby, if necessary by the use of PGD. It argues against prohibition, since it complements the current nature of prenatal diagnosis and avoids the need for abortions in case of afflicted embryos. Consideration is also given to other attempts at restriction that have failed.

[Review on the feeding ecology and migration patterns of sharks using stable isotopes].

PubMed

Li, Yun-Kai

2014-09-01

With the rapidly increasing use of stable isotope analysis (SIA) in ecology, it becomes a powerful tool and complement to traditional methods for investigating the trophic ecology of animals. Sharks play a keystone role in marine food webs as the apex predators and are recently becoming the frontier topic of food web studies and marine conservation because of their unique characteristics of evolution. Recently, SIA has recently been applied to trophic ecology studies of shark species. Here, we reviewed the current applications of SIA in shark species, focusing on available tissues for analyzing, standardized analytical approaches, diet-tissue discrimination factors, diet shift investigation, migration patterns predictions and niche-width analyses, with the aim of getting better understanding of stable-isotope dynamics in shark biology and ecology research.

Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

PubMed

Meisel, Jayda E; Chang, Mayland

2017-11-01

The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

Label-free imaging of atherosclerotic plaques using third-harmonic generation microscopy

PubMed Central

Small, David M.; Jones, Jason S.; Tendler, Irwin I.; Miller, Paul E.; Ghetti, Andre; Nishimura, Nozomi

2017-01-01

Multiphoton microscopy using laser sources in the mid-infrared range (MIR, 1,300 nm and 1,700 nm) was used to image atherosclerotic plaques from murine and human samples. Third harmonic generation (THG) from atherosclerotic plaques revealed morphological details of cellular and extracellular lipid deposits. Simultaneous nonlinear optical signals from the same laser source, including second harmonic generation and endogenous fluorescence, resulted in label-free images of various layers within the diseased vessel wall. The THG signal adds an endogenous contrast mechanism with a practical degree of specificity for atherosclerotic plaques that complements current nonlinear optical methods for the investigation of cardiovascular disease. Our use of whole-mount tissue and backward scattered epi-detection suggests THG could potentially be used in the future as a clinical tool. PMID:29359098

Imaging the microscopic structure of shear thinning and thickening colloidal suspensions.

PubMed

Cheng, Xiang; McCoy, Jonathan H; Israelachvili, Jacob N; Cohen, Itai

2011-09-02

The viscosity of colloidal suspensions varies with shear rate, an important effect encountered in many natural and industrial processes. Although this non-Newtonian behavior is believed to arise from the arrangement of suspended particles and their mutual interactions, microscopic particle dynamics are difficult to measure. By combining fast confocal microscopy with simultaneous force measurements, we systematically investigate a suspension's structure as it transitions through regimes of different flow signatures. Our measurements of the microscopic single-particle dynamics show that shear thinning results from the decreased relative contribution of entropic forces and that shear thickening arises from particle clustering induced by hydrodynamic lubrication forces. This combination of techniques illustrates an approach that complements current methods for determining the microscopic origins of non-Newtonian flow behavior in complex fluids.

Cotton regeneration in vitro

USDA-ARS?s Scientific Manuscript database

H. F. Sakhanokho and K. Rajasekaran Over the years, plant breeders have improved cotton via conventional breeding methods, but these methods are time-consuming. To complement classical breeding and, at times, reduce the time necessary for new cultivar development, breeders have turned to in vitro ...

Paying donors and the ethics of blood supply.

PubMed Central

Rodriguez del Pozo, P

1994-01-01

Countries may be erring in the current trend towards relying entirely on volunteers to fulfil blood and plasma needs. Complementing uncompensated blood with compensated blood is vitally necessary not only effectively to meet the blood and plasma needs of most countries, but it is also ethically sound. PMID:8035437

Women at Work: A Counselor's Sourcebook.

ERIC Educational Resources Information Center

Farmer, Helen S.; Backer, Thomas E.

This book is designed to complement current literature dealing with the vocational counseling of women. The purpose of the book is to provide counselors with timely information regarding: (1) career opportunities for women in fields traditionally dominated by men; (2) legal rights of women in the world of work; (3) counseling strategies and…

75 FR 54374 - BOEMRE Information Collection Activity: 1010-0112, Performance Measures Data, Revision of a...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-07

... industry as a complement to current regulatory efforts to protect people and the environment during OCS oil... ______ ENVIRONMENT G. No. of EPA NPDES Noncompliances _________ H. For Oil Spills ... oil, gas, and sulphur resources; make such resources available to meet the Nation's energy needs as...

Interprofessionalism: Educating to Meet Patient Needs

ERIC Educational Resources Information Center

Kirch, Darrell G.; Ast, Cori

2015-01-01

Interprofessional teams in health care are showing promise in achieving the triple aim--providing better care for the individual patient, reducing costs, and improving population health. To complement current changes in health care delivery in the United States, there is a growing consensus among health professions educators that students should…

Places and Things for Experimental Schools.

ERIC Educational Resources Information Center

Molloy, Laurence; And Others

The information available on current developments in the planning and use of educational facilities is dispersed among many resources. This publication gathers up the scattered information on all the lively facilities topics and complements it with the names and addresses of prime information sources for interested public officials, planners,…

MODELING THE DYNAMICS OF THREE FUNCTIONAL GROUPS OF MACROALGAE IN TROPICAL SEAGRASS HABITATS. (R828677C004)

EPA Science Inventory

A model of three functional groups of macroalgae, drift algae, rhizophytic calcareous algae, and seagrass epiphytes, was developed to complement an existing seagrass production model for tropical habitats dominated by Thalassia testudinum (Turtle-grass). The current modeling e...

Current Work in Linguistics. University of Pennsylvania Working Papers in Linguistics, Volume 6, Number 3.

ERIC Educational Resources Information Center

Williams, Alexander, Ed.; Kaiser, Elsi, Ed.

This issue includes the following articles: "On Negative Alternative Questions" (Chung-hye Han); "A Categorical Syntax for Verbs of Perception" (Robin Clark, Gerhard Jager); "Defective Complements in Tree Adjoining Grammar" (Seth Kulick, Robert Frank, K. Vijayshanker); "The Convergence of Lexicalist Perspectives in Psycholinguistics and…

Activation of the lectin pathway of complement in experimental human keratitis with Pseudomonas aeruginosa

PubMed Central

Osthoff, Michael; Brown, Karl D.; Kong, David C.M.; Daniell, Mark

2014-01-01

Purpose Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Methods Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT–PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. Results MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. Conclusions MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed. PMID:24426774

Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication

PubMed Central

Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin

2017-01-01

Abstract Introduction Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono‐substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry‐based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. Objective To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Method Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Results Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. Conclusions DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence‐based identification are necessary before DNA‐based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. PMID:28906059

Unfitted Two-Phase Flow Simulations in Pore-Geometries with Accurate

NASA Astrophysics Data System (ADS)

Heimann, Felix; Engwer, Christian; Ippisch, Olaf; Bastian, Peter

2013-04-01

The development of better macro scale models for multi-phase flow in porous media is still impeded by the lack of suitable methods for the simulation of such flow regimes on the pore scale. The highly complicated geometry of natural porous media imposes requirements with regard to stability and computational efficiency which current numerical methods fail to meet. Therefore, current simulation environments are still unable to provide a thorough understanding of porous media in multi-phase regimes and still fail to reproduce well known effects like hysteresis or the more peculiar dynamics of the capillary fringe with satisfying accuracy. Although flow simulations in pore geometries were initially the domain of Lattice-Boltzmann and other particle methods, the development of Galerkin methods for such applications is important as they complement the range of feasible flow and parameter regimes. In the recent past, it has been shown that unfitted Galerkin methods can be applied efficiently to topologically demanding geometries. However, in the context of two-phase flows, the interface of the two immiscible fluids effectively separates the domain in two sub-domains. The exact representation of such setups with multiple independent and time depending geometries exceeds the functionality of common unfitted methods. We present a new approach to pore scale simulations with an unfitted discontinuous Galerkin (UDG) method. Utilizing a recursive sub-triangulation algorithm, we extent the UDG method to setups with multiple independent geometries. This approach allows an accurate representation of the moving contact line and the interface conditions, i.e. the pressure jump across the interface. Example simulations in two and three dimensions illustrate and verify the stability and accuracy of this approach.

Can innate and autoimmune reactivity forecast early and advance stages of age-related macular degeneration?

PubMed

Adamus, Grazyna

2017-03-01

Age-related macular degeneration (AMD) is a major cause of central vision loss in persons over 55years of age in developed countries. AMD is a complex disease in which genetic, environmental and inflammatory factors influence its onset and progression. Elevation in serum anti-retinal autoantibodies, plasma and local activation of complement proteins of the alternative pathway, and increase in secretion of proinflammatory cytokines have been seen over the course of disease. Genetic studies of AMD patients confirmed that genetic variants affecting the alternative complement pathway have a major influence on AMD risk. Because the heterogeneity of this disease, there is no sufficient strategy to identify the disease onset and progression sole based eye examination, thus identification of reliable serological biomarkers for diagnosis, prognosis and response to treatment by sampling patient's blood is necessary. This review provides an outline of the current knowledge on possible serological (autoantibodies, complement factors, cytokines, chemokines) and related genetic biomarkers relevant to the pathology of AMD, and discusses their application for prediction of disease activity and prognosis in AMD. Copyright © 2017 Elsevier B.V. All rights reserved.

Ly6G-mediated depletion of neutrophils is dependent on macrophages.

PubMed

Bruhn, Kevin W; Dekitani, Ken; Nielsen, Travis B; Pantapalangkoor, Paul; Spellberg, Brad

2016-01-01

Antibody-mediated depletion of neutrophils is commonly used to study neutropenia. However, the mechanisms by which antibodies deplete neutrophils have not been well defined. We noticed that mice deficient in complement and macrophages had blunted neutrophil depletion in response to anti-Ly6G monoclonal antibody (MAb) treatment. In vitro, exposure of murine neutrophils to anti-Ly6G MAb in the presence of plasma did not result in significant depletion of cells, either in the presence or absence of complement. In vivo, anti-Ly6G-mediated neutrophil depletion was abrogated following macrophage depletion, but not complement depletion, indicating a requirement for macrophages to induce neutropenia by this method. These results inform the use and limitations of anti-Ly6G antibody as an experimental tool for depleting neutrophils in various immunological settings.

Advanced Current Collection Research

DTIC Science & Technology

1978-04-19

GoPDId Goal Current Density (HA/M3) 7.8 b4. Collector Surface Velocity (m/s) 15-75 25-75 Brush Material Life (uax, 1400 1400 velocity) (hr/in...net power loss and longest life for brush operation. The development of a multi-fiber shunt was continued through two iterations in preparation fnr... life . Neither energy loss density nor wear were degraded as the number of test brushes was increased to the full complement level. Over one year average

Estimating pathway-specific contributions to biodegradation in aquifers based on dual isotope analysis: theoretical analysis and reactive transport simulations.

PubMed

Centler, Florian; Heße, Falk; Thullner, Martin

2013-09-01

At field sites with varying redox conditions, different redox-specific microbial degradation pathways contribute to total contaminant degradation. The identification of pathway-specific contributions to total contaminant removal is of high practical relevance, yet difficult to achieve with current methods. Current stable-isotope-fractionation-based techniques focus on the identification of dominant biodegradation pathways under constant environmental conditions. We present an approach based on dual stable isotope data to estimate the individual contributions of two redox-specific pathways. We apply this approach to carbon and hydrogen isotope data obtained from reactive transport simulations of an organic contaminant plume in a two-dimensional aquifer cross section to test the applicability of the method. To take aspects typically encountered at field sites into account, additional simulations addressed the effects of transverse mixing, diffusion-induced stable-isotope fractionation, heterogeneities in the flow field, and mixing in sampling wells on isotope-based estimates for aerobic and anaerobic pathway contributions to total contaminant biodegradation. Results confirm the general applicability of the presented estimation method which is most accurate along the plume core and less accurate towards the fringe where flow paths receive contaminant mass and associated isotope signatures from the core by transverse dispersion. The presented method complements the stable-isotope-fractionation-based analysis toolbox. At field sites with varying redox conditions, it provides a means to identify the relative importance of individual, redox-specific degradation pathways. © 2013.

Quantification of Peptides from Immunoglobulin Constant and Variable Regions by Liquid Chromatography-Multiple Reaction Monitoring Mass Spectrometry for Assessment of Multiple Myeloma Patients

PubMed Central

Remily-Wood, Elizabeth R.; Benson, Kaaron; Baz, Rachid C.; Chen, Y. Ann; Hussein, Mohamad; Hartley-Brown, Monique A.; Sprung, Robert W.; Perez, Brianna; Liu, Richard Z.; Yoder, Sean; Teer, Jamie; Eschrich, Steven A.; Koomen, John M.

2014-01-01

Purpose Quantitative mass spectrometry assays for immunoglobulins (Igs) are compared with existing clinical methods in samples from patients with plasma cell dyscrasias, e.g. multiple myeloma. Experimental design Using LC-MS/MS data, Ig constant region peptides and transitions were selected for liquid chromatography-multiple reaction monitoring mass spectrometry (LC-MRM). Quantitative assays were used to assess Igs in serum from 83 patients. Results LC-MRM assays quantify serum levels of Igs and their isoforms (IgG1–4, IgA1–2, IgM, IgD, and IgE, as well as kappa(κ) and lambda(λ) light chains). LC-MRM quantification has been applied to single samples from a patient cohort and a longitudinal study of an IgE patient undergoing treatment, to enable comparison with existing clinical methods. Proof-of-concept data for defining and monitoring variable region peptides are provided using the H929 multiple myeloma cell line and two MM patients. Conclusions and Clinical Relevance LC-MRM assays targeting constant region peptides determine the type and isoform of the involved immunoglobulin and quantify its expression; the LC-MRM approach has improved sensitivity compared with the current clinical method, but slightly higher interassay variability. Detection of variable region peptides is a promising way to improve Ig quantification, which could produce a dramatic increase in sensitivity over existing methods, and could further complement current clinical techniques. PMID:24723328

Quantification of peptides from immunoglobulin constant and variable regions by LC-MRM MS for assessment of multiple myeloma patients.

PubMed

Remily-Wood, Elizabeth R; Benson, Kaaron; Baz, Rachid C; Chen, Y Ann; Hussein, Mohamad; Hartley-Brown, Monique A; Sprung, Robert W; Perez, Brianna; Liu, Richard Z; Yoder, Sean J; Teer, Jamie K; Eschrich, Steven A; Koomen, John M

2014-10-01

Quantitative MS assays for Igs are compared with existing clinical methods in samples from patients with plasma cell dyscrasias, for example, multiple myeloma (MM). Using LC-MS/MS data, Ig constant region peptides, and transitions were selected for LC-MRM MS. Quantitative assays were used to assess Igs in serum from 83 patients. RNA sequencing and peptide-based LC-MRM are used to define peptides for quantification of the disease-specific Ig. LC-MRM assays quantify serum levels of Igs and their isoforms (IgG1-4, IgA1-2, IgM, IgD, and IgE, as well as kappa (κ) and lambda (λ) light chains). LC-MRM quantification has been applied to single samples from a patient cohort and a longitudinal study of an IgE patient undergoing treatment, to enable comparison with existing clinical methods. Proof-of-concept data for defining and monitoring variable region peptides are provided using the H929 MM cell line and two MM patients. LC-MRM assays targeting constant region peptides determine the type and isoform of the involved Ig and quantify its expression; the LC-MRM approach has improved sensitivity compared with the current clinical method, but slightly higher inter-assay variability. Detection of variable region peptides is a promising way to improve Ig quantification, which could produce a dramatic increase in sensitivity over existing methods, and could further complement current clinical techniques. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tailored electron bunches with smooth current profiles for enhanced transformer ratios in beam-driven acceleration

DOE PAGES

Lemery, F.; Piot, P.

2015-08-03

Collinear high-gradient O(GV/m) beam-driven wakefield methods for charged-particle acceleration could be critical to the realization of compact, cost-efficient, accelerators, e.g., in support of TeV-scale lepton colliders or multiple-user free-electron laser facilities. To make these options viable, the high accelerating fields need to be complemented with large transformer ratios >2, a parameter characterizing the efficiency of the energy transfer between a wakefield-exciting “drive” bunch to an accelerated “witness” bunch. While several potential current distributions have been discussed, their practical realization appears challenging due to their often discontinuous nature. In this paper we propose several alternative continuously differentiable (smooth) current profiles whichmore » support enhanced transformer ratios. We especially demonstrate that one of the devised shapes can be implemented in a photo-emission electron source by properly shaping the photocathode-laser pulse. We finally discuss a possible superconducting linear-accelerator concept that could produce shaped drive bunches at high-repetition rates to drive a dielectric-wakefield accelerator with accelerating fields on the order of ~60 MV/m and a transformer ratio ~5 consistent with a recently proposed multiuser free-electron laser facility.« less

Tailored electron bunches with smooth current profiles for enhanced transformer ratios in beam-driven acceleration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lemery, F.; Piot, P.

Collinear high-gradient O(GV/m) beam-driven wakefield methods for charged-particle acceleration could be critical to the realization of compact, cost-efficient, accelerators, e.g., in support of TeV-scale lepton colliders or multiple-user free-electron laser facilities. To make these options viable, the high accelerating fields need to be complemented with large transformer ratios >2, a parameter characterizing the efficiency of the energy transfer between a wakefield-exciting “drive” bunch to an accelerated “witness” bunch. While several potential current distributions have been discussed, their practical realization appears challenging due to their often discontinuous nature. In this paper we propose several alternative continuously differentiable (smooth) current profiles whichmore » support enhanced transformer ratios. We especially demonstrate that one of the devised shapes can be implemented in a photo-emission electron source by properly shaping the photocathode-laser pulse. We finally discuss a possible superconducting linear-accelerator concept that could produce shaped drive bunches at high-repetition rates to drive a dielectric-wakefield accelerator with accelerating fields on the order of ~60 MV/m and a transformer ratio ~5 consistent with a recently proposed multiuser free-electron laser facility.« less

Exercise recommendations for childhood cancer survivors exposed to cardiotoxic therapies: an institutional clinical practice initiative.

PubMed

Okada, Maki; Meeske, Kathleen A; Menteer, Jondavid; Freyer, David R

2012-01-01

Childhood cancer survivors who have received treatment with anthracyclines are at risk for developing cardiomyopathy in dose-dependent fashion. Historically, restrictions on certain types of physical activity that were intended to preserve cardiac function have been recommended, based on a mixture of evidence-based and consensus-based recommendations. In the LIFE Cancer Survivorship & Transition Program at Children's Hospital Los Angeles, the authors reevaluated their recommendations for exercise in survivors who were exposed to anthracyclines, with or without irradiation in proximity to the myocardium. The primary goal was to develop consistent, specific, practical, safe, and (where possible) evidence-based recommendations for at-risk survivors in the program. To accomplish this, the authors referred to current exercise guidelines for childhood cancer survivors, consulted recent literature for relevant populations, and obtained input from the program's pediatric cardiology consultant. The resulting risk-based exercise recommendations are designed to complement current published guidelines, maximize safe exercise, and help childhood cancer survivors return to a normal life that emphasizes overall wellness and physical activity. This article describes a single institution's experience in modifying exercise recommendations for at-risk childhood survivors and includes the methods, findings, and current institutional practice recommendations along with sample education materials.

Alcohol and marijuana use among college students: economic complements or substitutes?

PubMed

Williams, J; Liccardo Pacula, Rosalie; Chaloupka, Frank J; Wechsler, Henry

2004-09-01

Previous research has shown that the recent tightening of college alcohol policies has been effective at reducing college students' drinking. Over the period in which these stricter alcohol policies have been put in place, marijuana use among college students has increased. This raises the question of whether current policies aimed at reducing alcohol consumption are inadvertently encouraging marijuana use. This paper begins to address this question by investigating the relationship between the demands for alcohol and marijuana for college students using data from the 1993, 1997 and 1999 waves of the Harvard School of Public Health's College Alcohol Study (CAS). We find that alcohol and marijuana are economic complements and that policies that increase the full price of alcohol decrease participation in marijuana use.

Substantial Loss of Conserved and Gain of Novel MicroRNA Families in Flatworms

PubMed Central

Fromm, Bastian; Worren, Merete Molton; Hahn, Christoph; Hovig, Eivind; Bachmann, Lutz

2013-01-01

Recent studies on microRNA (miRNA) evolution focused mainly on the comparison of miRNA complements between animal clades. However, evolution of miRNAs within such groups is poorly explored despite the availability of comparable data that in some cases lack only a few key taxa. For flatworms (Platyhelminthes), miRNA complements are available for some free-living flatworms and all major parasitic lineages, except for the Monogenea. We present the miRNA complement of the monogenean flatworm Gyrodactylus salaris that facilitates a comprehensive analysis of miRNA evolution in Platyhelminthes. Using the newly designed bioinformatics pipeline miRCandRef, the miRNA complement was disentangled from next-generation sequencing of small RNAs and genomic DNA without a priori genome assembly. It consists of 39 miRNA hairpin loci of conserved miRNA families, and 22 novel miRNAs. A comparison with the miRNA complements of Schmidtea mediterranea (Turbellaria), Schistosoma japonicum (Trematoda), and Echinococcus granulosus (Cestoda) reveals a substantial loss of conserved bilaterian, protostomian, and lophotrochozoan miRNAs. Eight of the 46 expected conserved miRNAs were lost in all flatworms, 16 in Neodermata and 24 conserved miRNAs could not be detected in the cestode and the trematode. Such a gradual loss of miRNAs has not been reported before for other animal phyla. Currently, little is known about miRNAs in Platyhelminthes, and for the majority of the lost miRNAs there is no prediction of function. As suggested earlier they might be related to morphological simplifications. The presence and absence of 153 conserved miRNAs was compared for platyhelminths and 32 other metazoan taxa. Phylogenetic analyses support the monophyly of Platyhelminthes (Turbellaria + Neodermata [Monogenea {Trematoda + Cestoda}]). PMID:24025793

Future perspectives in target-specific immunotherapies of myasthenia gravis

PubMed Central

Dalakas, Marinos C.

2015-01-01

Myasthenia gravis (MG) is an autoimmune disease caused by complement-fixing antibodies against acetylcholine receptors (AChR); antigen-specific CD4+ T cells, regulatory T cells (Tregs) and T helper (Th) 17+ cells are essential in antibody production. Target-specific therapeutic interventions should therefore be directed against antibodies, B cells, complement and molecules associated with T cell signaling. Even though the progress in the immunopathogenesis of the disease probably exceeds any other autoimmune disorder, MG is still treated with traditional drugs or procedures that exert a non-antigen specific immunosuppression or immunomodulation. Novel biological agents currently on the market, directed against the following molecular pathways, are relevant and specific therapeutic targets that can be tested in MG: (a) T cell intracellular signaling molecules, such as anti-CD52, anti-interleukin (IL) 2 receptors, anti- costimulatory molecules, and anti-Janus tyrosine kinases (JAK1, JAK3) that block the intracellular cascade associated with T-cell activation; (b) B cells and their trophic factors, directed against key B-cell molecules; (c) complement C3 or C5, intercepting the destructive effect of complement-fixing antibodies; (d) cytokines and cytokine receptors, such as those targeting IL-6 which promotes antibody production and IL-17, or the p40 subunit of IL-12/1L-23 that affect regulatory T cells; and (e) T and B cell transmigration molecules associated with lymphocyte egress from the lymphoid organs. All drugs against these molecular pathways require testing in controlled trials, although some have already been tried in small case series. Construction of recombinant AChR antibodies that block binding of the pathogenic antibodies, thereby eliminating complement and antibody-depended-cell-mediated cytotoxicity, are additional novel molecular tools that require exploration in experimental MG. PMID:26600875

Generation of Anaphylatoxins by Human β-Tryptase from C3, C4, and C51

PubMed Central

Fukuoka, Yoshihiro; Xia, Han-Zhang; Sanchez-Muñoz, Laura B.; Dellinger, Anthony L.; Escribano, Luis; Schwartz, Lawrence B.

2009-01-01

Both mast cells and complement participate in innate and acquired immunity. The current study examines whether β-tryptase, the major protease of human mast cells, can directly generate bioactive complement anaphylatoxins. Important variables included pH, monomeric vs tetrameric forms of β-tryptase, and the β-tryptase-activating polyanion. The B12 mAb was used to stabilize β-tryptase in its monomeric form. C3a and C4a were best generated from C3 and C4, respectively, by monomeric β-tryptase in the presence of low molecular weight dextran sulfate or heparin at acidic pH. High molecular weight polyanions increased degradation of these anaphylatoxins. C5a was optimally generated from C5 at acidic pH by β-tryptase monomers in the presence of high molecular weight dextran sulfate and heparin polyanions, but also was produced by β-tryptase tetramers under these conditions. Mass spectrometry verified that the molecular mass of each anaphylatoxin was correct. Both β-tryptase-generated C5a and C3a (but not C4a) were potent activators of human skin mast cells. These complement anaphylatoxins also could be generated by β-tryptase in releasates of activated skin mast cells. Of further biologic interest, β-tryptase also generated C3a from C3 in human plasma at acidic pH. These results suggest β-tryptase might generate complement anaphylatoxins in vivo at sites of inflammation, such as the airway of active asthma patients where the pH is acidic and where elevated levels of β-tryptase and complement anaphylatoxins are detected. PMID:18424754

Nucleic Acids for Ultra-Sensitive Protein Detection

PubMed Central

Janssen, Kris P. F.; Knez, Karel; Spasic, Dragana; Lammertyn, Jeroen

2013-01-01

Major advancements in molecular biology and clinical diagnostics cannot be brought about strictly through the use of genomics based methods. Improved methods for protein detection and proteomic screening are an absolute necessity to complement to wealth of information offered by novel, high-throughput sequencing technologies. Only then will it be possible to advance insights into clinical processes and to characterize the importance of specific protein biomarkers for disease detection or the realization of “personalized medicine”. Currently however, large-scale proteomic information is still not as easily obtained as its genomic counterpart, mainly because traditional antibody-based technologies struggle to meet the stringent sensitivity and throughput requirements that are required whereas mass-spectrometry based methods might be burdened by significant costs involved. However, recent years have seen the development of new biodetection strategies linking nucleic acids with existing antibody technology or replacing antibodies with oligonucleotide recognition elements altogether. These advancements have unlocked many new strategies to lower detection limits and dramatically increase throughput of protein detection assays. In this review, an overview of these new strategies will be given. PMID:23337338

Developmentalism: Learning as the Basis for Evaluating Information

ERIC Educational Resources Information Center

Lenker, Mark

2017-01-01

The developmentalist conception of information's value makes learning the central consideration for evaluating information. Following philosopher Richard Kraut, this article argues that developmentalism provides an important complement to prevalent methods of teaching the evaluation of information. These methods emphasize (a) trustworthiness--for…

Training needs for toxicity testing in the 21st century: a survey-informed analysis.

PubMed

Lapenna, Silvia; Gabbert, Silke; Worth, Andrew

2012-12-01

Current training needs on the use of alternative methods in predictive toxicology, including new approaches based on mode-of-action (MoA) and adverse outcome pathway (AOP) concepts, are expected to evolve rapidly. In order to gain insight into stakeholder preferences for training, the European Commission's Joint Research Centre (JRC) conducted a single-question survey with twelve experts in regulatory agencies, industry, national research organisations, NGOs and consultancies. Stakeholder responses were evaluated by means of theory-based qualitative data analysis. Overall, a set of training topics were identified that relate both to general background information and to guidance for applying alternative testing methods. In particular, for the use of in silico methods, stakeholders emphasised the need for training on data integration and evaluation, in order to increase confidence in applying these methods for regulatory purposes. Although the survey does not claim to offer an exhaustive overview of the training requirements, its findings support the conclusion that the development of well-targeted and tailor-made training opportunities that inform about the usefulness of alternative methods, in particular those that offer practical experience in the application of in silico methods, deserves more attention. This should be complemented by transparent information and guidance on the interpretation of the results generated by these methods and software tools. 2012 FRAME.

Development of an enzyme-linked-immunosorbent-assay technique for accurate identification of poorly preserved silks unearthed in ancient tombs.

PubMed

Zheng, Qin; Wu, Xiaofeng; Zheng, Hailing; Zhou, Yang

2015-05-01

We report the preparation of a specific fibroin antibody and its use for the identification of unearthed ancient silk relics. Based on the 12-amino-acid repeat sequence "GAGAGSGAGAGS", which is found in fibroin of the silkworm Bombyx mori, a specific antibody against fibroin was prepared in rabbits through peptide synthesis and carrier-protein coupling. This antibody was highly specific for fibroin found in silk. Using this antibody we have successfully identified four silk samples from different time periods. Our results reveal, for the first time, a method capable of detecting silk from a few milligrams of archaeological fabric that has been buried for thousands of years, confirming that the ancient practice of wearing silk products while praying for rebirth dated back to at least 400 BCE. This method also complements current approaches in silk detection, especially for the characterization of poorly preserved silks, promoting the investigation of silk origins and of ancient clothing cultures.

A novel muon detector for borehole density tomography

NASA Astrophysics Data System (ADS)

Bonneville, Alain; Kouzes, Richard T.; Yamaoka, Jared; Rowe, Charlotte; Guardincerri, Elena; Durham, J. Matthew; Morris, Christopher L.; Poulson, Daniel C.; Plaud-Ramos, Kenie; Morley, Deborah J.; Bacon, Jeffrey D.; Bynes, James; Cercillieux, Julien; Ketter, Chris; Le, Khanh; Mostafanezhad, Isar; Varner, Gary; Flygare, Joshua; Lintereur, Azaree T.

2017-04-01

Muons can be used to image the density of materials through which they pass, including geological structures. Subsurface applications of the technology include tracking fluid migration during injection or production, with increasing concern regarding such timely issues as induced seismicity or chemical leakage into aquifers. Current density monitoring options include gravimetric data collection and active or passive seismic surveys. One alternative, or complement, to these methods is the development of a muon detector that is sufficiently compact and robust for deployment in a borehole. Such a muon detector can enable imaging of density structure to monitor small changes in density - a proxy for fluid migration - at depths up to 1500 m. Such a detector has been developed, and Monte Carlo modeling methods applied to simulate the anticipated detector response. Testing and measurements using a prototype detector in the laboratory and shallow underground laboratory demonstrated robust response. A satisfactory comparison with a large drift tube-based muon detector is also presented.

Cardiac Rehabilitation Online Pilot: Extending Reach of Cardiac Rehabilitation.

PubMed

Higgins, Rosemary O; Rogerson, Michelle; Murphy, Barbara M; Navaratnam, Hema; Butler, Michael V; Barker, Lauren; Turner, Alyna; Lefkovits, Jeffrey; Jackson, Alun C

While cardiac rehabilitation (CR) is recommended for all patients after an acute cardiac event, limitations exist in reach. The purpose of the current study was to develop and pilot a flexible online CR program based on self-management principles "Help Yourself Online." The program was designed as an alternative to group-based CR as well as to complement traditional CR. The program was based on existing self-management resources developed previously by the Heart Research Centre. Twenty-one patients admitted to Cabrini Health for an acute cardiac event were recruited to test the program. The program was evaluated using qualitative and quantitative methods. Quantitative results demonstrated that patients believed the program would assist them in their self-management. Qualitative evaluation, using focus group and interview methods with 15 patients, showed that patients perceived the online CR approach to be a useful instrument for self-management. Broader implications of the data include the acceptability of the intervention, timing of intervention delivery, and patients' desire for additional online community support.

A novel muon detector for borehole density tomography

DOE PAGES

Bonneville, Alain; Kouzes, Richard T.; Yamaoka, Jared; ...

2017-02-01

Muons can be used to image the density of materials through which they pass, including geological structures. Subsurface applications of the technology include tracking fluid migration during injection or production, with increasing concern regarding such timely issues as induced seismicity or chemical leakage into aquifers. Current density monitoring options include gravimetric data collection and active or passive seismic surveys. One alternative, or complement, to these methods is the development of a muon detector that is sufficiently compact and robust for deployment in a borehole. Such a muon detector can enable imaging of density structure to monitor small changes in densitymore » – a proxy for fluid migration – at depths up to 1500 m. Such a detector has been developed, and Monte Carlo modeling methods applied to simulate the anticipated detector response. Testing and measurements using a prototype detector in the laboratory and shallow underground laboratory demonstrated robust response. Lastly, a satisfactory comparison with a large drift tube-based muon detector is also presented.« less

Challenges, uncertainties, and issues facing gas production from gas-hydrate deposits

USGS Publications Warehouse

Moridis, G.J.; Collett, T.S.; Pooladi-Darvish, M.; Hancock, S.; Santamarina, C.; Boswel, R.; Kneafsey, T.; Rutqvist, J.; Kowalsky, M.B.; Reagan, M.T.; Sloan, E.D.; Sum, A.K.; Koh, C.A.

2011-01-01

The current paper complements the Moridis et al. (2009) review of the status of the effort toward commercial gas production from hydrates. We aim to describe the concept of the gas-hydrate (GH) petroleum system; to discuss advances, requirements, and suggested practices in GH prospecting and GH deposit characterization; and to review the associated technical, economic, and environmental challenges and uncertainties, which include the following: accurate assessment of producible fractions of the GH resource; development of methods for identifying suitable production targets; sampling of hydrate-bearing sediments (HBS) and sample analysis; analysis and interpretation of geophysical surveys of GH reservoirs; well-testing methods; interpretation of well-testing results; geomechanical and reservoir/well stability concerns; well design, operation, and installation; field operations and extending production beyond sand-dominated GH reservoirs; monitoring production and geomechanical stability; laboratory investigations; fundamental knowledge of hydrate behavior; the economics of commercial gas production from hydrates; and associated environmental concerns. ?? 2011 Society of Petroleum Engineers.

The Complexities of Family Caregiving at Work: A Mixed-Methods Study.

PubMed

Gaugler, Joseph E; Pestka, Deborah L; Davila, Heather; Sales, Rebecca; Owen, Greg; Baumgartner, Sarah A; Shook, Rocky; Cunningham, Jane; Kenney, Maureen

2018-01-01

The current project examined the impact of caregiving and caregiving-work conflict on employees' well-being. A sequential explanatory mixed-methods design (QUAN→qual) was utilized, and a total of 880 employees from a large health-care plan employer completed an online survey. Forty-five caregivers who completed the survey also participated in one of the five focus groups held 1 to 2 months later. Employed caregivers were significantly ( p < .05) more likely to indicate poorer physical and mental health than noncaregivers; among caregivers ( n = 370), caregiving-work conflict emerged as the most significant predictor of well-being and fully mediated the empirical relationship between burden and well-being. The focus group findings complemented the quantitative results; many of the challenges employed caregivers experience stem from their ability or inability to effectively balance their employment and caregiving roles. The results suggest the need to focus on caregiving-work conflict when constructing new or translating existing evidence-based caregiver interventions.

Advances in the Use of Neuroscience Methods in Research on Learning and Instruction

ERIC Educational Resources Information Center

De Smedt, Bert

2014-01-01

Cognitive neuroscience offers a series of tools and methodologies that allow researchers in the field of learning and instruction to complement and extend the knowledge they have accumulated through decades of behavioral research. The appropriateness of these methods depends on the research question at hand. Cognitive neuroscience methods allow…

Benefits and Limitations of DNA Barcoding and Metabarcoding in Herbal Product Authentication.

PubMed

Raclariu, Ancuta Cristina; Heinrich, Michael; Ichim, Mihael Cristin; de Boer, Hugo

2018-03-01

Herbal medicines play an important role globally in the health care sector and in industrialised countries they are often considered as an alternative to mono-substance medicines. Current quality and authentication assessment methods rely mainly on morphology and analytical phytochemistry-based methods detailed in pharmacopoeias. Herbal products however are often highly processed with numerous ingredients, and even if these analytical methods are accurate for quality control of specific lead or marker compounds, they are of limited suitability for the authentication of biological ingredients. To review the benefits and limitations of DNA barcoding and metabarcoding in complementing current herbal product authentication. Recent literature relating to DNA based authentication of medicinal plants, herbal medicines and products are summarised to provide a basic understanding of how DNA barcoding and metabarcoding can be applied to this field. Different methods of quality control and authentication have varying resolution and usefulness along the value chain of these products. DNA barcoding can be used for authenticating products based on single herbal ingredients and DNA metabarcoding for assessment of species diversity in processed products, and both methods should be used in combination with appropriate hyphenated chemical methods for quality control. DNA barcoding and metabarcoding have potential in the context of quality control of both well and poorly regulated supply systems. Standardisation of protocols for DNA barcoding and DNA sequence-based identification are necessary before DNA-based biological methods can be implemented as routine analytical approaches and approved by the competent authorities for use in regulated procedures. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd. © 2017 The Authors. Phytochemical Analysis Published by John Wiley & Sons Ltd.

Use of Flood Seasonality in Pooling-Group Formation and Quantile Estimation: An Application in Great Britain

NASA Astrophysics Data System (ADS)

Formetta, Giuseppe; Bell, Victoria; Stewart, Elizabeth

2018-02-01

Regional flood frequency analysis is one of the most commonly applied methods for estimating extreme flood events at ungauged sites or locations with short measurement records. It is based on: (i) the definition of a homogeneous group (pooling-group) of catchments, and on (ii) the use of the pooling-group data to estimate flood quantiles. Although many methods to define a pooling-group (pooling schemes, PS) are based on catchment physiographic similarity measures, in the last decade methods based on flood seasonality similarity have been contemplated. In this paper, two seasonality-based PS are proposed and tested both in terms of the homogeneity of the pooling-groups they generate and in terms of the accuracy in estimating extreme flood events. The method has been applied in 420 catchments in Great Britain (considered as both gauged and ungauged) and compared against the current Flood Estimation Handbook (FEH) PS. Results for gauged sites show that, compared to the current PS, the seasonality-based PS performs better both in terms of homogeneity of the pooling-group and in terms of the accuracy of flood quantile estimates. For ungauged locations, a national-scale hydrological model has been used for the first time to quantify flood seasonality. Results show that in 75% of the tested locations the seasonality-based PS provides an improvement in the accuracy of the flood quantile estimates. The remaining 25% were located in highly urbanized, groundwater-dependent catchments. The promising results support the aspiration that large-scale hydrological models complement traditional methods for estimating design floods.

The Structure-Activity Relationship between Marine Algae Polysaccharides and Anti-Complement Activity

PubMed Central

Jin, Weihua; Zhang, Wenjing; Liang, Hongze; Zhang, Quanbin

2015-01-01

In this study, 33 different polysaccharides were prepared to investigate the structure-activity relationships between the polysaccharides, mainly from marine algae, and anti-complement activity in the classical pathway. Factors considered included extraction methods, fractionations, molecular weight, molar ratio of galactose to fucose, sulfate, uronic acid (UA) content, linkage, branching, and the type of monosaccharide. It was shown that the larger the molecular weights, the better the activities. The molar ratio of galactose (Gal) to fucose (Fuc) was a positive factor at a concentration lower than 10 µg/mL, while it had no effect at a concentration more than 10 µg/mL. In addition, sulfate was necessary; however, the sulfate content, the sulfate pattern, linkage and branching had no effect at a concentration of more than 10 µg/mL. Moreover, the type of monosaccharide had no effect. Laminaran and UA fractions had no activity; however, they could reduce the activity by decreasing the effective concentration of the active composition when they were mixed with the active compositions. The effect of the extraction methods could not be determined. Finally, it was observed that sulfated galactofucan showed good anti-complement activity after separation. PMID:26712768

Optimal economic order quantity for buyer-distributor-vendor supply chain with backlogging derived without derivatives

NASA Astrophysics Data System (ADS)

Teng, Jinn-Tsair; Cárdenas-Barrón, Leopoldo Eduardo; Lou, Kuo-Ren; Wee, Hui Ming

2013-05-01

In this article, we first complement an inappropriate mathematical error on the total cost in the previously published paper by Chung and Wee [2007, 'Optimal the Economic Lot Size of a Three-stage Supply Chain With Backlogging Derived Without Derivatives', European Journal of Operational Research, 183, 933-943] related to buyer-distributor-vendor three-stage supply chain with backlogging derived without derivatives. Then, an arithmetic-geometric inequality method is proposed not only to simplify the algebraic method of completing prefect squares, but also to complement their shortcomings. In addition, we provide a closed-form solution to integral number of deliveries for the distributor and the vendor without using complex derivatives. Furthermore, our method can solve many cases in which their method cannot, because they did not consider that a squared root of a negative number does not exist. Finally, we use some numerical examples to show that our proposed optimal solution is cheaper to operate than theirs.

Early Estimation of Solar Activity Cycle: Potential Capability and Limits

NASA Technical Reports Server (NTRS)

Kitiashvili, Irina N.; Collins, Nancy S.

2017-01-01

The variable solar magnetic activity known as the 11-year solar cycle has the longest history of solar observations. These cycles dramatically affect conditions in the heliosphere and the Earth's space environment. Our current understanding of the physical processes that make up global solar dynamics and the dynamo that generates the magnetic fields is sketchy, resulting in unrealistic descriptions in theoretical and numerical models of the solar cycles. The absence of long-term observations of solar interior dynamics and photospheric magnetic fields hinders development of accurate dynamo models and their calibration. In such situations, mathematical data assimilation methods provide an optimal approach for combining the available observational data and their uncertainties with theoretical models in order to estimate the state of the solar dynamo and predict future cycles. In this presentation, we will discuss the implementation and performance of an Ensemble Kalman Filter data assimilation method based on the Parker migratory dynamo model, complemented by the equation of magnetic helicity conservation and longterm sunspot data series. This approach has allowed us to reproduce the general properties of solar cycles and has already demonstrated a good predictive capability for the current cycle, 24. We will discuss further development of this approach, which includes a more sophisticated dynamo model, synoptic magnetogram data, and employs the DART Data Assimilation Research Testbed.

Technology complementing military behavioral health efforts at tripler army medical center.

PubMed

Stetz, Melba C; Folen, Raymond A; Yamanuha, Bronson K

2011-06-01

The purpose of this article is to provide a short narrative on the ways that behavioral health professionals and their patients are currently benefitting from the use of technology. Examples stem from applications of technology to patients/research participants at the Tripler Army Medical Center. The paper also discusses how current use of this technology has made it possible to serve individuals in their own cultural environment, providing a cost-effective means of providing mental health services.

Theorizing and Studying the Language-Teaching Mind: Mapping Research on Language Teacher Cognition

ERIC Educational Resources Information Center

Burns, Anne; Freeman, Donald; Edwards, Emily

2015-01-01

The overarching project of the conceptual and empirical contributions in this special issue is to redraw boundaries for language teacher cognition research. Our aim in this final article is to complement the foregoing collection of articles by conceptualizing ontologically and methodologically past and current trajectories in language teacher…

Language and False-Belief Task Performance in Children with Autism Spectrum Disorder

ERIC Educational Resources Information Center

Farrar, M. Jeffrey; Seung, Hye Kyeung; Lee, Hyeonjin

2017-01-01

Purpose: Language is related to false-belief (FB) understanding in both typically developing children and children with autism spectrum disorder (ASD). The current study examined the role of complementation and general language in FB understanding. Of interest was whether language plays similar or different roles in the groups' FB performance.…

A Parent's Guide to Encouraging Talent in the Humanities

ERIC Educational Resources Information Center

MacFarlane, Bronwyn

2012-01-01

A recent issue of "Educational Leadership" highlighted the lack of current focus in schools on humanities education (Ferrero, 2011). As the young lives of gifted children become ever busier with extracurricular options, parents are left with the question of how to best complement their child's academic life with his or her social and emotional…

Same-Sex Couples: Legal Complexities

ERIC Educational Resources Information Center

Oswald, Ramona Faith; Kuvalanka, Katherine A.

2008-01-01

In this article, the authors present a typology for organizing our current knowledge regarding same-sex couples in the United States who have and have not established legal ties between partners. This framework is complemented by a discussion of key rulings that define what is legally possible as well as the introduction of "legal consciousness,"…

Back to Basic: Aesthetic Experiences with Literature and Discovering the World

ERIC Educational Resources Information Center

Tice, Kathleen C.

2008-01-01

In this article, the author shares a current analysis of data that complements findings from earlier, related research that confirms the emotional aspects of reading experiences. The data from the earlier study is based upon comments by graduate students in online discussion groups, where they share their thoughts about the professional readings…

Energy beets: an undiscovered crop for the Southeastern US

USDA-ARS?s Scientific Manuscript database

Energy beets (Beta vulgaris), which are sugar beets grown for non-food sources, are a potential winter cash crop for growers in the southeastern U.S. that are planted in the autumn and harvested in the spring, complementing current summer crop rotations. The end-product from energy beets will be in...

Developing Non-Formal Education Competences as a Complement of Formal Education for STEM Lecturers

ERIC Educational Resources Information Center

Terrazas-Marín, Roy Alonso

2018-01-01

This paper focuses on a current practice piece on professional development for university lecturers, transformative learning, dialogism and STEM (Science, Technology, Engineering and Mathematics) education. Its main goals are to identify the key characteristics that allow STEM educators to experiment with the usage of non-formal education…

Oxorhenium Complexes for Catalytic Hydrosilylation and Hydrolytic Hydrogen Production: A Multiweek Advanced Laboratory Experiment for Undergraduate Students

ERIC Educational Resources Information Center

Ison, A.; Ison, E. A.; Perry, C. M.

2017-01-01

An effective way of teaching undergraduates a full complement of research skills is through a multiweek advanced laboratory experiment. Here we outline a comprehensive set of experiments adapted from current primary literature focusing on organic and inorganic synthesis, catalysis, reactivity, and reaction kinetics. The catalyst,…

Personalised Search Tool for Teachers--PoSTech!

ERIC Educational Resources Information Center

Seyedarabi, Faezeh; Peterson, Don; Keenoy, Kevin

2005-01-01

One of the ways in which teachers tend to "personalise" to the needs of their students is by complementing their teaching materials with online resources. However, the current online resources are designed in such a way that only allows teachers to customise their search and not personalise. Therefore, a Personalised Search Tool for…

Safe Schools: Unified Emergency Contingency Plan for Schools.

ERIC Educational Resources Information Center

Illinois State Police, Springfield.

This contingency plan is intended to stimulate emergency planning and provide an organizational tool for Illinois schools to use in the development of individual emergency plans. It may accommodate and complement a school's current contingency plan and will allow for the inclusion of additional material concerning school safety. It is intended as…

A Guide to Addressing Multiple Priorities in Core Content Instruction for Students with Severe Disabilities

ERIC Educational Resources Information Center

Root, Jenny R.; Knight, Victoria F.; Mims, Pamela J.

2017-01-01

Instruction in academic core content provides students with moderate to severe disabilities a full educational opportunity that promotes current and future options in the community and can complement acquisition of daily living skills. However, high school teachers face many challenges in balancing instructional priorities given the mission to…

75 FR 59411 - Defense Federal Acquisition Regulation Supplement; Patents, Data, and Copyrights (DFARS Case 2010...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-27

....'' The items ``design details, algorithms, processes, flow charts, formulas, and related material that describe the design, organization, or structure'' of computer software had been added to the current... 252.227-7018, which serves as the post-award complement to the pre-award identification and assertion...

The state of rehabilitation research: art or science?

PubMed

Tate, Denise G

2006-02-01

Rehabilitation research has been criticized as not standing up enough to the rigors of scientific method to be called "science." The field has been portrayed as slow to promote its scientific achievements and to include them under the rubric of evidence-based rehabilitation. Following in the footsteps of psychology, rehabilitation as a broad-based discipline has faced many similar obstacles in achieving scientific status. Controversy exists about what exactly constitutes rehabilitation science versus its art and its respective multidisciplinary domains. The conception of these domains is directly related to current methods available to assess the state of the discipline and its research accomplishments. I used quantitative methods, such as randomized clinical and/or controlled trials (RCTs) and systematic reviews, to assess the status of rehabilitation research. Findings suggest that, as a field, rehabilitation makes significant contributions to science, measurable by the number and quality of RCTs and systematic reviews conducted so far on topics of critical importance for clinical care. In "artful" complement, qualitative approaches can be used as research tools to aid investigators in seeking knowledge beyond that obtained by quantitative methods, assessing many complexities associated with the various contexts of rehabilitation research. Other requirements to develop a common vision of rehabilitation science are also discussed.

Growth of saprotrophic fungi and bacteria in soil.

PubMed

Rousk, Johannes; Bååth, Erland

2011-10-01

Bacterial and fungal growth rate measurements are sensitive variables to detect changes in environmental conditions. However, while considerable progress has been made in methods to assess the species composition and biomass of fungi and bacteria, information about growth rates remains surprisingly rudimentary. We review the recent history of approaches to assess bacterial and fungal growth rates, leading up to current methods, especially focusing on leucine/thymidine incorporation to estimate bacterial growth and acetate incorporation into ergosterol to estimate fungal growth. We present the underlying assumptions for these methods, compare estimates of turnover times for fungi and bacteria based on them, and discuss issues, including for example elusive conversion factors. We review what the application of fungal and bacterial growth rate methods has revealed regarding the influence of the environmental factors of temperature, moisture (including drying/rewetting), pH, as well as the influence of substrate additions, the presence of plants and toxins. We highlight experiments exploring the competitive and facilitative interaction between bacteria and fungi enabled using growth rate methods. Finally, we predict that growth methods will be an important complement to molecular approaches to elucidate fungal and bacterial ecology, and we identify methodological concerns and how they should be addressed. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Complement inhibition by hydroxychloroquine prevents placental and fetal brain abnormalities in antiphospholipid syndrome.

PubMed

Bertolaccini, Maria Laura; Contento, Gregorio; Lennen, Ross; Sanna, Giovanni; Blower, Philip J; Ma, Michelle T; Sunassee, Kavitha; Girardi, Guillermina

2016-12-01

Placental ischemic disease and adverse pregnancy outcomes are frequently observed in patients with antiphospholipid syndrome (APS). Despite the administration of conventional antithrombotic treatment a significant number of women continue to experience adverse pregnancy outcomes, with uncertain prevention and management. Efforts to develop effective pharmacological strategies for refractory obstetric APS cases will be of significant clinical benefit for both mothers and fetuses. Although the antimalarial drug, hydroxychloroquine (HCQ) is increasingly used to treat pregnant women with APS, little is known about its efficacy and mechanism of action of HCQ. Because complement activation plays a crucial and causative role in placental ischemia and abnormal fetal brain development in APS we hypothesised that HCQ prevents these pregnancy complications through inhibition of complement activation. Using a mouse model of obstetric APS that closely resembles the clinical condition, we found that HCQ prevented fetal death and the placental metabolic changes -measured by proton magnetic resonance spectroscopy in APS-mice. Using 111 In labelled antiphospholipid antibodies (aPL) we identified the placenta and the fetal brain as the main organ targets in APS-mice. Using this same method, we found that HCQ does not inhibit aPL binding to tissues as was previously suggested from in vitro studies. While HCQ did not affect aPL binding to fetal brain it prevented fetal brain abnormal cortical development. HCQ prevented complement activation in vivo and in vitro. Complement C5a levels in serum samples from APS patients and APS-mice were lower after treatment with HCQ while the antibodies titres remained unchanged. HCQ prevented not only placental insufficiency but also abnormal fetal brain development in APS. By inhibiting complement activation, HCQ might also be an effective antithrombotic therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Unmasking of complements using proteinase-K in formalin fixed paraffin embedded renal biopsies.

PubMed

Nada, R; Kumar, A; Kumar, V G; Gupta, K L; Joshi, K

2016-01-01

Renal biopsy interpretation requires histopathology, direct immunofluorescence (DIF) and electron microscopy. Formalin-fixed, paraffin-embedded tissue (FFPE) sent for light microscopy can be used for DIF after antigen retrieval. However, complement staining has not been satisfactory. We standardized DIF using proteinase-K for antigen retrieval in FFPE renal biopsies. A pilot study was conducted on known cases of membranous glomerulonephritis (MGN), membranoproliferative type-1 (MPGN-1), immunoglobulin A nephropathy (IgAN), and anti-glomerular basement disease (anti-GBM). Immunofluorescence panel included fluorescein isothiocyanate (FITC) conjugated IgG, IgA, IgM, complements (C3 and C1q), light chains (kappa, lambda) and fibrinogen antibodies. After standardization of the technique, 75 renal biopsies and 43 autopsies cases were stained. Out of 43 autopsy cases, immune-complex mediated glomerulonephritis (GN) was confirmed in 18 cases (Lupus nephritis-11, IgAN-6, MGN-1), complement-mediated dense deposit disease (DDD-1) and monoclonal diseases in 4 cases (amyloidosis-3, cast nephropathy-1). Immune-mediated injury was excluded in 17 cases (focal segmental glomerulosclerosis -3, crescentic GN-6 [pauci-immune-3, anti-GBM-3], thrombotic microangiopathy-5, atherosclerosis-3). Renal biopsies (n-75) where inadequate or no frozen sample was available; this technique classified 52 mesangiocapillary pattern as MPGN type-1-46, DDD-2 and (C3GN-4). Others were diagnosed as IgAN-3, lupus nephritis-2, MGN-4, diffuse proliferative glomerulonephritis (DPGN)-1, Non-IC crescentic GN-1, monoclonal diseases-3. In nine cases, DIF on FFPE tissue could not help in making diagnosis. Proteinase-K enzymatic digestion of FFPE renal biopsies can unmask complements (both C3 and C1q) in immune-complexes mediated and complement-mediated diseases. This method showed good results on autopsy tissues archived for as long as 15 years.

Genetics Home Reference: Fanconi anemia

MedlinePlus

... D1 Genetic Testing Registry: Fanconi anemia, complementation group D2 Genetic Testing Registry: Fanconi anemia, complementation group E ... ANEMIA, COMPLEMENTATION GROUP D1 FANCONI ANEMIA, COMPLEMENTATION GROUP D2 FANCONI ANEMIA, COMPLEMENTATION GROUP E FANCONI ANEMIA, COMPLEMENTATION ...

Use of Phage Display to Identify Novel Mineralocorticoid Receptor-Interacting Proteins

PubMed Central

Yang, Jun; Fuller, Peter J.; Morgan, James; Shibata, Hirotaka; McDonnell, Donald P.; Clyne, Colin D.

2014-01-01

The mineralocorticoid receptor (MR) plays a central role in salt and water homeostasis via the kidney; however, inappropriate activation of the MR in the heart can lead to heart failure. A selective MR modulator that antagonizes MR signaling in the heart but not the kidney would provide the cardiovascular protection of current MR antagonists but allow for normal electrolyte balance. The development of such a pharmaceutical requires an understanding of coregulators and their tissue-selective interactions with the MR, which is currently limited by the small repertoire of MR coregulators described in the literature. To identify potential novel MR coregulators, we used T7 phage display to screen tissue-selective cDNA libraries for MR-interacting proteins. Thirty MR binding peptides were identified, from which three were chosen for further characterization based on their nuclear localization and their interaction with other MR-interacting proteins or, in the case of x-ray repair cross-complementing protein 6, its known status as an androgen receptor coregulator. Eukaryotic elongation factor 1A1, structure-specific recognition protein 1, and x-ray repair cross-complementing protein 6 modulated MR-mediated transcription in a ligand-, cell- and/or promoter-specific manner and colocalized with the MR upon agonist treatment when imaged using immunofluorescence microscopy. These results highlight the utility of phage display for rapid and sensitive screening of MR binding proteins and suggest that eukaryotic elongation factor 1A1, structure-specific recognition protein 1, and x-ray repair cross-complementing protein 6 may be potential MR coactivators whose activity is dependent on the ligand, cellular context, and target gene promoter. PMID:25000480

Development of an opsonophagocytic killing assay for group a streptococcus.

PubMed

Jones, Scott; Moreland, Nicole J; Zancolli, Marta; Raynes, Jeremy; Loh, Jacelyn M S; Smeesters, Pierre R; Sriskandan, Shiranee; Carapetis, Jonathan R; Fraser, John D; Goldblatt, David

2018-05-15

Group A Streptococcus (GAS) or Streptococcus pyogenes is responsible for an estimated 500,000 deaths worldwide each year. Protection against GAS infection is thought to be mediated by phagocytosis, enhanced by bacteria-specific antibody. There are no licenced GAS vaccines, despite many promising candidates in preclinical and early stage clinical development, the most advanced of which are based on the GAS M-protein. Vaccine progress has been hindered, in part, by the lack of a standardised functional assay suitable for vaccine evaluation. Current assays, developed over 50 years ago, rely on non-immune human whole blood as a source of neutrophils and complement. Variations in complement and neutrophil activity between donors result in variable data that is difficult to interpret. We have developed an opsonophagocytic killing assay (OPKA) for GAS that utilises dimethylformamide (DMF)-differentiated human promyelocytic leukemia cells (HL-60) as a source of neutrophils and baby rabbit complement, thus removing the major sources of variation in current assays. We have standardised the OPKA for several clinically relevant GAS strain types (emm1, emm6 and emm12) and have shown antibody-specific killing for each emm-type using M-protein specific rabbit antisera. Specificity was demonstrated by pre-incubation of the antisera with homologous M-protein antigens that blocked antibody-specific killing. Additional qualifications of the GAS OPKA, including the assessment of the accuracy, precision, linearity and the lower limit of quantification, were also performed. This GAS OPKA assay has the potential to provide a robust and reproducible platform to accelerate GAS vaccine development. Copyright © 2018 Elsevier Ltd. All rights reserved.

Consensus on context-specific strategies for reducing the stigma of human immunodeficiency virus/acquired immunodeficiency syndrome in Zambézia Province, Mozambique.

PubMed

Mukolo, Abraham; Torres, Isabel; Bechtel, Ruth M; Sidat, Mohsin; Vergara, Alfredo E

2013-01-01

Stigma has been implicated in poor outcomes of human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) care. Reducing stigma is important for HIV prevention and long-term treatment success. Although stigma reduction interventions are conducted in Mozambique, little is known about the current nature of stigma and the efficacy and effectiveness of stigma reduction initiatives. We describe action research to generate consensus on critical characteristics of HIV stigma and anti-stigma interventions in Zambézia Province, Mozambique. Qualitative data gathering methods, including in-depth key-informant interviews, community interviews and consensus group sessions, were utilized. Delphi methods and the strategic options development analysis technique were used to synthesize qualitative data. Key findings are that stigma enacted by the general public might be declining in tandem with the HIV/AIDS epidemic in Mozambique, but there is likely excessive residual fear of HIV disease and community attitudes that sustain high levels of perceived stigma. HIV-positive women accessing maternal and child health services appear to shoulder a disproportionate burden of stigma. Unintentional biases among healthcare providers are currently the critical frontier of stigmatization, but there are few interventions designed to address them. Culturally sensitive psychotherapies are needed to address psychological distress associated with internalized stigma and these interventions should complement current supports for voluntary counseling and testing. While advantageous for defining stakeholder priorities for stigma reduction efforts, confirmatory quantitative studies of these consensus positions are needed before the launch of specific interventions.

Modulation of risk of squamous cell carcinoma head and neck in North Indian population with polymorphisms in xeroderma pigmentosum complementation Group C gene.

PubMed

Yadav, Suresh Kumar; Singh, Sudhir; Gupta, Shalini; Brahma Bhatt, Madan Lal; Mishra, Durga P; Roy, D; Sanyal, Somali

2018-01-01

Genetic variations in nucleotide excision repair genes can alter the risk of squamous cell carcinoma of head and neck (SCCHN). The present study has genotyped 334 subjects from North Indian population for xeroderma pigmentosum complementation Group C (XPC) rs2228001A>C, XPC rs77907221 polyadenylate (PAT) deletion/insertion (D/I), xeroderma pigmentosum complementation Group D - rs13181A>C, and xeroderma pigmentosum complementation Type G rs17655 G>C polymorphisms with polymerase chain reaction (PCR)-restriction-fragment length polymorphism or allele-specific PCR methods. Compared to D allele, I allele for XPC PAT D/I polymorphism was associated with significantly decreased the risk of SCCHN (odds ratios = 0.67, 95% confidence interval [CI] =0.48-0.94, P = 0.03). Haplotype CI constituted from XPC polymorphisms was also associated with decreased risk of SCCHN (P = 0.004). In contrast, haplotype Crohn's disease significantly increased the risk for SCCHN (P < 0.00). A significant early onset of SCCHN was observed in individuals with CC genotype for XPC A>C polymorphism (P = 0.004). Our results suggest a possible risk modulation for SCCHN with XPC polymorphisms in North Indian population.

Anticomplementary activity of horse IgG and F(ab')2 antivenoms.

PubMed

Squaiella-Baptistão, Carla Cristina; Marcelino, José Roberto; Ribeiro da Cunha, Luiz Eduardo; Gutiérrez, José María; Tambourgi, Denise V

2014-03-01

Envenomation by poisonous animals is a neglected condition according to the World Health Organization (WHO). Antivenoms are included in the WHO Essential Medicines List. It has been assumed that immunoglobulin G (IgG) antivenoms could activate the complement system through Fc and induce early adverse reactions (EARs). However, data in the literature indicate that F(ab')2 fragments can also activate the complement system. Herein, we show that several batches of IgG and F(ab')2 antivenoms from the Butantan, Vital Brazil, and Clodomiro Picado Institutes activated the complement classical pathway and induced the production of C3a; however, only those antivenoms from Clodomiro Picado generated C5a. Different protein profiles (IgG heavy chain, protein contaminants, and aggregates) were observed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analyses. Our results show that various antivenoms from different producers are able to activate the classical pathway of the complement system and generate anaphylatoxins, and these findings suggest that factors, such as composition, contaminant proteins, and aggregates, may influence the anticomplementary activity of antivenoms in vitro. Therefore, there is a need to further improve antivenom production methods to reduce their anticomplementary activity and potential to cause EARs.

Developing Investigative Entry Points: Exploring the Use of Quantitative Methods in English Education Research

ERIC Educational Resources Information Center

McGraner, Kristin L.; Robbins, Daniel

2010-01-01

Although many research questions in English education demand the use of qualitative methods, this paper will briefly explore how English education researchers and doctoral students may use statistics and quantitative methods to inform, complement, and/or deepen their inquiries. First, the authors will provide a general overview of the survey areas…

Research Methods in Healthcare Epidemiology: Survey and Qualitative Research.

PubMed

Safdar, Nasia; Abbo, Lilian M; Knobloch, Mary Jo; Seo, Susan K

2016-11-01

Surveys are one of the most frequently employed study designs in healthcare epidemiology research. Generally easier to undertake and less costly than many other study designs, surveys can be invaluable to gain insights into opinions and practices in large samples and may be descriptive and/or be used to test associations. In this context, qualitative research methods may complement this study design either at the survey development phase and/or at the interpretation/extension of results stage. This methods article focuses on key considerations for designing and deploying surveys in healthcare epidemiology and antibiotic stewardship, including identification of whether or not de novo survey development is necessary, ways to optimally lay out and display a survey, denominator measurement, discussion of biases to keep in mind particularly in research using surveys, and the role of qualitative research methods to complement surveys. We review examples of surveys in healthcare epidemiology and antimicrobial stewardship and review the pros and cons of methods used. A checklist is provided to help aid design and deployment of surveys in healthcare epidemiology and antimicrobial stewardship. Infect Control Hosp Epidemiol 2016;1-6.

Research Methods in Healthcare Epidemiology: Survey and Qualitative Research

PubMed Central

Safdar, Nasia; Abbo, Lilian M.; Knobloch, Mary Jo; Seo, Susan K.

2017-01-01

Surveys are one of the most frequently employed study designs in healthcare epidemiology research. Generally easier to undertake and less costly than many other study designs, surveys can be invaluable to gain insights into opinions and practices in large samples and may be descriptive and/or be used to test associations. In this context, qualitative research methods may complement this study design either at the survey development phase and/or at the interpretation/extension of results stage. This methods article focuses on key considerations for designing and deploying surveys in healthcare epidemiology and antibiotic stewardship, including identification of whether or not de novo survey development is necessary, ways to optimally lay out and display a survey, denominator measurement, discussion of biases to keep in mind particularly in research using surveys, and the role of qualitative research methods to complement surveys. We review examples of surveys in healthcare epidemiology and antimicrobial stewardship and review the pros and cons of methods used. A checklist is provided to help aid design and deployment of surveys in healthcare epidemiology and antimicrobial stewardship. PMID:27514583

Cognitive training and plasticity: Theoretical perspective and methodological consequences

PubMed Central

Willis, Sherry L.; Schaie, K. Warner

2013-01-01

Purpose To provide an overview of cognitive plasticity concepts and findings from a lifespan developmental perspective. Methods After an evaluation of the general concept of cognitive plasticity, the most important approaches to study behavioral and brain plasticity are reviewed. This includes intervention studies, experimental approaches, cognitive trainings, the study of facilitating factors for strategy learning and strategy use, practice, and person-environment interactions. Transfer and durability of training-induced plasticity is discussed. Results The review indicates that methodological and conceptual advances are needed to improve the match between levels of behavioral and brain plasticity targeted in current developmental research and study designs. Conclusions The results suggest that the emphasis of plasticity studies on treatment effectiveness needs to be complemented by a strong commitment to the grounding of the intervention in a conceptual framework. PMID:19847065

Virulence Associated Gene 8 of Bordetella pertussis Enhances Contact System Activity by Inhibiting the Regulatory Function of Complement Regulator C1 Inhibitor

PubMed Central

Hovingh, Elise S.; de Maat, Steven; Cloherty, Alexandra P. M.; Johnson, Steven; Pinelli, Elena; Maas, Coen; Jongerius, Ilse

2018-01-01

Bordetella pertussis is a Gram-negative bacterium and the causative agent of whooping cough. Whooping cough is currently re-emerging worldwide and, therefore, still poses a continuous global health threat. B. pertussis expresses several virulence factors that play a role in evading the human immune response. One of these virulence factors is virulence associated gene 8 (Vag8). Vag8 is a complement evasion molecule that mediates its effects by binding to the complement regulator C1 inhibitor (C1-INH). This regulatory protein is a fluid phase serine protease that controls proenzyme activation and enzyme activity of not only the complement system but also the contact system. Activation of the contact system results in the generation of bradykinin, a pro-inflammatory peptide. Here, the activation of the contact system by B. pertussis was explored. We demonstrate that recombinant as well as endogenous Vag8 enhanced contact system activity by binding C1-INH and attenuating its inhibitory function. Moreover, we show that B. pertussis itself is able to activate the contact system. This activation was dependent on Vag8 production as a Vag8 knockout B. pertussis strain was unable to activate the contact system. These findings show a previously overlooked interaction between the contact system and the respiratory pathogen B. pertussis. Activation of the contact system by B. pertussis may contribute to its pathogenicity and virulence. PMID:29915576

The alternative complement component factor B regulates UV-induced oedema, systemic suppression of contact and delayed hypersensitivity, and mast cell infiltration into the skin.

PubMed

Byrne, Scott N; Hammond, Kirsten J L; Chan, Carling Y-Y; Rogers, Linda J; Beaugie, Clare; Rana, Sabita; Marsh-Wakefield, Felix; Thurman, Joshua M; Halliday, Gary M

2015-04-01

Ultraviolet (UV) wavelengths in sunlight are the prime cause of skin cancer in humans with both the UVA and UVB wavebands making a contribution to photocarcinogenesis. UV has many different biological effects on the skin that contribute to carcinogenesis, including suppression of adaptive immunity, sunburn and altering the migration of mast cells into and away from irradiated skin. Many molecular mechanisms have been identified as contributing to skin responses to UV. Recently, using gene set enrichment analysis of microarray data, we identified the alternative complement pathway with a central role for factor B (fB) in UVA-induced immunosuppression. In the current study we used mice genetically deficient in fB (fB-/- mice) to study the functional role of the alternative complement pathway in skin responses to UV. We found that fB is required for not only UVA but also UVB-induced immunosuppression and solar-simulated UV induction of the oedemal component of sunburn. Factor B-/- mice had a larger number of resident skin mast cells than control mice, but unlike the controls did not respond to UV by increasing mast cell infiltration into the skin. This study provides evidence for a function role for fB in skin responses to UV radiation. Factor B regulates UVA and UVB induced immunosuppression, UV induced oedema and mast cell infiltration into the skin. The alternative complement pathway is therefore an important regulator of skin responses to UV.

Virulence Associated Gene 8 of Bordetella pertussis Enhances Contact System Activity by Inhibiting the Regulatory Function of Complement Regulator C1 Inhibitor.

PubMed

Hovingh, Elise S; de Maat, Steven; Cloherty, Alexandra P M; Johnson, Steven; Pinelli, Elena; Maas, Coen; Jongerius, Ilse

2018-01-01

Bordetella pertussis is a Gram-negative bacterium and the causative agent of whooping cough. Whooping cough is currently re-emerging worldwide and, therefore, still poses a continuous global health threat. B. pertussis expresses several virulence factors that play a role in evading the human immune response. One of these virulence factors is virulence associated gene 8 (Vag8). Vag8 is a complement evasion molecule that mediates its effects by binding to the complement regulator C1 inhibitor (C1-INH). This regulatory protein is a fluid phase serine protease that controls proenzyme activation and enzyme activity of not only the complement system but also the contact system. Activation of the contact system results in the generation of bradykinin, a pro-inflammatory peptide. Here, the activation of the contact system by B. pertussis was explored. We demonstrate that recombinant as well as endogenous Vag8 enhanced contact system activity by binding C1-INH and attenuating its inhibitory function. Moreover, we show that B. pertussis itself is able to activate the contact system. This activation was dependent on Vag8 production as a Vag8 knockout B. pertussis strain was unable to activate the contact system. These findings show a previously overlooked interaction between the contact system and the respiratory pathogen B. pertussis . Activation of the contact system by B. pertussis may contribute to its pathogenicity and virulence.

The role of language in the development of false belief understanding: a training study.

PubMed

Lohmann, Heidemarie; Tomasello, Michael

2003-01-01

The current study used a training methodology to determine whether different kinds of linguistic interaction play a causal role in children's development of false belief understanding. After 3 training sessions, 3-year-old children improved their false belief understanding both in a training condition involving perspective-shifting discourse about deceptive objects (without mental state terms) and in a condition in which sentential complement syntax was used (without deceptive objects). Children did not improve in a condition in which they were exposed to deceptive objects without accompanying language. Children showed most improvement in a condition using both perspective-shifting discourse and sentential complement syntax, suggesting that each of these types of linguistic experience plays an independent role in the ontogeny of false belief understanding.

Generation of a U.S. national urban land use product

USGS Publications Warehouse

Falcone, James A.; Homer, Collin G.

2012-01-01

Characterization of urban land uses is essential for many applications. However, differentiating among thematically-detailed urban land uses (residential, commercial, industrial, institutional, recreational, etc.) over broad areas is challenging, in part because image-based solutions are not ideal for establishing the contextual basis for identifying economic function and use. At present no current United States national-scale mapping exists for urban land uses similar to the classical Anderson Level II classification. This paper describes a product that maps urban land uses, and is linked to and corresponds with the National Land Cover Database (NLCD) 2006. In this product, NLCD urban pixels, in addition to their current imperviousness intensity classification, are assigned one of nine urban use classes based on information drawn from multiple data sources. These sources include detailed infrastructure information, population characteristics, and historical land use. The result is a method for creating a 30 m national-scale grid providing thematically-detailed urban land use information which complements the NLCD. Initial results for 10 major metropolitan areas are provided as an on-line link. Accuracy assessment of initial products yielded an overall accuracy of 81.6 percent.

Mapping human dimensions of climate change research in the Canadian Arctic.

PubMed

Ford, James D; Bolton, Kenyon; Shirley, Jamal; Pearce, Tristan; Tremblay, Martin; Westlake, Michael

2012-12-01

This study maps current understanding and research trends on the human dimensions of climate change (HDCC) in the eastern and central Canadian Arctic. Developing a systematic literature review methodology, 117 peer reviewed articles are identified and examined using quantitative and qualitative methods. The research highlights the rapid expansion of HDCC studies over the last decade. Early scholarship was dominated by work documenting Inuit observations of climate change, with research employing vulnerability concepts and terminology now common. Adaptation studies which seek to identify and evaluate opportunities to reduce vulnerability to climate change and take advantage of new opportunities remain in their infancy. Over the last 5 years there has been an increase social science-led research, with many studies employing key principles of community-based research. We currently have baseline understanding of climate change impacts, adaptation, and vulnerability in the region, but key gaps are evident. Future research needs to target significant geographic disparities in understanding, consider risks and opportunities posed by climate change outside of the subsistence hunting sector, complement case study research with regional analyses, and focus on identifying and characterizing sustainable and feasible adaptation interventions.

Development of the Digital Arthritis Index, a Novel Metric to Measure Disease Parameters in a Rat Model of Rheumatoid Arthritis.

PubMed

Lim, Maria A; Louie, Brenton; Ford, Daniel; Heath, Kyle; Cha, Paulyn; Betts-Lacroix, Joe; Lum, Pek Yee; Robertson, Timothy L; Schaevitz, Laura

2017-01-01

Despite a broad spectrum of anti-arthritic drugs currently on the market, there is a constant demand to develop improved therapeutic agents. Efficient compound screening and rapid evaluation of treatment efficacy in animal models of rheumatoid arthritis (RA) can accelerate the development of clinical candidates. Compound screening by evaluation of disease phenotypes in animal models facilitates preclinical research by enhancing understanding of human pathophysiology; however, there is still a continuous need to improve methods for evaluating disease. Current clinical assessment methods are challenged by the subjective nature of scoring-based methods, time-consuming longitudinal experiments, and the requirement for better functional readouts with relevance to human disease. To address these needs, we developed a low-touch, digital platform for phenotyping preclinical rodent models of disease. As a proof-of-concept, we utilized the rat collagen-induced arthritis (CIA) model of RA and developed the Digital Arthritis Index (DAI), an objective and automated behavioral metric that does not require human-animal interaction during the measurement and calculation of disease parameters. The DAI detected the development of arthritis similar to standard in vivo methods, including ankle joint measurements and arthritis scores, as well as demonstrated a positive correlation to ankle joint histopathology. The DAI also determined responses to multiple standard-of-care (SOC) treatments and nine repurposed compounds predicted by the SMarTR TM Engine to have varying degrees of impact on RA. The disease profiles generated by the DAI complemented those generated by standard methods. The DAI is a highly reproducible and automated approach that can be used in-conjunction with standard methods for detecting RA disease progression and conducting phenotypic drug screens.

A Genetic and Molecular Analysis of the 46c Chromosomal Region Surrounding the Fmrfamide Neuropeptide Gene in Drosophila Melanogaster

PubMed Central

O'Brien, M. A.; Roberts, M. S.; Taghert, P. H.

1994-01-01

We have analyzed the FMRFamide neuropeptide gene region of Drosophila melanogaster. This gene maps to the 46C region of chromosome 2R; this interval previously was not well characterized. For this genetic and molecular analysis, we have used X-ray mutagenesis, EMS mutagenesis, and the recently reported local P element transposition method. We identified four overlapping deletions, two of which have proximal breakpoints that define a 50-60-kb region surrounding the FMRFamide gene in 46C. To this small region, we mapped three lethal complementation groups; 10 additional lethal complementation groups were mapped to more distal regions of 46CD. One of these groups corresponds to even-skipped, the other 12 are previously unidentified. Using various lines of evidence we excluded the possibility that FMRFamide corresponds to any of the three lethal complementation groups mapping to its immediate 50-60-kb vicinity. The positions of two of the three lethal complementation groups were identified with P elements using a local transposition scheme. The third lethal complementation group was excluded as being FMRFamide mutants by sequence analysis and by immunocytochemistry with proFMRFamide precursor-specific antibodies. This analysis has (1) provided a genetic map of the 46CD chromosomal region and a detailed molecular map of a portion of the 46C region and (2) provided additional evidence of the utility of local transposition for targeting nearby genes. PMID:8056304

pDHS-SVM: A prediction method for plant DNase I hypersensitive sites based on support vector machine.

PubMed

Zhang, Shanxin; Zhou, Zhiping; Chen, Xinmeng; Hu, Yong; Yang, Lindong

2017-08-07

DNase I hypersensitive sites (DHSs) are accessible chromatin regions hypersensitive to cleavages by DNase I endonucleases. DHSs are indicative of cis-regulatory DNA elements (CREs), all of which play important roles in global gene expression regulation. It is helpful for discovering CREs by recognition of DHSs in genome. To accelerate the investigation, it is an important complement to develop cost-effective computational methods to identify DHSs. However, there is a lack of tools used for identifying DHSs in plant genome. Here we presented pDHS-SVM, a computational predictor to identify plant DHSs. To integrate the global sequence-order information and local DNA properties, reverse complement kmer and dinucleotide-based auto covariance of DNA sequences were applied to construct the feature space. In this work, fifteen physical-chemical properties of dinucleotides were used and Support Vector Machine (SVM) was employed. To further improve the performance of the predictor and extract an optimized subset of nucleotide physical-chemical properties positive for the DHSs, a heuristic nucleotide physical-chemical property selection algorithm was introduced. With the optimized subset of properties, experimental results of Arabidopsis thaliana and rice (Oryza sativa) showed that pDHS-SVM could achieve accuracies up to 87.00%, and 85.79%, respectively. The results indicated the effectiveness of proposed method for predicting DHSs. Furthermore, pDHS-SVM could provide a helpful complement for predicting CREs in plant genome. Our implementation of the novel proposed method pDHS-SVM is freely available as source code, at https://github.com/shanxinzhang/pDHS-SVM. Copyright © 2017 Elsevier Ltd. All rights reserved.

On Systems Thinking and Ways of Building It in Learning

ERIC Educational Resources Information Center

Abdyrova, Aitzhan; Galiyev, Temir; Yessekeshova, Maral; Aldabergenova, Saule; Alshynbayeva, Zhuldyz

2016-01-01

The article focuses on the issue of shaping learners' systems thinking skills in the context of traditional education using specially elaborated system methods that are implemented based on the standard textbook. Applying these methods naturally complements the existing learning process and contributes to an efficient development of learners'…

Interactive Anatomical and Surgical Live Stream Lectures Improve Students' Academic Performance in Applied Clinical Anatomy

ERIC Educational Resources Information Center

Shiozawa, Thomas; Butz, Benjamin; Herlan, Stephan; Kramer, Andreas; Hirt, Bernhard

2017-01-01

Tuebingen's "Sectio Chirurgica" (TSC) is an innovative, interactive, multimedia, and transdisciplinary teaching method designed to complement dissection courses. The Tuebingen's "Sectio Chirurgica" (TSC) allows clinical anatomy to be taught via interactive live stream surgeries moderated by an anatomist. This method aims to…

Trustworthiness and Authenticity: Alternate Ways To Judge Authentic Assessments.

ERIC Educational Resources Information Center

Hipps, Jerome A.

New methods are needed to judge the quality of alternative student assessment, methods which complement the philosophy underlying authentic assessments. This paper examines assumptions underlying validity, reliability, and objectivity, and why they are not matched to authentic assessment, concentrating on the constructivist paradigm of E. Guba and…

Guinea pig complement potently measures vibriocidal activity of human antibodies in response to cholera vaccines.

PubMed

Kim, Kyoung Whun; Jeong, Soyoung; Ahn, Ki Bum; Yang, Jae Seung; Yun, Cheol-Heui; Han, Seung Hyun

2017-12-01

The vibriocidal assay using guinea pig complement is widely used for the evaluation of immune responses to cholera vaccines in human clinical trials. However, it is unclear why guinea pig complement has been used over human complement in the measurement of vibriocidal activity of human sera and there have not been comparison studies for the use of guinea pig complement over those from other species. Therefore, we comparatively investigated the effects of complements derived from human, guinea pig, rabbit, and sheep on vibriocidal activity. Complements from guinea pig, rabbit, and human showed concentration-dependent vibriocidal activity in the presence of quality control serum antibodies. Of these complements, guinea pig complement was the most sensitive and effective over a wide concentration range. When the vibriocidal activity of complements was measured in the absence of serum antibodies, human, sheep, and guinea pig complements showed vibriocidal activity up to 40-fold, 20-fold, and 1-fold dilution, respectively. For human pre- and post-vaccination sera, the most potent vibriocidal activity was observed when guinea pig complement was used. In addition, the highest fold-increases between pre- and post- vaccinated sera were obtained with guinea pig complement. Furthermore, human complement contained a higher amount of V. cholerae- and its lipopolysaccharide-specific antibodies than guinea pig complement. Collectively, these results suggest that guinea pig complements are suitable for vibriocidal assays due to their high sensitivity and effectiveness to human sera.

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Physico-chemical properties of manufactured nanomaterials - Characterisation and relevant methods. An outlook based on the OECD Testing Programme.

PubMed

Rasmussen, Kirsten; Rauscher, Hubert; Mech, Agnieszka; Riego Sintes, Juan; Gilliland, Douglas; González, Mar; Kearns, Peter; Moss, Kenneth; Visser, Maaike; Groenewold, Monique; Bleeker, Eric A J

2018-02-01

Identifying and characterising nanomaterials require additional information on physico-chemical properties and test methods, compared to chemicals in general. Furthermore, regulatory decisions for chemicals are usually based upon certain toxicological properties, and these effects may not be equivalent to those for nanomaterials. However, regulatory agencies lack an authoritative decision framework for nanomaterials that links the relevance of certain physico-chemical endpoints to toxicological effects. This paper investigates various physico-chemical endpoints and available test methods that could be used to produce such a decision framework for nanomaterials. It presents an overview of regulatory relevance and methods used for testing fifteen proposed physico-chemical properties of eleven nanomaterials in the OECD Working Party on Manufactured Nanomaterials' Testing Programme, complemented with methods from literature, and assesses the methods' adequacy and applications limits. Most endpoints are of regulatory relevance, though the specific parameters depend on the nanomaterial and type of assessment. Size (distribution) is the common characteristic of all nanomaterials and is decisive information for classifying a material as a nanomaterial. Shape is an important particle descriptor. The octanol-water partitioning coefficient is undefined for particulate nanomaterials. Methods, including sample preparation, need to be further standardised, and some new methods are needed. The current work of OECD's Test Guidelines Programme regarding physico-chemical properties is highlighted. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Introducing Stochastic Simulation of Chemical Reactions Using the Gillespie Algorithm and MATLAB: Revisited and Augmented

ERIC Educational Resources Information Center

Argoti, A.; Fan, L. T.; Cruz, J.; Chou, S. T.

2008-01-01

The stochastic simulation of chemical reactions, specifically, a simple reversible chemical reaction obeying the first-order, i.e., linear, rate law, has been presented by Martinez-Urreaga and his collaborators in this journal. The current contribution is intended to complement and augment their work in two aspects. First, the simple reversible…

E-Learning from a Student's View with Focus on Global Studies

ERIC Educational Resources Information Center

Bader, Lena; Kottstorfer, Marlene

2013-01-01

Purpose: The current Internet Outlook of the OECD states that e-learning has the potential to revolutionise education and learning--if complemented by suitable didactic approaches. Therefore, the situation of e-learning is analysed from a student's perspective with focus on a new master program in Global Studies. The purpose of this paper is to…

Barriers to Support: A Qualitative Exploration into the Help-Seeking and Avoidance Factors of Young Adults

ERIC Educational Resources Information Center

Seamark, Daniel; Gabriel, Lynne

2018-01-01

The current research explores young adults' beliefs, awareness and understanding surrounding help-seeking behaviour in relation to barriers preventing access to counselling support. The literature suggests that several barriers, such as a lack of awareness, stigma and gender roles, will have a negative influence on help-seeking. To complement and…

iVirtualWorld: A Domain-Oriented End-User Development Environment for Building 3D Virtual Chemistry Experiments

ERIC Educational Resources Information Center

Zhong, Ying

2013-01-01

Virtual worlds are well-suited for building virtual laboratories for educational purposes to complement hands-on physical laboratories. However, educators may face technical challenges because developing virtual worlds requires skills in programming and 3D design. Current virtual world building tools are developed for users who have programming…

Improving the Current DHS Capabilities Framework

DTIC Science & Technology

2008-09-01

80 4. Pros and Cons .....................................................................................80 5. Performance Measurement... pros and cons . The chapter also provides a graphic of the proposed framework. • Chapter V – “The Road Ahead.” This chapter discovers and suggests...wheels, tires, tire pattern, tire width, and height to complement achieving the outcome. Finally, Jim considered the pros and cons of his new

Is Active Learning Like Broccoli? Student Perceptions of Active Learning in Large Lecture Classes

ERIC Educational Resources Information Center

Smith, C. Veronica; Cardaciotto, LeeAnn

2011-01-01

Although research suggests that active learning is associated with positive outcomes (e.g., memory, test performance), use of such techniques can be difficult to implement in large lecture-based classes. In the current study, 1,091 students completed out-of-class group exercises to complement course material in an Introductory Psychology class.…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xing, Yingjie, E-mail: xingyj@pku.edu.cn; Li, Shuai; Wang, Guiwei

The donor/acceptor heterojunction plays an important role in organic solar cells. An investigation of band bending in the donor/acceptor heterojunction is helpful in analysis of the charge transport behavior and for the improvement of the device performance. In this work, we report an approach for detection of band bending in a donor/acceptor heterojunction that has been prepared on a small and sharp tungsten tip. In situ field emission measurements are performed after the deposition process, and a linear Fowler-Nordheim plot is obtained from the fresh organic film surface. The thickness-dependent work function is then measured in the layer-by-layer deposited heterojunction.more » Several different types of heterojunction (zinc phthalocyanine (ZnPc)/C60, copper phthalocyanine (CuPc)/3,4,9,10-perylenetetracarboxylic bisbenzimidazole, and CuPc/C60) are fabricated and analyzed. The different charge transfer directions in the heterojunctions are distinguished by field emission measurements. The calculation method used to determine the band bending is then discussed in detail. A triple layer heterojunction (C60/ZnPc/CuPc) is also analyzed using this method. A small amount of band bending is measured in the outer CuPc layer. This method provides an independent reference method for determination of the band bending in an organic heterojunction that will complement photoemission spectroscopy and current-voltage measurement methods.« less

Feminist Pedagogy and the Socratic Method: Partners in the Classroom or a Disaster Waiting to Happen?

ERIC Educational Resources Information Center

Shah, Rita; Kopko, Kyle C.

2016-01-01

This article presents a case study analyzing the relationship between the Socratic method and feminist pedagogy in a team-taught undergraduate classroom in the United States. Specifically, we analyze the feedback provided by our students to determine the ways in which the Socratic method conflicted with, but also complemented, feminist pedagogy.…

Monte Carlo closure for moment-based transport schemes in general relativistic radiation hydrodynamic simulations

NASA Astrophysics Data System (ADS)

Foucart, Francois

2018-04-01

General relativistic radiation hydrodynamic simulations are necessary to accurately model a number of astrophysical systems involving black holes and neutron stars. Photon transport plays a crucial role in radiatively dominated accretion discs, while neutrino transport is critical to core-collapse supernovae and to the modelling of electromagnetic transients and nucleosynthesis in neutron star mergers. However, evolving the full Boltzmann equations of radiative transport is extremely expensive. Here, we describe the implementation in the general relativistic SPEC code of a cheaper radiation hydrodynamic method that theoretically converges to a solution of Boltzmann's equation in the limit of infinite numerical resources. The algorithm is based on a grey two-moment scheme, in which we evolve the energy density and momentum density of the radiation. Two-moment schemes require a closure that fills in missing information about the energy spectrum and higher order moments of the radiation. Instead of the approximate analytical closure currently used in core-collapse and merger simulations, we complement the two-moment scheme with a low-accuracy Monte Carlo evolution. The Monte Carlo results can provide any or all of the missing information in the evolution of the moments, as desired by the user. As a first test of our methods, we study a set of idealized problems demonstrating that our algorithm performs significantly better than existing analytical closures. We also discuss the current limitations of our method, in particular open questions regarding the stability of the fully coupled scheme.

Complement Activation in Inflammatory Skin Diseases

PubMed Central

Giang, Jenny; Seelen, Marc A. J.; van Doorn, Martijn B. A.; Rissmann, Robert; Prens, Errol P.; Damman, Jeffrey

2018-01-01

The complement system is a fundamental part of the innate immune system, playing a crucial role in host defense against various pathogens, such as bacteria, viruses, and fungi. Activation of complement results in production of several molecules mediating chemotaxis, opsonization, and mast cell degranulation, which can contribute to the elimination of pathogenic organisms and inflammation. Furthermore, the complement system also has regulating properties in inflammatory and immune responses. Complement activity in diseases is rather complex and may involve both aberrant expression of complement and genetic deficiencies of complement components or regulators. The skin represents an active immune organ with complex interactions between cellular components and various mediators. Complement involvement has been associated with several skin diseases, such as psoriasis, lupus erythematosus, cutaneous vasculitis, urticaria, and bullous dermatoses. Several triggers including auto-antibodies and micro-organisms can activate complement, while on the other hand complement deficiencies can contribute to impaired immune complex clearance, leading to disease. This review provides an overview of the role of complement in inflammatory skin diseases and discusses complement factors as potential new targets for therapeutic intervention. PMID:29713318

BIOSENSORS FOR ENVIRONMENTAL MONITORING: A REGULATORY PERSPECTIVE

EPA Science Inventory

Biosensors show the potential to complement laboratory-based analytical methods for environmental applications. Although biosensors for potential environmental-monitoring applications have been reported for a wide range of environmental pollutants, from a regulatory perspective, ...

Clinical endpoints for developing pharmaceuticals to manage patients with sporadic or genetic risk of colorectal cancer

PubMed Central

Rial, Nathaniel S.; Zell, Jason A.; Cohen, Alfred M.; Gerner, Eugene W.

2013-01-01

To reduce the morbidity and mortality from colorectal cancer, current clinical practice focuses on screening for early detection and polypectomy as a form of secondary prevention, complemented with surgical interventions when appropriate. No pharmaceutical agent is currently approved for use in clinical practice for the management of patients with risk of colorectal cancer. This article will review earlier attempts to develop pharmaceuticals for use in managing patients with sporadic or genetic risk of colorectal cancer. It will also discuss therapeutic endpoints under evaluation in current efforts to develop drugs for treating colorectal cancer risk factors. PMID:22928902

Electrical Prospecting Methods Employed by Junta de Energia Nuclear. Report No. 28; METODOS DE PROSPECCAO ELECTRICA ADOPTADOS NA JUNTA DE ENERGIA NUCLEAR. MEMORIA NO. 28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferrao, C.A.N.

1960-01-01

The electrical prospecting methods are described which bave been incorporated in the routine operations of the Prospecting and Mining Services. The methods are concerned with structure and are useful in prospecting for uranium, other minerals, and water. The methods were developed to complement other existing prospecting methods and to provide geological and structural information. (J.R.D.)

Assessing the search for information on Three Rs methods, and their subsequent implementation: a national survey among scientists in the Netherlands.

PubMed

van Luijk, Judith; Cuijpers, Yvonne; van der Vaart, Lilian; Leenaars, Marlies; Ritskes-Hoitinga, Merel

2011-10-01

A local survey conducted among scientists into the current practice of searching for information on Three Rs (i.e. Replacement, Reduction and Refinement) methods has highlighted the gap between the statutory requirement to apply Three Rs methods and the lack of criteria to search for them. To verify these findings on a national level, we conducted a survey among scientists throughout The Netherlands. Due to the low response rate, the results give an impression of opinions, rather than being representative of The Netherlands as a whole. The findings of both surveys complement each other, and indicate that there is room for improvement. Scientists perceive searching the literature for information on Three Rs methods to be a difficult task, and specific Three Rs search skills and knowledge of Three Rs databases are limited. Rather than using a literature search, many researchers obtain information on these methods through personal communication, which means that published information on possible Three Rs methods often remains unfound and unused. A solution might be to move beyond the direct search for information on Three Rs methods and choose another approach. One approach that seems rather appropriate is that of systematic review. This provides insight into the necessity for any new animal studies, as well as optimal implementation of available data and the prevention of unnecessary animal use in the future. 2011 FRAME.

The Semantics of Complementation in English: A Cognitive Semantic Account of Two English Complement Constructions

ERIC Educational Resources Information Center

Smith, Michael B.

2009-01-01

Studies on complementation in English and other languages have traditionally focused on syntactic issues, most notably on the constituent structures of different complement types. As a result, they have neglected the role of meaning in the choice of different complements. This paper investigates the semantics of complementation within the…

Effects of Different Palliative Jaundice Reducing Methods on Immunologic Functions in Patients with Advanced Malignant Obstructive Jaundice.

PubMed

Tang, Kun; Sui, Lu-Lu; Xu, Gang; Zhang, Tong; Liu, Qiang; Liu, Xiao-Fang

2017-08-01

This study aimed to investigate the effects of three treatment methods on the immunological function of patients with advanced malignant obstructive jaundice (MOJ). Patients with advanced MOJ were randomly divided into three groups according to biliary drainage methods. Detection of levels of multi-indices were investigated in different time periods. After drainage, the levels of complement 3 (C3) and complement 4 (C4) were increased. Forteen days post-operation, the levels of immunoglobulin G (IgG), immunoglobulin A (IgA) and immunoglobulin M (IgM) in the group undergoing palliative surgery decreased significantly compared to those in both percutaneous transhepatic cholangio drainage (PTCD) and endoscopic retrograde biliary drainage (ERBD) groups. The level of serum endotoxin in the group undergoing palliative surgery decreased gradually. Palliative surgery for reducing jaundice is superior to PTCD and ERBD in improving immune function of patients with MOJ. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Complement-dependent cytotoxicity (CDC) to detect Anti-HLA antibodies: old but gold.

PubMed

Saito, Patrícia Keiko; Yamakawa, Roger Haruki; Pereira, Lucieni Christina Marques da Silva; da Silva, Waldir Veríssimo; Borelli, Sueli Donizete

2014-07-01

The criterion (gold) standard to detect anti-human leukocyte antigen (HLA) antibodies is the complement-dependent cytotoxicity (CDC) assay. Recently, more sensitive methods have been used for the same purpose. This study analyzed 70 serum samples of patients with end-stage renal disease using CDC, CDC with the addition of anti-human globulin (CDC-AHG), CDC with the addition of dithiothreitol (CDC-DTT), and the recent solid-phase immunoassay (SPI; Labscreen PRA) to detect anti-HLA antibodies. Mean percent panel reactive antibodies (PRA) detected by SPI was 37.5% (±34.2) higher than the values detected by the other methods. Comparative analyses revealed significant difference between CDC and CDC-AHG, and between CDC and SPI (P < 0.0001), but not between CDC-AHG and SPI (P = 0.8026). Although the CDC-AHG method is "old," its performance to detect anti-HLA antibodies in the samples analyzed was comparable to the SPI in the evaluation of percent class I PRA. © 2014 Wiley Periodicals, Inc.

Systematic approaches to toxicology in the zebrafish.

PubMed

Peterson, Randall T; Macrae, Calum A

2012-01-01

As the current paradigms of drug discovery evolve, it has become clear that a more comprehensive understanding of the interactions between small molecules and organismal biology will be vital. The zebrafish is emerging as a complement to existing in vitro technologies and established preclinical in vivo models that can be scaled for high-throughput. In this review, we highlight the current status of zebrafish toxicology studies, identify potential future niches for the model in the drug development pipeline, and define the hurdles that must be overcome as zebrafish technologies are refined for systematic toxicology.

Diet and diabetes.

PubMed

Deed, Gary; Barlow, John; Kawol, Dev; Kilov, Gary; Sharma, Anita; Hwa, Liew Yu

2015-05-01

Guidelines for the prevention and management of type 2 diabetes mellitus (T2DM) reinforce lifestyle management, yet advice to guide general practitioners on principles around dietary choices is needed. This article provides current evidence regarding the differing diets in diabetes prevention and management once T2DM arises, including the role in management of complications such as hypoglycaemia. Diets should incorporate weight maintenance or loss, while complementing changes in physical activity to optimise the metabolic effects of dietary advice. Using a structured, team-care approach supports pragmatic and sustainable individualised plans, while incorporating current evidence-based dietary approaches.

The two sides of complement C3d: evolution of electrostatics in a link between innate and adaptive immunity.

PubMed

Kieslich, Chris A; Morikis, Dimitrios

2012-01-01

The interaction between complement fragment C3d and complement receptor 2 (CR2) is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2), which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3d, after the divergence of jawless fish.

The Two Sides of Complement C3d: Evolution of Electrostatics in a Link between Innate and Adaptive Immunity

PubMed Central

Kieslich, Chris A.; Morikis, Dimitrios

2012-01-01

The interaction between complement fragment C3d and complement receptor 2 (CR2) is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of −1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic “hot-spots”. Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic “hot-spots” at the two functional sites of C3d, while the surface of CR2 lacks electrostatic “hot-spots” despite its excessively positive nature. We propose that the electrostatic “hot-spots” of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2), which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3d, after the divergence of jawless fish. PMID:23300422

Molluskan Hemocyanins Activate the Classical Pathway of the Human Complement System through Natural Antibodies

PubMed Central

Pizarro-Bauerle, Javier; Maldonado, Ismael; Sosoniuk-Roche, Eduardo; Vallejos, Gerardo; López, Mercedes N.; Salazar-Onfray, Flavio; Aguilar-Guzmán, Lorena; Valck, Carolina; Ferreira, Arturo; Becker, María Inés

2017-01-01

Molluskan hemocyanins are enormous oxygen-carrier glycoproteins that show remarkable immunostimulatory properties when inoculated in mammals, such as the generation of high levels of antibodies, a strong cellular reaction, and generation of non-specific antitumor immune responses in some types of cancer, particularly for superficial bladder cancer. These proteins have the ability to bias the immune response toward a Th1 phenotype. However, despite all their current uses with beneficial clinical outcomes, a clear mechanism explaining these properties is not available. Taking into account reports of natural antibodies against the hemocyanin of the gastropod Megathura crenulata [keyhole limpet hemocyanin (KLH)] in humans as well as other vertebrate species, we report here for the first time, the presence, in sera from unimmunized healthy donors, of antibodies recognizing, in addition to KLH, two other hemocyanins from gastropods with documented immunomodulatory capacities: Fisurella latimarginata hemocyanin (FLH) and Concholepas concholepas hemocyanin (CCH). Through an ELISA screening, we found IgM and IgG antibodies reactive with these hemocyanins. When the capacity of these antibodies to bind deglycosylated hemocyanins was studied, no decreased interaction was detected. Moreover, in the case of FLH, deglycosylation increased antibody binding. We evaluated through an in vitro complement deposition assay whether these antibodies activated the classical pathway of the human complement system. The results showed that all three hemocyanins and their deglycosylated counterparts elicited this activation, mediated by C1 binding to immunoglobulins. Thus, this work contributes to the understanding on how the complement system could participate in the immunostimulatory properties of hemocyanins, through natural, complement-activating antibodies reacting with these proteins. Although a role for carbohydrates cannot be completely ruled out, in our experimental setting, glycosylation status had a limited effect. Finally, our data open possibilities for further studies leading to the design of improved hemocyanin-based research tools for diagnosis and immunotherapy. PMID:28286504

Molluskan Hemocyanins Activate the Classical Pathway of the Human Complement System through Natural Antibodies.

PubMed

Pizarro-Bauerle, Javier; Maldonado, Ismael; Sosoniuk-Roche, Eduardo; Vallejos, Gerardo; López, Mercedes N; Salazar-Onfray, Flavio; Aguilar-Guzmán, Lorena; Valck, Carolina; Ferreira, Arturo; Becker, María Inés

2017-01-01

Molluskan hemocyanins are enormous oxygen-carrier glycoproteins that show remarkable immunostimulatory properties when inoculated in mammals, such as the generation of high levels of antibodies, a strong cellular reaction, and generation of non-specific antitumor immune responses in some types of cancer, particularly for superficial bladder cancer. These proteins have the ability to bias the immune response toward a T h 1 phenotype. However, despite all their current uses with beneficial clinical outcomes, a clear mechanism explaining these properties is not available. Taking into account reports of natural antibodies against the hemocyanin of the gastropod Megathura crenulata [keyhole limpet hemocyanin (KLH)] in humans as well as other vertebrate species, we report here for the first time, the presence, in sera from unimmunized healthy donors, of antibodies recognizing, in addition to KLH, two other hemocyanins from gastropods with documented immunomodulatory capacities: Fisurella latimarginata hemocyanin (FLH) and Concholepas concholepas hemocyanin (CCH). Through an ELISA screening, we found IgM and IgG antibodies reactive with these hemocyanins. When the capacity of these antibodies to bind deglycosylated hemocyanins was studied, no decreased interaction was detected. Moreover, in the case of FLH, deglycosylation increased antibody binding. We evaluated through an in vitro complement deposition assay whether these antibodies activated the classical pathway of the human complement system. The results showed that all three hemocyanins and their deglycosylated counterparts elicited this activation, mediated by C1 binding to immunoglobulins. Thus, this work contributes to the understanding on how the complement system could participate in the immunostimulatory properties of hemocyanins, through natural, complement-activating antibodies reacting with these proteins. Although a role for carbohydrates cannot be completely ruled out, in our experimental setting, glycosylation status had a limited effect. Finally, our data open possibilities for further studies leading to the design of improved hemocyanin-based research tools for diagnosis and immunotherapy.

Language, cognitive flexibility, and explicit false belief understanding: longitudinal analysis in typical development and specific language impairment.

PubMed

Farrant, Brad M; Maybery, Murray T; Fletcher, Janet

2012-01-01

The hypothesis that language plays a role in theory-of-mind (ToM) development is supported by a number of lines of evidence (e.g., H. Lohmann & M. Tomasello, 2003). The current study sought to further investigate the relations between maternal language input, memory for false sentential complements, cognitive flexibility, and the development of explicit false belief understanding in 91 English-speaking typically developing children (M age = 61.3 months) and 30 children with specific language impairment (M age = 63.0 months). Concurrent and longitudinal findings converge in supporting a model in which maternal language input predicts the child's memory for false complements, which predicts cognitive flexibility, which in turn predicts explicit false belief understanding. © 2011 The Authors. Child Development © 2011 Society for Research in Child Development, Inc.

GFP-complementation assay to detect functional CPP and protein delivery into living cells

PubMed Central

Milech, Nadia; Longville, Brooke AC; Cunningham, Paula T; Scobie, Marie N; Bogdawa, Heique M; Winslow, Scott; Anastasas, Mark; Connor, Theresa; Ong, Ferrer; Stone, Shane R; Kerfoot, Maria; Heinrich, Tatjana; Kroeger, Karen M; Tan, Yew-Foon; Hoffmann, Katrin; Thomas, Wayne R; Watt, Paul M; Hopkins, Richard M

2015-01-01

Efficient cargo uptake is essential for cell-penetrating peptide (CPP) therapeutics, which deliver widely diverse cargoes by exploiting natural cell processes to penetrate the cell’s membranes. Yet most current CPP activity assays are hampered by limitations in assessing uptake, including confounding effects of conjugated fluorophores or ligands, indirect read-outs requiring secondary processing, and difficulty in discriminating internalization from endosomally trapped cargo. Split-complementation Endosomal Escape (SEE) provides the first direct assay visualizing true cytoplasmic-delivery of proteins at biologically relevant concentrations. The SEE assay has minimal background, is amenable to high-throughput processes, and adaptable to different transient and stable cell lines. This split-GFP-based platform can be useful to study transduction mechanisms, cellular imaging, and characterizing novel CPPs as pharmaceutical delivery agents in the treatment of disease. PMID:26671759

Genetic variation in CFH predicts phenytoin-induced maculopapular exanthema in European-descent patients

PubMed Central

McCormack, Mark; Gui, Hongsheng; Ingason, Andrés; Speed, Doug; Wright, Galen E.B.; Zhang, Eunice J.; Secolin, Rodrigo; Yasuda, Clarissa; Kwok, Maxwell; Wolking, Stefan; Becker, Felicitas; Rau, Sarah; Avbersek, Andreja; Heggeli, Kristin; Leu, Costin; Depondt, Chantal; Sills, Graeme J.; Marson, Anthony G.; Auce, Pauls; Brodie, Martin J.; Francis, Ben; Johnson, Michael R.; Koeleman, Bobby P.C.; Striano, Pasquale; Coppola, Antonietta; Zara, Federico; Kunz, Wolfram S.; Sander, Josemir W.; Lerche, Holger; Klein, Karl Martin; Weckhuysen, Sarah; Krenn, Martin; Gudmundsson, Lárus J.; Stefánsson, Kári; Krause, Roland; Shear, Neil; Ross, Colin J.D.; Delanty, Norman; Pirmohamed, Munir; Carleton, Bruce C.; Cendes, Fernando; Lopes-Cendes, Iscia; Liao, Wei-ping; O'Brien, Terence J.; Sisodiya, Sanjay M.; Cherny, Stacey; Kwan, Patrick; Baum, Larry

2018-01-01

Objective To characterize, among European and Han Chinese populations, the genetic predictors of maculopapular exanthema (MPE), a cutaneous adverse drug reaction common to antiepileptic drugs. Methods We conducted a case-control genome-wide association study of autosomal genotypes, including Class I and II human leukocyte antigen (HLA) alleles, in 323 cases and 1,321 drug-tolerant controls from epilepsy cohorts of northern European and Han Chinese descent. Results from each cohort were meta-analyzed. Results We report an association between a rare variant in the complement factor H–related 4 (CFHR4) gene and phenytoin-induced MPE in Europeans (p = 4.5 × 10–11; odds ratio [95% confidence interval] 7 [3.2–16]). This variant is in complete linkage disequilibrium with a missense variant (N1050Y) in the complement factor H (CFH) gene. In addition, our results reinforce the association between HLA-A*31:01 and carbamazepine hypersensitivity. We did not identify significant genetic associations with MPE among Han Chinese patients. Conclusions The identification of genetic predictors of MPE in CFHR4 and CFH, members of the complement factor H–related protein family, suggest a new link between regulation of the complement system alternative pathway and phenytoin-induced hypersensitivity in European-ancestral patients. PMID:29288229

The European Drought Observatory (EDO): Current State and Future Directions

NASA Astrophysics Data System (ADS)

Vogt, J.; Singleton, A.; Sepulcre, G.; Micale, F.; Barbosa, P.

2012-12-01

Europe has repeatedly been affected by droughts, resulting in considerable ecological and economic damage and climate change studies indicate a trend towards increasing climate variability most likely resulting in more frequent drought occurrences also in Europe. Against this background, the European Commission's Joint Research Centre (JRC) is developing methods and tools for assessing, monitoring and forecasting droughts in Europe and develops a European Drought Observatory (EDO) to complement and integrate national activities with a European view. At the core of the European Drought Observatory (EDO) is a portal, including a map server, a metadata catalogue, a media-monitor and analysis tools. The map server presents Europe-wide up-to-date information on the occurrence and severity of droughts, which is complemented by more detailed information provided by regional, national and local observatories through OGC compliant web mapping and web coverage services. In addition, time series of historical maps as well as graphs of the temporal evolution of drought indices for individual grid cells and administrative regions in Europe can be retrieved and analysed. Current work is focusing on validating the available products, improving the functionalities, extending the linkage to additional national and regional drought information systems and improving medium to long-range probabilistic drought forecasting products. Probabilistic forecasts are attractive in that they provide an estimate of the range of uncertainty in a particular forecast. Longer-term goals include the development of long-range drought forecasting products, the analysis of drought hazard and risk, the monitoring of drought impact and the integration of EDO in a global drought information system. The talk will provide an overview on the development and state of EDO, the different products, and the ways to include a wide range of stakeholders (i.e. European, national river basin, and local authorities) in the development of the system as well as an outlook on the future developments.

Differential distribution of voltage-gated channels in myelinated and unmyelinated baroreceptor afferents.

PubMed

Schild, John H; Kunze, Diana L

2012-12-24

Voltage gated ion channels (VGC) make possible the frequency coding of arterial pressure and the neurotransmission of this information along myelinated and unmyelinated fiber pathways. Although many of the same VGC isoforms are expressed in both fiber types, it is the relative expression of each that defines the unique discharge properties of myelinated A-type and unmyelinated C-type baroreceptors. For example, the fast inward Na⁺ current is a major determinant of the action potential threshold and the regenerative transmembrane current needed to sustain repetitive discharge. In A-type baroreceptors the TTX-sensitive Na(v)1.7 VGC contributes to the whole cell Na⁺ current. Na(v)1.7 is expressed at a lower density in C-type neurons and in conjunction with TTX-insensitive Na(v)1.8 and Na(v)1.9 VGC. As a result, action potentials of A-type neurons have firing thresholds that are 15-20 mV more negative and upstroke velocities that are 5-10 times faster than unmyelinated C-type neurons. A more depolarized threshold in conjunction with a broader complement of non-inactivating K(V) VGC subtypes produces C-type action potentials that are 3-4 times longer in duration than A-type neurons and at markedly lower levels of cell excitability. Unmyelinated baroreceptors also express KCa1.1 which provides approximately 25% of the total outward K⁺ current. KCa1.1 plays a critically important role in shaping the action potential profile of C-type neurons and strongly impacts neuronal excitability. A-type neurons do not functionally express the KCa1.1 channel despite having a whole cell Ca(V) current quite similar to that of C-type neurons. As a result, A-type neurons do not have the frequency-dependent braking forces of KCa1.1. Lack of a KCa current and only a limited complement of non-inactivating K(V) VGC in addition to a hyperpolarization activated HCN1 current that is nearly 10 times larger than in C-type neurons leads to elevated levels of discharge in A-type neurons, a hallmark of myelinated baroreceptors. Interestingly, HCN2 and HCN4 expression levels are comparable in both fiber types. Collectively, such apportion of VGC constrains the neural coding of myelinated A-type baroreceptors to low threshold, high frequency, high fidelity discharge but with a limited capacity for neuromodulation of afferent bandwidth. Unmyelinated C-type baroreceptors require greater depolarizing forces for spike initiation and have a low frequency discharge profile that is often poorly correlated with the physiological stimulus. But the complement of VGC in C-type neurons provides far greater capacity for neuromodulation of cell excitability than can be obtained from A-type baroreceptors. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization of Louisiana asphalt mixtures using simple performance tests and MEPDG.

DOT National Transportation Integrated Search

2014-04-01

The National Cooperative Highway Research Program (NCHRP) Project 9-19, Superpave Support and Performance : Models Management, recommended three Simple Performance Tests (SPTs) to complement the Superpave volumetric : mixture design method. These are...

The Complement System and Adverse Pregnancy Outcomes

PubMed Central

Regal, Jean F.; Gilbert, Jeffrey S.; Burwick, Richard M.

2015-01-01

Adverse pregnancy outcomes significantly contribute to morbidity and mortality for mother and child, with lifelong health consequences for both. The innate and adaptive immune system must be regulated to insure survival of the feta allograft, and the complement system is no exception. An intact complement system optimizes placental development and function and is essential to maintain host defense and fetal survival. Complement regulation is apparent at the placental interface from early pregnancy with some degree of complement activation occurring normally throughout gestation. However, a number of pregnancy complications including early pregnancy loss, fetal growth restriction, hypertensive disorders of pregnancy and preterm birth are associated with excessive or misdirected complement activation, and are more frequent in women with inherited or acquired complement system disorders or complement gene mutations. Clinical studies employing complement biomarkers in plasma and urine implicate dysregulated complement activation in components of each of the adverse pregnancy outcomes. In addition, mechanistic studies in rat and mouse models of adverse pregnancy outcomes address the complement pathways or activation products of importance and allow critical analysis of the pathophysiology. Targeted complement therapeutics are already in use to control adverse pregnancy outcomes in select situations. A clearer understanding of the role of the complement system in both normal pregnancy and complicated or failed pregnancy will allow a rational approach to future therapeutic strategies for manipulating complement with the goal of mitigating adverse pregnancy outcomes, preserving host defense, and improving long term outcomes for both mother and child. PMID:25802092

Toward Mixed Method Evaluations of Scientific Visualizations and Design Process as an Evaluation Tool.

PubMed

Jackson, Bret; Coffey, Dane; Thorson, Lauren; Schroeder, David; Ellingson, Arin M; Nuckley, David J; Keefe, Daniel F

2012-10-01

In this position paper we discuss successes and limitations of current evaluation strategies for scientific visualizations and argue for embracing a mixed methods strategy of evaluation. The most novel contribution of the approach that we advocate is a new emphasis on employing design processes as practiced in related fields (e.g., graphic design, illustration, architecture) as a formalized mode of evaluation for data visualizations. To motivate this position we describe a series of recent evaluations of scientific visualization interfaces and computer graphics strategies conducted within our research group. Complementing these more traditional evaluations our visualization research group also regularly employs sketching, critique, and other design methods that have been formalized over years of practice in design fields. Our experience has convinced us that these activities are invaluable, often providing much more detailed evaluative feedback about our visualization systems than that obtained via more traditional user studies and the like. We believe that if design-based evaluation methodologies (e.g., ideation, sketching, critique) can be taught and embraced within the visualization community then these may become one of the most effective future strategies for both formative and summative evaluations.

Toward Mixed Method Evaluations of Scientific Visualizations and Design Process as an Evaluation Tool

PubMed Central

Jackson, Bret; Coffey, Dane; Thorson, Lauren; Schroeder, David; Ellingson, Arin M.; Nuckley, David J.

2017-01-01

In this position paper we discuss successes and limitations of current evaluation strategies for scientific visualizations and argue for embracing a mixed methods strategy of evaluation. The most novel contribution of the approach that we advocate is a new emphasis on employing design processes as practiced in related fields (e.g., graphic design, illustration, architecture) as a formalized mode of evaluation for data visualizations. To motivate this position we describe a series of recent evaluations of scientific visualization interfaces and computer graphics strategies conducted within our research group. Complementing these more traditional evaluations our visualization research group also regularly employs sketching, critique, and other design methods that have been formalized over years of practice in design fields. Our experience has convinced us that these activities are invaluable, often providing much more detailed evaluative feedback about our visualization systems than that obtained via more traditional user studies and the like. We believe that if design-based evaluation methodologies (e.g., ideation, sketching, critique) can be taught and embraced within the visualization community then these may become one of the most effective future strategies for both formative and summative evaluations. PMID:28944349

Characterization of the Inflammatory Response in Dystrophic Muscle Using Flow Cytometry.

PubMed

Kastenschmidt, Jenna M; Avetyan, Ileen; Villalta, S A

2018-01-01

Although mutations of the dystrophin gene are the causative defect in Duchenne muscular dystrophy (DMD) patients, secondary disease processes such as inflammation contribute greatly to the pathogenesis of DMD. Genetic and histological studies have shown that distinct facets of the immune system promote muscle degeneration or regeneration during muscular dystrophy through mechanisms that are only beginning to be defined. Although histological methods have allowed the enumeration and localization of immune cells within dystrophic muscle, they are limited in their ability to assess the full spectrum of phenotypic states of an immune cell population and its functional characteristics. This chapter highlights flow cytometry methods for the isolation and functional study of immune cell populations from muscle of the mdx mouse model of DMD. We include a detailed description of preparing single-cell suspensions of dystrophic muscle that maintain the integrity of cell-surface markers used to identify macrophages, eosinophils, group 2 innate lymphoid cells, and regulatory T cells. This method complements the battery of histological assays that are currently used to study the role of inflammation in muscular dystrophy, and provides a platform capable of being integrated with multiple downstream methodologies for the mechanistic study of immunity in muscle degenerative diseases.

A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego

2015-12-01

Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles aftermore » incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow and critical parameters is presented. • The method could provide a useful tool to complement existing chemical assays.« less

Sundanese Complementation

ERIC Educational Resources Information Center

Kurniawan, Eri

2013-01-01

The focus of this thesis is the description and analysis of clausal complementation in Sundanese, an Austronesian language spoken in Indonesia. The thesis examined a range of clausal complement types in Sundanese, which consists of (i) "yen/(wi)rehna" "that" complements, (ii) "pikeun" "for" complements,…

Proteolysis of complement factors iC3b and C5 by the serine protease prostate-specific antigen in prostatic fluid and seminal plasma.

PubMed

Manning, Michael L; Williams, Simon A; Jelinek, Christine A; Kostova, Maya B; Denmeade, Samuel R

2013-03-15

Prostate-specific Ag (PSA) is a serine protease that is expressed exclusively by normal and malignant prostate epithelial cells. The continued high-level expression of PSA by the majority of men with both high- and low-grade prostate cancer throughout the course of disease progression, even in the androgen-ablated state, suggests that PSA has a role in the pathogenesis of disease. Current experimental and clinical evidence suggests that chronic inflammation, regardless of the cause, may predispose men to prostate cancer. The responsibility of the immune system in immune surveillance and eventually tumor progression is well appreciated but not completely understood. In this study, we used a mass spectrometry-based evaluation of prostatic fluid obtained from diseased prostates after removal by radical prostatectomy to identify potential immunoregulatory proteins. This analysis revealed the presence of Igs and the complement system proteins C3, factor B, and clusterin. Verification of these findings by Western blot confirmed the high-level expression of C3 in the prostatic fluid and the presence of a previously uncharacterized C-terminal C3 cleavage product. Biochemical analysis of this C3 cleavage fragment revealed a putative PSA cleavage site after tyrosine-1348. Purified PSA was able to cleave iC3b and the related complement protein C5. These results suggest a previously uncharacterized function of PSA as an immunoregulatory protease that could help to create an environment hospitable to malignancy through proteolysis of the complement system.

Complement Evasion Strategies of Viruses: An Overview

PubMed Central

Agrawal, Palak; Nawadkar, Renuka; Ojha, Hina; Kumar, Jitendra; Sahu, Arvind

2017-01-01

Being a major first line of immune defense, the complement system keeps a constant vigil against viruses. Its ability to recognize large panoply of viruses and virus-infected cells, and trigger the effector pathways, results in neutralization of viruses and killing of the infected cells. This selection pressure exerted by complement on viruses has made them evolve a multitude of countermeasures. These include targeting the recognition molecules for the avoidance of detection, targeting key enzymes and complexes of the complement pathways like C3 convertases and C5b-9 formation – either by encoding complement regulators or by recruiting membrane-bound and soluble host complement regulators, cleaving complement proteins by encoding protease, and inhibiting the synthesis of complement proteins. Additionally, viruses also exploit the complement system for their own benefit. For example, they use complement receptors as well as membrane regulators for cellular entry as well as their spread. Here, we provide an overview on the complement subversion mechanisms adopted by the members of various viral families including Poxviridae, Herpesviridae, Adenoviridae, Flaviviridae, Retroviridae, Picornaviridae, Astroviridae, Togaviridae, Orthomyxoviridae and Paramyxoviridae. PMID:28670306

The effects of antibodies on cells

PubMed Central

Dumonde, D. C.; Bitensky, Lucille; Cunningham, G. J.; Chayen, J.

1965-01-01

Biochemical and histochemical methods were used to study the interaction of antibodies and complement with mouse Ehrlich ascites tumour cells. In the presence of complement, both iso- and hetero-antibodies caused cell lysis with penetration of antibodies into the damaged cells, as detected by immunofluorescence; the cells were then unable to support aerobic glycolysis though they retained their ability to consume oxygen in the presence of succinate. Under these conditions there was unmasking of phospholipid particularly at the cell surface, together with lysosomal changes resulting in diffuse staining for lysosomal acid—phosphatase. In the absence of complement, antibodies did not appear to penetrate the cells which respired normally and were not lysed. However, in these cells there was intense lysosomal activation accompanied by unmasking of cytoplasmic phospholipid; it appeared that an immune reaction confined to the cell surface was able to induce changes in the cytoplasm without acutely impairing the viability of the cell. ImagesFIGS. 1-8FIGS. 9-14 PMID:14245309

The Relationship of Level of Positive Mental Health with Current Mental Disorders in Predicting Suicidal Behavior and Academic Impairment in College Students

ERIC Educational Resources Information Center

Keyes, Corey L. M.; Eisenberg, Daniel; Perry, Geraldine S.; Dube, Shanta R.; Kroenke, Kurt; Dhingra, Satvinder S.

2012-01-01

Objective: To investigate whether level of positive mental health complements mental illness in predicting students at risk for suicidal behavior and impaired academic performance. Participants: A sample of 5,689 college students participated in the 2007 Healthy Minds Study and completed an Internet survey that included the Mental Health…

Vocational Behavior and Development in Times of Social Change: New Perspectives for Theory and Practice

ERIC Educational Resources Information Center

Vondracek, Fred W.; Ferreira, Joaquim Armando Gomes; dos Santos, Eduardo Joao Ribeiro

2010-01-01

A review of new and emerging conceptions of work and career is complemented by a description of a comprehensive systems framework that avoids many of the dichotomies found in current accounts of career development and intervention. This is followed by a description of Ford and Smith's ("Educational Psychologist" 42(3):153-171, "2007") "thriving…

Language, Cognitive Flexibility, and Explicit False Belief Understanding: Longitudinal Analysis in Typical Development and Specific Language Impairment

ERIC Educational Resources Information Center

Farrant, Brad M.; Maybery, Murray T.; Fletcher, Janet

2012-01-01

The hypothesis that language plays a role in theory-of-mind (ToM) development is supported by a number of lines of evidence (e.g., H. Lohmann & M. Tomasello, 2003). The current study sought to further investigate the relations between maternal language input, memory for false sentential complements, cognitive flexibility, and the development of…

Design Concerns in the Engineering of Virtual Worlds for Learning

ERIC Educational Resources Information Center

Rapanotti, Lucia; Hall, Jon G.

2011-01-01

The convergence of 3D simulation and social networking into current multi-user virtual environments has opened the door to new forms of interaction for learning in order to complement the face-to-face and Web 2.0-based systems. Yet, despite a growing user community, design knowledge for virtual worlds remains patchy, particularly when it comes to…

Internationalization, Nationalism, and Global Competitiveness: A Comparison of Approaches to Higher Education in China and Japan

ERIC Educational Resources Information Center

Hammond, Christopher D.

2016-01-01

This paper explores the ways in which policies for national identity formation and internationalization interact to complement and contradict each other in the context of global higher education. These themes are explored by comparing recent policies in two countries in East Asia, a part of the world currently on the rise in the global hierarchy…

Numerical modelling as a cost-reduction tool for probability of detection of bolt hole eddy current testing

NASA Astrophysics Data System (ADS)

Mandache, C.; Khan, M.; Fahr, A.; Yanishevsky, M.

2011-03-01

Probability of detection (PoD) studies are broadly used to determine the reliability of specific nondestructive inspection procedures, as well as to provide data for damage tolerance life estimations and calculation of inspection intervals for critical components. They require inspections on a large set of samples, a fact that makes these statistical assessments time- and cost-consuming. Physics-based numerical simulations of nondestructive testing inspections could be used as a cost-effective alternative to empirical investigations. They realistically predict the inspection outputs as functions of the input characteristics related to the test piece, transducer and instrument settings, which are subsequently used to partially substitute and/or complement inspection data in PoD analysis. This work focuses on the numerical modelling aspects of eddy current testing for the bolt hole inspections of wing box structures typical of the Lockheed Martin C-130 Hercules and P-3 Orion aircraft, found in the air force inventory of many countries. Boundary element-based numerical modelling software was employed to predict the eddy current signal responses when varying inspection parameters related to probe characteristics, crack geometry and test piece properties. Two demonstrator exercises were used for eddy current signal prediction when lowering the driver probe frequency and changing the material's electrical conductivity, followed by subsequent discussions and examination of the implications on using simulated data in the PoD analysis. Despite some simplifying assumptions, the modelled eddy current signals were found to provide similar results to the actual inspections. It is concluded that physics-based numerical simulations have the potential to partially substitute or complement inspection data required for PoD studies, reducing the cost, time, effort and resources necessary for a full empirical PoD assessment.

Reasoning and Data Representation in a Health and Lifestyle Support System.

PubMed

Hanke, Sten; Kreiner, Karl; Kropf, Johannes; Scase, Marc; Gossy, Christian

2017-01-01

Case-based reasoning and data interpretation is an artificial intelligence approach that capitalizes on past experience to solve current problems and this can be used as a method for practical intelligent systems. Case-based data reasoning is able to provide decision support for experts and clinicians in health systems as well as lifestyle systems. In this project we were focusing on developing a solution for healthy ageing considering daily activities, nutrition as well as cognitive activities. The data analysis of the reasoner followed state of the art guidelines from clinical practice. Guidelines provide a general framework to guide clinicians, and require consequent background knowledge to become operational, which is precisely the kind of information recorded in practice cases; cases complement guidelines very well and helps to interpret them. It is expected that the interest in case-based reasoning systems in the health.

Direct Maximization of Protein Identifications from Tandem Mass Spectra*

PubMed Central

Spivak, Marina; Weston, Jason; Tomazela, Daniela; MacCoss, Michael J.; Noble, William Stafford

2012-01-01

The goal of many shotgun proteomics experiments is to determine the protein complement of a complex biological mixture. For many mixtures, most methodological approaches fall significantly short of this goal. Existing solutions to this problem typically subdivide the task into two stages: first identifying a collection of peptides with a low false discovery rate and then inferring from the peptides a corresponding set of proteins. In contrast, we formulate the protein identification problem as a single optimization problem, which we solve using machine learning methods. This approach is motivated by the observation that the peptide and protein level tasks are cooperative, and the solution to each can be improved by using information about the solution to the other. The resulting algorithm directly controls the relevant error rate, can incorporate a wide variety of evidence and, for complex samples, provides 18–34% more protein identifications than the current state of the art approaches. PMID:22052992

The simulation approach to lipid-protein interactions.

PubMed

Paramo, Teresa; Garzón, Diana; Holdbrook, Daniel A; Khalid, Syma; Bond, Peter J

2013-01-01

The interactions between lipids and proteins are crucial for a range of biological processes, from the folding and stability of membrane proteins to signaling and metabolism facilitated by lipid-binding proteins. However, high-resolution structural details concerning functional lipid/protein interactions are scarce due to barriers in both experimental isolation of native lipid-bound complexes and subsequent biophysical characterization. The molecular dynamics (MD) simulation approach provides a means to complement available structural data, yielding dynamic, structural, and thermodynamic data for a protein embedded within a physiologically realistic, modelled lipid environment. In this chapter, we provide a guide to current methods for setting up and running simulations of membrane proteins and soluble, lipid-binding proteins, using standard atomistically detailed representations, as well as simplified, coarse-grained models. In addition, we outline recent studies that illustrate the power of the simulation approach in the context of biologically relevant lipid/protein interactions.

Medical equipment classification: method and decision-making support based on paraconsistent annotated logic.

PubMed

Oshiyama, Natália F; Bassani, Rosana A; D'Ottaviano, Itala M L; Bassani, José W M

2012-04-01

As technology evolves, the role of medical equipment in the healthcare system, as well as technology management, becomes more important. Although the existence of large databases containing management information is currently common, extracting useful information from them is still difficult. A useful tool for identification of frequently failing equipment, which increases maintenance cost and downtime, would be the classification according to the corrective maintenance data. Nevertheless, establishment of classes may create inconsistencies, since an item may be close to two classes by the same extent. Paraconsistent logic might help solve this problem, as it allows the existence of inconsistent (contradictory) information without trivialization. In this paper, a methodology for medical equipment classification based on the ABC analysis of corrective maintenance data is presented, and complemented with a paraconsistent annotated logic analysis, which may enable the decision maker to take into consideration alerts created by the identification of inconsistencies and indeterminacies in the classification.

Proteomics and metabolomics for mechanistic insights and biomarker discovery in cardiovascular disease.

PubMed

Barallobre-Barreiro, Javier; Chung, Yuen-Li; Mayr, Manuel

2013-08-01

In the last decade, proteomics and metabolomics have contributed substantially to our understanding of cardiovascular diseases. The unbiased assessment of pathophysiological processes without a priori assumptions complements other molecular biology techniques that are currently used in a reductionist approach. In this review, we highlight some of the "omics" methods used to assess protein and metabolite changes in cardiovascular disease. A discrete biological function is very rarely attributed to a single molecule; more often it is the combined input of many proteins. In contrast to the reductionist approach, in which molecules are studied individually, "omics" platforms allow the study of more complex interactions in biological systems. Combining proteomics and metabolomics to quantify changes in metabolites and their corresponding enzymes will advance our understanding of pathophysiological mechanisms and aid the identification of novel biomarkers for cardiovascular disease. Copyright © 2013 Sociedad Española de Cardiología. Published by Elsevier Espana. All rights reserved.

Optimization of power and energy densities in supercapacitors

NASA Astrophysics Data System (ADS)

Robinson, David B.

Supercapacitors use nanoporous electrodes to store large amounts of charge on their high surface areas, and use the ions in electrolytes to carry charge into the pores. Their high power density makes them a potentially useful complement to batteries. However, ion transport through long, narrow channels still limits power and efficiency in these devices. Proper design can mitigate this. Current collector geometry must also be considered once this is done. Here, De Levie's model for porous electrodes is applied to quantitatively predict device performance and to propose optimal device designs for given specifications. Effects unique to nanoscale pores are considered, including that pores may not have enough salt to fully charge. Supercapacitors are of value for electric vehicles, portable electronics, and power conditioning in electrical grids with distributed renewable sources, and that value will increase as new device fabrication methods are developed and proper design accommodates those improvements. Example design outlines for vehicle applications are proposed and compared.

Failure analysis of solid rocket apogee motors

NASA Technical Reports Server (NTRS)

Martin, P. J.

1972-01-01

The analysis followed five selected motors through initial design, development, test, qualification, manufacture, and final flight reports. An audit was conducted at the manufacturing plants to complement the literature search with firsthand observations of the current philosophies and practices that affect reliability of the motors. A second literature search emphasized acquisition of spacecraft and satellite data bearing on solid motor reliability. It was concluded that present practices at the plants yield highly reliable flight hardware. Reliability can be further improved by new developments of aft-end bonding and initiator/igniter nondestructive test methods, a safe/arm device, and an insulation formulation. Minimum diagnostic instrumentation is recommended for all motor flights. Surplus motors should be used in margin testing. Criteria should be established for pressure and zone curing. The motor contractor should be represented at launch. New design analyses should be made of stretched motors and spacecraft/motor pairs.

Line Coupling Effects in the Isotropic Raman Spectra of N2: A Quantum Calculation at Room Temperature

NASA Technical Reports Server (NTRS)

Thibault, Franck; Boulet, Christian; Ma, Qiancheng

2014-01-01

We present quantum calculations of the relaxation matrix for the Q branch of N2 at room temperature using a recently proposed N2-N2 rigid rotor potential. Close coupling calculations were complemented by coupled states studies at high energies and provide about 10200 two-body state-to state cross sections from which the needed one-body cross-sections may be obtained. For such temperatures, convergence has to be thoroughly analyzed since such conditions are close to the limit of current computational feasibility. This has been done using complementary calculations based on the energy corrected sudden formalism. Agreement of these quantum predictions with experimental data is good, but the main goal of this work is to provide a benchmark relaxation matrix for testing more approximate methods which remain of a great utility for complex molecular systems at room (and higher) temperatures.

A digital future for the history of psychology?

PubMed

Green, Christopher D

2016-08-01

This article discusses the role that digital approaches to the history of psychology are likely to play in the near future. A tentative hierarchy of digital methods is proposed. A few examples are briefly described: a digital repository, a simple visualization using ready-made online database and tools, and more complex visualizations requiring the assembly of the database and, possibly, the analytic tools by the researcher. The relationship of digital history to the old "New Economic History" (Cliometrics) is considered. The question of whether digital history and traditional history need be at odds or, instead, might complement each other is woven throughout. The rapidly expanding territory of digital humanistic research outside of psychology is briefly discussed. Finally, the challenging current employment trends in history and the humanities more broadly are considered, along with the role that digital skills might play in mitigating those factors for prospective academic workers. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

The edge transient-current technique (E-TCT) with high energy hadron beam

NASA Astrophysics Data System (ADS)

Gorišek, Andrej; Cindro, Vladimir; Kramberger, Gregor; Mandić, Igor; Mikuž, Marko; Muškinja, Miha; Zavrtanik, Marko

2016-09-01

We propose a novel way to investigate the properties of silicon and CVD diamond detectors for High Energy Physics experiments complementary to the already well-established E-TCT technique using laser beam. In the proposed setup the beam of high energy hadrons (MIPs) is used instead of laser beam. MIPs incident on the detector in the direction parallel to the readout electrode plane and perpendicular to the edge of the detector. Such experiment could prove very useful to study CVD diamond detectors that are almost inaccessible for the E-TCT measurements with laser due to large band-gap as well as to verify and complement the E-TCT measurements of silicon. The method proposed is being tested at CERN in a beam of 120 GeV hadrons using a reference telescope with track resolution at the DUT of few μm. The preliminary results of the measurements are presented.

On the generation of novel anticancer drugs by recombinant DNA technology: the use of combinatorial biosynthesis to produce novel drugs.

PubMed

Méndez, Carmen; Salas, José A

2003-09-01

Chemotherapeutic drugs for cancer treatment have been traditionally originated by the isolation of natural products from different environmental niches, by chemical synthesis or by a combination of both approaches thus generating semisynthetic drugs. In the last years, a number of gene clusters from several antitumor biosynthetic pathways, mainly produced by actinomycetes and belonging to the polyketides family, are being characterized. Genetic manipulation of these antitumor biosynthetic pathways will offer in the near future an alternative for the generation of novel antitumor derivatives and thus complementing current methods for obtaining novel anticancer drugs. Novel antitumor derivatives have been produced by targetted gene disruption and heterologous expression of single (or a few) gene(s) in another hosts or by combining genes from different, but structurally related, biosynthetic pathways ("combinatorial biosynthesis"). These strategies take advantage from the "relaxed substrate specificity" that characterize secondary metabolism enzymes.

Digital imaging and image analysis applied to numerical applications in forensic hair examination.

PubMed

Brooks, Elizabeth; Comber, Bruce; McNaught, Ian; Robertson, James

2011-03-01

A method that provides objective data to complement the hair analysts' microscopic observations, which is non-destructive, would be of obvious benefit in the forensic examination of hairs. This paper reports on the use of objective colour measurement and image analysis techniques of auto-montaged images. Brown Caucasian telogen scalp hairs were chosen as a stern test of the utility of these approaches. The results show the value of using auto-montaged images and the potential for the use of objective numerical measures of colour and pigmentation to complement microscopic observations. 2010. Published by Elsevier Ireland Ltd. All rights reserved.

[Evaluation of postoperative pain comparing manual and ultrasonic endodontic instrumentation in patients with cleft lip and palate].

PubMed

Brosco, H B; Pimentel, P A; Lacerda, A G; Nishiyama, C K; de Moraes, I G

1989-01-01

Our purpose was to compare incidence of post-surgical pain associated to the endodontic therapy where the instrumentation on the root canal was performed by the method of Marshall & Pappin and the method of Marshall & Pappin complemented by the ultrasonic. Seventy patients with only one tooth needing endodontic treatment were treated by one of the methods and, posteriorly, evaluated. The endodontic treatment was performed at one time and from the seventy teeth, thirty have been instrumented by the manual method complemented by the ultrasonic and forty by the manual instrumentation. The patients were clinically controlled after the endodontic treatment was finished during periods of 24, 48 and 72 hours to evaluate their post-surgical condition. The results suggest that were no statistically significant differences (p less than 0.05) in the incidence of pain between the employed methods or according to the pulpar semiologic condition in any of the observed periods. However, we have realized that there was a tendency for a smaller percentage of a postoperative pain in those cases of necropulpectamy treated by the endosonic ultrasonic synergistic system. In those cases of biopulpectomy this has been not observed.

Audiovisual quality estimation of mobile phone video cameras with interpretation-based quality approach

NASA Astrophysics Data System (ADS)

Radun, Jenni E.; Virtanen, Toni; Olives, Jean-Luc; Vaahteranoksa, Mikko; Vuori, Tero; Nyman, Göte

2007-01-01

We present an effective method for comparing subjective audiovisual quality and the features related to the quality changes of different video cameras. Both quantitative estimation of overall quality and qualitative description of critical quality features are achieved by the method. The aim was to combine two image quality evaluation methods, the quantitative Absolute Category Rating (ACR) method with hidden reference removal and the qualitative Interpretation- Based Quality (IBQ) method in order to see how they complement each other in audiovisual quality estimation tasks. 26 observers estimated the audiovisual quality of six different cameras, mainly mobile phone video cameras. In order to achieve an efficient subjective estimation of audiovisual quality, only two contents with different quality requirements were recorded with each camera. The results show that the subjectively important quality features were more related to the overall estimations of cameras' visual video quality than to the features related to sound. The data demonstrated two significant quality dimensions related to visual quality: darkness and sharpness. We conclude that the qualitative methodology can complement quantitative quality estimations also with audiovisual material. The IBQ approach is valuable especially, when the induced quality changes are multidimensional.

Magnetically coupled resonance wireless charging technology principles and transfer mechanisms

NASA Astrophysics Data System (ADS)

Zhou, Jiehua; Wan, Jian; Ma, Yinping

2017-05-01

With the tenure of Electric-Vehicle rising around the world, the charging methods have been paid more and more attention, the current charging mode mainly has the charging posts and battery swapping station. The construction of the charging pile or battery swapping station not only require lots of manpower, material costs but the bare conductor is also easy to generate electric spark hidden safety problems, still occupies large space. Compared with the wired charging, wireless charging mode is flexible, unlimited space and location factors and charging for vehicle safety and quickly. It complements the traditional charging methods in adaptability and the independent charge deficiencies. So the researching the wireless charging system have an important practical significance and application value. In this paper, wireless charging system designed is divided into three parts: the primary side, secondary side and resonant coupling. The main function of the primary side is to generate high-frequency alternating current, so selecting CLASS-E amplifier inverter structure through the research on full bridge, half-bridge and power amplification circuit. Addition, the wireless charging system is susceptible to outside interference, frequency drift phenomenon. Combined with the wireless energy transmission characteristics, resonant parts adopt resonant coupling energy transmission scheme and the Series-Series coupling compensation structure. For the electric vehicle charging power and voltage requirements, the main circuit is a full bridge inverter and Boost circuit used as the secondary side.

Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

PubMed Central

Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

2017-01-01

The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

PubMed

Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

2017-01-01

The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

The Lectin Complement Pathway Is Involved in Protection Against Enteroaggregative Escherichia coli Infection.

PubMed

Adler Sørensen, Camilla; Rosbjerg, Anne; Hebbelstrup Jensen, Betina; Krogfelt, Karen Angeliki; Garred, Peter

2018-01-01

Enteroaggregative Escherichia coli (EAEC) causes acute and persistent diarrhea worldwide. Still, the involvement of host factors in EAEC infections is unresolved. Binding of recognition molecules from the lectin pathway of complement to EAEC strains have been observed, but the importance is not known. Our aim was to uncover the involvement of these molecules in innate complement dependent immune protection toward EAEC. Binding of mannose-binding lectin, ficolin-1, -2, and -3 to four prototypic EAEC strains, and ficolin-2 binding to 56 clinical EAEC isolates were screened by a consumption-based ELISA method. Flow cytometry was used to determine deposition of C4b, C3b, and the bactericidal C5b-9 membrane attack complex (MAC) on the bacteria in combination with different complement inhibitors. In addition, the direct serum bactericidal effect was assessed. Screening of the prototypic EAEC strains revealed that ficolin-2 was the major binder among the lectin pathway recognition molecules. However, among the clinical EAEC isolates only a restricted number ( n  = 5) of the isolates bound ficolin-2. Using the ficolin-2 binding isolate C322-17 as a model, we found that incubation with normal human serum led to deposition of C4b, C3b, and to MAC formation. No inhibition of complement deposition was observed when a C1q inhibitor was added, while partial inhibition was observed when ficolin-2 or factor D inhibitors were used separately. Combining the inhibitors against ficolin-2 and factor D led to virtually complete inhibition of complement deposition and protection against direct bacterial killing. These results demonstrate that ficolin-2 may play an important role in innate immune protection against EAEC when an appropriate ligand is exposed, but many EAEC strains evade lectin pathway recognition and may, therefore, circumvent this strategy of innate host immune protection.

Improvement of the analog forecasting method by using local thermodynamic data. Application to autumn precipitation in Catalonia

NASA Astrophysics Data System (ADS)

Gibergans-Báguena, J.; Llasat, M. C.

2007-12-01

The objective of this paper is to present the improvement of quantitative forecasting of daily rainfall in Catalonia (NE Spain) from an analogues technique, taking into account synoptic and local data. This method is based on an analogues sorting technique: meteorological situations similar to the current one, in terms of 700 and 1000 hPa geopotential fields at 00 UTC, complemented with the inclusion of some thermodynamic parameters extracted from an historical data file. Thermodynamic analysis acts as a highly discriminating feature for situations in which the synoptic situation fails to explain either atmospheric phenomena or rainfall distribution. This is the case in heavy rainfall situations, where the existence of instability and high water vapor content is essential. With the objective of including these vertical thermodynamic features, information provided by the Palma de Mallorca radiosounding (Spain) has been used. Previously, a selection of the most discriminating thermodynamic parameters for the daily rainfall was made, and then the analogues technique applied to them. Finally, three analog forecasting methods were applied for the quantitative daily rainfall forecasting in Catalonia. The first one is based on analogies from geopotential fields to synoptic scale; the second one is exclusively based on the search of similarity from local thermodynamic information and the third method combines the other two methods. The results show that this last method provides a substantial improvement of quantitative rainfall estimation.

[Qualitative techniques for public health research and the development of health care services: more than just another technique].

PubMed

March Cerdà, J C; Prieto Rodríguez, M A; Hernán García, M; Solas Gaspar, O

1999-01-01

Regarding the debate on the existence of two current focuses on health science research (qualitative and quantitative), the paper states the need for complementing the techniques which contribute to a better knowledge of populations and communities, and the need for offering effective solutions to different problems. The article analyses the usefulness of qualitative methods, describes the techniques and procedures more frequently used to guarantee the validity and reliability of research findings and ends bringing up the need for using qualitative and quantitative approaches. This way of working together or learning from each other will enrich research and interventions on public heath and health management fields. Qualitative methods are useful for sound understanding of a given issue that is being investigated or evaluated taking into account the point of view of the participants under research. Key techniques, listed from the most structured to the less structured are among others: structured interview, Delphi, nominal group, case study, semistructured interview, focal group, brainstorming, discussion group, in depth interview, life story and participant observation.

Integration of Geodata in Documenting Castle Ruins

NASA Astrophysics Data System (ADS)

Delis, P.; Wojtkowska, M.; Nerc, P.; Ewiak, I.; Lada, A.

2016-06-01

Textured three dimensional models are currently the one of the standard methods of representing the results of photogrammetric works. A realistic 3D model combines the geometrical relations between the structure's elements with realistic textures of each of its elements. Data used to create 3D models of structures can be derived from many different sources. The most commonly used tool for documentation purposes, is a digital camera and nowadays terrestrial laser scanning (TLS). Integration of data acquired from different sources allows modelling and visualization of 3D models historical structures. Additional aspect of data integration is possibility of complementing of missing points for example in point clouds. The paper shows the possibility of integrating data from terrestrial laser scanning with digital imagery and an analysis of the accuracy of the presented methods. The paper describes results obtained from raw data consisting of a point cloud measured using terrestrial laser scanning acquired from a Leica ScanStation2 and digital imagery taken using a Kodak DCS Pro 14N camera. The studied structure is the ruins of the Ilza castle in Poland.

Bioprocessing development: Immune/cellular applications: Anti-Ig autoantibody and complement-mediated destruction of neoplastic cells

NASA Technical Reports Server (NTRS)

Twomey, J. J.

1976-01-01

This space bioprocessing contract effort was comprised of four general objectives. These were: (1) the evaluation of current separation processes, (2) the identification of problems relevant to the separation of important biologicals, (3) the identification of ground-based assay methods needed for pre- and postflight analysis of space bioprocessing separation technology; and (4) the establishment of methods to determine the efficiency of space bioprocessing separation procedures. Immunology was deemed advantageous to study the diversity of cells and cell products involved and the extensive interest being given to their separation. Upon recognition of a cellular or molecular agent as foreign to the body, the immune system becomes activated to produce cells whose function is to destroy that agent and cell products whose function is to inactivate the agent and assist in its destruction. Long after the agent is removed from the body, some cells remain in a state of readiness to continue these destructive actions specifically against that agent should further exposure to it occur. This is the basis of acquired immunity to disease.

Identification and ranking of environmental threats with ecosystem vulnerability distributions.

PubMed

Zijp, Michiel C; Huijbregts, Mark A J; Schipper, Aafke M; Mulder, Christian; Posthuma, Leo

2017-08-24

Responses of ecosystems to human-induced stress vary in space and time, because both stressors and ecosystem vulnerabilities vary in space and time. Presently, ecosystem impact assessments mainly take into account variation in stressors, without considering variation in ecosystem vulnerability. We developed a method to address ecosystem vulnerability variation by quantifying ecosystem vulnerability distributions (EVDs) based on monitoring data of local species compositions and environmental conditions. The method incorporates spatial variation of both abiotic and biotic variables to quantify variation in responses among species and ecosystems. We show that EVDs can be derived based on a selection of locations, existing monitoring data and a selected impact boundary, and can be used in stressor identification and ranking for a region. A case study on Ohio's freshwater ecosystems, with freshwater fish as target species group, showed that physical habitat impairment and nutrient loads ranked highest as current stressors, with species losses higher than 5% for at least 6% of the locations. EVDs complement existing approaches of stressor assessment and management, which typically account only for variability in stressors, by accounting for variation in the vulnerability of the responding ecosystems.

Consensus on context-specific strategies for reducing the stigma of human immunodeficiency virus/acquired immunodeficiency syndrome in Zambézia Province, Mozambique

PubMed Central

Mukolo, Abraham; Torres, Isabel; Bechtel, Ruth M.; Sidat, Mohsin; Vergara, Alfredo E.

2014-01-01

Stigma has been implicated in poor outcomes of human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) care. Reducing stigma is important for HIV prevention and long-term treatment success. Although stigma reduction interventions are conducted in Mozambique, little is known about the current nature of stigma and the efficacy and effectiveness of stigma reduction initiatives. We describe action research to generate consensus on critical characteristics of HIV stigma and anti-stigma interventions in Zambézia Province, Mozambique. Qualitative data gathering methods, including indepth key-informant interviews, community interviews and consensus group sessions, were utilized. Delphi methods and the strategic options development analysis technique were used to synthesize qualitative data. Key findings are that stigma enacted by the general public might be declining in tandem with the HIV/AIDS epidemic in Mozambique, but there is likely excessive residual fear of HIV disease and community attitudes that sustain high levels of perceived stigma. HIV-positive women accessing maternal and child health services appear to shoulder a disproportionate burden of stigma. Unintentional biases among healthcare providers are currently the critical frontier of stigmatization, but there are few interventions designed to address them. Culturally sensitive psychotherapies are needed to address psychological distress associated with internalized stigma and these interventions should complement current supports for voluntary counseling and testing. While advantageous for defining stakeholder priorities for stigma reduction efforts, confirmatory quantitative studies of these consensus positions are needed before the launch of specific interventions. PMID:24527744

Genetic control of the alternative pathway of complement in humans and age-related macular degeneration

PubMed Central

Hecker, Laura A.; Edwards, Albert O.; Ryu, Euijung; Tosakulwong, Nirubol; Baratz, Keith H.; Brown, William L.; Issa, Peter Charbel; Scholl, Hendrik P.; Pollok-Kopp, Beatrix; Schmid-Kubista, Katharina E.; Bailey, Kent R.; Oppermann, Martin

2010-01-01

Activation of the alternative pathway of complement is implicated in common neurodegenerative diseases including age-related macular degeneration (AMD). We explored the impact of common variation in genes encoding proteins of the alternative pathway on complement activation in human blood and in AMD. Genetic variation across the genes encoding complement factor H (CFH), factor B (CFB) and component 3 (C3) was determined. The influence of common haplotypes defining transcriptional and translational units on complement activation in blood was determined in a quantitative genomic association study. Individual haplotypes in CFH and CFB were associated with distinct and novel effects on plasma levels of precursors, regulators and activation products of the alternative pathway of complement in human blood. Further, genetic variation in CFH thought to influence cell surface regulation of complement did not alter plasma complement levels in human blood. Plasma markers of chronic activation (split-products Ba and C3d) and an activating enzyme (factor D) were elevated in AMD subjects. Most of the elevation in AMD was accounted for by the genetic variation controlling complement activation in human blood. Activation of the alternative pathway of complement in blood is under genetic control and increases with age. The genetic variation associated with increased activation of complement in human blood also increased the risk of AMD. Our data are consistent with a disease model in which genetic variation in the complement system increases the risk of AMD by a combination of systemic complement activation and abnormal regulation of complement activation in local tissues. PMID:19825847

Complement in Lupus Nephritis: New Perspectives.

PubMed

Bao, Lihua; Cunningham, Patrick N; Quigg, Richard J

2015-09-01

Systemic lupus erythematosus (SLE) is an autoimmune disorder caused by loss of tolerance to self-antigens, the production of autoantibodies and deposition of complement-fixing immune complexes (ICs) in injured tissues. SLE is characterized by a wide range of clinical manifestations and targeted organs, with lupus nephritis being one of the most serious complications. The complement system consists of three pathways and is tightly controlled by a set of regulatory proteins to prevent injudicious complement activation on host tissue. The involvement of the complement system in the pathogenesis of SLE is well accepted; yet, its exact role is still not clear. Complement plays dual roles in the pathogenesis of SLE. On the one hand, the complement system appears to have protective features in that hereditary homozygous deficiencies of classical pathway components, such as C1q and C4, are associated with an increased risk for SLE. On the other hand, IC-mediated activation of complement in affected tissues is clearly evident in both experimental and human SLE along with pathological features that are logical consequences of complement activation. Studies in genetically altered mice have shown that lack of complement inhibitors, such as complement factor H (CFH) or decay-accelerating factor (DAF) accelerates the development of experimental lupus nephritis, while treatment with recombinant protein inhibitors, such as Crry-Ig, CR2-Crry, CR2-DAF and CR2-CFH, ameliorates the disease development. Complement-targeted drugs, including soluble complement receptor 1 (TP10), C1 esterase inhibitor and a monoclonal anti-C5 antibody (eculizumab), have been shown to inhibit complement safely, and are now being investigated in a variety of clinical conditions. SLE is an autoimmune disorder which targets multiple systems. Complement is centrally involved and plays dual roles in the pathogenesis of SLE. Studies from experimental lupus models and clinical trials support the use of complement-targeted therapy in the treatment of SLE.

Evaluation of medical research performance – position paper of the Association of the Scientific Medical Societies in Germany (AWMF)

PubMed Central

Herrmann-Lingen, Christoph; Brunner, Edgar; Hildenbrand, Sibylle; Loew, Thomas H.; Raupach, Tobias; Spies, Claudia; Treede, Rolf-Detlef; Vahl, Christian-Friedrich; Wenz, Hans-Jürgen

2014-01-01

Objective: The evaluation of medical research performance is a key prerequisite for the systematic advancement of medical faculties, research foci, academic departments, and individual scientists’ careers. However, it is often based on vaguely defined aims and questionable methods and can thereby lead to unwanted regulatory effects. The current paper aims at defining the position of German academic medicine toward the aims, methods, and consequences of its evaluation. Methods: During the Berlin Forum of the Association of the Scientific Medical Societies in Germany (AWMF) held on 18 October 2013, international experts presented data on methods for evaluating medical research performance. Subsequent discussions among representatives of relevant scientific organizations and within three ad-hoc writing groups led to a first draft of this article. Further discussions within the AWMF Committee for Evaluation of Performance in Research and Teaching and the AWMF Executive Board resulted in the final consented version presented here. Results: The AWMF recommends modifications to the current system of evaluating medical research performance. Evaluations should follow clearly defined and communicated aims and consist of both summative and formative components. Informed peer reviews are valuable but feasible in longer time intervals only. They can be complemented by objective indicators. However, the Journal Impact Factor is not an appropriate measure for evaluating individual publications or their authors. The scientific “impact” rather requires multidimensional evaluation. Indicators of potential relevance in this context may include, e.g., normalized citation rates of scientific publications, other forms of reception by the scientific community and the public, and activities in scientific organizations, research synthesis and science communication. In addition, differentiated recommendations are made for evaluating the acquisition of third-party funds and the promotion of junior scientists. Conclusions: With the explicit recommendations presented in the current position paper, the AWMF suggests enhancements to the practice of evaluating medical research performance by faculties, ministries and research funding organizations. PMID:24971044

Application of phyto-indication and radiocesium indicative methods for microrelief mapping

NASA Astrophysics Data System (ADS)

Panidi, E.; Trofimetz, L.; Sokolova, J.

2016-04-01

Remote sensing technologies are widely used for production of Digital Elevation Models (DEMs), and geomorphometry techniques are valuable tools for DEM analysis. One of the broadly used applications of these technologies and techniques is relief mapping. In the simplest case, we can identify relief structures using DEM analysis, and produce a map or map series to show the relief condition. However, traditional techniques might fail when used for mapping microrelief structures (structures below ten meters in size). In this case high microrelief dynamics lead to technological and conceptual difficulties. Moreover, erosion of microrelief structures cannot be detected at the initial evolution stage using DEM modelling and analysis only. In our study, we investigate the possibilities and specific techniques for allocation of erosion microrelief structures, and mapping techniques for the microrelief derivatives (e.g. quantitative parameters of microrelief). Our toolset includes the analysis of spatial redistribution of the soil pollutants and phyto-indication analysis, which complement the common DEM modelling and geomorphometric analysis. We use field surveys produced at the test area, which is arable territory with high erosion risks. Our main conclusion at the current stage is that the indicative methods (i.e. radiocesium and phyto-indication methods) are effective for allocation of the erosion microrelief structures. Also, these methods need to be formalized for convenient use.

Weather Typing-Based Flood Frequency Analysis Verified for Exceptional Historical Events of Past 500 Years Along the Meuse River

NASA Astrophysics Data System (ADS)

De Niel, J.; Demarée, G.; Willems, P.

2017-10-01

Governments, policy makers, and water managers are pushed by recent socioeconomic developments such as population growth and increased urbanization inclusive of occupation of floodplains to impose very stringent regulations on the design of hydrological structures. These structures need to withstand storms with return periods typically ranging between 1,250 and 10,000 years. Such quantification involves extrapolations of systematically measured instrumental data, possibly complemented by quantitative and/or qualitative historical data and paleoflood data. The accuracy of the extrapolations is, however, highly unclear in practice. In order to evaluate extreme river peak flow extrapolation and accuracy, we studied historical and instrumental data of the past 500 years along the Meuse River. We moreover propose an alternative method for the estimation of the extreme value distribution of river peak flows, based on weather types derived by sea level pressure reconstructions. This approach results in a more accurate estimation of the tail of the distribution, where current methods are underestimating the design levels related to extreme high return periods. The design flood for a 1,250 year return period is estimated at 4,800 m3 s-1 for the proposed method, compared with 3,450 and 3,900 m3 s-1 for a traditional method and a previous study.

Determining skeletal muscle architecture with Laplacian simulations: a comparison with diffusion tensor imaging.

PubMed

Handsfield, Geoffrey G; Bolsterlee, Bart; Inouye, Joshua M; Herbert, Robert D; Besier, Thor F; Fernandez, Justin W

2017-12-01

Determination of skeletal muscle architecture is important for accurately modeling muscle behavior. Current methods for 3D muscle architecture determination can be costly and time-consuming, making them prohibitive for clinical or modeling applications. Computational approaches such as Laplacian flow simulations can estimate muscle fascicle orientation based on muscle shape and aponeurosis location. The accuracy of this approach is unknown, however, since it has not been validated against other standards for muscle architecture determination. In this study, muscle architectures from the Laplacian approach were compared to those determined from diffusion tensor imaging in eight adult medial gastrocnemius muscles. The datasets were subdivided into training and validation sets, and computational fluid dynamics software was used to conduct Laplacian simulations. In training sets, inputs of muscle geometry, aponeurosis location, and geometric flow guides resulted in good agreement between methods. Application of the method to validation sets showed no significant differences in pennation angle (mean difference [Formula: see text] or fascicle length (mean difference 0.9 mm). Laplacian simulation was thus effective at predicting gastrocnemius muscle architectures in healthy volunteers using imaging-derived muscle shape and aponeurosis locations. This method may serve as a tool for determining muscle architecture in silico and as a complement to other approaches.

The Continuous Monitoring of Desert Dust using an Infrared-based Dust Detection and Retrieval Method

NASA Technical Reports Server (NTRS)

Duda, David P.; Minnis, Patrick; Trepte, Qing; Sun-Mack, Sunny

2006-01-01

Airborne dust and sand are significant aerosol sources that can impact the atmospheric and surface radiation budgets. Because airborne dust affects visibility and air quality, it is desirable to monitor the location and concentrations of this aerosol for transportation and public health. Although aerosol retrievals have been derived for many years using visible and near-infrared reflectance measurements from satellites, the detection and quantification of dust from these channels is problematic over bright surfaces, or when dust concentrations are large. In addition, aerosol retrievals from polar orbiting satellites lack the ability to monitor the progression and sources of dust storms. As a complement to current aerosol dust retrieval algorithms, multi-spectral thermal infrared (8-12 micron) data from the Moderate Resolution Imaging Spectroradiometer (MODIS) and the Meteosat-8 Spinning Enhanced Visible and Infrared Imager (SEVIRI) are used in the development of a prototype dust detection method and dust property retrieval that can monitor the progress of Saharan dust fields continuously, both night and day. The dust detection method is incorporated into the processing of CERES (Clouds and the Earth s Radiant Energy System) aerosol retrievals to produce dust property retrievals. Both MODIS (from Terra and Aqua) and SEVERI data are used to develop the method.

In vivo X-ray fluorescence of lead in bone: review and current issues.

PubMed Central

Todd, A C; Chettle, D R

1994-01-01

Bone lead measurements can assess long-term lead dosimetry because the residence time of lead in bone is long. Bone lead measurements thus complement blood and plasma lead measurements, which reflect more short-term exposure. Although the noninvasive, in vivo measurement of lead in bone by X-ray fluorescence (XRF) has been under development since the 1970s, its use is still largely confined to research institutions. There are three principal methods used that vary both in the how lead X-rays are fluoresced and in which lead X-rays are fluoresced. Several groups have reported the independent development of in vivo measurement systems, the majority adopting the 109Cd K XRF method because of its advantages: a robust measurement, a lower detection limit (compared to 57Co K XRF), and a lower effective (radiation) dose (compared to L XRF) when calculated according to the most recent guidelines. These advantages, and the subsequent widespread adoption of the 109Cd method, are primarily consequences of the physics principles of the technique. This paper presents an explanation of the principles of XRF, a description of the practical measurement systems, a review of the human bone lead studies performed to date; and a discussion of some issues surrounding future application of the methods. Images p172-a PMID:8033846

ANALYTICAL METHODS DEVELOPMENT FOR DIETARY SAMPLES

EPA Science Inventory

The Microbiological and Chemical Exposure Assessment Research Division's (MCEARD) dietary exposure research program is conducted to complement the NERL aggregate and cumulative exposure program. Its purpose is to reduce the level of uncertainty in exposure assessment by improvin...

Applying a statistical PTB detection procedure to complement the gold standard.

PubMed

Noor, Norliza Mohd; Yunus, Ashari; Bakar, S A R Abu; Hussin, Amran; Rijal, Omar Mohd

2011-04-01

This paper investigates a novel statistical discrimination procedure to detect PTB when the gold standard requirement is taken into consideration. Archived data were used to establish two groups of patients which are the control and test group. The control group was used to develop the statistical discrimination procedure using four vectors of wavelet coefficients as feature vectors for the detection of pulmonary tuberculosis (PTB), lung cancer (LC), and normal lung (NL). This discrimination procedure was investigated using the test group where the number of sputum positive and sputum negative cases that were correctly classified as PTB cases were noted. The proposed statistical discrimination method is able to detect PTB patients and LC with high true positive fraction. The method is also able to detect PTB patients that are sputum negative and therefore may be used as a complement to the gold standard. Copyright © 2010 Elsevier Ltd. All rights reserved.

Ecotoxicological evaluation of areas polluted by mining activities

NASA Astrophysics Data System (ADS)

García-Lorenzo, M. L.; Martínez-Sánchez, M. J.; Pérez-Sirvent, C.; Molina, J.

2009-04-01

Determination of the contaminant content is not enough to evaluate the toxic effects or to characterise contaminated sites, because such a measure does not reflect the ecotoxicological danger in the environment and does not provide information on the effects of the chemical compounds. To estimate the risk of contaminants, chemical methods need to be complemented with biological methods. Therefore, ecotoxicological testing may be a useful approach for assessing the toxicity as a complement to chemical analysis. The aim of this study was to develop a battery of bioassays for the ecotoxicological screening of areas polluted by mining activities. Particularly, the toxicity of water samples, sediments and their pore-water extracts was evaluated by using three assays: bacteria, plants and ostracods. Moreover, the possible relationship between observed toxicity and results of chemical analysis was studied. The studied area, Sierra Minera, is close to the mining region of La Uni

Evasion of Complement-Mediated Lysis and Complement C3 Deposition Are Regulated by Francisella tularensis Lipopolysaccharide O Antigen1

PubMed Central

Clay, Corey D.; Soni, Shilpa; Gunn, John S.; Schlesinger, Larry S.

2009-01-01

The bacterium Francisella tularensis (Ft) is a potential weapon of bioterrorism when aerosolized. Macrophage infection is necessary for disease progression and efficient phagocytosis by human macrophages requires serum opsonization by complement. Microbial complement activation leads to surface deposition of a highly regulated protein complex resulting in opsonization or membrane lysis. The nature of complement component C3 deposition, i.e., C3b (opsonization and lysis) or C3bi (opsonization only) fragment deposition, is central to the outcome of activation. In this study, we examine the mechanisms of Ft resistance to complement-mediated lysis, C3 component deposition on the Ft surface, and complement activation. Upon incubation in fresh nonimmune human serum, Schu S4 (Ft subsp. tularensis), Fn (Ft subsp. novicida), and LVS (Ft subsp. holarctica live vaccine strain) were resistant to complement-mediated lysis, but LVSG and LVSR (LVS strains altered in surface carbohydrate structures) were susceptible. C3 deposition, however, occurred on all strains. Complement-susceptible strains had markedly increased C3 fragment deposition, including the persistent presence of C3b compared with C3bi, which indicates that C3b inactivation results in survival of complement-resistant strains. C1q, an essential component of the classical activation pathway, was necessary for lysis of complement-susceptible strains and optimal C3 deposition on all strains. Finally, use of Francisella LPS mutants confirmed O Ag as a major regulator of complement resistance. These data provide evidence that pathogenic Francisella activate complement, but are resistant to complement-mediated lysis in part due to limited C3 deposition, rapid conversion of surface-bound C3b to C3bi, and the presence of LPS O Ag. PMID:18832715

NETosing Neutrophils Activate Complement Both on Their Own NETs and Bacteria via Alternative and Non-alternative Pathways

PubMed Central

Yuen, Joshua; Pluthero, Fred G.; Douda, David N.; Riedl, Magdalena; Cherry, Ahmed; Ulanova, Marina; Kahr, Walter H. A.; Palaniyar, Nades; Licht, Christoph

2016-01-01

Neutrophils deposit antimicrobial proteins, such as myeloperoxidase and proteases on chromatin, which they release as neutrophil extracellular traps (NETs). Neutrophils also carry key components of the complement alternative pathway (AP) such as properdin or complement factor P (CFP), complement factor B (CFB), and C3. However, the contribution of these complement components and complement activation during NET formation in the presence and absence of bacteria is poorly understood. We studied complement activation on NETs and a Gram-negative opportunistic bacterial pathogen Pseudomonas aeruginosa (PA01, PAKwt, and PAKgfp). Here, we show that anaphylatoxin C5a, formyl-methionyl-leucyl-phenylalanine (fMLP) and phorbol myristate acetate (PMA), which activates NADPH oxidase, induce the release of CFP, CFB, and C3 from neutrophils. In response to PMA or P. aeruginosa, neutrophils secrete CFP, deposit it on NETs and bacteria, and induce the formation of terminal complement complexes (C5b–9). A blocking anti-CFP antibody inhibited AP-mediated but not non-AP-mediated complement activation on NETs and P. aeruginosa. Therefore, NET-mediated complement activation occurs via both AP- and non AP-based mechanisms, and AP-mediated complement activation during NETosis is dependent on CFP. These findings suggest that neutrophils could use their “AP tool kit” to readily activate complement on NETs and Gram-negative bacteria, such as P. aeruginosa, whereas additional components present in the serum help to fix non-AP-mediated complement both on NETs and bacteria. This unique mechanism may play important roles in host defense and help to explain specific roles of complement activation in NET-related diseases. PMID:27148258

Blood SC5b-9 complement levels increase at parturition during term and preterm labor.

PubMed

Segura-Cervantes, Enrique; Mancilla-Ramirez, Javier; Zurita, Luis; Paredes, Yuriria; Arredondo, José Luis; Galindo-Sevilla, Norma

2015-06-01

We explored the hypothesis that complement, an innate and adaptive immune effector, is active in the plasma of parturient women and is deposited on fetal membranes collected after delivery. A cross-sectional study was designed to evaluate complement activity at parturition. Pregnant women (n = 97) between 15 and 41 years of age were enrolled in a hospital protocol during the perinatal period to assess both SC5b-9 complement activity in blood and complement deposition on fetal membranes during parturition. Soluble SC5b-9 complement activity in plasma fractions was measured using a standard enzyme-linked immunosorbent assay (ELISA) that included specific anti-complement antibodies. Complement deposition on membranes was analyzed using immuno-dot blots and immunohistochemistry. Soluble SC5b-9 complement complex levels were increased in the plasma of women during term labor (TL; median 3361; range 1726-5670 ng/mL), preterm labor (PL; median 2958; range 1552-7092 ng/mL), and preterm premature rupture of membranes (PPROM; median 2272; range 167-6540 ng/mL) compared with pregnant women who were not in labor (P; median 1384; range 174-4570 ng/mL; P < 0.001, Kruskal-Wallis test). Active complement, as assessed by the C9 neo-antigen in C5b-9 complexes, was deposited on fetal membranes, with no difference between term and preterm delivery. The deposition of active complement on fetal membranes was confirmed by immunohistochemistry. Women who underwent non-labor-indicated Cesarean sections did not exhibit complement deposition. Soluble SC5b-9 complement complex levels increased in the plasma of women during parturition, and complement C5b-9 complexes were deposited on fetal membranes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Radio Science from an Optical Communications Signal

NASA Technical Reports Server (NTRS)

Moision, Bruce; Asmar, Sami; Oudrhiri, Kamal

2013-01-01

NASA is currently developing the capability to deploy deep space optical communications links. This creates the opportunity to utilize the optical link to obtain range, doppler, and signal intensity estimates. These may, in turn, be used to complement or extend the capabilities of current radio science. In this paper we illustrate the achievable precision in estimating range, doppler, and received signal intensity of an non-coherent optical link (the current state-of-the-art for a deep-space link). We provide a joint estimation algorithm with performance close to the bound. We draw comparisons to estimates based on a coherent radio frequency signal, illustrating that large gains in either precision or observation time are possible with an optical link.

Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

PubMed

Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

2016-01-01

The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion

PubMed Central

Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse

2016-01-01

The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340

Complement Constructions in English: Fairly Difficult for EFL Language Learners

ERIC Educational Resources Information Center

Fazeli, Fatemeh; Shokrpour, Nasrin

2012-01-01

Complement constructions vary significantly in English and Persian. There are more complementation structures in English than in Persian and a complement structure in Persian might have more than one equivalent in English. Producing complement structures (CSs) in English is very difficult for native speakers of Persian, especially in an EFL…

NASA Countermeasures Evaluation and Validation Project

NASA Technical Reports Server (NTRS)

Lundquist, Charlie M.; Paloski, William H. (Technical Monitor)

2000-01-01

To support its ISS and exploration class mission objectives, NASA has developed a Countermeasure Evaluation and Validation Project (CEVP). The goal of this project is to evaluate and validate the optimal complement of countermeasures required to maintain astronaut health, safety, and functional ability during and after short- and long-duration space flight missions. The CEVP is the final element of the process in which ideas and concepts emerging from basic research evolve into operational countermeasures. The CEVP is accomplishing these objectives by conducting operational/clinical research to evaluate and validate countermeasures to mitigate these maladaptive responses. Evaluation is accomplished by testing in space flight analog facilities, and validation is accomplished by space flight testing. Both will utilize a standardized complement of integrated physiological and psychological tests, termed the Integrated Testing Regimen (ITR) to examine candidate countermeasure efficacy and intersystem effects. The CEVP emphasis is currently placed on validating the initial complement of ISS countermeasures targeting bone, muscle, and aerobic fitness; followed by countermeasures for neurological, psychological, immunological, nutrition and metabolism, and radiation risks associated with space flight. This presentation will review the processes, plans, and procedures that will enable CEVP to play a vital role in transitioning promising research results into operational countermeasures necessary to maintain crew health and performance during long duration space flight.

Complement fixation test to C burnetii

MedlinePlus

... complement fixation test; Coxiella burnetii - complement fixation test; C burnetii - complement fixation test ... a specific foreign substance ( antigen ), in this case, C burnetii . Antibodies defend the body against bacteria, viruses, ...

DIETARY EXPOSURE METHODS AND MODELS

EPA Science Inventory

The research reported in this task description constitutes the MCEARD base dietary exposure research program and is conducted to complement the NERL aggregate and cumulative exposure program. Its purpose is to reduce the level of uncertainty in exposure assessment by improving N...

Host response to Candida albicans bloodstream infection and sepsis

PubMed Central

Duggan, Seána; Leonhardt, Ines; Hünniger, Kerstin; Kurzai, Oliver

2015-01-01

Candida albicans is a major cause of bloodstream infection which may present as sepsis and septic shock - major causes of morbidity and mortality world-wide. After invasion of the pathogen, innate mechanisms govern the early response. Here, we outline the models used to study these mechanisms and summarize our current understanding of innate immune responses during Candida bloodstream infection. This includes protective immunity as well as harmful responses resulting in Candida induced sepsis. Neutrophilic granulocytes are considered principal effector cells conferring protection and recognize C. albicans mainly via complement receptor 3. They possess a range of effector mechanisms, contributing to elimination of the pathogen. Neutrophil activation is closely linked to complement and modulated by activated mononuclear cells. A thorough understanding of these mechanisms will help in creating an individualized approach to patients suffering from systemic candidiasis and aid in optimizing clinical management. PMID:25785541

Masturbation in the United States.

PubMed

Das, Aniruddha

2007-01-01

Using data from the nationally representative National Health and Social Life Survey, this study queried the correlates of masturbation in the United States in 1992. Among those aged 18-60, 38% (CI, 35-41) of women and 61% (CI, 57-65) of men reported any masturbation over the preceding year. The system of factors underlying masturbation was similar for both genders, consistent with a convergence in gender patterns of sexual expression in the United States. Among both women and men, masturbation responded to a stable sexualized personality pattern, catalyzed by early-life factors and manifested in current sexual traits. Strikingly, the masturbation-partnered sex linkage, often conceptualized either as compensating for unsatisfying sex or complementing a satisfactory sex life, appeared to be bimodal for both genders. For some, masturbation complemented an active and pleasurable sex life, while among others, it compensated for a lack of partnered sex or satisfaction in sex.

Staphylococcus aureus Manipulates Innate Immunity through Own and Host-Expressed Proteases.

PubMed

Pietrocola, Giampiero; Nobile, Giulia; Rindi, Simonetta; Speziale, Pietro

2017-01-01

Neutrophils, complement system and skin collectively represent the main elements of the innate immune system, the first line of defense of the host against many common microorganisms. Bacterial pathogens have evolved strategies to counteract all these defense activities. Specifically, Staphylococcus aureus , a major human pathogen, secretes a variety of immune evasion molecules including proteases, which cleave components of the innate immune system or disrupt the integrity of extracellular matrix and intercellular connections of tissues. Additionally, S. aureus secretes proteins that can activate host zymogens which, in turn, target specific defense components. Secreted proteins can also inhibit the anti-bacterial function of neutrophils or complement system proteases, potentiating S. aureus chances of survival. Here, we review the current understanding of these proteases and modulators of host proteases in the functioning of innate immunity and describe the importance of these mechanisms in the pathology of staphylococcal diseases.

Staphylococcus aureus Manipulates Innate Immunity through Own and Host-Expressed Proteases

PubMed Central

Pietrocola, Giampiero; Nobile, Giulia; Rindi, Simonetta; Speziale, Pietro

2017-01-01

Neutrophils, complement system and skin collectively represent the main elements of the innate immune system, the first line of defense of the host against many common microorganisms. Bacterial pathogens have evolved strategies to counteract all these defense activities. Specifically, Staphylococcus aureus, a major human pathogen, secretes a variety of immune evasion molecules including proteases, which cleave components of the innate immune system or disrupt the integrity of extracellular matrix and intercellular connections of tissues. Additionally, S. aureus secretes proteins that can activate host zymogens which, in turn, target specific defense components. Secreted proteins can also inhibit the anti-bacterial function of neutrophils or complement system proteases, potentiating S. aureus chances of survival. Here, we review the current understanding of these proteases and modulators of host proteases in the functioning of innate immunity and describe the importance of these mechanisms in the pathology of staphylococcal diseases. PMID:28529927

The interrelationship of complement-activation fragments and angiogenesis-related factors in early pregnancy and their association with pre-eclampsia

PubMed Central

Lynch, AM; Murphy, JR; Gibbs, RS; Levine, RJ; Giclas, PC; Salmon, JE; Holers, VM

2016-01-01

Objective To determine the interrelationships during early pregnancy of complement-activation fragments Bb, C3a and sC5b-9, and angiogenesis-related factors placental growth factor (PiGF), soluble fms-like tyrosine kinase-1 (sFlt-1) and soluble endoglin (sEng), and their associations with pre-eclampsia. Design Prospective cohort study. Setting Denver complement study (June 2005–June 2008). Population A total of 668 pregnant women with singleton gestations, recruited between 10 and 15 weeks of gestation. Methods Using univariable and multivariable logistic regression analysis, concentrations of complement-activation fragments and angiogenesis-related factors were compared between 10 and 15 weeks of gestation in women who subsequently did or did not develop pre-eclampsia. Interrelationships between these variables were tested using the non-parametric Spearman rank correlation coefficient. Main outcome measure Pre-eclampsia. The association of complement-activation fragments and angiogenesis-related factors with obesity was also examined. Results The mean (±SD) levels of complement Bb in early pregnancy among women who did and did not develop pre-eclampsia were 0.84 (±0.26) µg/ml and 0.69 (±0.2) µg/ml, respectively (P = 0.001). Concentrations of PiGF were significantly (P = 0.01) lower (31 ± 12 pg/ml) in early pregnancy in the pre-eclamptic group of women, as compared with the normotensive group (39 ± 32 pg/ml). The adjusted odds ratio (AOR) of Bb and PiGF were 2.1 (CI = 1.4–3.1, P < 0.0003) and 0.2 (CI = 0.07–0.7, P = 0.01), respectively. There was no significant difference in the levels of C3a, sC5b-9, sFlt-1 and sEng in early pregnancy among women who developed pre-eclampsia, compared with women who remained normotensive during pregnancy. Higher levels of Bb (P = 0.0001) and C3a (P = 0.03), and lower levels of sFlt-1 (P = 0.0002) and sEng (P = 0.0001) were found among women with obesity, compared with non-obese controls. No meaningful relationships were found between the complement-activation fragments and the angiogenesis-related factors. Conclusions In this cohort during early pregnancy, increased concentrations of complement-activation factor Bb and lower concentrations of PiGF were associated with the development of pre-eclampsia later in pregnancy. PMID:20074261

Outreach and educational activities in Russia

NASA Astrophysics Data System (ADS)

Gritsevich, M.; Kartashova, A.

2012-09-01

We present an overview of the major internal as well as international meetings and events held in Russia and dedicated to the integration, development and expanding of knowledge in Planetary Research. The report is complemented by the Europlanet activities in Russia over the last year, achieved goals and lessons learned. Additionally, we highlight current problems and possible future improvements to the present educational and outreach techniques.

Classification of Complex Sounds.

DTIC Science & Technology

1992-10-31

spectral weights may be useful in developing signal enhancement techniques based on psychological aspects of the listener (providing a complement to...Journals) Green, D.M., and Berg, B.G. (1991). Spectral weights and the profile bowl. Quarterly Journal of Experimental Psychology , 43A, 449-458. Dai, H...Macmillan and C.D. Creelman . Cambridge/NY: Cambridge Universi- ty Press, 1991.) J. Math. Psych., in press. Training Currently, there are two graduate

An Australian and New Zealand Scoping Study on the Use of 3D Immersive Virtual Worlds in Higher Education

ERIC Educational Resources Information Center

Dalgarno, Barney; Lee, Mark J. W.; Carlson, Lauren; Gregory, Sue; Tynan, Belinda

2011-01-01

This article describes the research design of, and reports selected findings from, a scoping study aimed at examining current and planned applications of 3D immersive virtual worlds at higher education institutions across Australia and New Zealand. The scoping study is the first of its kind in the region, intended to parallel and complement a…

Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria.

PubMed

Gelderman, Grant; Sivakumar, Anusha; Lipp, Sarah; Contreras, Lydia

2015-02-01

sRNAs play a significant role in controlling and regulating cellular metabolism. One of the more interesting aspects of certain sRNAs is their ability to make global changes in the cell by interacting with regulatory proteins. In this work, we demonstrate the use of an in vivo Tri-molecular Fluorescence Complementation assay to detect and visualize the central regulatory sRNA-protein interaction of the Carbon Storage Regulatory system in E. coli. The Carbon Storage Regulator consists primarily of an RNA binding protein, CsrA, that alters the activity of mRNA targets and of an sRNA, CsrB, that modulates the activity of CsrA. We describe the construction of a fluorescence complementation system that detects the interactions between CsrB and CsrA. Additionally, we demonstrate that the intensity of the fluorescence of this system is able to detect changes in the affinity of the CsrB-CsrA interaction, as caused by mutations in the protein sequence of CsrA. While previous methods have adopted this technique to study mRNA or RNA localization, this is the first attempt to use this technique to study the sRNA-protein interaction directly in bacteria. This method presents a potentially powerful tool to study complex bacterial RNA protein interactions in vivo. © 2014 Wiley Periodicals, Inc.

Using animal models to determine the significance of complement activation in Alzheimer's disease

PubMed Central

Loeffler, David A

2004-01-01

Complement inflammation is a major inflammatory mechanism whose function is to promote the removal of microorganisms and the processing of immune complexes. Numerous studies have provided evidence for an increase in this process in areas of pathology in the Alzheimer's disease (AD) brain. Because complement activation proteins have been demonstrated in vitro to exert both neuroprotective and neurotoxic effects, the significance of this process in the development and progression of AD is unclear. Studies in animal models of AD, in which brain complement activation can be experimentally altered, should be of value for clarifying this issue. However, surprisingly little is known about complement activation in the transgenic animal models that are popular for studying this disorder. An optimal animal model for studying the significance of complement activation on Alzheimer's – related neuropathology should have complete complement activation associated with senile plaques, neurofibrillary tangles (if present), and dystrophic neurites. Other desirable features include both classical and alternative pathway activation, increased neuronal synthesis of native complement proteins, and evidence for an increase in complement activation prior to the development of extensive pathology. In order to determine the suitability of different animal models for studying the role of complement activation in AD, the extent of complement activation and its association with neuropathology in these models must be understood. PMID:15479474

Realistic soft tissue deformation strategies for real time surgery simulation.

PubMed

Shen, Yunhe; Zhou, Xiangmin; Zhang, Nan; Tamma, Kumar; Sweet, Robert

2008-01-01

A volume-preserving deformation method (VPDM) is developed in complement with the mass-spring method (MSM) to improve the deformation quality of the MSM to model soft tissue in surgical simulation. This method can also be implemented as a stand-alone model. The proposed VPDM satisfies the Newton's laws of motion by obtaining the resultant vectors form an equilibrium condition. The proposed method has been tested in virtual surgery systems with haptic rendering demands.

Simultaneous detection and quantitation of organic impurities in methamphetamine by ultra-high-performance liquid chromatography-tandem mass spectrometry, a complementary technique for methamphetamine profiling.

PubMed

Li, Li; Brown, Jaclyn L; Toske, Steven G

2018-04-06

The analysis of organic impurities plays an important role in the impurity profiling of methamphetamine, which in turn provides valuable information about methamphetamine manufacturing, in particular its synthetic route, chemicals, and precursors used. Ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) is ideally suited for this purpose due to its excellent sensitivity, selectivity, and wide linear range in multiple reaction monitoring (MRM) mode. In this study, a dilute-and-shoot UHPLC-MS/MS method was developed for the simultaneous identification and quantitation of 23 organic manufacturing impurities in illicit methamphetamine. The developed method was validated in terms of stability, limit of detection (LOD), lower limit of quantification (LLOQ), accuracy, and precision. More than 100 illicitly prepared methamphetamine samples were analyzed. Due to its ability to detect ephedrine/pseudoephedrine and its high sensitivity for critical target markers (eg, chloro-pseudoephedrine, N-cyclohexylamphetamine, and compounds B and P), more impurities and precursor/pre-precursors were identified and quantified versus the current procedure by gas chromatography-mass spectrometry (GC-MS). Consequently, more samples could be classified by their synthetic routes. However, the UHPLC-MS/MS method has difficulty in detecting neutral and untargeted emerging manufacturing impurities and can therefore only serve as a complement to the current method. Despite this deficiency, the quantitative information acquired by the presented UHPLC-MS/MS methodology increased the sample discrimination power, thereby enhancing the capacity of methamphetamine profiling program (MPP) to conduct sample-sample comparisons. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.

Complement Factor H Is Expressed in Adipose Tissue in Association With Insulin Resistance

PubMed Central

Moreno-Navarrete, José María; Martínez-Barricarte, Rubén; Catalán, Victoria; Sabater, Mònica; Gómez-Ambrosi, Javier; Ortega, Francisco José; Ricart, Wifredo; Blüher, Mathias; Frühbeck, Gema; Rodríguez de Cordoba, Santiago; Fernández-Real, José Manuel

2010-01-01

OBJECTIVE Activation of the alternative pathway of the complement system, in which factor H (fH; complement fH [CFH]) is a key regulatory component, has been suggested as a link between obesity and metabolic disorders. Our objective was to study the associations between circulating and adipose tissue gene expressions of CFH and complement factor B (fB; CFB) with obesity and insulin resistance. RESEARCH DESIGN AND METHODS Circulating fH and fB were determined by enzyme-linked immunosorbent assay in 398 subjects. CFH and CFB gene expressions were evaluated in 76 adipose tissue samples, in isolated adipocytes, and in stromovascular cells (SVC) (n = 13). The effects of weight loss and rosiglitazone were investigated in independent cohorts. RESULTS Both circulating fH and fB were associated positively with BMI, waist circumference, triglycerides, and inflammatory parameters and negatively with insulin sensitivity and HDL cholesterol. For the first time, CFH gene expression was detected in human adipose tissue (significantly increased in subcutaneous compared with omental fat). CFH gene expression in omental fat was significantly associated with insulin resistance. In contrast, CFB gene expression was significantly increased in omental fat but also in association with fasting glucose and triglycerides. The SVC fraction was responsible for these differences, although isolated adipocytes also expressed fB and fH at low levels. Both weight loss and rosiglitazone led to significantly decreased circulating fB and fH levels. CONCLUSIONS Increased circulating fH and fB concentrations in subjects with altered glucose tolerance could reflect increased SVC-induced activation of the alternative pathway of complement in omental adipose tissue linked to insulin resistance and metabolic disturbances. PMID:19833879

Expression of proteins in serum, synovial fluid, synovial membrane, and articular cartilage samples obtained from dogs with stifle joint osteoarthritis secondary to cranial cruciate ligament disease and dogs without stifle joint arthritis.

PubMed

Garner, Bridget C; Kuroki, Keiichi; Stoker, Aaron M; Cook, Cristi R; Cook, James L

2013-03-01

To identify proteins with differential expression between healthy dogs and dogs with stifle joint osteoarthritis secondary to cranial cruciate ligament (CCL) disease. Serum and synovial fluid samples obtained from dogs with stifle joint osteoarthritis before (n = 10) and after (8) surgery and control dogs without osteoarthritis (9) and archived synovial membrane and articular cartilage samples obtained from dogs with stifle joint osteoarthritis (5) and dogs without arthritis (5). Serum and synovial fluid samples were analyzed via liquid chromatography-tandem mass spectrometry; results were compared against a nonredundant protein database. Expression of complement component 3 in archived tissue samples was determined via immunohistochemical methods. No proteins had significantly different expression between serum samples of control dogs versus those of dogs with stifle joint osteoarthritis. Eleven proteins (complement component 3 precursor, complement factor I precursor, apolipoprotein B-100 precursor, serum paraoxonase and arylesterase 1, zinc-alpha-2-glycoprotein precursor, serum amyloid A, transthyretin precursor, retinol-binding protein 4 precursor, alpha-2-macroglobulin precursor, angiotensinogen precursor, and fibronectin 1 isoform 1 preproprotein) had significantly different expression (> 2.0-fold) between synovial fluid samples obtained before surgery from dogs with stifle joint osteoarthritis versus those obtained from control dogs. Complement component 3 was strongly expressed in all (5/5) synovial membrane samples of dogs with stifle joint osteoarthritis and weakly expressed in 3 of 5 synovial membrane samples of dogs without stifle joint arthritis. Findings suggested that the complement system and proteins involved in lipid and cholesterol metabolism may have a role in stifle joint osteoarthritis, CCL disease, or both.

Budget cuts, technology, and the loss of experienced security personnel: what can be done to stem the tide?

PubMed

2000-10-01

As a result of hospital budget-cutting, the healthcare industry is losing many of its best security directors and managers, some experts warn. This loss is extending to the reduction of security officer complements, partially due to an "overdependence" on technology. And it's not only personnel who are being cut, but training programs as well. In this report, we'll give details on the current trend, its dangers to patient protection, and what changes can be made to operate more effectively in the current economic environment.

Water-based Tai Chi: theoretical benefits in musculoskeletal diseases. Current evidence

PubMed Central

Macías-Hernández, Salvador Israel; Vázquez-Torres, Lucio; Morones-Alba, Juan Daniel; Coronado-Zarco, Roberto; de los Angeles Soria-Bastida, María; Cruz-Medina, Eva; Nava-Bringas, Tania Inés

2015-01-01

Tai Chi is a low-impact and moderate intensity exercise that has shown positive effects in patients with musculoskeletal disorders. Recently have been developed clinical studies on the benefits of Tai Chi techniques combined with hydrotherapy. Both types of treatment include physical training of balance, mobility, strength, coordination and sensory input that could complement each other. This report aims to present the current evidence about the benefits of the combination of water based Tai Chi in musculoskeletal diseases in order to establish whether the combined intervention is better than Tai Chi or hydrotherapy alone. PMID:26171376

An effective assessment of valproate sodium-induced hepatotoxicity with UPLC-MS and (1)HNMR-based metabonomics approach.

PubMed

Huo, Taoguang; Chen, Xi; Lu, Xiumei; Qu, Lianyue; Liu, Yang; Cai, Shuang

2014-10-15

Valproate sodium is one of the most prescribed antiepileptic drugs. However, valproate sodium has various side effects, especially its toxicity on liver. Current markers for toxicity reflect mostly the late stages of tissue damage; thus, more efficient methods for toxicity evaluation are desired. To evaluate the toxicity of valproate sodium on liver, we performed both UPLC-MS and (1)HNMR-based metabonomics analysis of serum samples from 34 epileptic patients (age: 42.0±18.6, 18 male/16 female) after valproate sodium treatment. Compared to conventional markers, the serum metabolic profiles provided clear distinction of the valproate sodium induced normal liver function and abnormal liver function in epileptic patients. Through multivariate statistical analysis, we identified marker metabolites associated with the hepatotoxicity induced by valproate sodium, such as glucose, lactate, acetoacetate, VLDL/LDL, lysophosphatidylcholines, phosphatidylcholines, choline, creatine, amino acids, N-acetyl glycoprotein, pyruvate and uric acid. This metabonomics approach may provide effective way to evaluate the valproate sodium-induced toxicity in a manner that can complement current measures. This approach is expected to find broader application in other drug-induced toxicity assessment. Copyright © 2014 Elsevier B.V. All rights reserved.

Quasi-isentropic compression of materials using the magnetic loading technique

NASA Astrophysics Data System (ADS)

Ao, Tommy

2009-06-01

The Isentropic Compression Experiment (ICE) technique has proven to be a valuable complement to the well-established method of shock compression of condensed matter. The magnetic loading technique using pulsed power generators was first developed about a decade ago on the Z Accelerator, and has matured significantly. The recent development of small pulsed power generators have enabled several key issues in ICE, such as panel & sample preparation, uniformity of loading, and edge effects to be studied. Veloce is a medium-voltage, high-current, compact pulsed power generator developed for cost effective isentropic experiments. The machine delivers up to 3 MA of current rapidly (˜ 440-530 ns) into an inductive load where significant magnetic pressures are produced. Examples of recent material strength measurements from quasi-isentropic loading and unloading of materials will be presented. In particular, the influence that the strength of interferometer windows has on wave profile analyses and thus the inferred strength of materials is examined. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the U.S. Department of Energy's National Nuclear Security Administration under Contract No. DE-AC04-94AL85000.

Identification of novel candidate maternal serum protein markers for Down syndrome by integrated proteomic and bioinformatic analysis.

PubMed

Kang, Yuan; Dong, Xinran; Zhou, Qiongjie; Zhang, Ying; Cheng, Yan; Hu, Rong; Su, Cuihong; Jin, Hong; Liu, Xiaohui; Ma, Duan; Tian, Weidong; Li, Xiaotian

2012-03-01

This study aimed to identify candidate protein biomarkers from maternal serum for Down syndrome (DS) by integrated proteomic and bioinformatics analysis. A pregnancy DS group of 18 women and a control group with the same number were prepared, and the maternal serum proteins were analyzed by isobaric tags for relative and absolute quantitation and mass spectrometry, to identify DS differentially expressed maternal serum proteins (DS-DEMSPs). Comprehensive bioinformatics analysis was then employed to analyze DS-DEMSPs both in this paper and seven related publications. Down syndrome differentially expressed maternal serum proteins from different studies are significantly enriched with common Gene Ontology functions, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, transcription factor binding sites, and Pfam protein domains, However, the DS-DEMSPs are less functionally related to known DS-related genes. These evidences suggest that common molecular mechanisms induced by secondary effects may be present upon DS carrying. A simple scoring scheme revealed Alpha-2-macroglobulin, Apolipoprotein A1, Apolipoprotein E, Complement C1s subcomponent, Complement component 5, Complement component 8, alpha polypeptide, Complement component 8, beta polypeptide and Fibronectin as potential DS biomarkers. The integration of proteomics and bioinformatics studies provides a novel approach to develop new prenatal screening methods for noninvasive yet accurate diagnosis of DS. Copyright © 2012 John Wiley & Sons, Ltd.

Immune functions of the garment workers.

PubMed

Sultana, R; Ferdous, K J; Hossain, M; Zahid, M S H; Islam, L N

2012-10-01

Occupational exposure to cotton dust, fibers, metal fumes and different chemicals used in the aparrel manufacturing industries cause a wide range of physical and psychological health problems in the garment workers that may also affect their immune function. To assess the immune system function in garment workers. A total of 45 workers of a garment factory, and 41 control subjects, not exposed to the garment working environment were enrolled in this study. In the study subjects, the complement system function was assessed as bactericidal activity on Escherichia coli DH5α cells using the standard plate count method. Serum complement components C3 and C4 were measured by immunoprecipitation, and IgG was measured by immunonephelometry. The bactericidal activity of serum complement in the garment workers (range: 93.5%-99.9%) was significantly (p<0.01) lower than that in the controls (range: 98.6%-100%). The heat-inactivated serum of the workers showed a significantly enhanced bactericidal activity. In the garment workers, the mean levels of complement C3, and C4 were 1.75 and 0.26 g/L, respectively that were close to those of the controls. The mean IgG level in the garment workers was 13.5 g/L that was significantly (p<0.001) higher than that in the controls. Working in a garment factory may affect the immune system.

Field emission analysis of band bending in donor/acceptor heterojunction

NASA Astrophysics Data System (ADS)

Xing, Yingjie; Li, Shuai; Wang, Guiwei; Zhao, Tianjiao; Zhang, Gengmin

2016-06-01

The donor/acceptor heterojunction plays an important role in organic solar cells. An investigation of band bending in the donor/acceptor heterojunction is helpful in analysis of the charge transport behavior and for the improvement of the device performance. In this work, we report an approach for detection of band bending in a donor/acceptor heterojunction that has been prepared on a small and sharp tungsten tip. In situ field emission measurements are performed after the deposition process, and a linear Fowler-Nordheim plot is obtained from the fresh organic film surface. The thickness-dependent work function is then measured in the layer-by-layer deposited heterojunction. Several different types of heterojunction (zinc phthalocyanine (ZnPc)/C60, copper phthalocyanine (CuPc)/3,4,9,10-perylenetetracarboxylic bisbenzimidazole, and CuPc/C60) are fabricated and analyzed. The different charge transfer directions in the heterojunctions are distinguished by field emission measurements. The calculation method used to determine the band bending is then discussed in detail. A triple layer heterojunction (C60/ZnPc/CuPc) is also analyzed using this method. A small amount of band bending is measured in the outer CuPc layer. This method provides an independent reference method for determination of the band bending in an organic heterojunction that will complement photoemission spectroscopy and current-voltage measurement methods.

C1 inhibitor-mediated myocardial protection from chronic intermittent hypoxia-induced injury

PubMed Central

Fu, Jinrong; Guo, Furong; Chen, Cheng; Yu, Xiaoman; Hu, Ke; Li, Mingjiang

2016-01-01

The optimal treatment for chronic intermittent hypoxia (CIH)-induced cardiovascular injuries has yet to be determined. The aim of the current study was to explore the potential protective effect and mechanism of a C1 inhibitor in CIH in the myocardium. The present study used a rat model of CIH in which complement regulatory protein, known as C1 inhibitor (C1INH), was administered to the rats in the intervention groups. Cardiomyocyte apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling. The expression of proteins associated with the apoptotic pathway, such as B-cell lymphoma 2 (Bcl-2), Bax and caspase-3 were detected by western blot analysis. The expression of complement C3 protein and RNA were also analyzed. C1INH was observed to improve the cardiac function in rats with CIH. Myocardial myeloperoxidase activity, a marker of neutrophil infiltration, was significantly decreased in the C1INH intervention group compared with the CIH control group, and cardiomyocyte apoptosis was significantly attenuated (P<0.05). Western blotting and reverse transcription-polymerase chain reaction analysis indicated that the protein expression levels of Bcl-2 were decreased and those of Bax were increased in the CIH group compared with the normal control group, but the protein expression levels of Bcl-2 were increased and those of Bax were decreased in the C1INH intervention group, as compared with the CIH group. Furthermore, the CIH-induced expression and synthesis of complement C3 in the myocardium were also reduced in the C1INH intervention group. C1INH, in addition to inhibiting complement activation and inflammation, preserved cardiac function in CIH-mediated myocardial cell injury through an anti-apoptotic mechanism. PMID:27698713

Induction of passive Heymann nephritis in complement component 6-deficient PVG rats.

PubMed

Spicer, S Timothy; Tran, Giang T; Killingsworth, Murray C; Carter, Nicole; Power, David A; Paizis, Kathy; Boyd, Rochelle; Hodgkinson, Suzanne J; Hall, Bruce M

2007-07-01

Passive Heymann nephritis (PHN), a model of human membranous nephritis, is induced in susceptible rat strains by injection of heterologous antisera to rat renal tubular Ag extract. PHN is currently considered the archetypal complement-dependent form of nephritis, with the proteinuria resulting from sublytic glomerular epithelial cell injury induced by the complement membrane attack complex (MAC) of C5b-9. This study examined whether C6 and MAC are essential to the development of proteinuria in PHN by comparing the effect of injection of anti-Fx1A antisera into PVG rats deficient in C6 (PVG/C6(-)) and normal PVG rats (PVG/c). PVG/c and PVG/C6(-) rats developed similar levels of proteinuria at 3, 7, 14, and 28 days following injection of antisera. Isolated whole glomeruli showed similar deposition of rat Ig and C3 staining in PVG/c and PVG/C6(-) rats. C9 deposition was abundant in PVG/c but was not detected in PVG/C6(-) glomeruli, indicating C5b-9/MAC had not formed in PVG/C6(-) rats. There was also no difference in the glomerular cellular infiltrate of T cells and macrophages nor the size of glomerular basement membrane deposits measured on electron micrographs. To examine whether T cells effect injury, rats were depleted of CD8+ T cells which did not affect proteinuria in the early heterologous phase but prevented the increase in proteinuria associated with the later autologous phase. These studies showed proteinuria in PHN occurs without MAC and that other mechanisms, such as immune complex size, early complement components, CD4+ and CD8+ T cells, disrupt glomerular integrity and lead to proteinuria.

Early Components of the Complement Classical Activation Pathway in Human Systemic Autoimmune Diseases

PubMed Central

Lintner, Katherine E.; Wu, Yee Ling; Yang, Yan; Spencer, Charles H.; Hauptmann, Georges; Hebert, Lee A.; Atkinson, John P.; Yu, C. Yung

2016-01-01

The complement system consists of effector proteins, regulators, and receptors that participate in host defense against pathogens. Activation of the complement system, via the classical pathway (CP), has long been recognized in immune complex-mediated tissue injury, most notably systemic lupus erythematosus (SLE). Paradoxically, a complete deficiency of an early component of the CP, as evidenced by homozygous genetic deficiencies reported in human, are strongly associated with the risk of developing SLE or a lupus-like disease. Similarly, isotype deficiency attributable to a gene copy-number (GCN) variation and/or the presence of autoantibodies directed against a CP component or a regulatory protein that result in an acquired deficiency are relatively common in SLE patients. Applying accurate assay methodologies with rigorous data validations, low GCNs of total C4, and heterozygous and homozygous deficiencies of C4A have been shown as medium to large effect size risk factors, while high copy numbers of total C4 or C4A as prevalent protective factors, of European and East-Asian SLE. Here, we summarize the current knowledge related to genetic deficiency and insufficiency, and acquired protein deficiencies for C1q, C1r, C1s, C4A/C4B, and C2 in disease pathogenesis and prognosis of SLE, and, briefly, for other systemic autoimmune diseases. As the complement system is increasingly found to be associated with autoimmune diseases and immune-mediated diseases, it has become an attractive therapeutic target. We highlight the recent developments and offer a balanced perspective concerning future investigations and therapeutic applications with a focus on early components of the CP in human systemic autoimmune diseases. PMID:26913032

Application of a hierarchical enzyme classification method reveals the role of gut microbiome in human metabolism

PubMed Central

2015-01-01

Background Enzymes are known as the molecular machines that drive the metabolism of an organism; hence identification of the full enzyme complement of an organism is essential to build the metabolic blueprint of that species as well as to understand the interplay of multiple species in an ecosystem. Experimental characterization of the enzymatic reactions of all enzymes in a genome is a tedious and expensive task. The problem is more pronounced in the metagenomic samples where even the species are not adequately cultured or characterized. Enzymes encoded by the gut microbiota play an essential role in the host metabolism; thus, warranting the need to accurately identify and annotate the full enzyme complements of species in the genomic and metagenomic projects. To fulfill this need, we develop and apply a method called ECemble, an ensemble approach to identify enzymes and enzyme classes and study the human gut metabolic pathways. Results ECemble method uses an ensemble of machine-learning methods to accurately model and predict enzymes from protein sequences and also identifies the enzyme classes and subclasses at the finest resolution. A tenfold cross-validation result shows accuracy between 97 and 99% at different levels in the hierarchy of enzyme classification, which is superior to comparable methods. We applied ECemble to predict the entire complements of enzymes from ten sequenced proteomes including the human proteome. We also applied this method to predict enzymes encoded by the human gut microbiome from gut metagenomic samples, and to study the role played by the microbe-derived enzymes in the human metabolism. After mapping the known and predicted enzymes to canonical human pathways, we identified 48 pathways that have at least one bacteria-encoded enzyme, which demonstrates the complementary role of gut microbiome in human gut metabolism. These pathways are primarily involved in metabolizing dietary nutrients such as carbohydrates, amino acids, lipids, cofactors and vitamins. Conclusions The ECemble method is able to hierarchically assign high quality enzyme annotations to genomic and metagenomic data. This study demonstrated the real application of ECemble to understand the indispensable role played by microbe-encoded enzymes in the healthy functioning of human metabolic systems. PMID:26099921

Application of a hierarchical enzyme classification method reveals the role of gut microbiome in human metabolism.

PubMed

Mohammed, Akram; Guda, Chittibabu

2015-01-01

Enzymes are known as the molecular machines that drive the metabolism of an organism; hence identification of the full enzyme complement of an organism is essential to build the metabolic blueprint of that species as well as to understand the interplay of multiple species in an ecosystem. Experimental characterization of the enzymatic reactions of all enzymes in a genome is a tedious and expensive task. The problem is more pronounced in the metagenomic samples where even the species are not adequately cultured or characterized. Enzymes encoded by the gut microbiota play an essential role in the host metabolism; thus, warranting the need to accurately identify and annotate the full enzyme complements of species in the genomic and metagenomic projects. To fulfill this need, we develop and apply a method called ECemble, an ensemble approach to identify enzymes and enzyme classes and study the human gut metabolic pathways. ECemble method uses an ensemble of machine-learning methods to accurately model and predict enzymes from protein sequences and also identifies the enzyme classes and subclasses at the finest resolution. A tenfold cross-validation result shows accuracy between 97 and 99% at different levels in the hierarchy of enzyme classification, which is superior to comparable methods. We applied ECemble to predict the entire complements of enzymes from ten sequenced proteomes including the human proteome. We also applied this method to predict enzymes encoded by the human gut microbiome from gut metagenomic samples, and to study the role played by the microbe-derived enzymes in the human metabolism. After mapping the known and predicted enzymes to canonical human pathways, we identified 48 pathways that have at least one bacteria-encoded enzyme, which demonstrates the complementary role of gut microbiome in human gut metabolism. These pathways are primarily involved in metabolizing dietary nutrients such as carbohydrates, amino acids, lipids, cofactors and vitamins. The ECemble method is able to hierarchically assign high quality enzyme annotations to genomic and metagenomic data. This study demonstrated the real application of ECemble to understand the indispensable role played by microbe-encoded enzymes in the healthy functioning of human metabolic systems.

Complement activation on the surface of cell-derived microparticles during cardiac surgery with cardiopulmonary bypass - is retransfusion of pericardial blood harmful?

PubMed

Biró, E; van den Goor, J M; de Mol, B A; Schaap, M C; Ko, L-Y; Sturk, A; Hack, C E; Nieuwland, R

2011-01-01

To investigate whether cell-derived microparticles play a role in complement activation in pericardial blood of patients undergoing cardiac surgery with cardiopulmonary bypass (CPB) and whether microparticles in pericardial blood contribute to systemic complement activation upon retransfusion. Pericardial blood of 13 patients was retransfused in 9 and discarded in 4 cases. Microparticles were isolated from systemic blood collected before anesthesia (T1) and at the end of CPB (T2), and from pericardial blood. The microparticles were analyzed by flow cytometry for bound complement components C1q, C4 and C3, and bound complement activator molecules C-reactive protein (CRP), serum amyloid P-component (SAP), immunoglobulin (Ig)M and IgG. Fluid-phase complement activation products (C4b/c, C3b/c) and activator molecules were determined by ELISA. Compared with systemic T1 blood, pericardial blood contained increased C4b/c and C3b/c, and increased levels of microparticles with bound complement components. In systemic T1 samples, microparticle-bound CRP, whereas in pericardial blood, microparticle-bound SAP and IgM were associated with complement activation. At the end of CPB, increased C3b/c (but not C4b/c) was present in systemic T2 blood compared with T1, while concentrations of microparticles binding complement components and of those binding complement activator molecules were similar. Concentrations of fluid-phase complement activation products and microparticles were similar in patients whether or not retransfused with pericardial blood. In pericardial blood of patients undergoing cardiac surgery with CPB, microparticles contribute to activation of the complement system via bound SAP and IgM. Retransfusion of pericardial blood, however, does not contribute to systemic complement activation.

Firing-rate response of linear and nonlinear integrate-and-fire neurons to modulated current-based and conductance-based synaptic drive.

PubMed

Richardson, Magnus J E

2007-08-01

Integrate-and-fire models are mainstays of the study of single-neuron response properties and emergent states of recurrent networks of spiking neurons. They also provide an analytical base for perturbative approaches that treat important biological details, such as synaptic filtering, synaptic conductance increase, and voltage-activated currents. Steady-state firing rates of both linear and nonlinear integrate-and-fire models, receiving fluctuating synaptic drive, can be calculated from the time-independent Fokker-Planck equation. The dynamic firing-rate response is less easy to extract, even at the first-order level of a weak modulation of the model parameters, but is an important determinant of neuronal response and network stability. For the linear integrate-and-fire model the response to modulations of current-based synaptic drive can be written in terms of hypergeometric functions. For the nonlinear exponential and quadratic models no such analytical forms for the response are available. Here it is demonstrated that a rather simple numerical method can be used to obtain the steady-state and dynamic response for both linear and nonlinear models to parameter modulation in the presence of current-based or conductance-based synaptic fluctuations. To complement the full numerical solution, generalized analytical forms for the high-frequency response are provided. A special case is also identified--time-constant modulation--for which the response to an arbitrarily strong modulation can be calculated exactly.

A SWOT Analysis of the Integration of E-Learning at a University in Uganda and a University in Tanzania

ERIC Educational Resources Information Center

Zhu, Chang; Justice Mugenyi, Kintu

2015-01-01

This research examines the strengths, weaknesses, opportunities and threats (SWOT) to integrating e-learning perceived by academic staff at a university in Uganda and a university in Tanzania. Mixed-methods research was used in which a main qualitative study was complemented by a quantitative method. The sample participants were academic staff…

Understanding Unimer Exchange Processes in Block Copolymer Micelles using NMR Diffusometry, Time-Resolved NMR, and SANS

NASA Astrophysics Data System (ADS)

Madsen, Louis; Kidd, Bryce; Li, Xiuli; Miller, Katherine; Cooksey, Tyler; Robertson, Megan

Our team seeks to understand dynamic behaviors of block copolymer micelles and their interplay with encapsulated cargo molecules. Quantifying unimer and cargo exchange rates micelles can provide critical information for determining mechanisms of unimer exchange as well as designing systems for specific cargo release dynamics. We are exploring the utility of NMR spectroscopy and diffusometry techniques as complements to existing SANS and fluorescence methods. One promising new method involves time-resolved NMR spin relaxation measurements, wherein mixing of fully protonated and 2H-labeled PEO-b-PCL micelles solutions shows an increase in spin-lattice relaxation time (T1) with time after mixing. This is due to a weakening in magnetic environment surrounding 1H spins as 2H-bearing unimers join fully protonated micelles. We are measuring time constants for unimer exchange of minutes to hours, and we expect to resolve times of <1 min. This method can work on any solution NMR spectrometer and with minimal perturbation to chemical structure (as in dye-labelled fluorescence methods). Multimodal NMR can complement existing characterization tools, expanding and accelerating dynamics measurements for polymer micelle, nanogel, and nanoparticle developers.

Using polarized positrons to probe physics beyond the standard model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Furletova, Yulia; Mantry, Sonny

A high intensity polarized positron beam, as part of the JLAB 12 GeV program and the proposed electron-ion collider (EIC), can provide a unique opportunity for testing the Standard Model (SM) and probing for new physics. The combination of high luminosity with polarized electrons and positrons incident on protons and deuterons can isolate important effects and distinguish between possible new physics scenarios in a manner that will complement current experimental efforts. Here, a comparison of cross sections between polarized electron and positron beams will allow for an extraction of the poorly known weak neutral current coupling combination 2C 3u -more » C 3d and would complement the proposed plan for a precision extraction of the combination 2C 2u - C d at the EIC. Precision measurements of these neutral weak couplings would constrain new physics scenarios including Leptoquarks, R-parity violating supersymmetry, and electron and quark compositeness. The dependence of the charged current cross section on the longitudinal polarization of the positron beam will provide an independent probe to test the chiral structure of the electroweak interactions. A polarized positron can probe charged lepton flavor violation (CLFV) through a search for e + → τ + transitions in a manner that is independent and complementary to the proposed e - → τ - search at the EIC. A positron beam incident on an electron in a stationary nuclear target will also allow for a dark-photon (A') search via the annihilation process e + + e - → A' + γ.« less

Using polarized positrons to probe physics beyond the standard model

DOE PAGES

Furletova, Yulia; Mantry, Sonny

2018-05-25

A high intensity polarized positron beam, as part of the JLAB 12 GeV program and the proposed electron-ion collider (EIC), can provide a unique opportunity for testing the Standard Model (SM) and probing for new physics. The combination of high luminosity with polarized electrons and positrons incident on protons and deuterons can isolate important effects and distinguish between possible new physics scenarios in a manner that will complement current experimental efforts. Here, a comparison of cross sections between polarized electron and positron beams will allow for an extraction of the poorly known weak neutral current coupling combination 2C 3u -more » C 3d and would complement the proposed plan for a precision extraction of the combination 2C 2u - C d at the EIC. Precision measurements of these neutral weak couplings would constrain new physics scenarios including Leptoquarks, R-parity violating supersymmetry, and electron and quark compositeness. The dependence of the charged current cross section on the longitudinal polarization of the positron beam will provide an independent probe to test the chiral structure of the electroweak interactions. A polarized positron can probe charged lepton flavor violation (CLFV) through a search for e + → τ + transitions in a manner that is independent and complementary to the proposed e - → τ - search at the EIC. A positron beam incident on an electron in a stationary nuclear target will also allow for a dark-photon (A') search via the annihilation process e + + e - → A' + γ.« less

Using polarized positrons to probe physics beyond the standard model

NASA Astrophysics Data System (ADS)

Furletova, Yulia; Mantry, Sonny

2018-05-01

A high intensity polarized positron beam, as part of the JLAB 12 GeV program and the proposed electron-ion collider (EIC), can provide a unique opportunity for testing the Standard Model (SM) and probing for new physics. The combination of high luminosity with polarized electrons and positrons incident on protons and deuterons can isolate important effects and distinguish between possible new physics scenarios in a manner that will complement current experimental efforts. A comparison of cross sections between polarized electron and positron beams will allow for an extraction of the poorly known weak neutral current coupling combination 2C3u - C3d and would complement the proposed plan for a precision extraction of the combination 2C2u - Cd at the EIC. Precision measurements of these neutral weak couplings would constrain new physics scenarios including Leptoquarks, R-parity violating supersymmetry, and electron and quark compositeness. The dependence of the charged current cross section on the longitudinal polarization of the positron beam will provide an independent probe to test the chiral structure of the electroweak interactions. A polarized positron can probe charged lepton flavor violation (CLFV) through a search for e+ → τ+ transitions in a manner that is independent and complementary to the proposed e- → τ- search at the EIC. A positron beam incident on an electron in a stationary nuclear target will also allow for a dark-photon (A') search via the annihilation process e+ + e- → A' + γ.

A Radionavigation Systems Course

ERIC Educational Resources Information Center

Lozano-Guerrero, Antonio José; Valenzuela-Valdés, Juan Francisco

2015-01-01

This paper presents a new course, Radionavigation Systems, whose laboratory and theoretical components complement each other to enhance student learning. Radionavigation skills and knowledge are taught by means of various instructional methods, and the laboratory successfully merges hands-on learning using specific instrumentation and software…

Solving the electron and electron-nuclear Schroedinger equations for the excited states of helium atom with the free iterative-complement-interaction method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakashima, Hiroyuki; Hijikata, Yuh; Nakatsuji, Hiroshi

2008-04-21

Very accurate variational calculations with the free iterative-complement-interaction (ICI) method for solving the Schroedinger equation were performed for the 1sNs singlet and triplet excited states of helium atom up to N=24. This is the first extensive applications of the free ICI method to the calculations of excited states to very high levels. We performed the calculations with the fixed-nucleus Hamiltonian and moving-nucleus Hamiltonian. The latter case is the Schroedinger equation for the electron-nuclear Hamiltonian and includes the quantum effect of nuclear motion. This solution corresponds to the nonrelativistic limit and reproduced the experimental values up to five decimal figures. Themore » small differences from the experimental values are not at all the theoretical errors but represent the physical effects that are not included in the present calculations, such as relativistic effect, quantum electrodynamic effect, and even the experimental errors. The present calculations constitute a small step toward the accurately predictive quantum chemistry.« less

Serological and Genetic Evidence for Altered Complement System Functionality in Systemic Lupus Erythematosus: Findings of the GAPAID Consortium.

PubMed

Prechl, József; Papp, Krisztián; Hérincs, Zoltán; Péterfy, Hajna; Lóránd, Veronika; Szittner, Zoltán; Estonba, Andone; Rovero, Paolo; Paolini, Ilaria; Del Amo, Jokin; Uribarri, Maria; Alcaro, Maria Claudia; Ruiz-Larrañaga, Otsanda; Migliorini, Paola; Czirják, László

2016-01-01

Systemic lupus erythematosus is a chronic autoimmune disease with multifactorial ethiopathogenesis. The complement system is involved in both the early and late stages of disease development and organ damage. To better understand autoantibody mediated complement consumption we examined ex vivo immune complex formation on autoantigen arrays. We recruited patients with SLE (n = 211), with other systemic autoimmune diseases (n = 65) and non-autoimmune control subjects (n = 149). Standard clinical and laboratory data were collected and serum complement levels were determined. The genotype of SNP rs1143679 in the ITGAM gene was also determined. Ex vivo formation of immune complexes, with respect to IgM, IgG, complement C4 and C3 binding, was examined using a functional immunoassay on autoantigen microarray comprising nucleic acids, proteins and lipids. Complement consumption of nucleic acids increased upon binding of IgM and IgG even when serum complement levels were decreased due to consumption in SLE patients. A negative correlation between serum complement levels and ex vivo complement deposition on nucleic acid autoantigens is demonstrated. On the contrary, complement deposition on tested protein and lipid autoantigens showed positive correlation with C4 levels. Genetic analysis revealed that the non-synonymous variant rs1143679 in complement receptor type 3 is associated with an increased production of anti-dsDNA IgG antibodies. Notwithstanding, homozygous carriers of the previously reported susceptible allele (AA) had lower levels of dsDNA specific IgM among SLE patients. Both the non-synonymous variant rs1143679 and the high ratio of nucleic acid specific IgG/IgM were associated with multiple organ involvement. In summary, secondary complement deficiency in SLE does not impair opsonization of nucleic-acid-containing autoantigens but does affect other antigens and potentially other complement dependent processes. Dysfunction of the receptor recognizing complement opsonized immune complexes promotes the development of class-switched autoantibodies targeting nucleic acids.

BCILAB: a platform for brain-computer interface development

NASA Astrophysics Data System (ADS)

Kothe, Christian Andreas; Makeig, Scott

2013-10-01

Objective. The past two decades have seen dramatic progress in our ability to model brain signals recorded by electroencephalography, functional near-infrared spectroscopy, etc., and to derive real-time estimates of user cognitive state, response, or intent for a variety of purposes: to restore communication by the severely disabled, to effect brain-actuated control and, more recently, to augment human-computer interaction. Continuing these advances, largely achieved through increases in computational power and methods, requires software tools to streamline the creation, testing, evaluation and deployment of new data analysis methods. Approach. Here we present BCILAB, an open-source MATLAB-based toolbox built to address the need for the development and testing of brain-computer interface (BCI) methods by providing an organized collection of over 100 pre-implemented methods and method variants, an easily extensible framework for the rapid prototyping of new methods, and a highly automated framework for systematic testing and evaluation of new implementations. Main results. To validate and illustrate the use of the framework, we present two sample analyses of publicly available data sets from recent BCI competitions and from a rapid serial visual presentation task. We demonstrate the straightforward use of BCILAB to obtain results compatible with the current BCI literature. Significance. The aim of the BCILAB toolbox is to provide the BCI community a powerful toolkit for methods research and evaluation, thereby helping to accelerate the pace of innovation in the field, while complementing the existing spectrum of tools for real-time BCI experimentation, deployment and use.

Synchrotron X-ray Analytical Techniques for Studying Materials Electrochemistry in Rechargeable Batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Feng; Liu, Yijin; Yu, Xiqian

Rechargeable battery technologies have ignited major breakthroughs in contemporary society, including but not limited to revolutions in transportation, electronics, and grid energy storage. The remarkable development of rechargeable batteries is largely attributed to in-depth efforts to improve battery electrode and electrolyte materials. There are, however, still intimidating challenges of lower cost, longer cycle and calendar life, higher energy density, and better safety for large scale energy storage and vehicular applications. Further progress with rechargeable batteries may require new chemistries (lithium ion batteries and beyond) and better understanding of materials electrochemistry in the various battery technologies. In the past decade, advancementmore » of battery materials has been complemented by new analytical techniques that are capable of probing battery chemistries at various length and time scales. Synchrotron X-ray techniques stand out as one of the most effective methods that allows for nearly nondestructive probing of materials characteristics such as electronic and geometric structures with various depth sensitivities through spectroscopy, scattering, and imaging capabilities. This article begins with the discussion of various rechargeable batteries and associated important scientific questions in the field, followed by a review of synchrotron X-ray based analytical tools (scattering, spectroscopy and imaging) and their successful applications (ex situ, in situ, and in operando) in gaining fundamental insights into these scientific questions. Furthermore, electron microscopy and spectroscopy complement the detection length scales of synchrotron X-ray tools, and are also discussed towards the end. We highlight the importance of studying battery materials by combining analytical techniques with complementary length sensitivities, such as the combination of X-ray absorption spectroscopy and electron spectroscopy with spatial resolution, because a sole technique may lead to biased and inaccurate conclusions. We then discuss the current progress of experimental design for synchrotron experiments and methods to mitigate beam effects. Finally, a perspective is provided to elaborate how synchrotron techniques can impact the development of next-generation battery chemistries.« less

Synchrotron X-ray Analytical Techniques for Studying Materials Electrochemistry in Rechargeable Batteries

DOE PAGES

Lin, Feng; Liu, Yijin; Yu, Xiqian; ...

2017-08-30

Rechargeable battery technologies have ignited major breakthroughs in contemporary society, including but not limited to revolutions in transportation, electronics, and grid energy storage. The remarkable development of rechargeable batteries is largely attributed to in-depth efforts to improve battery electrode and electrolyte materials. There are, however, still intimidating challenges of lower cost, longer cycle and calendar life, higher energy density, and better safety for large scale energy storage and vehicular applications. Further progress with rechargeable batteries may require new chemistries (lithium ion batteries and beyond) and better understanding of materials electrochemistry in the various battery technologies. In the past decade, advancementmore » of battery materials has been complemented by new analytical techniques that are capable of probing battery chemistries at various length and time scales. Synchrotron X-ray techniques stand out as one of the most effective methods that allows for nearly nondestructive probing of materials characteristics such as electronic and geometric structures with various depth sensitivities through spectroscopy, scattering, and imaging capabilities. This article begins with the discussion of various rechargeable batteries and associated important scientific questions in the field, followed by a review of synchrotron X-ray based analytical tools (scattering, spectroscopy and imaging) and their successful applications (ex situ, in situ, and in operando) in gaining fundamental insights into these scientific questions. Furthermore, electron microscopy and spectroscopy complement the detection length scales of synchrotron X-ray tools, and are also discussed towards the end. We highlight the importance of studying battery materials by combining analytical techniques with complementary length sensitivities, such as the combination of X-ray absorption spectroscopy and electron spectroscopy with spatial resolution, because a sole technique may lead to biased and inaccurate conclusions. We then discuss the current progress of experimental design for synchrotron experiments and methods to mitigate beam effects. Finally, a perspective is provided to elaborate how synchrotron techniques can impact the development of next-generation battery chemistries.« less

Complement component 4

MedlinePlus

... of a certain protein. This protein is part of the complement system. The complement system is a group of proteins ... system and play a role in the development of inflammation. The complement system protects the body from infections, dead cells and ...

Thermal Response of Cooled Silicon Nitride Plate Due to Thermal Conductivity Effects Analyzed

NASA Technical Reports Server (NTRS)

Baaklini, George Y.; Abdul-Aziz, Ali; Bhatt, Ramakrishna

2003-01-01

Lightweight, strong, tough high-temperature materials are required to complement efficiency improvements for next-generation gas turbine engines that can operate with minimum cooling. Because of their low density, high-temperature strength, and high thermal conductivity, ceramics are being investigated as materials to replace the nickelbase superalloys that are currently used for engine hot-section components. Ceramic structures can withstand higher operating temperatures and a harsh combustion environment. In addition, their low densities relative to metals help reduce component mass (ref. 1). To complement the effectiveness of the ceramics and their applicability for turbine engine applications, a parametric study using the finite element method is being carried out. The NASA Glenn Research Center remains very active in conducting and supporting a variety of research activities related to ceramic matrix composites through both experimental and analytical efforts (ref. 1). The objectives of this work are to develop manufacturing technology, develop a thermal and environmental barrier coating (TBC/EBC), develop an analytical modeling capability to predict thermomechanical stresses, and perform a minimal burner rig test on silicon nitride (Si3N4) and SiC/SiC turbine nozzle vanes under simulated engine conditions. Moreover, we intend to generate a detailed database of the material s property characteristics and their effects on structural response. We expect to offer a wide range of data since the modeling will account for other variables, such as cooling channel geometry and spacing. Comprehensive analyses have begun on a plate specimen with Si3N4 cooling holes.

Hemocompatibility studies on a degradable polar hydrophobic ionic polyurethane (D-PHI).

PubMed

Brockman, Kathryne S; Kizhakkedathu, Jayachandran N; Santerre, J Paul

2017-01-15

Biomaterial blood compatibility is a complex process that involves four key pathways, including the coagulation cascade, the complement system, platelets, and leukocytes. While many studies have addressed the initial contact of blood with homopolymeric (e.g. Teflon) or simple copolymeric (e.g. Dacron) biomaterials, relatively less attention has been given to investigating blood coagulation with respect to complex copolymeric systems containing well defined and diverse function. The current study sought to assess the hemocompatibility of a complex polyurethane (PU) containing a unique combination of polar, hydrophobic, and ionic domains (D-PHI). This included a whole blood (WB) study, followed by tests on the intrinsic and extrinsic coagulation pathways, complement activation, platelet activation, and an assessment of the effect of leukocytes on platelet-biomaterial interactions. A small increase in blood clot formation was observed on D-PHI in WB; however, there was no significant increase in clotting via the intrinsic coagulation cascade. No significant increase in platelet adhesion and only a very slight increase in platelet activation were observed in comparison to albumin-coated substrates (negative control). D-PHI showed mild complement activation and increased initiation of the extrinsic pathway of coagulation, along with the observation that leukocytes were important in mediating platelet-biomaterial interactions. It is proposed that complement is responsible for activating coagulation by inciting leukocytes to generate tissue factor (TF), which causes extrinsic pathway activation. This low level of blood clotting on D-PHI's surface may be necessary for the beneficial wound healing of vascular constructs that has been previously reported for this material. Understanding the hemocompatibility of devices intended for blood-contacting applications is important for predicting device failure. Hemocompatibility is a complex parameter (affected by at least four different mechanisms) that measures the level of thrombus generation and immune system activation resulting from blood-biomaterial contact. The complexity of hemocompatibility implies that homopolymers are unlikely to solve the clotting challenges that face most biomaterials. Diversity in surface chemistry (containing hydrophobic, ionic, and polar domains) obtained from engineered polyurethanes can lead to favourable interactions with blood. The current research considered the effect of a highly functionalized polyurethane biomaterial on all four mechanisms in order to provide a comprehensive in vitro measure of the hemocompatibility of this unique material and the important mechanisms at play. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

The topology of galaxy clustering.

NASA Astrophysics Data System (ADS)

Coles, P.; Plionis, M.

The authors discuss an objective method for quantifying the topology of the galaxy distribution using only projected galaxy counts. The method is a useful complement to fully three-dimensional studies of topology based on the genus by virtue of the enormous projected data sets available. Applying the method to the Lick counts they find no evidence for large-scale non-gaussian behaviour, whereas the small-scale distribution is strongly non-gaussian, with a shift in the meatball direction.

Formalizing Space Shuttle Software Requirements

NASA Technical Reports Server (NTRS)

Crow, Judith; DiVito, Ben L.

1996-01-01

This paper describes two case studies in which requirements for new flight-software subsystems on NASA's Space Shuttle were analyzed, one using standard formal specification techniques, the other using state exploration. These applications serve to illustrate three main theses: (1) formal methods can complement conventional requirements analysis processes effectively, (2) formal methods confer benefits regardless of how extensively they are adopted and applied, and (3) formal methods are most effective when they are judiciously tailored to the application.

21 CFR 866.5260 - Complement C3b inactivator immunological test system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

Landscape complementation revealed through bipartite networks: An example with the Florida manatee

USGS Publications Warehouse

Haase, Catherine G.; Fletcher, Robert J.; Slone, Daniel H.; Reid, James P.; Butler, Susan M.

2017-01-01

Landscape complementation is an important predictor of selection and thus classic complementation measures are not sufficient in describing the process. Formalization of complementation with bipartite network can therefor reveal effects potentially missed with conventional measures.

21 CFR 866.5260 - Complement C3b inactivator immunological test system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

21 CFR 866.5260 - Complement C3b inactivator immunological test system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

21 CFR 866.5260 - Complement C3b inactivator immunological test system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... immunochemical techniques the complement C3b inactivator (a plasma protein) in serum. Complement is a group of serum proteins that destroy infectious agents. Measurement of complement C3b inactivator aids in the...

Complement component 3 (C3)

MedlinePlus

... of a certain protein. This protein is part of the complement system. The complement system is a group of proteins ... system and play a role in the development of inflammation. The complement system protects the body from infections, dead cells and ...

Non-specific adsorption of complement proteins affects complement activation pathways of gold nanomaterials.

PubMed

Quach, Quang Huy; Kah, James Chen Yong

2017-04-01

The complement system is a key humoral component of innate immunity, serving as the first line of defense against intruders, including foreign synthetic nanomaterials. Although gold nanomaterials (AuNMs) are widely used in nanomedicine, their immunological response is not well understood. Using AuNMs of three shapes commonly used in biomedical applications: spherical gold nanoparticles, gold nanostars and gold nanorods, we demonstrated that AuNMs activated whole complement system, leading to the formation of SC5b-9 complex. All three complement pathways were simultaneously activated by all the AuNMs. Recognition molecules of the complement system interacted with all AuNMs in vitro, except for l-ficolin, but the correlation between these interactions and corresponding complement pathway activation was only observed in the classical and alternative pathways. We also observed the mediating role of complement activation in cellular uptake of all AuNMs by human U937 promonocytic cells, which expresses complement receptors. Taken together, our results highlighted the potential immunological challenges for clinical applications of AuNMs that were often overlooked.

Split luciferase complementation assay to detect regulated protein-protein interactions in rice protoplasts in a large-scale format

PubMed Central

2014-01-01

Background The rice interactome, in which a network of protein-protein interactions has been elucidated in rice, is a useful resource to identify functional modules of rice signal transduction pathways. Protein-protein interactions occur in cells in two ways, constitutive and regulative. While a yeast-based high-throughput method has been widely used to identify the constitutive interactions, a method to detect the regulated interactions is rarely developed for a large-scale analysis. Results A split luciferase complementation assay was applied to detect the regulated interactions in rice. A transformation method of rice protoplasts in a 96-well plate was first established for a large-scale analysis. In addition, an antibody that specifically recognizes a carboxyl-terminal fragment of Renilla luciferase was newly developed. A pair of antibodies that recognize amino- and carboxyl- terminal fragments of Renilla luciferase, respectively, was then used to monitor quality and quantity of interacting recombinant-proteins accumulated in the cells. For a proof-of-concept, the method was applied to detect the gibberellin-dependent interaction between GIBBERELLIN INSENSITIVE DWARF1 and SLENDER RICE 1. Conclusions A method to detect regulated protein-protein interactions was developed towards establishment of the rice interactome. PMID:24987490

Isolation and complementation analysis of 10 methanol oxidation mutant classes and identification of the methanol dehydrogenase structural gene of Methylobacterium sp. strain AM1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nunn, D.N.; Lidstrom, M.E.

A method has been developed for the direct selection of methanol oxidation mutants of the facultative methylotroph Methylobacterium sp. strain AM1 (formerly Pseudomonas sp. strain AM1). Using this direct selection technique, we have isolated mutants of Methylobacterium sp. strain AM1 that are no longer capable of growth on methanol but retain the ability to grow on methylamine. These methanol oxidation (Mox) mutants were complemented with a genomic clone bank of this organism constructed in the broad-host-range cosmid pVK100, and subcloning and Tn5 mutagenesis experiments have assigned the Mox mutants to 10 distinct complementation groups. Using an open reading frame beta-galactosidasemore » fusion vector and antibodies specific for Methylobacterium sp. strain AM1 methanol dehydrogenase, we have identified the methanol dehydrogenase structural gene and determined the direction of transcription. The results suggest that the synthesis and utilization of an active methanol dehydrogenase in this organism requires at least 10 different gene functions.« less

Tuning complement activation and pathway through controlled molecular architecture of dextran chains in nanoparticle corona.

PubMed

Coty, Jean-Baptiste; Eleamen Oliveira, Elquio; Vauthier, Christine

2017-11-05

The understanding of complement activation by nanomaterials is a key to a rational design of safe and efficient nanomedicines. This work proposed a systematic study investigating how molecular design of nanoparticle coronas made of dextran impacts on mechanisms that trigger complement activation. The nanoparticles used for this work consisted of dextran-coated poly(isobutylcyanoacrylate) (PIBCA) nanoparticles have already been thoroughly characterized. Their different capacity to trigger complement activation established on the cleavage of the protein C3 was also already described making these nanoparticles good models to investigate the relation between the molecular feature of their corona and the mechanism by which they triggered complement activation. Results of this new study show that complement activation pathways can be selected by distinct architectures formed by dextran chains composing the nanoparticle corona. Assumptions that explain the relation between complement activation mechanisms triggered by the nanoparticles and the nanoparticle corona molecular feature were proposed. These results are of interest to better understand how the design of dextran-coated nanomaterials will impact interactions with the complement system. It can open perspectives with regard to the selection of a preferential complement activation pathway or prevent the nanoparticles to activate the complement system, based on a rational choice of the corona configuration. Copyright © 2017 Elsevier B.V. All rights reserved.

An open-source, mobile-friendly search engine for public medical knowledge.

PubMed

Samwald, Matthias; Hanbury, Allan

2014-01-01

The World Wide Web has become an important source of information for medical practitioners. To complement the capabilities of currently available web search engines we developed FindMeEvidence, an open-source, mobile-friendly medical search engine. In a preliminary evaluation, the quality of results from FindMeEvidence proved to be competitive with those from TRIP Database, an established, closed-source search engine for evidence-based medicine.

Strategy’s Relevance to the War in Afghanistan

DTIC Science & Technology

2010-06-11

specifically regarding Operation Enduring Freedom, the operational environment, policy and strategy, the oral histories presented by Christopher Koontz in...intervening years. And, of significant note, it captures nuances reflected in the current 2009 strategy. Complementing Koontz ’ material is a report by COL Ian...that can defend itself as economic growth and development takes hold.” 49 In his work on Afghanistan from 2003 to 2005, Christopher Koontz captures

Evaluation of a Surfing Programme Designed to Increase Personal Well-Being and Connectedness to the Natural Environment among "At Risk" Young People

ERIC Educational Resources Information Center

Hignett, Amanda; White, Mathew P.; Pahl, Sabine; Jenkin, Rebecca; Froy, Mod Le

2018-01-01

Outdoor activities can be an important complement to classroom learning, especially for children/young people excluded, or at risk of exclusion, from mainstream schooling. The current research explored the impact of a 12-week surfing programme among such a group in the UK. Pre-post data on physiological health (heart rate (HR)/blood pressure),…

The Effects of Explosive Blast as Compared to Post-traumatic Stress Disorder on Brain Function and Structure

DTIC Science & Technology

2013-04-01

Neuropsychology (AACN). Chicago , Illinois. One of the challenges in assessing the essential neural features of mild TBI in veterans is that... Chicago , Illinois. The tool, preliminarily called the Minnesota Blast Exposure Screening Tool (MN-BEST; see Figure 12), complements current screening...the AACN. Chicago , Illinois. Examination of the number of post-concussive symptoms endorsed by the entire National Guard sample indicates that

Professional Military Education for Life (PME4L)

DTIC Science & Technology

2014-12-08

The Air Force embracing a continuous educational model which integrates CPE concepts in order to persistently develop professional Airmen, engages...exposure to new ideas and career fields. Due to PME’s importance in an Airman’s career development, PME should be a continuous process with the...current PME courses as anchors. PME4L complements traditional Air Force PME and invests in Airmen at all levels. This paper presents a Continuous

BIOLUMINESCENT SENSORS FOR DETECTION OF BIOAVAILABLE HG(II) IN THE ENVIRONMENT

EPA Science Inventory

Biosensors for the detection of pollutants in the environment can complement analytical methods by distinguishing bioavailable from inert unavailable forms of the contaminants. y using fusions of the well understood TN21 mercury resistance operon (mer) with promoterless luxCDABE ...

New Economic and Financial Indicators of Sustainability

ERIC Educational Resources Information Center

Pittman, James; Wilhelm, Kevin

2007-01-01

Financial accounting methods fall short of fully accounting for the relative sustainability of college and university operations. Management of social, environmental, and economic performance will be aided by changes to and new developments in financial accounting practices to complement other indicators of sustainability.

Rituximab for Treatment of Membranoproliferative Glomerulonephritis and C3 Glomerulopathies

PubMed Central

2017-01-01

Membranoproliferative glomerulonephritis (MPGN) is a histological pattern of injury resulting from predominantly subendothelial and mesangial deposition of immunoglobulins or complement factors with subsequent inflammation and proliferation particularly of the glomerular basement membrane. Recent classification of MPGN is based on pathogenesis dividing MPGN into immunoglobulin-associated MPGN and complement-mediated C3 glomerulonephritis (C3GN) and dense deposit disease (DDD). Current guidelines suggest treatment with steroids, cytotoxic agents with or without plasmapheresis only for subjects with progressive disease, that is, nephrotic range proteinuria and decline of renal function. Rituximab, a chimeric B-cell depleting anti-CD20 antibody, has emerged in the last decade as a treatment option for patients with primary glomerular diseases such as minimal change disease, focal-segmental glomerulosclerosis, or idiopathic membranous nephropathy. However, data on the use of rituximab in MPGN, C3GN, and DDD are limited to case reports and retrospective case series. Patients with immunoglobulin-associated and idiopathic MPGN who were treated with rituximab showed partial and complete responses in the majorities of cases. However, rituximab was not effective in few cases of C3GN and DDD. Despite promising results in immunoglobulin-associated and idiopathic MPGN, current evidence on this treatment remains weak, and controlled and prospective data are urgently needed. PMID:28573137

On the Functional Overlap between Complement and Anti-Microbial Peptides.

PubMed

Zimmer, Jana; Hobkirk, James; Mohamed, Fatima; Browning, Michael J; Stover, Cordula M

2014-01-01

Intriguingly, activated complement and anti-microbial peptides share certain functionalities; lytic, phagocytic, and chemo-attractant activities and each may, in addition, exert cell instructive roles. Each has been shown to have distinct LPS detoxifying activity and may play a role in the development of endotoxin tolerance. In search of the origin of complement, a functional homolog of complement C3 involved in opsonization has been identified in horseshoe crabs. Horseshoe crabs possess anti-microbial peptides able to bind to acyl chains or phosphate groups/saccharides of endotoxin, LPS. Complement activity as a whole is detectable in marine invertebrates. These are also a source of anti-microbial peptides with potential pharmaceutical applicability. Investigating the locality for the production of complement pathway proteins and their role in modulating cellular immune responses are emerging fields. The significance of local synthesis of complement components is becoming clearer from in vivo studies of parenchymatous disease involving specifically generated, complement-deficient mouse lines. Complement C3 is a central component of complement activation. Its provision by cells of the myeloid lineage varies. Their effector functions in turn are increased in the presence of anti-microbial peptides. This may point to a potentiating range of activities, which should serve the maintenance of health but may also cause disease. Because of the therapeutic implications, this review will consider closely studies dealing with complement activation and anti-microbial peptide activity in acute inflammation (e.g., dialysis-related peritonitis, appendicitis, and ischemia).

Complement System Part II: Role in Immunity

PubMed Central

Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.

2015-01-01

The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922

21 CFR 866.5240 - Complement components immunological test system.

Code of Federal Regulations, 2010 CFR

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5240 Complement components immunological test system. (a) Identification. A complement components... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Complement components immunological test system...

A Cost-effective Satellite-aircraft-drogue Approach for Studying Estuarine Circulation and Shelf Waste Dispersion. [Delaware Bay

NASA Technical Reports Server (NTRS)

Klemas, V. (Principal Investigator); Davis, G.; Wang, H.; Whelan, W.; Tornatore, G.

1975-01-01

The author has identified the following significant results. Satellites, such as ERTS-1, can be used to obtain a synoptic view of current circulation over large coastal areas. Since in turbid coastal regions suspended sediment acts as a natural tracer, cost is minimized by eliminating the need for expensive injections of large volumes of dye such as Rhodamine-B. One of the principal shortcomings of satellite imaging of coastal currents was its inability to determine current magnitude and to penetrate beyond the upper few meters of the water column. These objections were overcome by complementing satellite observations with drogues tracking currents at various selected depths. By combining the satellite's wide coverage with aircraft or shore stations capable of tracking expendable drogues, a cost effective, integrated system was devised for monitoring currents over large areas, various depths, and under severe environmental conditions.

Sex matters: Systemic complement activity of female C57BL/6J and BALB/cJ mice is limited by serum terminal pathway components.

PubMed

Kotimaa, Juha; Klar-Mohammad, Ngaisah; Gueler, Faikah; Schilders, Geurt; Jansen, Aswin; Rutjes, Helma; Daha, Mohamed R; van Kooten, Cees

2016-08-01

Experimental mouse models have been extensively used to elucidate the role of the complement system in different diseases and injuries. Contribution of gender has revealed an intriguing gender specific difference; female mice often show protection against most complement driven injuries such as ischemia/reperfusion injury, graft rejection and sepsis. Interestingly, early studies to the mouse complement system revealed that female mice have very low total complement activity (CH50), which is related to androgen regulation of hepatic complement synthesis. Here, our aim was to understand at which level the female specific differences in mouse complement resides. We have used recently developed complement assays to study the functional activities of female and male mice at the level of C3 and C9 activation, and furthermore assayed key complement factor levels in serum of age-matched female and male C57BL/6 mice. Our results show that the female mice have normal complement cascade functionality at the level of C3 activation, which was supported by determinations of early complement factors. However, all pathways are strongly reduced at the level of C9 activation, suggesting a terminal pathway specific difference. This was in line with C6 and C9 measurements, showing strongly decreased levels in females. Furthermore, similar gender differences were also found in BALB/cJ mice, but not in CD-1 mice. Our results clearly demonstrate that the complement system in females of frequently used mouse strains is restricted by the terminal pathway components and that the perceived female specific protection against experimental disease and injury might be in part explained by the inability promote inflammation through C5b-9. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Binding of Free and Immune Complex-Associated Hepatitis C Virus to Erythrocytes Is Mediated by the Complement System.

PubMed

Salam, Kazi Abdus; Wang, Richard Y; Grandinetti, Teresa; De Giorgi, Valeria; Alter, Harvey J; Allison, Robert D

2018-05-09

Erythrocytes bind circulating immune complexes (IC) and facilitate IC clearance from the circulation. Chronic hepatitis C virus (HCV) infection is associated with IC-related disorders. In this study we investigated the kinetics and mechanism of HCV and HCV-IC binding to and dissociation from erythrocytes. Cell culture-produced HCV was mixed with erythrocytes from healthy blood donors and erythrocyte-associated virus particles were quantified. Purified complement proteins, complement-depleted serum, and complement receptor antibodies were used to investigate complement-mediated HCV-erythrocyte binding. Purified HCV-specific immunoglobulin G from a chronic HCV-infected patient was used to study complement-mediated HCV-IC-erythrocyte binding. Binding of HCV to erythrocytes increased 200 to 1,000 fold after adding complement active human serum in the absence of antibody. Opsonization of free HCV occurred within 10 minutes and peak binding to erythrocytes was observed at 20-30 minutes. Complement protein C1 was required for binding, while C2, C3 and C4 significantly enhanced binding. Complement receptor 1 (CR1, CD35) antibodies blocked the binding of HCV to erythrocytes isolated from chronically infected HCV patients and healthy blood donors. HCV-ICs significantly enhanced complement-mediated binding to erythrocytes compared to unbound HCV. Dissociation of complement-opsonized HCV from erythrocytes depended on the presence of Factor I. HCV released by Factor I bound preferentially to CD19+ B cells compared to other leukocytes. These results demonstrate that complement mediates the binding of free and IC-associated HCV to CR1 on erythrocytes, and provide a mechanistic rationale for investigating the differential phenotypic expression of HCV-IC-related disease. This article is protected by copyright. All rights reserved. © 2018 by the American Association for the Study of Liver Diseases.

A novel earth observation based ecological indicator for cyanobacterial blooms

NASA Astrophysics Data System (ADS)

Anttila, Saku; Fleming-Lehtinen, Vivi; Attila, Jenni; Junttila, Sofia; Alasalmi, Hanna; Hällfors, Heidi; Kervinen, Mikko; Koponen, Sampsa

2018-02-01

Cyanobacteria form spectacular mass occurrences almost annually in the Baltic Sea. These harmful algal blooms are the most visible consequences of marine eutrophication, driven by a surplus of nutrients from anthropogenic sources and internal processes of the ecosystem. We present a novel Cyanobacterial Bloom Indicator (CyaBI) targeted for the ecosystem assessment of eutrophication in marine areas. The method measures the current cyanobacterial bloom situation (an average condition of recent 5 years) and compares this to the estimated target level for 'good environmental status' (GES). The current status is derived with an index combining indicative bloom event variables. As such we used seasonal information from the duration, volume and severity of algal blooms derived from earth observation (EO) data. The target level for GES was set by using a remote sensing based data set named Fraction with Cyanobacterial Accumulations (FCA; Kahru & Elmgren, 2014) covering years 1979-2014. Here a shift-detection algorithm for time series was applied to detect time-periods in the FCA data where the level of blooms remained low several consecutive years. The average conditions from these time periods were transformed into respective CyaBI target values to represent target level for GES. The indicator is shown to pass the three critical factors set for marine indicator development, namely it measures the current status accurately, the target setting can be scientifically proven and it can be connected to the ecosystem management goal. An advantage of the CyaBI method is that it's not restricted to the data used in the development work, but can be complemented, or fully applied, by using different types of data sources providing information on cyanobacterial accumulations.

Foetal Ureaplasma parvum bacteraemia as a function of gestation-dependent complement insufficiency: Evidence from a sheep model of pregnancy.

PubMed

Kemp, Matthew W; Ahmed, Shatha; Beeton, Michael L; Payne, Matthew S; Saito, Masatoshi; Miura, Yuichiro; Usuda, Haruo; Kallapur, Suhas G; Kramer, Boris W; Stock, Sarah J; Jobe, Alan H; Newnham, John P; Spiller, Owen B

2017-01-01

Complement is a central defence against sepsis, and increasing complement insufficiency in neonates of greater prematurity may predispose to increased sepsis. Ureaplasma spp. are the most frequently cultured bacteria from preterm blood samples. A sheep model of intrauterine Ureaplasma parvum infection was used to examine in vivo Ureaplasma bacteraemia at early and late gestational ages. Complement function and Ureaplasma killing assays were used to determine the correlation between complement potency and bactericidal activity of sera ex vivo. Ureaplasma was cultured from 50% of 95-day gestation lamb cord blood samples compared to 10% of 125-day gestation lambs. Bactericidal activity increased with increased gestational age, and a direct correlation between functional complement activity and bactericidal activity (R 2 =.86; P<.001) was found for 95-day gestational lambs. Ureaplasma bacteraemia in vivo was confined to early preterm lambs with low complement function, but Ureaplasma infection itself did not diminish complement levels. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Complement C5-inhibiting therapy for the thrombotic microangiopathies: accumulating evidence, but not a panacea

PubMed Central

Brocklebank, Vicky

2017-01-01

Abstract Thrombotic microangiopathy (TMA), characterized by organ injury occurring consequent to severe endothelial damage, can manifest in a diverse range of diseases. In complement-mediated atypical haemolytic uraemic syndrome (aHUS) a primary defect in complement, such as a mutation or autoantibody leading to over activation of the alternative pathway, predisposes to the development of disease, usually following exposure to an environmental trigger. The elucidation of the pathogenesis of aHUS resulted in the successful introduction of the complement inhibitor eculizumab into clinical practice. In other TMAs, although complement activation may be seen, its role in the pathogenesis remains to be confirmed by an interventional trial. Although many case reports in TMAs other than complement-mediated aHUS hint at efficacy, publication bias, concurrent therapies and in some cases the self-limiting nature of disease make broader interpretation difficult. In this article, we will review the evidence for the role of complement inhibition in complement-mediated aHUS and other TMAs. PMID:28980670

Practice-Relevant Pedagogy for Mining Software Engineering Curricula Assets

DTIC Science & Technology

2007-06-20

permits the application of the Lean methods by virtually grouping shared services into eWorkcenters to which only non-routine requests are routed...engineering can be applied to IT shared services improvement and provide precise system improvement methods to complement the ITIL best practice. This...Vertical� or internal service- chain of primary business functions and enabling shared services Framework results - Mined patterns that relate

A Method and a Model for Describing Competence and Adjustment: A Preschool Version of the Classroom Behavior Inventory.

ERIC Educational Resources Information Center

Schaefer, Earl S.; Edgerton, Marianna D.

A preschool version of the Classroom Behavior Inventory which provides a method for collecting valid data on a child's classroom behavior from day care and preschool teachers, was developed to complement the earlier form which was developed and validated for elementary school populations. The new version was tested with a pilot group of twenty-two…

Theory of mind in SLI revisited: links with syntax, comparisons with ASD.

PubMed

Durrleman, Stephanie; Burnel, Morgane; Reboul, Anne

2017-11-01

According to the linguistic determinism approach, knowledge of sentential complements such as: John says that the earth is flat plays a crucial role in theory of mind (ToM) development by providing a means to represent explicitly people's mental attitudes and beliefs. This approach predicts that mastery of complements determines successful belief reasoning across explicit ToM tasks, even low-verbal ones, and across populations. (1) To investigate the link between a low-verbal ToM-task and complements in Specific Language Impairment (SLI), (2) To determine whether this population shows similar ToM performance to that of children with Autism Spectrum Disorder (ASD) or those with Typical Development (TD) once these groups are matched on competency for complements, (3) To explore whether complements conveying a falsehood without jeopardizing the veracity of the entire sentence, such as complements of verbs of communication, are more crucial for belief attribution than complements which do not have this property, namely complements of verbs of perception, (?John sees that the earth is flat). Children with SLI (n = 20), with ASD (n = 34) and TD (n = 30) completed sentence-picture-matching tasks assessing complementation with communication and perception verbs, as well as a picture-sequencing task assessing ToM. Children were furthermore evaluated for general grammatical and lexical abilities and non-verbal IQ. Results reveal that competency on complements relates to ToM performance with a low-verbal task in SLI, and that SLI, ASD and TD groups of equivalent performance on complements also perform similarly for ToM. Results further suggest that complements with an independent truth-value are the only ones to show a significant relation to ToM performance after teasing out the impact of non-verbal reasoning. This study suggests that clinical groups of different aetiologies as well as TD children perform comparably for ToM once they have similar complementation skills. Findings further highlight that specific types of complements, namely those with an independent truth value, relate in a special way to mentalizing. Future work should determine whether these specific structures could be effective in ToM remediation programmes. © 2017 Royal College of Speech and Language Therapists.

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

PubMed

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-10-03

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes

PubMed Central

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-01-01

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274

Automated sample preparation using membrane microtiter extraction for bioanalytical mass spectrometry.

PubMed

Janiszewski, J; Schneider, P; Hoffmaster, K; Swyden, M; Wells, D; Fouda, H

1997-01-01

The development and application of membrane solid phase extraction (SPE) in 96-well microtiter plate format is described for the automated analysis of drugs in biological fluids. The small bed volume of the membrane allows elution of the analyte in a very small solvent volume, permitting direct HPLC injection and negating the need for the time consuming solvent evaporation step. A programmable liquid handling station (Quadra 96) was modified to automate all SPE steps. To avoid drying of the SPE bed and to enhance the analytical precision a novel protocol for performing the condition, load and wash steps in rapid succession was utilized. A block of 96 samples can now be extracted in 10 min., about 30 times faster than manual solvent extraction or single cartridge SPE methods. This processing speed complements the high-throughput speed of contemporary high performance liquid chromatography mass spectrometry (HPLC/MS) analysis. The quantitative analysis of a test analyte (Ziprasidone) in plasma demonstrates the utility and throughput of membrane SPE in combination with HPLC/MS. The results obtained with the current automated procedure compare favorably with those obtained using solvent and traditional solid phase extraction methods. The method has been used for the analysis of numerous drug prototypes in biological fluids to support drug discovery efforts.

Predictive Models for Carcinogenicity and Mutagenicity ...

EPA Pesticide Factsheets

Mutagenicity and carcinogenicity are endpoints of major environmental and regulatory concern. These endpoints are also important targets for development of alternative methods for screening and prediction due to the large number of chemicals of potential concern and the tremendous cost (in time, money, animals) of rodent carcinogenicity bioassays. Both mutagenicity and carcinogenicity involve complex, cellular processes that are only partially understood. Advances in technologies and generation of new data will permit a much deeper understanding. In silico methods for predicting mutagenicity and rodent carcinogenicity based on chemical structural features, along with current mutagenicity and carcinogenicity data sets, have performed well for local prediction (i.e., within specific chemical classes), but are less successful for global prediction (i.e., for a broad range of chemicals). The predictivity of in silico methods can be improved by improving the quality of the data base and endpoints used for modelling. In particular, in vitro assays for clastogenicity need to be improved to reduce false positives (relative to rodent carcinogenicity) and to detect compounds that do not interact directly with DNA or have epigenetic activities. New assays emerging to complement or replace some of the standard assays include VitotoxTM, GreenScreenGC, and RadarScreen. The needs of industry and regulators to assess thousands of compounds necessitate the development of high-t

Complement activation promotes colitis-associated carcinogenesis through activating intestinal IL-1β/IL-17A axis.

PubMed

Ning, C; Li, Y-Y; Wang, Y; Han, G-C; Wang, R-X; Xiao, H; Li, X-Y; Hou, C-M; Ma, Y-F; Sheng, D-S; Shen, B-F; Feng, J-N; Guo, R-F; Li, Y; Chen, G-J

2015-11-01

Colitis-associated colorectal cancer (CAC) is the most serious complication of inflammatory bowel disease (IBD). Excessive complement activation has been shown to be involved in the pathogenesis of IBD. However, its role in the development of CAC is largely unknown. Here, using a CAC model induced by combined administration of azoxymethane (AOM) and dextran sulfate sodium (DSS), we demonstrated that complement activation was required for CAC pathogenesis. Deficiency in key components of complement (e.g., C3, C5, or C5a receptor) rendered tumor repression in mice subjected to AOM/DSS. Mechanistic investigation revealed that complement ablation dramatically reduced proinflammatory cytokine interleukin (IL)-1β levels in the colonic tissues that was mainly produced by infiltrating neutrophils. IL-1β promoted colon carcinogenesis by eliciting IL-17 response in intestinal myeloid cells. Furthermore, complement-activation product C5a represented a potent inducer for IL-1β in neutrophil, accounting for downregulation of IL-1β levels in the employed complement-deficient mice. Overall, our study proposes a protumorigenic role of complement in inflammation-related colorectal cancer and that the therapeutic strategies targeting complement may be beneficial for the treatment of CAC in clinic.

Protection of host cells by complement regulators.

PubMed

Schmidt, Christoph Q; Lambris, John D; Ricklin, Daniel

2016-11-01

The complement cascade is an ancient immune-surveillance system that not only provides protection from pathogen invasion but has also evolved to participate in physiological processes to maintain tissue homeostasis. The alternative pathway (AP) of complement activation is the evolutionarily oldest part of this innate immune cascade. It is unique in that it is continuously activated at a low level and arbitrarily probes foreign, modified-self, and also unaltered self-structures. This indiscriminate activation necessitates the presence of preformed regulators on autologous surfaces to spare self-cells from the undirected nature of AP activation. Although the other two canonical complement activation routes, the classical and lectin pathways, initiate the cascade more specifically through pattern recognition, their activity still needs to be tightly controlled to avoid excessive reactivity. It is the perpetual duty of complement regulators to protect the self from damage inflicted by inadequate complement activation. Here, we review the role of complement regulators as preformed mediators of defense, explain their common and specialized functions, and discuss selected cases in which alterations in complement regulators lead to disease. Finally, rational engineering approaches using natural complement inhibitors as potential therapeutics are highlighted. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Inactivation of complement by Loxosceles reclusa spider venom.

PubMed

Gebel, H M; Finke, J H; Elgert, K D; Cambell, B J; Barrett, J T

1979-07-01

Zymosan depletion of serum complement in guinea pigs rendered them highly resistant to lesion by Loxosceles reclusa spider venom. Guinea pigs deficient in C4 of the complement system are as sensitive to the venom as normal guinea pigs. The injection of 35 micrograms of whole recluse venom intradermally into guinea pigs lowered their complement level by 35.7%. Brown recluse spider venom in concentrations as slight as 0.02 micrograms protein/ml can totally inactivate one CH50 of guinea pig complement in vitro. Bee, scorpion, and other spider venoms had no influence on the hemolytic titer of complement. Fractionation of recluse spider venom by Sephadex G-200 filtration separated the complement-inactivating property of the venom into three major regions which could be distinguished on the basis of heat stability as well as size. None was neutralized by antivenom. Polyacrylamide gel electrophoresis of venom resolved the complement inactivators into five fractions. Complement inactivated by whole venom or the Sephadex fractions could be restored to hemolytic activity by supplements of fresh serum but not by heat-inactivated serum, pure C3, pure C5, or C3 and C5 in combination.

Reconstruction of Cell Surface Densities of Ion Pumps, Exchangers, and Channels from mRNA Expression, Conductance Kinetics, Whole-Cell Calcium, and Current-Clamp Voltage Recordings, with an Application to Human Uterine Smooth Muscle Cells

PubMed Central

Atia, Jolene; McCloskey, Conor; Shmygol, Anatoly S.; Rand, David A.; van den Berg, Hugo A.; Blanks, Andrew M.

2016-01-01

Uterine smooth muscle cells remain quiescent throughout most of gestation, only generating spontaneous action potentials immediately prior to, and during, labor. This study presents a method that combines transcriptomics with biophysical recordings to characterise the conductance repertoire of these cells, the ‘conductance repertoire’ being the total complement of ion channels and transporters expressed by an electrically active cell. Transcriptomic analysis provides a set of potential electrogenic entities, of which the conductance repertoire is a subset. Each entity within the conductance repertoire was modeled independently and its gating parameter values were fixed using the available biophysical data. The only remaining free parameters were the surface densities for each entity. We characterise the space of combinations of surface densities (density vectors) consistent with experimentally observed membrane potential and calcium waveforms. This yields insights on the functional redundancy of the system as well as its behavioral versatility. Our approach couples high-throughput transcriptomic data with physiological behaviors in health and disease, and provides a formal method to link genotype to phenotype in excitable systems. We accurately predict current densities and chart functional redundancy. For example, we find that to evoke the observed voltage waveform, the BK channel is functionally redundant whereas hERG is essential. Furthermore, our analysis suggests that activation of calcium-activated chloride conductances by intracellular calcium release is the key factor underlying spontaneous depolarisations. PMID:27105427

False Belief, Complementation Language, and Contextual Bias in Preschoolers

ERIC Educational Resources Information Center

Ng, Lisa; Cheung, Him; Xiao, Wen

2010-01-01

In the present study, we address two questions concerning the relation between children's false belief and their understanding of complex object complements. The first question is whether the previously demonstrated association between tensed complements and false belief generalizes to infinitival complements (de Villiers & Pyers, 2002). The…

The Syntax of Sentential Complementation in Turkish

ERIC Educational Resources Information Center

Predolac, Esra

2017-01-01

This dissertation examines primarily the syntactic, but also the semantic/pragmatic behavior of sentential complement clauses in Turkish and proposes a new classification of such complements. A head-final language, Turkish lacks an overt, lexical complementizer akin to English "that". The most frequent types of sentential complementation…

Complement activation in the tubulointerstitium: AKI, CKD, and in between.

PubMed

Brar, Jyoti E; Quigg, Richard J

2014-10-01

Complement activation is actively regulated to prevent injudicious activation, such as on peritubular endothelia and basolateral aspects of tubules. Miao et al. studied mice in which the key complement regulator, Crry, was deleted from tubular cells. This lacked functional consequence in unmanipulated animals. Yet, following ischemia-reperfusion, there was greater injury due to alternative pathway activation of C5. When the balance between complement activation and regulation is tipped towards the former, pathologic complement activation can ensue.