Sample records for complement dna polymerase
-
Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran
2015-01-01
Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610
-
Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P
1997-02-01
The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).
-
Shpakovski, G V; Acker, J; Wintzerith, M; Lacroix, J F; Thuriaux, P; Vigneron, M
1995-01-01
Four cDNAs encoding human polypeptides hRPB7.0, hRPB7.6, hRPB17, and hRPB14.4 (referred to as Hs10 alpha, Hs10 beta, Hs8, and Hs6, respectively), homologous to the ABC10 alpha, ABC10 beta, ABC14.5, and ABC23 RNA polymerase subunits (referred to as Sc10 alpha, Sc10 beta, Sc8, and Sc6, respectively) of Saccharomyces cerevisiae, were cloned and characterized for their ability to complement defective yeast mutants. Hs10 alpha and the corresponding Sp10 alpha of Schizosaccharomyces pombe can complement an S. cerevisiae mutant (rpc10-delta::HIS3) defective in Sc10 alpha. The peptide sequences are highly conserved in their carboxy-terminal halves, with an invariant motif CX2CX12RCX2CGXR corresponding to a canonical zinc-binding domain. Hs10 beta, Sc10 beta, and the N subunit of archaeal RNA polymerase are homologous. An invariant CX2CGXnCCR motif presumably forms an atypical zinc-binding domain. Hs10 beta, but not the archaeal subunit, complemented an S. cerevisiae mutant (rpb10-delta 1::HIS3) lacking Sc10 beta. Hs8 complemented a yeast mutant (rpb8-delta 1::LYS2) defective in the corresponding Sc8 subunit, although with a strong thermosensitive phenotype. Interspecific complementation also occurred with Hs6 and with the corresponding Dm6 cDNA of Drosophila melanogaster. Hs6 cDNA and the Sp6 cDNA of S. pombe are dosage-dependent suppressors of rpo21-4, a mutation generating a slowly growing yeast defective in the largest subunit of RNA polymerase II. Finally, a doubly chimeric S. cerevisiae strain bearing the Sp6 cDNA and the human Hs10 beta cDNA was also viable. No interspecific complementation was observed for the human hRPB25 (Hs5) homolog of the yeast ABC27 (Sc5) subunit. PMID:7651387
-
Gene for ataxia-telangiectasia complementation group D (ATDC)
Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung
1995-03-07
Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.
-
Gene for ataxia-telangiectasia complementation group D (ATDC)
Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.
1995-03-07
Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.
-
Nicolay, Nils H; Carter, Rebecca; Hatch, Stephanie B; Schultz, Niklas; Prevo, Remko; McKenna, W Gillies; Helleday, Thomas; Sharma, Ricky A
2012-11-01
DNA polymerase eta (pol η) is the only DNA polymerase causally linked to carcinogenesis in humans. Inherited deficiency of pol η in the variant form of xeroderma pigmentosum (XPV) predisposes to UV-light-induced skin cancer. Pol η-deficient cells demonstrate increased sensitivity to cisplatin and oxaliplatin chemotherapy. We have found that XP30R0 fibroblasts derived from a patient with XPV are more resistant to cell kill by ionising radiation (IR) than the same cells complemented with wild-type pol η. This phenomenon has been confirmed in Burkitt's lymphoma cells, which either expressed wild-type pol η or harboured a pol η deletion. Pol η deficiency was associated with accumulation of cells in S-phase, which persisted after IR. Cells deficient in pol η demonstrated increased homologous recombination (HR)-directed repair of double strand breaks created by IR. Depletion of the HR protein, X-ray repair cross-complementing protein 3 (XRCC3), abrogated the radioresistance observed in pol η-deficient cells as compared with pol η-complemented cells. These findings suggest that HR mediates S-phase-dependent radioresistance associated with pol η deficiency. We propose that pol η protein levels in tumours may potentially be used to identify patients who require treatment with chemo-radiotherapy rather than radiotherapy alone for adequate tumour control.
-
Sharma, Ricky A.
2012-01-01
DNA polymerase eta (pol η) is the only DNA polymerase causally linked to carcinogenesis in humans. Inherited deficiency of pol η in the variant form of xeroderma pigmentosum (XPV) predisposes to UV-light-induced skin cancer. Pol η-deficient cells demonstrate increased sensitivity to cisplatin and oxaliplatin chemotherapy. We have found that XP30R0 fibroblasts derived from a patient with XPV are more resistant to cell kill by ionising radiation (IR) than the same cells complemented with wild-type pol η. This phenomenon has been confirmed in Burkitt’s lymphoma cells, which either expressed wild-type pol η or harboured a pol η deletion. Pol η deficiency was associated with accumulation of cells in S-phase, which persisted after IR. Cells deficient in pol η demonstrated increased homologous recombination (HR)-directed repair of double strand breaks created by IR. Depletion of the HR protein, X-ray repair cross-complementing protein 3 (XRCC3), abrogated the radioresistance observed in pol η-deficient cells as compared with pol η-complemented cells. These findings suggest that HR mediates S-phase-dependent radioresistance associated with pol η deficiency. We propose that pol η protein levels in tumours may potentially be used to identify patients who require treatment with chemo-radiotherapy rather than radiotherapy alone for adequate tumour control. PMID:22822095
-
Moro, Sean L; Cocco, Melanie J
2015-10-01
The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains.
-
Qian, Yufeng; Kachroo, Aashiq H.; Yellman, Christopher M.; Marcotte, Edward M.; Johnson, Kenneth A.
2014-01-01
Mutations in the human mitochondrial polymerase (polymerase-γ (Pol-γ)) are associated with various mitochondrial disorders, including mitochondrial DNA (mtDNA) depletion syndrome, Alpers syndrome, and progressive external opthamalplegia. To correlate biochemically quantifiable defects resulting from point mutations in Pol-γ with their physiological consequences, we created “humanized” yeast, replacing the yeast mtDNA polymerase (MIP1) with human Pol-γ. Despite differences in the replication and repair mechanism, we show that the human polymerase efficiently complements the yeast mip1 knockouts, suggesting common fundamental mechanisms of replication and conserved interactions between the human polymerase and other components of the replisome. We also examined the effects of four disease-related point mutations (S305R, H932Y, Y951N, and Y955C) and an exonuclease-deficient mutant (D198A/E200A). In haploid cells, each mutant results in rapid mtDNA depletion, increased mutation frequency, and mitochondrial dysfunction. Mutation frequencies measured in vivo equal those measured with purified enzyme in vitro. In heterozygous diploid cells, wild-type Pol-γ suppresses mutation-associated growth defects, but continuous growth eventually leads to aerobic respiration defects, reduced mtDNA content, and depolarized mitochondrial membranes. The severity of the Pol-γ mutant phenotype in heterozygous diploid humanized yeast correlates with the approximate age of disease onset and the severity of symptoms observed in humans. PMID:24398692
-
NASA Astrophysics Data System (ADS)
Satpati, Suresh; Manohar, Kodavati; Acharya, Narottam; Dixit, Anshuman
2017-01-01
Genomic instability in Candida albicans is believed to play a crucial role in fungal pathogenesis. DNA polymerases contribute significantly to stability of any genome. Although Candida Genome database predicts presence of S. cerevisiae DNA polymerase orthologs; functional and structural characterizations of Candida DNA polymerases are still unexplored. DNA polymerase eta (Polη) is unique as it promotes efficient bypass of cyclobutane pyrimidine dimers. Interestingly, C. albicans is heterozygous in carrying two Polη genes and the nucleotide substitutions were found only in the ORFs. As allelic differences often result in functional differences of the encoded proteins, comparative analyses of structural models and molecular dynamic simulations were performed to characterize these orthologs of DNA Polη. Overall structures of both the ORFs remain conserved except subtle differences in the palm and PAD domains. The complementation analysis showed that both the ORFs equally suppressed UV sensitivity of yeast rad30 deletion strain. Our study has predicted two novel molecular interactions, a highly conserved molecular tetrad of salt bridges and a series of π-π interactions spanning from thumb to PAD. This study suggests these ORFs as the homologues of yeast Polη, and due to its heterogeneity in C. albicans they may play a significant role in pathogenicity.
-
DNA polymerase γ and disease: what we have learned from yeast
Lodi, Tiziana; Dallabona, Cristina; Nolli, Cecilia; Goffrini, Paola; Donnini, Claudia; Baruffini, Enrico
2015-01-01
Mip1 is the Saccharomyces cerevisiae DNA polymerase γ (Pol γ), which is responsible for the replication of mitochondrial DNA (mtDNA). It belongs to the family A of the DNA polymerases and it is orthologs to human POLGA. In humans, mutations in POLG(1) cause many mitochondrial pathologies, such as progressive external ophthalmoplegia (PEO), Alpers' syndrome, and ataxia-neuropathy syndrome, all of which present instability of mtDNA, which results in impaired mitochondrial function in several tissues with variable degrees of severity. In this review, we summarize the genetic and biochemical knowledge published on yeast mitochondrial DNA polymerase from 1989, when the MIP1 gene was first cloned, up until now. The role of yeast is particularly emphasized in (i) validating the pathological mutations found in human POLG and modeled in MIP1, (ii) determining the molecular defects caused by these mutations and (iii) finding the correlation between mutations/polymorphisms in POLGA and mtDNA toxicity induced by specific drugs. We also describe recent findings regarding the discovery of molecules able to rescue the phenotypic defects caused by pathological mutations in Mip1, and the construction of a model system in which the human Pol γ holoenzyme is expressed in yeast and complements the loss of Mip1. PMID:25852747
-
Baldeck, Nadège; Janel-Bintz, Régine; Wagner, Jérome; Tissier, Agnès; Fuchs, Robert P.; Burkovics, Peter; Haracska, Lajos; Despras, Emmanuelle; Bichara, Marc; Chatton, Bruno; Cordonnier, Agnès M.
2015-01-01
Switching between replicative and translesion synthesis (TLS) DNA polymerases are crucial events for the completion of genomic DNA synthesis when the replication machinery encounters lesions in the DNA template. In eukaryotes, the translesional DNA polymerase η (Polη) plays a central role for accurate bypass of cyclobutane pyrimidine dimers, the predominant DNA lesions induced by ultraviolet irradiation. Polη deficiency is responsible for a variant form of the Xeroderma pigmentosum (XPV) syndrome, characterized by a predisposition to skin cancer. Here, we show that the FF483–484 amino acids in the human Polη (designated F1 motif) are necessary for the interaction of this TLS polymerase with POLD2, the B subunit of the replicative DNA polymerase δ, both in vitro and in vivo. Mutating this motif impairs Polη function in the bypass of both an N-2-acetylaminofluorene adduct and a TT-CPD lesion in cellular extracts. By complementing XPV cells with different forms of Polη, we show that the F1 motif contributes to the progression of DNA synthesis and to the cell survival after UV irradiation. We propose that the integrity of the F1 motif of Polη, necessary for the Polη/POLD2 interaction, is required for the establishment of an efficient TLS complex. PMID:25662213
-
Rates of Spontaneous Mutation in Bacteriophage T4 Are Independent of Host Fidelity Determinants
Santos, M. E.; Drake, J. W.
1994-01-01
Bacteriophage T4 encodes most of the genes whose products are required for its DNA metabolism, and host (Escherichia coli) genes can only infrequently complement mutationally inactivated T4 genes. We screened the following host mutator mutations for effects on spontaneous mutation rates in T4: mutT (destruction of aberrant dGTPs), polA, polB and polC (DNA polymerases), dnaQ (exonucleolytic proofreading), mutH, mutS, mutL and uvrD (methyl-directed DNA mismatch repair), mutM and mutY (excision repair of oxygen-damaged DNA), mutA (function unknown), and topB and osmZ (affecting DNA topology). None increased T4 spontaneous mutation rates within a resolving power of about twofold (nor did optA, which is not a mutator but overexpresses a host dGTPase). Previous screens in T4 have revealed strong mutator mutations only in the gene encoding the viral DNA polymerase and proofreading 3'-exonuclease, plus weak mutators in several polymerase accessory proteins or determinants of dNTP pool sizes. T4 maintains a spontaneous mutation rate per base pair about 30-fold greater than that of its host. Thus, the joint high fidelity of insertion by T4 DNA polymerase and proofreading by its associated 3'-exonuclease appear to determine the T4 spontaneous mutation rate, whereas the host requires numerous additional systems to achieve high replication fidelity. PMID:7851754
-
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
-
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
-
Wang, Amy; Wolf, Douglas C; Sen, Banalata; Knapp, Geremy W; Holladay, Steven D; Huckle, William R; Caceci, Thomas; Robertson, John L
2009-06-01
Inorganic arsenic increases urinary bladder transitional cell carcinoma in humans. In F344 rats, dimethylarsinic acid (DMA[V]) increases transitional cell carcinoma. Arsenic-induced inhibition of DNA repair has been reported in cultured cell lines and in lymphocytes of arsenic-exposed humans, but it has not been studied in urinary bladder. Should inhibition of DNA damage repair in transitional epithelium occur, it may contribute to carcinogenesis or cocarcinogenesis. We investigated morphology and expression of DNA repair genes in F344 rat transitional cells following up to 100 ppm DMA(V) in drinking water for four weeks. Mitochondria were very sensitive to DMA(V), and swollen mitochondria appeared to be the main source of vacuoles in the transitional epithelium. Real-time reverse transcriptase polymerase chain reaction (Real-Time RT PCR) showed the mRNA levels of tested DNA repair genes, ataxia telangectasia mutant (ATM), X-ray repair cross-complementing group 1 (XRCC1), excision repair cross-complementing group 3/xeroderma pigmentosum B (ERCC3/XPB), and DNA polymerase beta (Polbeta), were not altered by DMA(V). These data suggested that either DMA(V) does not affect DNA repair in the bladder or DMA(V) affects DNA repair without affecting baseline mRNA levels of repair genes. The possibility remains that DMA(V) may lower damage-induced increases in repair gene expression or cause post-translational modification of repair enzymes.
-
Powers, Kyle T; Washington, M Todd
2018-01-01
Abstract Eukaryotic DNA polymerase η catalyzes translesion synthesis of thymine dimers and 8-oxoguanines. It is comprised of a polymerase domain and a C-terminal region, both of which are required for its biological function. The C-terminal region mediates interactions with proliferating cell nuclear antigen (PCNA) and other translesion synthesis proteins such as Rev1. This region contains a ubiquitin-binding/zinc-binding (UBZ) motif and a PCNA-interacting protein (PIP) motif. Currently little structural information is available for this region of polymerase η. Using a combination of approaches—including genetic complementation assays, X-ray crystallography, Langevin dynamics simulations, and small-angle X-ray scattering—we show that the C-terminal region is partially unstructured and has high conformational flexibility. This implies that the C-terminal region acts as a flexible tether linking the polymerase domain to PCNA thereby increasing its local concentration. Such tethering would facilitate the sampling of translesion synthesis polymerases to ensure that the most appropriate one is selected to bypass the lesion. PMID:29385534
-
Shpakovskiĭ, G V; Lebedenko, E N
1997-05-01
The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.
-
Douziech, Maxime; Coin, Frédéric; Chipoulet, Jean-Marc; Arai, Yoko; Ohkuma, Yoshiaki; Egly, Jean-Marc; Coulombe, Benoit
2000-01-01
The p89/xeroderma pigmentosum complementation group B (XPB) ATPase-helicase of transcription factor IIH (TFIIH) is essential for promoter melting prior to transcription initiation by RNA polymerase II (RNAPII). By studying the topological organization of the initiation complex using site-specific protein-DNA photo-cross-linking, we have shown that p89/XPB makes promoter contacts both upstream and downstream of the initiation site. The upstream contact, which is in the region where promoter melting occurs (positions −9 to +2), requires tight DNA wrapping around RNAPII. The addition of hydrolyzable ATP tethers the template strand at positions −5 and +1 to RNAPII subunits. A mutation in p89/XPB found in a xeroderma pigmentosum patient impairs the ability of TFIIH to associate correctly with the complex and thereby melt promoter DNA. A model for open complex formation is proposed. PMID:11027286
-
Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, P.K.; Sirover, M.A.
1984-10-01
The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmethane sulfonate. WI-38 normal human diploid fibroblasts, xeroderma pigmentosum variant cells, as well as ataxia telangiectasia cells enhanced their capacity for both nucleotide excision repair and for base excision repair prior tomore » their enhancement of DNA synthesis. Further, in each cell strain, the base excision repair enzyme uracil DNA glycosylase was increased prior to the induction of DNA polymerase using the identical cells to quantitate each activity. In contrast, each of the three xeroderma complementation groups that were examined failed to increase their capacity for nucleotide excision repair above basal levels at any interval examined. This result was observed using either unscheduled DNA synthesis in the presence of 10 mM hydroxyurea or using repair replication in the absence of hydroxyurea to quantitate DNA repair. However, each of the three complementation groups normally regulated the enhancement of base excision repair after methylmethane sulfonate exposure and each induced the uracil DNA glycosylase prior to DNA synthesis. 62 references, 3 figures, 2 tables.« less
-
Su, Mei-Tzu; Liu, I-Hua; Wu, Chia-Wei; Chang, Shu-Ming; Tsai, Ching-Hwa; Yang, Pei-Wen; Chuang, Yu-Chia; Lee, Chung-Pei; Chen, Mei-Ru
2014-08-01
Epstein-Barr virus (EBV) BKRF3 shares sequence homology with members of the uracil-N-glycosylase (UNG) protein family and has DNA glycosylase activity. Here, we explored how BKRF3 participates in the DNA replication complex and contributes to viral DNA replication. Exogenously expressed Flag-BKRF3 was distributed mostly in the cytoplasm, whereas BKRF3 was translocated into the nucleus and colocalized with the EBV DNA polymerase BALF5 in the replication compartment during EBV lytic replication. The expression level of BKRF3 increased gradually during viral replication, coupled with a decrease of cellular UNG2, suggesting BKRF3 enzyme activity compensates for UNG2 and ensures the fidelity of viral DNA replication. In immunoprecipitation-Western blotting, BKRF3 was coimmuno-precipitated with BALF5, the polymerase processivity factor BMRF1, and the immediate-early transactivator Rta. Coexpression of BMRF1 appeared to facilitate the nuclear targeting of BKRF3 in immunofluorescence staining. Residues 164 to 255 of BKRF3 were required for interaction with Rta and BALF5, whereas residues 81 to 166 of BKRF3 were critical for BMRF1 interaction in glutathione S-transferase (GST) pulldown experiments. Viral DNA replication was defective in cells harboring BKRF3 knockout EBV bacmids. In complementation assays, the catalytic mutant BKRF3(Q90L,D91N) restored viral DNA replication, whereas the leucine loop mutant BKRF3(H213L) only partially rescued viral DNA replication, coupled with a reduced ability to interact with the viral DNA polymerase and Rta. Our data suggest that BKRF3 plays a critical role in viral DNA synthesis predominantly through its interactions with viral proteins in the DNA replication compartment, while its enzymatic activity may be supplementary for uracil DNA glycosylase (UDG) function during virus replication. Catalytic activities of both cellular UDG UNG2 and viral UDGs contribute to herpesviral DNA replication. To ensure that the enzyme activity executes at the right time and the right place in DNA replication forks, complex formation with other components in the DNA replication machinery provides an important regulation for UDG function. In this study, we provide the mechanism for EBV UDG BKRF3 nuclear targeting and the interacting domains of BKRF3 with viral DNA replication proteins. Through knockout and complementation approaches, we further demonstrate that in addition to UDG activity, the interaction of BKRF3 with viral proteins in the replication compartment is crucial for efficient viral DNA replication. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
-
Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooper, Karen L.; Dashner, Erica J.; Tsosie, Ranalda
Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; < 10 μM) is not cytotoxic to human embryonic kidney cells or normal human keratinocytes; however, uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein.more » Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. - Highlights: • Low micromolar concentration of uranium inhibits polymerase-1 (PARP-1) activity. • Uranium causes zinc loss from multiple DNA repair proteins. • Uranium enhances retention of DNA damage caused by ultraviolet radiation. • Zinc reverses the effects of uranium on PARP activity and DNA damage repair.« less
-
Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G
2012-04-01
Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.
-
Kobayashi, Kaori; Guilliam, Thomas A; Tsuda, Masataka; Yamamoto, Junpei; Bailey, Laura J; Iwai, Shigenori; Takeda, Shunichi; Doherty, Aidan J; Hirota, Kouji
2016-08-02
PrimPol is a DNA damage tolerance enzyme possessing both translesion synthesis (TLS) and primase activities. To uncover its potential role in TLS-mediated IgVλ hypermutation and define its interplay with other TLS polymerases, PrimPol(-/-) and PrimPol(-/-)/Polη(-/-)/Polζ (-/-) gene knockouts were generated in avian cells. Loss of PrimPol had no significant impact on the rate of hypermutation or the mutation spectrum of IgVλ. However, PrimPol(-/-) cells were sensitive to methylmethane sulfonate, suggesting that it may bypass abasic sites at the IgVλ segment by repriming DNA synthesis downstream of these sites. PrimPol(-/-) cells were also sensitive to cisplatin and hydroxyurea, indicating that it assists in maintaining / restarting replication at a variety of lesions. To accurately measure the relative contribution of the TLS and primase activities, we examined DNA damage sensitivity in PrimPol(-/-) cells complemented with polymerase or primase-deficient PrimPol. Polymerase-defective, but not primase-deficient, PrimPol suppresses the hypersensitivity of PrimPol(-/-) cells. This indicates that its primase, rather than TLS activity, is pivotal for DNA damage tolerance. Loss of TLS polymerases, Polη and Polζ has an additive effect on the sensitivity of PrimPol(-/-) cells. Moreover, we found that PrimPol and Polη-Polζ redundantly prevented cell death and facilitated unperturbed cell cycle progression. PrimPol(-/-) cells also exhibited increased sensitivity to a wide variety of chain-terminating nucleoside analogs (CTNAs). PrimPol could perform close-coupled repriming downstream of CTNAs and oxidative damage in vitro. Together, these results indicate that PrimPol's repriming activity plays a central role in reinitiating replication downstream from CTNAs and other specific DNA lesions.
-
Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium
Cooper, Karen L.; Dashner, Erica J.; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye
2015-01-01
Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; <10 μM) is not cytotoxic to human embryonic kidney cells or normal human keratinocytes; however, uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. PMID:26627003
-
Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium.
Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G
2016-01-15
Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; <10 μM) is not cytotoxic to human embryonic kidney cells or normal human keratinocytes; however, uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Xeroderma pigmentosum complementation group E and UV-damaged DNA-binding protein
Tang, Jean; Chu, Gilbert
2010-01-01
UV-damaged DNA-binding protein (UV-DDB) is composed of two subunits, DDB1 (p127) and DDB2 (p48). Mutations in the DDB2 gene inactivate UV-DDB in individuals from complementation group E of xeroderma pigmentosum (XP-E), an autosomal recessive disease characterized by sun sensitivity, severe risk for skin cancer and defective nucleotide excision repair. UV-DDB is also deficient in many rodent tissues, exposing a shortcoming in rodent models for cancer. In vitro, UV-DDB binds to cyclobutane pyrimidine dimers (CPDs), 6–4 photoproducts and other DNA lesions, stimulating the excision of CPDs, and to a lesser extent, of 6–4 photoproducts. In vivo, UV-DDB plays an important role in the p53-dependent response of mammalian cells to DNA damage. When cells are exposed to UV, the resulting accumulation of p53 activates DDB2 transcription, which leads to increased levels of UV-DDB. Binding of UV-DDB to CPDs targets these lesions for global genomic repair, suppressing mutations without affecting UV survival. Apparently, cells are able to survive with unrepaired CPDs because of the activity of bypass DNA polymerases. Finally, there is evidence that UV-DDB may have roles in the cell that are distinct from DNA repair. PMID:12509284
-
Laquel, P; Litvak, S; Castroviejo, M
1993-01-01
Multiple DNA polymerases have been described in all organisms studied to date. Their specific functions are not easy to determine, except when powerful genetic and/or biochemical tools are available. However, the processivity of a DNA polymerase could reflect the physiological role of the enzyme. In this study, analogies between plant and animal DNA polymerases have been investigated by analyzing the size of the products synthesized by wheat DNA polymerases A, B, CI, and CII as a measure of their processivity. Thus, incubations have been carried out with poly(dA)-oligo(dT) as a template-primer under varying assay conditions. In the presence of MgCl2, DNA polymerase A was highly processive, whereas DNA polymerases B, CI, and CII synthesized much shorter products. With MnCl2 instead of MgCl2, DNA polymerase A was highly processive, DNA polymerases B and CII were moderately processive, and DNA polymerase CI remained strictly distributive. The effect of calf thymus proliferating cell nuclear antigen (PCNA) on wheat polymerases was studied as described for animal DNA polymerases. The high processivity of DNA polymerase A was PCNA independent, whereas both enzyme activity and processivity of wheat DNA polymerases B and CII were significantly stimulated by PCNA. On the other hand, DNA polymerase CI was not stimulated by PCNA and, like animal DNA polymerase beta, was distributive in all cases. From these results, we propose that wheat DNA polymerase A could correspond to a DNA polymerase alpha, DNA polymerases B and CII could correspond to the delta-like enzyme, and DNA polymerase CI could correspond to DNA polymerase beta. PMID:7906418
-
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2012-11-01
Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro
Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi
2012-01-01
Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263
-
Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong
2016-08-01
Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa.
-
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
-
Palm Mutants in DNA Polymerases α and η Alter DNA Replication Fidelity and Translesion Activity
Niimi, Atsuko; Limsirichaikul, Siripan; Yoshida, Shonen; Iwai, Shigenori; Masutani, Chikahide; Hanaoka, Fumio; Kool, Eric T.; Nishiyama, Yukihiro; Suzuki, Motoshi
2004-01-01
We isolated active mutants in Saccharomyces cerevisiae DNA polymerase α that were associated with a defect in error discrimination. Among them, L868F DNA polymerase α has a spontaneous error frequency of 3 in 100 nucleotides and 570-fold lower replication fidelity than wild-type (WT) polymerase α. In vivo, mutant DNA polymerases confer a mutator phenotype and are synergistic with msh2 or msh6, suggesting that DNA polymerase α-dependent replication errors are recognized and repaired by mismatch repair. In vitro, L868F DNA polymerase α catalyzes efficient bypass of a cis-syn cyclobutane pyrimidine dimer, extending the 3′ T 26,000-fold more efficiently than the WT. Phe34 is equivalent to residue Leu868 in translesion DNA polymerase η, and the F34L mutant of S. cerevisiae DNA polymerase η has reduced translesion DNA synthesis activity in vitro. These data suggest that high-fidelity DNA synthesis by DNA polymerase α is required for genomic stability in yeast. The data also suggest that the phenylalanine and leucine residues in translesion and replicative DNA polymerases, respectively, might have played a role in the functional evolution of these enzyme classes. PMID:15024063
-
Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases
2015-01-01
The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and allow for efficient lesion bypass. Their promiscuous active sites, however, also lead to fidelities that are much lower than those observed for other DNA polymerases and give rise to interesting mechanistic properties. Additionally, the Y-family DNA polymerases have several other unique structural features and undergo a set of conformational changes during substrate binding and catalysis different from those observed for replicative DNA polymerases. In recent years, pre-steady-state kinetic methods have been extensively employed to reveal a wealth of information about the catalytic properties of these fascinating noncanonical DNA polymerases. Here, we review many of the recent findings on the kinetic mechanisms of DNA polymerization with undamaged and damaged DNA substrates by the Y-family DNA polymerases, and the conformational dynamics employed by these error-prone enzymes during catalysis. PMID:24716482
-
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
-
Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2012-01-01
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201
-
Family A and B DNA Polymerases in Cancer: Opportunities for Therapeutic Interventions
Shanbhag, Vinit; Sachdev, Shrikesh; Flores, Jacqueline A.; Modak, Mukund J.; Singh, Kamalendra
2018-01-01
DNA polymerases are essential for genome replication, DNA repair and translesion DNA synthesis (TLS). Broadly, these enzymes belong to two groups: replicative and non-replicative DNA polymerases. A considerable body of data suggests that both groups of DNA polymerases are associated with cancer. Many mutations in cancer cells are either the result of error-prone DNA synthesis by non-replicative polymerases, or the inability of replicative DNA polymerases to proofread mismatched nucleotides due to mutations in 3′-5′ exonuclease activity. Moreover, non-replicative, TLS-capable DNA polymerases can negatively impact cancer treatment by synthesizing DNA past lesions generated from treatments such as cisplatin, oxaliplatin, etoposide, bleomycin, and radiotherapy. Hence, the inhibition of DNA polymerases in tumor cells has the potential to enhance treatment outcomes. Here, we review the association of DNA polymerases in cancer from the A and B families, which participate in lesion bypass, and conduct gene replication. We also discuss possible therapeutic interventions that could be used to maneuver the role of these enzymes in tumorigenesis. PMID:29301327
-
Belotserkovskii, Boris P; Hanawalt, Philip C
2015-11-01
Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.
-
Bridge, Julia A
2017-01-01
The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.
-
Dutta, Arijit; Yang, Chunying; Sengupta, Shiladitya; Mitra, Sankar; Hegde, Muralidhar L
2015-05-01
Oxidized bases in the mammalian genome, which are invariably mutagenic due to their mispairing property, are continuously induced by endogenous reactive oxygen species and more abundantly after oxidative stress. Unlike bulky base adducts induced by UV and other environmental mutagens in the genome that block replicative DNA polymerases, oxidatively damaged bases such as 5-hydroxyuracil, produced by oxidative deamination of cytosine in the template strand, do not block replicative polymerases and thus need to be repaired prior to replication to prevent mutation. Following up our earlier studies, which showed that the Nei endonuclease VIII like 1 (NEIL1) DNA glycosylase, one of the five base excision repair (BER)-initiating enzymes in mammalian cells, has enhanced expression during the S-phase and higher affinity for replication fork-mimicking single-stranded (ss) DNA substrates, we recently provided direct experimental evidence for NEIL1's role in replicating template strand repair. The key requirement for this event, which we named as the 'cow-catcher' mechanism of pre-replicative BER, is NEIL1's non-productive binding (substrate binding without product formation) to the lesion base in ss DNA template to stall DNA synthesis, causing fork regression. Repair of the lesion in reannealed duplex is then carried out by NEIL1 in association with the DNA replication proteins. NEIL1 (and other BER-initiating enzymes) also interact with several accessory and non-canonical proteins including the heterogeneous nuclear ribonucleoprotein U and Y-box-binding protein 1 as well as high mobility group box 1 protein, whose precise roles in BER are still obscure. In this review, we have discussed the recent advances in our understanding of oxidative genome damage repair pathways with particular focus on the pre-replicative template strand repair and the role of scaffold factors like X-ray repairs cross-complementing protein 1 and poly (ADP-ribose) polymerase 1 and other accessory proteins guiding distinct BER sub-pathways.
-
Chung, Suhman; Himmel, Daniel M.; Jiang, Jian-Kang; Wojtak, Krzysztof; Bauman, Joseph D.; Rausch, Jason W.; Wilson, Jennifer A.; Beutler, John A.; Thomas, Craig J.; Arnold, Eddy; Le Grice, Stuart F.J.
2011-01-01
The α-hydroxytroplone, manicol (5,7-dihydroxy-2-isopropenyl-9-methyl-1,2,3,4-tetrahydro-benzocyclohepten-6-one) potently and specifically inhibits ribonuclease H (RNase H) activity of human immunodeficiency virus reverse transcriptase (HIV RT) in vitro. However, manicol was ineffective in reducing virus replication in culture. Ongoing efforts to improve the potency and specificity over the lead compound led us to synthesize 14 manicol derivatives that retain the divalent metal-chelating α-hydroxytropolone pharmacophore. These efforts were augmented by a high resolution structure of p66/p51 HIV-1 RT containing the nonnucleoside reverse transcriptase inhibitor (NNRTI), TMC278 and manicol in the DNA polymerase and RNase H active sites, respectively. We demonstrate here that several modified α-hydroxytropolones exhibit antiviral activity at non-cytotoxic concentrations. Inclusion of RNase H active site mutants indicated that manicol analogs can occupy an additional site in or around the DNA polymerase catalytic center. Collectively, our studies will promote future structure-based design of improved α-hydroxytropolones to complement the NRTI and NNRTI currently in clinical use. PMID:21568335
-
DNA polymerase having modified nucleotide binding site for DNA sequencing
Tabor, Stanley; Richardson, Charles
1997-01-01
Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.
-
King, Brenee S.; Cooper, Karen L.; Liu, Ke Jian; Hudson, Laurie G.
2012-01-01
Exposure to ultraviolet radiation (UVR) promotes the formation of UVR-induced, DNA helix distorting photolesions such as (6-4) pyrimidine-pyrimidone photoproducts and cyclobutane pyrimidine dimers. Effective repair of such lesions by the nucleotide excision repair (NER) pathway is required to prevent DNA mutations and chromosome aberrations. Poly(ADP-ribose) polymerase-1 (PARP-1) is a zinc finger protein with well documented involvement in base excision repair. PARP-1 is activated in response to DNA damage and catalyzes the formation of poly(ADP-ribose) subunits that assist in the assembly of DNA repair proteins at sites of damage. In this study, we present evidence for PARP-1 contributions to NER, extending the knowledge of PARP-1 function in DNA repair beyond the established role in base excision repair. Silencing the PARP-1 protein or inhibiting PARP activity leads to retention of UVR-induced photolesions. PARP activation following UVR exposure promotes association between PARP-1 and XPA, a central protein in NER. Administration of PARP inhibitors confirms that poly(ADP-ribose) facilitates PARP-1 association with XPA in whole cell extracts, in isolated chromatin complexes, and in vitro. Furthermore, inhibition of PARP activity decreases UVR-stimulated XPA chromatin association, illustrating that these relationships occur in a meaningful context for NER. These results provide a mechanistic link for PARP activity in the repair of UVR-induced photoproducts. PMID:23038248
-
Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L
2008-10-04
Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.
-
Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L
2008-01-01
Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537
-
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Insdorf, N.F.; Bogenhagen, D.F.
1989-12-25
DNA polymerase gamma has been purified over 10,000-fold from mitochondria of Xenopus laevis ovaries. We have developed a novel technique which specifically photolabels DNA polymerases. This procedure, the DNA polymerase trap, was used to identify a catalytic subunit of 140,000 Da from X. laevis DNA polymerase gamma. Additional catalytically active polypeptides of 100,000 and 55,000 Da were identified in the highly purified enzyme. These appear to be products of degradation of the 140,000-Da subunit. The DNA polymerase trap, which does not require large amounts of enzyme or renaturation from sodium dodecyl sulfate, is an alternative to the classic activity gel.
-
New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2
Price, Alan R.; Cook, Sandra J.
1972-01-01
The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224
-
Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.
Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C
2017-03-21
A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.
-
DNA polymerase having modified nucleotide binding site for DNA sequencing
Tabor, S.; Richardson, C.
1997-03-25
A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.
-
Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes
Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas
2014-01-01
The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089
-
2011-01-01
Y-family DNA polymerases are characterized by low-fidelity synthesis on undamaged DNA and ability to catalyze translesion synthesis over the damaged DNA. Their translocation along the DNA template is an important event during processive DNA synthesis. In this work we present a Brownian ratchet model for this translocation, where the directed translocation is rectified by the nucleotide binding to the polymerase. Using the model, different features of the available structures for Dpo4, Dbh and polymerase ι in binary and ternary forms can be easily explained. Other dynamic properties of the Y-family polymerases such as the fast translocation event upon dNTP binding for Dpo4 and the considerable variations of the processivity among the polymerases can also be well explained by using the model. In addition, some predicted results of the DNA synthesis rate versus the external force acting on Dpo4 and Dbh polymerases are presented. Moreover, we compare the effect of the external force on the DNA synthesis rate of the Y-family polymerase with that of the replicative DNA polymerase. PMID:21699732
-
Lee, Young-Sam; Gregory, Mark T.; Yang, Wei
2014-01-01
DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3–Rev7–PolD2–PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3–Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3′ guanine and Pol ζ4 to extend the primers. PMID:24449906
-
Lee, Young-Sam; Gregory, Mark T; Yang, Wei
2014-02-25
DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3-Rev7-PolD2-PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3-Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3' guanine and Pol ζ4 to extend the primers.
-
Human DNA polymerase η accommodates RNA for strand extension.
Su, Yan; Egli, Martin; Guengerich, F Peter
2017-11-03
Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Lin, Chang-Shen; Chiou, Wen-Yen; Lee, Ka-Wo; Chen, Tzu-Fen; Lin, Yuan-Jen; Huang, Jau-Ling
2016-01-01
DNA repair genes play critical roles in response to carcinogen-induced and anticancer therapy-induced DNA damage. Benzo[a]pyrene (BaP), the most carcinogenic polycyclic aromatic hydrocarbon (PAH), is classified as a group 1 carcinogen by International Agency for Research on Cancer. The aims of this study were to (1) evaluate the effects of BaP on DNA repair activity and expression of DNA repair genes in vitro and (2) examine the role of xeroderma pigmentosum, complementation group D (XPD) mRNA expression in human head and neck cancers. Host cell reactivation assay showed that BaP inhibited nucleotide excision repair in H1299 lung cancer cells. DNA repair through the non-homologous end-joining pathway was not affected by BaP. Real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) and Western blot demonstrated that XPD was downregulated by BaP treatment. BaP exposure did not apparently affect expression of another 11 DNA repair genes. BaP treatment increased the DNA damage marker γ-H2AX and ultraviolet (UV) sensitivity, supporting an impairment of DNA repair in BaP-treated cells. XPD expression was also examined by quantitative RT-PCR in 68 head and neck cancers, and a lower XPD mRNA level was found in smokers' cancer specimens. Importantly, reduced XPD expression was correlated with patient 5-year overall survival rate (35 vs. 56%) and was an independent prognostic factor (hazard ratio: 2.27). Data demonstrated that XPD downregulation was correlated with BaP exposure and human head and neck cancer survival.
-
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C
2009-10-30
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.
-
Real-time monitoring of rolling-circle amplification using a modified molecular beacon design
Nilsson, Mats; Gullberg, Mats; Dahl, Fredrik; Szuhai, Karoly; Raap, Anton K.
2002-01-01
We describe a method to monitor rolling-circle replication of circular oligonucleotides in dual-color and in real-time using molecular beacons. The method can be used to study the kinetics of the polymerization reaction and to amplify and quantify circularized oligonucleotide probes in a rolling-circle amplification (RCA) reaction. Modified molecular beacons were made of 2′-O-Me-RNA to prevent 3′ exonucleolytic degradation by the polymerase used. Moreover, the complement of one of the stem sequences of the molecular beacon was included in the RCA products to avoid fluorescence quenching due to inter-molecular hybridization of neighboring molecular beacons hybridizing to the concatemeric polymerization product. The method allows highly accurate quantification of circularized DNA over a broad concentration range by relating the signal from the test DNA circle to an internal reference DNA circle reporting in a distinct fluorescence color. PMID:12136114
-
Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases
Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2002-01-01
Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475
-
NASA Astrophysics Data System (ADS)
Miles, Jeff; Formosa, Tim
1992-02-01
We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.
-
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-01-01
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618
-
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-07-14
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
-
General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.
Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun
2018-02-19
DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Earl, P L; Jones, E V; Moss, B
1986-01-01
A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524
-
Seco, Elena M.
2017-01-01
Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448
-
Repair of Clustered Damage and DNA Polymerase Iota.
Belousova, E A; Lavrik, O I
2015-08-01
Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.
-
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.
2009-01-01
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688
-
DNA synthesis involving a complexes form of DNA polymerase I in extracts of Escherichia coli.
Hendler, R W; Pereira, M; Scharff, R
1975-01-01
DNA polymerase I (EC 2.7.7.7; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase) has been recovered as a complex of about 390,000 molecular weight. The complex displays an ATP-stimulated DNA-synthesizing activity that prefers native to heat-denatured DNA. Genetic evidence indicates that the recBC enzyme is associated with the polymerase in the complex. Preliminary evidence for complexes involving DNA polymerases II and III is also presented. PMID:1094453
-
Structure of human DNA polymerase iota and the mechanism of DNA synthesis.
Makarova, A V; Kulbachinskiy, A V
2012-06-01
Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.
-
[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].
D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V
1980-11-01
A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.
-
Effect of pH on the Misincorporation Rate of DNA Polymerase η.
Nishimoto, Naomi; Suzuki, Motoshi; Izuta, Shunji
2016-01-01
The many known eukaryotic DNA polymerases are classified into four families; A, B, X, and Y. Among them, DNA polymerase η, a Y family polymerase, is a low fidelity enzyme that contributes to translesional synthesis and somatic hypermutation. Although a high mutation frequency is observed in immunoglobulin genes, translesional synthesis occurs with a high accuracy. We determined whether the misincorporation rate of DNA polymerase η varies with ambient conditions. It has been reported that DNA polymerase η is unable to exclude water molecules from the active site. This finding suggests that some ions affect hydrogen bond formation at the active site. We focused on the effect of pH and evaluated the misincorporation rate of deoxyguanosine triphosphate (dGTP) opposite template T by DNA polymerase η at various pH levels with a synthetic template-primer. The misincorporation rate of dGTP by DNA polymerase η drastically increased at pH 8.0-9.0 compared with that at pH 6.5-7.5. Kinetic analysis revealed that the Km value for dGTP on the misincorporation opposite template T was markedly affected by pH. However, this drastic change was not seen with the low fidelity DNA polymerase α.
-
Wardle, Josephine; Burgers, Peter M J; Cann, Isaac K O; Darley, Kate; Heslop, Pauline; Johansson, Erik; Lin, Li-Jung; McGlynn, Peter; Sanvoisin, Jonathan; Stith, Carrie M; Connolly, Bernard A
2008-02-01
Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.
-
DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride.
Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A
1980-06-01
Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.
-
Human DNA polymerase θ grasps the primer terminus to mediate DNA repair
Zahn, Karl E.; Averill, April M.; Aller, Pierre; ...
2015-03-16
DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less
-
Laquel, P.; Litvak, S.; Castroviejo, M.
1994-01-01
DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187
-
DNA Polymerase Eta and Chemotherapeutic Agents
2011-01-01
Abstract The discovery of human DNA polymerase eta (pol η) has a major impact on the fields of DNA replication/repair fields. Since the discovery of human pol η, a number of new DNA polymerases with the ability to bypass various DNA lesions have been discovered. Among these polymerases, pol η is the most extensively studied lesion bypass polymerase with a defined major biological function, that is, to replicate across the cyclobutane pyrimidine dimers introduced by UV irradiation. Cyclobutane pyrimidine dimer is a major DNA lesion that causes distortion of DNA structure and block the replicative DNA polymerases during DNA replication process. Genetic defects in the pol η gene, Rad30, results in a disease called xeroderma pigmentosum variant. This review focuses on the overall properties of pol η and the mechanism that involved in regulating its activity in cells. In addition, the role of pol η in the action of DNA-targeting anticancer compounds is also discussed. Antioxid. Redox Signal. 14, 2521–2529. PMID:21050139
-
Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.; Mead, David A.
2016-01-01
Here we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharides except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles. PMID:28066333
-
Rojas, Diego A; Urbina, Fabiola; Moreira-Ramos, Sandra; Castillo, Christian; Kemmerling, Ulrike; Lapier, Michel; Maya, Juan Diego; Solari, Aldo; Maldonado, Edio
2018-02-01
Trypanosoma cruzi is exposed during its life to exogenous and endogenous oxidative stress, leading to damage of several macromolecules such as DNA. There are many DNA repair pathways in the nucleus and mitochondria (kinetoplast), where specific protein complexes detect and eliminate damage to DNA. One group of these proteins is the DNA polymerases. In particular, Tc DNA polymerase β participates in kinetoplast DNA replication and repair. However, the mechanisms which control its expression under oxidative stress are still unknown. Here we describe the effect of oxidative stress on the expression and function of Tc DNA polymerase β To this end parasite cells (epimastigotes and trypomastigotes) were exposed to peroxide during short periods of time. Tc DNA polymerase β which was associated physically with kinetoplast DNA, showed increased protein levels in response to peroxide damage in both parasite forms analyzed. Two forms of DNA polymerase β were identified and overexpressed after peroxide treatment. One of them was phosphorylated and active in DNA synthesis after renaturation on polyacrylamide electrophoresis gel. This phosphorylated form showed 3-4-fold increase in both parasite forms. Our findings indicate that these increments in protein levels are not under transcriptional control because the level of Tc DNA polymerase β mRNA is maintained or slightly decreased during the exposure to oxidative stress. We propose a mechanism where a DNA repair pathway activates a cascade leading to the increment of expression and phosphorylation of Tc DNA polymerase β in response to oxidative damage, which is discussed in the context of what is known in other trypanosomes which lack transcriptional control.
-
Djachenko, A G; Lapin, B A
1981-01-01
A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.
-
NASA Technical Reports Server (NTRS)
Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.
1999-01-01
Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.
-
A Polymerase With Potential: The Fe-S Cluster in Human DNA Primase.
Holt, Marilyn E; Salay, Lauren E; Chazin, Walter J
2017-01-01
Replication of DNA in eukaryotes is primarily executed by the combined action of processive DNA polymerases δ and ɛ. These enzymes cannot initiate synthesis of new DNA without the presence of a primer on the template ssDNA. The primers on both the leading and lagging strands are generated by DNA polymerase α-primase (pol-prim). DNA primase is a DNA-dependent RNA polymerase that synthesizes the first ~10 nucleotides and then transfers the substrate to polymerase α to complete primer synthesis. The mechanisms governing the coordination and handoff between primase and polymerase α are largely unknown. Isolated DNA primase contains a [4Fe-4S] 2+ cluster that has been shown to serve as a redox switch modulating DNA binding affinity. This discovery suggests a mechanism for modulating the priming activity of primase and handoff to polymerase α. In this chapter, we briefly discuss the current state of knowledge of primase structure and function, including the role of its iron-sulfur cluster. This is followed by providing the methods for expressing, purifying, and biophysically/structurally characterizing primase and its iron-sulfur cluster-containing domain, p58C. © 2017 Elsevier Inc. All rights reserved.
-
Lee, M Y; Whyte, W A
1984-05-01
The use of 5'-AMP as a ligand for the affinity chromatography of DNA polymerases with intrinsic 3' to 5' exonuclease activities was investigated. The basis for this is that 5'-AMP would be expected to act as a ligand for the associated 3' to 5' exonuclease. The requirements for binding of Escherichia coli DNA polymerase I, T4 DNA polymerase, and calf thymus DNA polymerase delta, all of which have associated 3' to 5' exonuclease activities, to several commercially available 5'-AMP supports with different linkages of 5'-AMP to either agarose or cellulose were examined. The DNA polymerases which possessed 3' to 5' exonuclease activities were bound to agarose types in which the 5'-phosphoryl group and the 3'-hydroxyl group of the AMP were unsubstituted. Bound enzyme could be eluted by either an increase in ionic strength or competitive binding of nucleoside 5'-monophosphates. Magnesium was found to reinforce the binding of the enzyme to these affinity supports. DNA polymerase alpha, which does not have an associated 3' to 5' exonuclease activity, did not bind to any of these columns. These differences can be used to advantage for the purification of DNA polymerases that have associated 3' to 5' exonuclease activities, as well as a means for establishing the association of 3' to 5' exonuclease activities with DNA polymerases.
-
Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.
Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J
2011-08-01
DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.
-
Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently
Yu, Chuanhe; Gan, Haiyun
2017-01-01
ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720
-
Bypass of a Nick by the Replisome of Bacteriophage T7*
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2011-01-01
DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase·polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick. PMID:21701044
-
Bypass of a nick by the replisome of bacteriophage T7.
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C
2011-08-12
DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase · polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heltzel, J.; Scouten Ponticelli, S; Sanders, L
2009-01-01
Sliding clamp proteins topologically encircle DNA and play vital roles in coordinating the actions of various DNA replication, repair, and damage tolerance proteins. At least three distinct surfaces of the Escherichia coli {beta} clamp interact physically with the DNA that it topologically encircles. We utilized mutant {beta} clamp proteins bearing G66E and G174A substitutions ({beta}159), affecting the single-stranded DNA-binding region, or poly-Ala substitutions in place of residues 148-HQDVR-152 ({beta}148-152), affecting the double-stranded DNA binding region, to determine the biological relevance of clamp-DNA interactions. As part of this work, we solved the X-ray crystal structure of {beta}148-152, which verified that themore » poly-Ala substitutions failed to significantly alter the tertiary structure of the clamp. Based on functional assays, both {beta}159 and {beta}148-152 were impaired for loading and retention on a linear primed DNA in vitro. In the case of {beta}148-152, this defect was not due to altered interactions with the DnaX clamp loader, but rather was the result of impaired {beta}148-152-DNA interactions. Once loaded, {beta}148-152 was proficient for DNA polymerase III (Pol III) replication in vitro. In contrast, {beta}148-152 was severely impaired for Pol II and Pol IV replication and was similarly impaired for direct physical interactions with these Pols. Despite its ability to support Pol III replication in vitro, {beta}148-152 was unable to support viability of E. coli. Nevertheless, physiological levels of {beta}148-152 expressed from a plasmid efficiently complemented the temperature-sensitive growth phenotype of a strain expressing {beta}159 (dnaN159), provided that Pol II and Pol IV were inactivated. Although this strain was impaired for Pol V-dependent mutagenesis, inactivation of Pol II and Pol IV restored the Pol V mutator phenotype. Taken together, these results support a model in which a sophisticated combination of competitive clamp-DNA, clamp-partner, and partner-DNA interactions serve to manage the actions of the different E. coli Pols in vivo.« less
-
Moreira-Ramos, Sandra; Castillo, Christian; Kemmerling, Ulrike; Lapier, Michel; Maya, Juan Diego; Solari, Aldo
2018-01-01
Trypanosoma cruzi is exposed during its life to exogenous and endogenous oxidative stress, leading to damage of several macromolecules such as DNA. There are many DNA repair pathways in the nucleus and mitochondria (kinetoplast), where specific protein complexes detect and eliminate damage to DNA. One group of these proteins is the DNA polymerases. In particular, Tc DNA polymerase β participates in kinetoplast DNA replication and repair. However, the mechanisms which control its expression under oxidative stress are still unknown. Here we describe the effect of oxidative stress on the expression and function of Tc DNA polymerase β To this end parasite cells (epimastigotes and trypomastigotes) were exposed to peroxide during short periods of time. Tc DNA polymerase β which was associated physically with kinetoplast DNA, showed increased protein levels in response to peroxide damage in both parasite forms analyzed. Two forms of DNA polymerase β were identified and overexpressed after peroxide treatment. One of them was phosphorylated and active in DNA synthesis after renaturation on polyacrylamide electrophoresis gel. This phosphorylated form showed 3-4-fold increase in both parasite forms. Our findings indicate that these increments in protein levels are not under transcriptional control because the level of Tc DNA polymerase β mRNA is maintained or slightly decreased during the exposure to oxidative stress. We propose a mechanism where a DNA repair pathway activates a cascade leading to the increment of expression and phosphorylation of Tc DNA polymerase β in response to oxidative damage, which is discussed in the context of what is known in other trypanosomes which lack transcriptional control. PMID:29432450
-
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...
2017-01-03
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
-
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wallen, Jamie R.; Zhang, Hao; Weis, Caroline
The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
-
Cloning of the altered mRNA stability (ams) gene of Escherichia coli K-12.
Claverie-Martin, F; Diaz-Torres, M R; Yancey, S D; Kushner, S R
1989-01-01
A temperature-sensitive mutation in the ams gene of Escherichia coli causes an increase in the chemical half-life of pulse-labeled RNA at the nonpermissive temperature. Using lambda clones containing DNA fragments from the 23- to 24-min region on the E. coli chromosome, we have isolated a 5.8-kilobase DNA fragment which, when present in a low-copy-number plasmid, complements the conditional lethality and increased mRNA stability associated with the ams-1 mutation. The approximate initiation site and the direction of transcription of the ams gene were determined from the size of truncated polypeptides produced by Tn1000 insertions and Bal 31 deletions. Overexpression of the ams locus by using a T7 RNA polymerase-promoter system permitted the identification of an ams-encoded polypeptide of 110 kilodaltons. Images PMID:2477358
-
Waqar, M A; Evans, M J; Huberman, J A
1978-01-01
We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840
-
Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication
Lapenta, Fabio; Montón Silva, Alejandro; Brandimarti, Renato; Lanzi, Massimiliano; Gratani, Fabio Lino; Vellosillo Gonzalez, Perceval; Perticarari, Sofia; Hochkoeppler, Alejandro
2016-01-01
DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP) domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics. PMID:27050298
-
Tubeleviciute, Agne; Skirgaila, Remigijus
2010-08-01
The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.
-
Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi
2008-08-01
In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.
-
Role of the C-terminal residue of the DNA polymerase of bacteriophage T7.
Kumar, J K; Tabor, S; Richardson, C C
2001-09-14
The crystal structure of the DNA polymerase encoded by gene 5 of bacteriophage T7, in a complex with its processivity factor, Escherichia coli thioredoxin, a primer-template, and an incoming deoxynucleoside triphosphate reveals a putative hydrogen bond between the C-terminal residue, histidine 704 of gene 5 protein, and an oxygen atom on the penultimate phosphate diester of the primer strand. Elimination of this electrostatic interaction by replacing His(704) with alanine renders the phage nonviable, and no DNA synthesis is observed in vivo. Polymerase activity of the genetically altered enzyme on primed M13 DNA is only 12% of the wild-type enzyme, and its processivity is drastically reduced. Kinetic parameters for binding a primer-template (K(D)(app)), nucleotide binding (K(m)), and k(off) for dissociation of the altered polymerase from a primer-template are not significantly different from that of wild-type T7 DNA polymerase. However, the decrease in polymerase activity is concomitant with increased hydrolytic activity, judging from the turnover of nucleoside triphosphate into the corresponding nucleoside monophosphate (percentage of turnover, 65%) during DNA synthesis. Biochemical data along with structural observations imply that the terminal amino acid residue of T7 DNA polymerase plays a critical role in partitioning DNA between the polymerase and exonuclease sites.
-
Qi, Yonghe; Gao, Zhenchao; Peng, Bo; Yan, Huan; Tang, Dingbin; Song, Zilin; He, Wenhui; Sun, Yinyan; Guo, Ju-Tao; Li, Wenhui
2016-01-01
Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV. PMID:27783675
-
Qi, Yonghe; Gao, Zhenchao; Xu, Guangwei; Peng, Bo; Liu, Chenxuan; Yan, Huan; Yao, Qiyan; Sun, Guoliang; Liu, Yang; Tang, Dingbin; Song, Zilin; He, Wenhui; Sun, Yinyan; Guo, Ju-Tao; Li, Wenhui
2016-10-01
Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.
-
Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori
2016-08-01
On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
-
DNA Polymerase in Virions of a Reptilian Type C Virus
Twardzik, Daniel R.; Papas, Takis S.; Portugal, Frank H.
1974-01-01
A study was made of the DNA polymerase of reptilian type C virus isolated from Russell's viper spleen cells. Simultaneous detection experiments demonstrated the presence of 70S RNA and RNA-dependent DNA polymerase activity in reptilian type C virions. The endogenous activity was dependent on the addition of all four deoxynucleotide triphosphates and demonstrated an absolute requirement for a divalent cation. The reptilian viral DNA polymerase elutes from phosphocellulose at 0.22 M salt. In this respect, it is similar to the avian (avian myeloblastosis virus; AMV) viral enzyme but is different from the mammalian (Rauscher leukemia virus; RLV) viral enzyme which elutes at 0.4 M salt. The molecular weight of the viper DNA polymerase as estimated from glycerol gradient centrifugation is 109,000. It is a smaller enzyme than the AMV DNA polymerase (180,000 daltons) and somewhat larger than the RLV enzyme (70,000 daltons). A comparison of other properties of the type C reptilian DNA polymerase with the enzyme found in other type C oncogenic viruses is made. PMID:4129837
-
Independent Structural Domains in Paramyxovirus Polymerase Protein*
Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.
2012-01-01
All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662
-
Lee, Young-Sam; Lee, Sujin; Demeler, Borries; Molineux, Ian J.; Johnson, Kenneth A.; Yin, Y. Whitney
2010-01-01
The accessory protein polymerase (pol) γB of the human mitochondrial DNA polymerase stimulates the synthetic activity of the catalytic subunit. pol γB functions by both accelerating the polymerization rate and enhancing polymerase-DNA interaction, thereby distinguishing itself from the accessory subunits of other DNA polymerases. The molecular basis for the unique functions of human pol γB lies in its dimeric structure, where the pol γB monomer proximal to pol γA in the holoenzyme strengthens the interaction with DNA, and the distal pol γB monomer accelerates the reaction rate. We further show that human pol γB exhibits a catalytic subunit- and substrate DNA-dependent dimerization. By duplicating the monomeric pol γB of lower eukaryotes, the dimeric mammalian proteins confer additional processivity to the holoenzyme polymerase. PMID:19858216
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zahn, Karl E.; Averill, April M.; Aller, Pierre
DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less
-
Isolation and characterization of high affinity aptamers against DNA polymerase iota.
Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V
2012-02-01
Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.
-
Leem, S H; Ropp, P A; Sugino, A
1994-08-11
We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.
-
Aydin, A Fatih; Aydıngöz, İkbal Esen; Doğru-Abbasoğlu, Semra; Vural, Pervin; Uysal, Müjdat
2017-01-01
Oxidative stress and increased DNA damage have been implicated in the etiopathogenesis of vitiligo. Oxidative DNA damage is mainly repaired by the base excision repair (BER) pathway. We sought to determine whether polymorphisms in DNA repair genes may have a role in the pathogenesis of vitiligo. We conducted a study including 100 patients with vitiligo and age- and sex-matched 193 control subjects to examine the role of single-nucleotide polymorphisms of BER genes, human 8-oxoG DNA N-glycosylase 1 (codon 326), apurinic/apyrimidinic endonuclease 1 (APE1) (codon 148), and X-ray repair cross-complementing group 1 (codon 399) as risk factors for vitiligo. These polymorphisms were determined by quantitative real-time polymerase chain reaction and melting curve analysis. No significant association was observed between the variant alleles of studied genes and vitiligo. However, we showed that the presence of APE1 148Glu variant allele is associated with leukotrichia. This preliminary study suggests that APE1 (codon 148) polymorphism may play a role in vitiligo pathogenesis.
-
McQuade, L R; Hill, R J; Francis, D
1994-01-01
B chromosomes, despite their common occurrence throughout the animal and plant kingdoms, have not been investigated extensively at the molecular level. While the majority of B chromosomes occurring in animals have been described as heterochromatic, only a few researchers have examined the DNA of these chromosomes beyond this gross cytological level. This is the case in the largest of the gliding marsupial possums, the greater glider, Petauroides volans. To examine the molecular composition and localization of B-chromosome DNA sequences in P. volans, a combination of micromanipulation and the polymerase chain reaction was used in this study to isolate and then amplify the DNA of the B chromosomes. Localization of the isolated B-chromosome sequences to metaphase chromosomes was investigated using fluorescence in situ hybridization. The B chromosomes in this species are shown to be composed of a heterogeneous mixture of sequences, some of which are unique to the B chromosomes, while others exhibit homology to the centromeric regions of the autosomal complement.
-
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
-
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
-
Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.
Frank, K B; Cheng, Y C
1986-02-05
Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.
-
Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai
2011-01-01
Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702
-
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
-
Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S
2011-01-21
DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.
Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva
2007-01-01
Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.
-
Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis.
Livneh, Zvi; Ziv, Omer; Shachar, Sigal
2010-02-15
The encounter of replication forks with DNA lesions may lead to fork arrest and/or the formation of single-stranded gaps. A major strategy to cope with these replication irregularities is translesion DNA synthesis (TLS), in which specialized error-prone DNA polymerases bypass the blocking lesions. Recent studies suggest that TLS across a particular DNA lesion may involve as many as four different TLS polymerases, acting in two-polymerase reactions in which insertion by a particular polymerase is followed by extension by another polymerase. Insertion determines the accuracy and mutagenic specificity of the TLS reaction, and is carried out by one of several polymerases such as poleta, polkappa or poliota. In contrast, extension is carried out primarily by polzeta. In cells from XPV patients, which are deficient in TLS across cyclobutane pyrimidine dimers (CPD) due to a deficiency in poleta, TLS is carried out by at least two backup reactions each involving two polymerases: One reaction involves polkappa and polzeta, and the other poliota and polzeta. These mechanisms may also assist poleta in normal cells under an excessive amount of UV lesions.
-
Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.; ...
2016-12-20
In this study we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharidesmore » except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brumm, Phillip J.; Gowda, Krishne; Robb, Frank T.
In this study we report the complete genome sequence of the chemoorganotrophic, extremely thermophilic bacterium, Dictyoglomus turgidum, which is a Gram negative, strictly anaerobic bacterium. D. turgidum and D. thermophilum together form the Dictyoglomi phylum. The two Dictyoglomus genomes are highly syntenic, and both are distantly related to Caldicellulosiruptor spp. D. turgidum is able to grow on a wide variety of polysaccharide substrates due to significant genomic commitment to glycosyl hydrolases, 16 of which were cloned and expressed in our study. The GH5, GH10, and GH42 enzymes characterized in this study suggest that D. turgidum can utilize most plant-based polysaccharidesmore » except crystalline cellulose. The DNA polymerase I enzyme was also expressed and characterized. The pure enzyme showed improved amplification of long PCR targets compared to Taq polymerase. The genome contains a full complement of DNA modifying enzymes, and an unusually high copy number (4) of a new, ancestral family of polB type nucleotidyltransferases designated as MNT (minimal nucleotidyltransferases). Considering its optimal growth at 72°C, D. turgidum has an anomalously low G+C content of 39.9% that may account for the presence of reverse gyrase, usually associated with hyperthermophiles.« less
-
Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc
2016-08-22
Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same 'double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs.
-
Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc
2016-01-01
Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same ‘double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs. PMID:27548043
-
DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.
Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele
2016-08-31
DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.
-
Sulfamoylbenzamide Derivatives Inhibit the Assembly of Hepatitis B Virus Nucleocapsids
Campagna, Matthew R.; Liu, Fei; Mao, Richeng; Mills, Courtney; Cai, Dawei; Guo, Fang; Zhao, Xuesen; Ye, Hong; Cuconati, Andrea; Guo, Haitao; Chang, Jinhong; Xu, Xiaodong; Block, Timothy M.
2013-01-01
Chronic hepatitis B virus (HBV) infection, a serious public health problem leading to cirrhosis and hepatocellular carcinoma, is currently treated with either pegylated alpha interferon (pegIFN-α) or one of the five nucleos(t)ide analogue viral DNA polymerase inhibitors. However, neither pegIFN-α nor nucleos(t)ide analogues are capable of reliably curing the viral infection. In order to develop novel antiviral drugs against HBV, we established a cell-based screening assay by using an immortalized mouse hepatocyte-derived stable cell line supporting a high level of HBV replication in a tetracycline-inducible manner. Screening of a library consisting of 26,900 small molecules led to the discovery of a series of sulfamoylbenzamide (SBA) derivatives that significantly reduced the amount of cytoplasmic HBV DNA. Structure-activity relationship studies have thus far identified a group of fluorine-substituted SBAs with submicromolar antiviral activity against HBV in human hepatoma cells. Mechanistic analyses reveal that the compounds dose dependently inhibit the formation of pregenomic RNA (pgRNA)-containing nucleocapsids of HBV but not other animal hepadnaviruses, such as woodchuck hepatitis virus (WHV) and duck hepatitis B virus (DHBV). Moreover, heterologous genetic complementation studies of capsid protein, DNA polymerase, and pgRNA between HBV and WHV suggest that HBV capsid protein confers sensitivity to the SBAs. In summary, SBAs represent a novel chemical entity with superior activity and a unique antiviral mechanism and are thus warranted for further development as novel antiviral therapeutics for the treatment of chronic hepatitis B. PMID:23576513
-
Wong, T C; Kang, C Y
1978-01-01
Chicken bone marrow cells transformed by reticuloendotheliosis virus (REV) produce in the cytoplasm a ribonucleoprotein (RNP) complex which has a sedimentation value of approximately 80 to 100S and a density of 1.23 g/cm3. This RNP complex is not derived from the mature virion. An endogenous RNA-directed DNA polymerase activity is associated with the RNP complex. The enzyme activity was completely neutralized by anti-REV DNA polymerase antibody but not by anti-avian myeloblastosis virus DNA polymerase antibody. The DNA product from the endogenous RNA-directed DNA polymerase reaction of the RNP complex hybridized to REV RNA but not to avian leukosis virus RNA. The RNA extracted from the RNP hybridized only to REV-specific complementary DNA synthesized from an endogenous DNA polymerase reaction of purified REV. The size of the RNA in the RNP is 30 to 35S, which represents the subunit size of the genomic RNA. No 60S mature genomic RNA was found within the RNP complex. The significance of finding the endogenous DNA polymerase activity in the viral RNP in infected cells and the maturation process of 60S virion RNA of REV are discussed. PMID:81319
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Mitra, S.
Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.
-
Ma, Emilie; Veaute, Xavier; Coïc, Eric
2017-01-01
Replicative DNA polymerases cannot insert efficiently nucleotides at sites of base lesions. This function is taken over by specialized translesion DNA synthesis (TLS) polymerases to allow DNA replication completion in the presence of DNA damage. In eukaryotes, Rad6- and Rad18-mediated PCNA ubiquitination at lysine 164 promotes recruitment of TLS polymerases, allowing cells to efficiently cope with DNA damage. However, several studies showed that TLS polymerases can be recruited also in the absence of PCNA ubiquitination. We hypothesized that the stability of the interactions between DNA polymerase δ (Pol δ) subunits and/or between Pol δ and PCNA at the primer/template junction is a crucial factor to determine the requirement of PCNA ubiquitination. To test this hypothesis, we used a structural mutant of Pol δ in which the interaction between Pol3 and Pol31 is inhibited. We found that in yeast, rad18Δ-associated UV hypersensitivity is suppressed by pol3-ct, a mutant allele of the POL3 gene that encodes the catalytic subunit of replicative Pol δ. pol3-ct suppressor effect was specifically dependent on the Rev1 and Pol ζ TLS polymerases. This result strongly suggests that TLS polymerases could rely much less on PCNA ubiquitination when Pol δ interaction with PCNA is partially compromised by mutations. In agreement with this model, we found that the pol3-FI allele suppressed rad18Δ-associated UV sensitivity as observed for pol3-ct. This POL3 allele carries mutations within a putative PCNA Interacting Peptide (PIP) motif. We then provided molecular and genetic evidence that this motif could contribute to Pol δ-PCNA interaction indirectly, although it is not a bona fide PIP. Overall, our results suggest that the primary role of PCNA ubiquitination is to allow TLS polymerases to outcompete Pol δ for PCNA access upon DNA damage. PMID:29281621
-
Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*
Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio
1971-01-01
In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548
-
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
2014-01-01
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
-
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
-
Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I
1990-03-25
The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.
-
Inhibition of RNA-Dependent DNA Polymerase of Avian Myeloblastosis Virus by Pyran Copolymer
Papas, Takis S.; Pry, Thomas W.; Chirigos, Michael A.
1974-01-01
Pyran copolymer, a known immunostimulator, was found to be a potent inhibitor of purified DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7) isolated from avian myeloblastosis virus. Unlike other inhibitors, pyran showed unique features of inhibition. It interacts with the polymerase at a region other than the template site. The inhibitory effect was overcome only by excess enzyme and not affected by excess template. The degree of inhibition was not template specific for the templates tested: 70S RNA from avian myeloblastosis virus, synthetic hybrid poly(rA)·oligo(dT)10, synthetic copolymer poly(dA-dT), and activated calf-thymus DNA. The observed rate of inhibition by pyran was shown to vary with the different polymerases tested. Inhibition was shown with all oncornaviral polymerases and, to a lesser extent, with mammalian polymerases. However, two of the three bacterial polymerases, by contrast, showed a marked activation. PMID:4131275
-
Mechanisms of mutagenesis: DNA replication in the presence of DNA damage
Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F. Peter; Zhang, Huidong
2017-01-01
Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, E. coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. PMID:27234563
-
Mechanisms of mutagenesis: DNA replication in the presence of DNA damage.
Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F Peter; Zhang, Huidong
2016-01-01
Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, Escherichia coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
B Akabayov; A Kulczyk; S Akabayov
2011-12-31
DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-Vmore » distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.« less
-
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
-
1988-10-03
DNA replication showed an average of 2.5 primers per M13 DNA circle. The measurement of the double stranded length from individual replicative intermediates by electron microscopy was within the accuracy of 10% standard deviation. The product length distribution obtained from the HSV-1 DNA polymerase catalyzed replication of M13 DNA primed with a specific pentadecamer and in the presence of E. Coli SSB protein showed a near Poisson distribution. Replication of the same primer-template system or DNA primase primed M13 DNA template by calf thymus DNA polymerase a showed a
-
High-fidelity DNA replication in Mycobacterium tuberculosis relies on a trinuclear zinc center.
Baños-Mateos, Soledad; van Roon, Anne-Marie M; Lang, Ulla F; Maslen, Sarah L; Skehel, J Mark; Lamers, Meindert H
2017-10-11
High-fidelity DNA replication depends on a proofreading 3'-5' exonuclease that is associated with the replicative DNA polymerase. The replicative DNA polymerase DnaE1 from the major pathogen Mycobacterium tuberculosis (Mtb) uses its intrinsic PHP-exonuclease that is distinct from the canonical DEDD exonucleases found in the Escherichia coli and eukaryotic replisomes. The mechanism of the PHP-exonuclease is not known. Here, we present the crystal structure of the Mtb DnaE1 polymerase. The PHP-exonuclease has a trinuclear zinc center, coordinated by nine conserved residues. Cryo-EM analysis reveals the entry path of the primer strand in the PHP-exonuclease active site. Furthermore, the PHP-exonuclease shows a striking similarity to E. coli endonuclease IV, which provides clues regarding the mechanism of action. Altogether, this work provides important insights into the PHP-exonuclease and reveals unique properties that make it an attractive target for novel anti-mycobacterial drugs.The polymerase and histidinol phosphatase (PHP) domain in the DNA polymerase DnaE1 is essential for mycobacterial high-fidelity DNA replication. Here, the authors determine the DnaE1 crystal structure, which reveals the PHP-exonuclease mechanism that can be exploited for antibiotic development.
-
Influence of PCR reagents on DNA polymerase extension rates measured on real-time PCR instruments.
Montgomery, Jesse L; Wittwer, Carl T
2014-02-01
Radioactive DNA polymerase activity methods are cumbersome and do not provide initial extension rates. A simple extension rate assay would enable study of basic assumptions about PCR and define the limits of rapid PCR. A continuous assay that monitors DNA polymerase extension using noncovalent DNA dyes on common real-time PCR instruments was developed. Extension rates were measured in nucleotides per second per molecule of polymerase. To initiate the reaction, a nucleotide analog was heat activated at 95 °C for 5 min, the temperature decreased to 75 °C, and fluorescence monitored until substrate exhaustion in 30-90 min. The assay was linear with time for over 40% of the reaction and for polymerase concentrations over a 100-fold range (1-100 pmol/L). Extension rates decreased continuously with increasing monovalent cation concentrations (lithium, sodium, potassium, cesium, and ammonium). Melting-temperature depressors had variable effects. DMSO increased rates up to 33%, whereas glycerol had little effect. Betaine, formamide, and 1,2-propanediol decreased rates with increasing concentrations. Four common noncovalent DNA dyes inhibited polymerase extension. Heat-activated nucleotide analogs were 92% activated after 5 min, and hot start DNA polymerases were 73%-90% activated after 20 min. Simple DNA extension rate assays can be performed on real-time PCR instruments. Activity is decreased by monovalent cations, DNA dyes, and most melting temperature depressors. Rational inclusion of PCR components on the basis of their effects on polymerase extension is likely to be useful in PCR, particularly rapid-cycle or fast PCR.
-
Structural insight into recruitment of translesion DNA polymerase Dpo4 to sliding clamp PCNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xing, G.; Kirouac, K.; Shin, Y.J.
2009-09-16
DNA polymerases are co-ordinated by sliding clamps (PCNA/{beta}-clamp) in translesion synthesis. It is unclear how these enzymes assemble on PCNA with geometric and functional compatibility. We report the crystal structure of a full-length Y-family polymerase, Dpo4, in complex with heterodimeric PCNA1-PCNA2 at 2.05 {angstrom} resolution. Dpo4 exhibits an extended conformation that differs from the Dpo4 structures in apo- or DNA-bound form. Two hinges have been identified in Dpo4, which render the multidomain polymerase flexible conformations and orientations relative to PCNA. Dpo4 binds specifically to PCNA1 on the conserved ligand binding site. The C-terminal peptide of Dpo4 becomes structured with amore » 3{sub 10} helix and dominates the specific binding. The Y-family polymerase also contacts PCNA1 with its finger, thumb and little finger domains, which are conformation-dependent protein-protein interactions that diversify the binding mode of Dpo4 on PCNA. The structure reveals a molecular model in which substrate/partner binding-coupled multiple conformations of a Y-family polymerase facilitate its recruitment and co-ordination on the sliding clamp. The conformational flexibility would turn the error-prone Y-family polymerase off when more efficient high-fidelity DNA polymerases work on undamaged DNA and turn it onto DNA templates to perform translesion synthesis when replication forks are stalled by DNA lesions.« less
-
Lesion bypass by S. cerevisiae Pol ζ alone
Stone, Jana E.; Kumar, Dinesh; Binz, Sara K.; Inase, Aki; Iwai, Shigenori; Chabes, Andrei; Burgers, Peter M.; Kunkel, Thomas A.
2011-01-01
DNA polymerase zeta (Pol ζ) participates in translesion synthesis (TLS) of DNA adducts that stall replication fork progression. Previous studies have led to the suggestion that the primary role of Pol ζ in TLS is to extend primers created when another DNA polymerase inserts nucleotides opposite lesions. Here we test the non-exclusive possibility that Pol ζ can sometimes perform TLS in the absence of any other polymerase. To do so, we quantified the efficiency with which S. cerevisiae Pol ζ bypasses abasic sites, cis-syn cyclobutane pyrimidine dimers and (6-4) photoproducts. In reactions containing dNTP concentrations that mimic those induced by DNA damage, a Pol ζ derivative with phenylalanine substituted for leucine 979 at the polymerase active site bypasses all three lesions at efficiencies between 27–73%. Wild-type Pol ζ also bypasses these lesions, with efficiencies that are lower and depend on the sequence context in which the lesion resides. The results are consistent with the hypothesis that, in addition to extending aberrant termini created by other DNA polymerases, Pol ζ has the potential to be the sole DNA polymerase involved in TLS. PMID:21622032
-
Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai
2010-01-01
Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853
-
Single molecular biology: coming of age in DNA replication.
Liu, Xiao-Jing; Lou, Hui-Qiang
2017-09-20
DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.
-
Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A
2013-06-13
Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.
-
The expanding polymerase universe.
Goodman, M F; Tippin, B
2000-11-01
Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.
-
Characterization of human translesion DNA synthesis across a UV-induced DNA lesion
Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J
2016-01-01
Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570
-
Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa
2005-01-01
Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.
-
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
-
A meiotic DNA polymerase from a mushroom, Agaricus bisporus.
Takami, K; Matsuda, S; Sono, A; Sakaguchi, K
1994-01-01
A meiotic DNA polymerase [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7], which likely has a role in meiotic DNA repair, was isolated from a mushroom, Agaricus bisporus. The purified fraction displays three bands in SDS/PAGE, at molecular masses of 72 kDa, 65 kDa and 36 kDa. Optimal activity is at pH 7.0-8.0 in the presence of 5 mM Mg2+ and 50 mM KCl and at 28-30 degrees C, which is the temperature for meiosis. This enzyme is resistant to N-ethylmaleimide and sensitive to 2',3'-dideoxythymidine 5'-triphosphate, suggesting that it is a beta-like DNA polymerase. These characteristics are similar to those of Coprinus DNA polymerase beta [Sakaguchi and Lu (1982) Mol. Cell. Biol. 2, 752-757]. In Western-blot analysis, the antiserum against the Coprinus polymerase reacts only with the 65 kDa band, which coincides with the molecular mass of the Coprinus polymerase. Western-blot analysis also showed that the antiserum could react with crude extracts not only from the Agaricales family, to which Agaricus and Coprinus belong, but also from different mushroom families and Saccharomyces. The Agaricus polymerase activity can be found only in the meiotic-cell-rich fraction, but the enzyme is also present in the somatic cells in an inactive state. Images Figure 2 Figure 5 Figure 6 PMID:8172591
-
Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong
2013-01-01
Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. PMID:23876706
-
Kirouac, Kevin N; Basu, Ashis K; Ling, Hong
2013-11-15
Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. © 2013.
-
DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase
Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F
2014-01-01
Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026
-
Yamamoto, Junpei; Loakes, David; Masutani, Chikahide; Simmyo, Shizu; Urabe, Kumiko; Hanaoka, Fumio; Holliger, Philipp; Iwai, Shigenori
2008-01-01
We analyzed the translesion synthesis across the UV-induced lesions, the (6-4) photoproduct and its Dewar valence isomer, by using human DNA polymerases eta and iota in vitro. The primer extension experiments revealed that pol eta tended to incorporate dG opposite the 3' component of both lesions, but the incorporation efficiency for the Dewar isomer was higher than that for the (6-4) photoproduct. On the other hand, pol iota was likely to incorporate dA opposite the 3' components of the (6-4) photoproduct and its Dewar isomer with a similar efficiency. Elongation after the incorporation opposite the UV lesions was not observed for these Y-family polymerases. We further analyzed the bypass ability of an engineered polymerase developed from Thermus DNA polymerase for the amplification of ancient DNA. This polymerase could bypass the Dewar isomer more efficiently than the (6-4) photoproduct.
-
Error-free versus mutagenic processing of genomic uracil--relevance to cancer.
Krokan, Hans E; Sætrom, Pål; Aas, Per Arne; Pettersen, Henrik Sahlin; Kavli, Bodil; Slupphaug, Geir
2014-07-01
Genomic uracil is normally processed essentially error-free by base excision repair (BER), with mismatch repair (MMR) as an apparent backup for U:G mismatches. Nuclear uracil-DNA glycosylase UNG2 is the major enzyme initiating BER of uracil of U:A pairs as well as U:G mismatches. Deficiency in UNG2 results in several-fold increases in genomic uracil in mammalian cells. Thus, the alternative uracil-removing glycosylases, SMUG1, TDG and MBD4 cannot efficiently complement UNG2-deficiency. A major function of SMUG1 is probably to remove 5-hydroxymethyluracil from DNA with general back-up for UNG2 as a minor function. TDG and MBD4 remove deamination products U or T mismatched to G in CpG/mCpG contexts, but may have equally or more important functions in development, epigenetics and gene regulation. Genomic uracil was previously thought to arise only from spontaneous cytosine deamination and incorporation of dUMP, generating U:G mismatches and U:A pairs, respectively. However, the identification of activation-induced cytidine deaminase (AID) and other APOBEC family members as DNA-cytosine deaminases has spurred renewed interest in the processing of genomic uracil. Importantly, AID triggers the adaptive immune response involving error-prone processing of U:G mismatches, but also contributes to B-cell lymphomagenesis. Furthermore, mutational signatures in a substantial fraction of other human cancers are consistent with APOBEC-induced mutagenesis, with U:G mismatches as prime suspects. Mutations can be caused by replicative polymerases copying uracil in U:G mismatches, or by translesion polymerases that insert incorrect bases opposite abasic sites after uracil-removal. In addition, kataegis, localized hypermutations in one strand in the vicinity of genomic rearrangements, requires APOBEC protein, UNG2 and translesion polymerase REV1. What mechanisms govern error-free versus error prone processing of uracil in DNA remains unclear. In conclusion, genomic uracil is an essential intermediate in adaptive immunity and innate antiviral responses, but may also be a fundamental cause of a wide range of malignancies. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
-
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.
-
5',5'''-P1, P4 diadenosine tetraphosphate (Ap4A): a putative initiator of DNA replication.
Baril, E F; Coughlin, S A; Zamecnik, P C
1985-01-01
The proposal that Ap4A acts as an inducer of DNA replication is based primarily on two pieces of evidence (7). The intracellular levels of Ap4A increase ten- to 1000-fold as cells progress into S phase and the introduction of Ap4A into nonproliferating cells stimulated DNA synthesis. There is also some additional suggestive evidence such as the binding of Ap4A to a protein that is associated with multiprotein forms of the replicative DNA polymerase alpha and the ability of this enzyme to use Ap4A as a primer for DNA synthesis in vitro with single-stranded DNA templates. These observations have stimulated interest in the cellular metabolism of Ap4A. This is well since there is a great need for additional experimentation in order to clearly establish Ap4A as an inducer of DNA replication. Microinjection experiments of Ap4A into quiescent cells are needed in order to ascertain if Ap4A will stimulate DNA replication and possibly cell division in intact cells. Studies of the effects of nonhydrolyzable analogs of Ap4A on DNA replication in intact quiescent cells could also prove valuable. Although Ap4A can function as a primer for in vitro DNA synthesis by DNA polymerase alpha this may not be relevant in regard to its in vivo role in DNA replication. Ap4A in vivo could interact with key protein(s) in DNA replication and in this way act as an effector molecule in the initiation of DNA replication. In this regard the interaction of Ap4A with a protein associated with a multiprotein form of DNA polymerase alpha isolated from S-phase cells is of interest. More experiments are required to determine if there is a specific target protein(s) for Ap4A in vivo and what its role in DNA replication is. The cofractionation of tryptophanyl-tRNA synthetase with the replicative DNA polymerase alpha from animal and plant cells is of interest. The DNA polymerase alpha from synchronized animal cells also interacted with Ap4A. Although the plant cell alpha-like DNA polymerase did not interact with Ap4A this DNA polymerase was not a multiprotein form of polymerase alpha and the synchrony of the wheat germ embryos was not known. A possible tie between protein-synthesizing systems and the regulation of proteins involved in DNA replication may exist. The requirement of protein synthesis for the initiation of DNA replication has long been known. Also, it is well established that many temperature-sensitive mutants for tRNA synthetases are also DNA-synthesizing mutants. More investigation in this area may be warranted.(ABSTRACT TRUNCATED AT 400 WORDS)
-
Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.
Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J
2015-05-26
DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Heat-mediated activation of affinity-immobilized Taq DNA polymerase.
Nilsson, J; Bosnes, M; Larsen, F; Nygren, P A; Uhlén, M; Lundeberg, J
1997-04-01
A novel strategy for heat-mediated activation of recombinant Taq DNA polymerase is described. A serum albumin binding protein tag is used to affinity-immobilize an E. coli-expressed Taq DNA polymerase fusion protein onto a solid support coated with human serum albumin (HSA). Analysis of heat-mediated elution showed that elevated temperatures (> 70 degrees C) were required to significantly release the fusion protein from the solid support. A primer-extension assay showed that immobilization of the fusion protein resulted in little or no extension product. In contrast, fusion protein released from the HSA ligand by heat showed high polymerase activity. Thus, a heat-mediated release and reactivation of the Taq DNA polymerase fusion protein from the solid support can be obtained to allow for hot-start PCR with improved amplification performance.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Ratrie, H. III; Datta, A.K.
E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less
-
Molecular Dynamics Study of the Opening Mechanism for DNA Polymerase I
Miller, Bill R.; Parish, Carol A.; Wu, Eugene Y.
2014-01-01
During DNA replication, DNA polymerases follow an induced fit mechanism in order to rapidly distinguish between correct and incorrect dNTP substrates. The dynamics of this process are crucial to the overall effectiveness of catalysis. Although X-ray crystal structures of DNA polymerase I with substrate dNTPs have revealed key structural states along the catalytic pathway, solution fluorescence studies indicate that those key states are populated in the absence of substrate. Herein, we report the first atomistic simulations showing the conformational changes between the closed, open, and ajar conformations of DNA polymerase I in the binary (enzyme∶DNA) state to better understand its dynamics. We have applied long time-scale, unbiased molecular dynamics to investigate the opening process of the fingers domain in the absence of substrate for B. stearothermophilis DNA polymerase in silico. These simulations are biologically and/or physiologically relevant as they shed light on the transitions between states in this important enzyme. All closed and ajar simulations successfully transitioned into the fully open conformation, which is known to be the dominant binary enzyme-DNA conformation from solution and crystallographic studies. Furthermore, we have detailed the key stages in the opening process starting from the open and ajar crystal structures, including the observation of a previously unknown key intermediate structure. Four backbone dihedrals were identified as important during the opening process, and their movements provide insight into the recognition of dNTP substrate molecules by the polymerase binary state. In addition to revealing the opening mechanism, this study also demonstrates our ability to study biological events of DNA polymerase using current computational methods without biasing the dynamics. PMID:25474643
-
Azevedo, Ana P; Silva, Susana N; De Lima, João P; Reichert, Alice; Lima, Fernando; Júnior, Esmeraldina; Rueff, José
2017-06-01
The role of base excision repair (BER) genes in Philadelphia-negative (PN)-myeloproliferative neoplasms (MPNs) susceptibility was evaluated by genotyping eight polymorphisms [apurinic/apyrimidinic endodeoxyribonuclease 1, mutY DNA glycosylase, earlier mutY homolog ( E. coli ) (MUTYH), 8-oxoguanine DNA glycosylase 1, poly (ADP-ribose) polymerase (PARP) 1, PARP4 and X-ray repair cross-complementing 1 (XRCC1)] in a case-control study involving 133 Caucasian Portuguese patients. The results did not reveal a correlation between individual BER polymorphisms and PN-MPNs when considered as a whole. However, stratification for essential thrombocythaemia revealed i) borderline effect/tendency to increased risk when carrying at least one variant allele for XRCC1_399 single-nucleotide polymorphism (SNP); ii) decreased risk for Janus kinase 2-positive patients carrying at least one variant allele for XRCC1_399 SNP; and iii) decreased risk in females carrying at least one variant allele for MUTYH SNP. Combination of alleles demonstrated an increased risk to PN-MPNs for one specific haplogroup. These findings may provide evidence for gene variants in susceptibility to MPNs. Indeed, common variants in DNA repair genes may hamper the capacity to repair DNA, thus increasing cancer susceptibility.
-
Azevedo, Ana P.; Silva, Susana N.; De Lima, João P.; Reichert, Alice; Lima, Fernando; Júnior, Esmeraldina; Rueff, José
2017-01-01
The role of base excision repair (BER) genes in Philadelphia-negative (PN)-myeloproliferative neoplasms (MPNs) susceptibility was evaluated by genotyping eight polymorphisms [apurinic/apyrimidinic endodeoxyribonuclease 1, mutY DNA glycosylase, earlier mutY homolog (E. coli) (MUTYH), 8-oxoguanine DNA glycosylase 1, poly (ADP-ribose) polymerase (PARP) 1, PARP4 and X-ray repair cross-complementing 1 (XRCC1)] in a case-control study involving 133 Caucasian Portuguese patients. The results did not reveal a correlation between individual BER polymorphisms and PN-MPNs when considered as a whole. However, stratification for essential thrombocythaemia revealed i) borderline effect/tendency to increased risk when carrying at least one variant allele for XRCC1_399 single-nucleotide polymorphism (SNP); ii) decreased risk for Janus kinase 2-positive patients carrying at least one variant allele for XRCC1_399 SNP; and iii) decreased risk in females carrying at least one variant allele for MUTYH SNP. Combination of alleles demonstrated an increased risk to PN-MPNs for one specific haplogroup. These findings may provide evidence for gene variants in susceptibility to MPNs. Indeed, common variants in DNA repair genes may hamper the capacity to repair DNA, thus increasing cancer susceptibility. PMID:28599464
-
T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures
Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca
2018-01-01
Abstract The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases. PMID:29718412
-
T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures.
Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca; Franco, Elisa
2018-06-01
The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases.
-
Synchronization of DNA array replication kinetics
NASA Astrophysics Data System (ADS)
Manturov, Alexey O.; Grigoryev, Anton V.
2016-04-01
In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.
-
Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.
Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L
2018-03-27
The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hogg, Matthew; Rudnicki, Jean; Midkiff, John
2010-04-12
The fidelity of DNA replication is under constant threat from the formation of lesions within the genome. Oxidation of DNA bases leads to the formation of altered DNA bases such as 8-oxo-7,8-dihydroguanine, commonly called 8-oxoG, and 2-hydroxyadenenine, or 2-OHA. In this work we have examined the incorporation kinetics opposite these two oxidatively derived lesions as well as an abasic site analogue by the replicative DNA polymerase from bacteriophage RB69. We compared the kinetic parameters for both wild type and the low fidelity L561A variant. While nucleotide incorporation rates (k{sub pol}) were generally higher for the variant, the presence of amore » lesion in the templating position reduced the ability of both the wild-type and variant DNA polymerases to form ternary enzyme-DNA-dNTP complexes. Thus, the L561A substitution does not significantly affect the ability of the RB69 DNA polymerase to recognize damaged DNA; instead, the mutation increases the probability that nucleotide incorporation will occur. We have also solved the crystal structure of the L561A variant forming an 8-oxoG {center_dot} dATP mispair and show that the propensity for forming this mispair depends on an enlarged polymerase active site.« less
-
Homouz, Dirar; Joyce-Tan, Kwee Hong; Shahir Shamsir, Mohd; Moustafa, Ibrahim M; Idriss, Haitham
2018-01-01
DNA polymerase β is a 39kDa enzyme that is a major component of Base Excision Repair in human cells. The enzyme comprises two major domains, a 31kDa domain responsible for the polymerase activity and an 8kDa domain, which bind ssDNA and has a deoxyribose phosphate (dRP) lyase activity. DNA polymerase β was shown to be phosphorylated in vitro with protein kinase C (PKC) at serines 44 and 55 (S44 and S55), resulting in loss of its polymerase enzymic activity, but not its ability to bind ssDNA. In this study, we investigate the potential phosphorylation-induced structural changes for DNA polymerase β using molecular dynamics. The simulations show drastic conformational changes of the polymerase structure as a result of S44 phosphorylation. Phosphorylation-induced conformational changes transform the closed (active) enzyme structure into an open one. Further analysis of the results points to a key hydrogen bond and newly formed salt bridges as potential drivers of these structural fluctuations. The changes observed with S44/55 and S55 phosphorylation were less dramatic than S44 and the integrity of the H-bond was not compromised. Thus the phosphorylation of S44 is likely the major contributor to structural fluctuations that lead to loss of enzymatic activity. Copyright © 2017. Published by Elsevier Inc.
-
Sergio, Luiz Philippe S; Campos, Vera Maria A; Vicentini, Solange C; Mencalha, Andre Luiz; de Paoli, Flavia; Fonseca, Adenilson S
2016-04-01
Lasers emit light beams with specific characteristics, in which wavelength, frequency, power, fluence, and emission mode properties determine the photophysical, photochemical, and photobiological responses. Low-intensity lasers could induce free radical generation in biological tissues and cause alterations in macromolecules, such as DNA. Thus, the aim of this work was to evaluate excision repair cross-complementing group 1 (ERCC1) and excision repair cross-complementing group 2 (ERCC2) messenger RNA (mRNA) expression in biological tissues exposed to low-intensity lasers. Wistar rat (n = 28, 4 for each group) skin and muscle were exposed to low-intensity red (660 nm) and near-infrared (880 nm) lasers at different fluences (25, 50, and 100 J/cm(2)), and samples of these tissues were withdrawn for RNA extraction, cDNA synthesis, and gene expression evaluation by quantitative polymerase chain reaction. Laser exposure was in continuous wave and power of 100 mW. Data show that ERCC1 and ERCC2 mRNA expressions decrease in skin (p < 0.001) exposed to near-infrared laser, but increase in muscle tissue (p < 0.001). ERCC1 mRNA expression does not alter (p > 0.05), but ERCC2 mRNA expression decreases in skin (p < 0.001) and increases in muscle tissue (p < 0.001) exposed to red laser. Our results show that ERCC1 and ERCC2 mRNA expression is differently altered in skin and muscle tissue exposed to low-intensity lasers depending on wavelengths and fluences used in therapeutic protocols.
-
Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp
2006-08-18
DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.
-
Unlocking the sugar "steric gate" of DNA polymerases.
Brown, Jessica A; Suo, Zucai
2011-02-22
To maintain genomic stability, ribonucleotide incorporation during DNA synthesis is controlled predominantly at the DNA polymerase level. A steric clash between the 2'-hydroxyl of an incoming ribonucleotide and a bulky active site residue, known as the "steric gate", establishes an effective mechanism for most DNA polymerases to selectively insert deoxyribonucleotides. Recent kinetic, structural, and in vivo studies have illuminated novel features about ribonucleotide exclusion and the mechanistic consequences of ribonucleotide misincorporation on downstream events, such as the bypass of a ribonucleotide in a DNA template and the subsequent extension of the DNA lesion bypass product. These important findings are summarized in this review.
-
Getting it Right: How DNA Polymerases Select the Right Nucleotide.
Ludmann, Samra; Marx, Andreas
2016-01-01
All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.
-
DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†
Wickner, William; Kornberg, Arthur
1973-01-01
DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657
-
Kansara, Seema G.; Sukhodolets, Maxim V.
2011-01-01
In this work, using multiple, dissimilar physico-chemical techniques, we demonstrate that the Escherichia coli RNA polymerase core enzyme obtained through a classic purification procedure forms stable (α2ββ'ω)2 complexes in the presence or absence of short DNA probes. Multiple control experiments indicate that this self-association is unlikely to be mediated by RNA polymerase-associated non-protein molecules. We show that the formation of (α2ββ'ω)2 complexes is subject to regulation by known RNA polymerase interactors, such as the auxiliary SWI/SNF subunit of RNA polymerase RapA, as well as NusA and σ70. We also demonstrate that the separation of the core RNA polymerase and RNA polymerase holoenzyme species during Mono Q chromatography is likely due to oligomerization of the core enzyme. We have analyzed the oligomeric state of the polymerase in the presence or absence of DNA, an aspect that was missing from previous studies. Importantly, our work demonstrates that RNA polymerase oligomerization is compatible with DNA binding. Through in vitro transcription and in vivo experiments (utilizing a RapAR599/Q602 mutant lacking transcription-stimulatory function), we demonstrate that the formation of tandem (α2ββ'ω)2–DNA complexes is likely functionally significant and beneficial for the transcriptional activity of the polymerase. Taken together, our findings suggest a novel structural aspect of the E. coli elongation complex. We hypothesize that transcription by tandem RNA polymerase complexes initiated at hypothetical bidirectional “origins of transcription” may explain recurring switches of the direction of transcription in bacterial genomes. PMID:21533049
-
Worldwide Distribution of Four SNPs in X‐Ray and Repair and Cross‐Complementing Group 1 (XRCC1)
Takeshita, Haruo; Yasuda, Toshihiro; Kimura‐Kataoka, Kaori
2014-01-01
Abstract Purpose X‐ray repair cross‐complementing group 1 (XRCC1) repairs single‐strand breaks in DNA. Several reports have shown the association of single nucleotide polymorphisms (SNPs) (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 to diseases. Limited population data are available regarding SNPs in XRCC1, especially in African populations. In this study, genotype distributions of four SNPs in worldwide populations were examined and compared with those reported previously. Materials and Methods Four SNPs (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 from genomic DNA samples of 10 populations were evaluated by using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results The frequency of the minor allele corresponding to the Trp allele of XRCC1Arg194Trp was higher in Asian populations than in African and Caucasian populations. As for XRCC1Pro206Pro, Africans showed higher minor allele frequencies than did Asian populations, except for Tamils and Sinhalese. XRCC1 Arg280His frequencies were similar among Africans and Caucasians but differed among Asian populations. Similarly, lower mutant XRCC1 Arg399Gln frequencies were observed in Africans. Conclusions This study is the first to show the existence of a certain genetic heterogeneity in the worldwide distribution of four SNPs in XRCC1. PMID:25387884
-
Sekimoto, Takayuki; Oda, Tsukasa; Kurashima, Kiminori; Hanaoka, Fumio
2014-01-01
DNA rereplication is a major form of aberrant replication that causes genomic instabilities, such as gene amplification. However, little is known about which DNA polymerases are involved in the process. Here, we report that low-fidelity Y-family polymerases (Y-Pols), Pol η, Pol ι, Pol κ, and REV1, significantly contribute to DNA synthesis during rereplication, while the replicative polymerases, Pol δ and Pol ε, play an important role in rereplication, as expected. When rereplication was induced by depletion of geminin, these polymerases were recruited to rereplication sites in human cell lines. This finding was supported by RNA interference (RNAi)-mediated knockdown of the polymerases, which suppressed rereplication induced by geminin depletion. Interestingly, epistatic analysis indicated that Y-Pols collaborate in a common pathway, independently of replicative polymerases. We also provide evidence for a catalytic role for Pol η and the involvement of Pol η and Pol κ in cyclin E-induced rereplication. Collectively, our findings indicate that, unlike normal S-phase replication, rereplication induced by geminin depletion and oncogene activation requires significant contributions of both Y-Pols and replicative polymerases. These findings offer important mechanistic insights into cancer genomic instability. PMID:25487575
-
Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E
2013-06-01
Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to <20% during long-term stationary phase. Pol IV transcription dominates as cells transition out of exponential phase into stationary phase and a burst of Pol V transcription is observed as cells transition from death phase to long-term stationary phase. These changes in alternative DNA polymerase transcription occur in the absence of SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.
-
Structure of nascent replicative form DNA of coliphage M13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less
-
Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai
2009-01-01
SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241
-
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
-
Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction
Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.
2017-01-01
DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020
-
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
-
A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.
2013-01-01
A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700
-
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
-
Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents Against Lung Cancer
2014-10-01
pol eta when replicating damaged DNA. 1S. SUBJECT TERMS: Mutagenesis, DNA polymerases, nucleoside analogs, chemotherapeutic agents 16. SECURITY ...such as polymerase eta, iota , and kappa that are involved in replicating damaged DNA. Our kinetic data obtained under Task 1B indicates that pol eta
-
Replication of N[superscript 2],3-Ethenoguanine by DNA Polymerases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Linlin; Christov, Plamen P.; Kozekov, Ivan D.
2014-10-02
The unstable DNA adduct N2,3-ethenoguanine, a product of both exposure to the carcinogen vinyl chloride and of oxidative stress, was built into an oligonucleotide, using an isostere strategy to stabilize the glycosidic bond. This modification was then used to examine the cause of mutations by DNA polymerases, in terms of both the biochemistry of the lesion and a structure of the lesion within a polymerase.
-
A Transient Kinetic Approach to Investigate Nucleoside Inhibitors of Mitochondrial DNA polymerase γ
Anderson, Karen S.
2010-01-01
Nucleoside analogs play an essential role in treating human immunodeficiency virus (HIV) infection since the beginning of the AIDS epidemic and work by inhibition of HIV-1 reverse transcriptase (RT), a viral polymerase essential for DNA replication. Today, over 90% of all regimens for HIV treatment contain at least one nucleoside. Long-term use of nucleoside analogs has been associated with adverse effects including mitochondrial toxicity due to inhibition of the mitochondrial polymerase, DNA polymerase gamma (mtDNA pol ©). In this review, we describe our efforts to delineate the molecular mechanism of nucleoside inhibition of HIV-1 RT and mtDNA pol © based upon a transient kinetic approach using rapid chemical quench methodology. Using transient kinetic methods, the maximum rate of polymerization (kpol), the dissociation constant for the ground state binding (Kd), and the incorporation efficiency (kpol/Kd) can be determined for the nucleoside analogs and their natural substrates. This analysis allowed us to develop an understanding of the structure activity relationships that allow correlation between the structural and stereochemical features of the nucleoside analog drugs with their mechanistic behavior toward the viral polymerase, RT, and the host cell polymerase, mtDNA pol γ. An in-depth understanding of the mechanisms of inhibition of these enzymes is imperative in overcoming problems associated with toxicity. PMID:20573564
-
Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2012-01-01
N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544
-
Refolding Active Human DNA Polymerase ν from Inclusion Bodies
Arana, Mercedes E.; Powell, Gary K.; Edwards, Lori L.; Kunkel, Thomas A.; Petrovich, Robert M.
2017-01-01
Human DNA polymerase ν (Pol ν) is a conserved family A DNA polymerase of uncertain biological function. Physical and biochemical characterization aimed at understanding Pol ν function is hindered by the fact that, when over-expressed in E. coli, Pol ν is largely insoluble, and the small amount of soluble protein is difficult to purify. Here we describe the use of high hydrostatic pressure to refold Pol ν from inclusion bodies, in soluble and active form. The refolded Pol ν has properties comparable to those of the small amount of Pol ν that was purified from the soluble fraction. The approach described here may be applicable to other DNA polymerases that are expressed as insoluble inclusion bodies in E. coli. PMID:19853037
-
Polymerase Gamma Disease through the Ages
ERIC Educational Resources Information Center
Saneto, Russell P.; Naviaux, Robert K.
2010-01-01
The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…
-
Fixing the model for transcription: the DNA moves, not the polymerase.
Papantonis, Argyris; Cook, Peter R
2011-01-01
The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.
-
Heyduk, T; Niedziela-Majka, A
Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.
-
Kinetics and thermodynamics of exonuclease-deficient DNA polymerases
NASA Astrophysics Data System (ADS)
Gaspard, Pierre
2016-04-01
A kinetic theory is developed for exonuclease-deficient DNA polymerases, based on the experimental observation that the rates depend not only on the newly incorporated nucleotide, but also on the previous one, leading to the growth of Markovian DNA sequences from a Bernoullian template. The dependencies on nucleotide concentrations and template sequence are explicitly taken into account. In this framework, the kinetic and thermodynamic properties of DNA replication, in particular, the mean growth velocity, the error probability, and the entropy production are calculated analytically in terms of the rate constants and the concentrations. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.
-
Donigan, Katherine A; McLenigan, Mary P; Yang, Wei; Goodman, Myron F; Woodgate, Roger
2014-03-28
Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A "steric gate" pol ι mutant is considerably more active in the presence of Mn(2+) compared with Mg(2+) and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be "at risk" for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
-
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
-
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2009-04-01
The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.
-
Schermerhorn, Kelly M.; Gardner, Andrew F.
2015-01-01
Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179
-
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
-
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
-
Gammon, Don B; Evans, David H
2009-05-01
Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.
-
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
The conversion of both parental- and progeny-nascent open circular M13 RF DNA into covalently closed RF I is drastically reduced in an E. coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I. The nascent progeny RF DNA also contains a significant proportion of fragments of smaller than unit length.
-
DNA of a Human Hepatitis B Virus Candidate
Robinson, William S.; Clayton, David A.; Greenman, Richard L.
1974-01-01
Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328
-
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
-
1988-10-10
identify by block number) FIELD GROUP S OUP - Archaebacteria , Halobacteria, Proteins Nucleic Acids, 08 RNA Polymerase-DNA Interactionsi R soimal operons...objectives of our program are to isolate and characterize a fully active DNA dependent RNA polymerase from the extremely halophilic archaebacteria from...Woese and his colleagues to suggest that all living organisms can be classified into three phylogenetic kingdoms : the eukaryotes, the eubacterla and
-
Techniques used to study the DNA polymerase reaction pathway
Joyce, Catherine M.
2009-01-01
Summary A minimal reaction pathway for DNA polymerases was established over 20 years ago using chemical quench methods. Since that time there has been considerable interest in noncovalent steps in the reaction pathway, conformational changes involving the polymerase or its DNA substrate that may play a role in substrate specificity. Fluorescence-based assays have been devised in order to study these conformational transitions and the results obtained have added new detail to the reaction pathway. PMID:19665596
-
d'Ambrosio, E; Furano, A V
1987-01-01
An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148
-
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
-
Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C.M.; Jansen, Jacob G.; Hogenbirk, Marc A.; de Wind, Niels; Jacobs, Heinz
2015-01-01
Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (PcnaK164R) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. PMID:25505145
-
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
-
Boehm, Elizabeth M.; Powers, Kyle T.; Kondratick, Christine M.; Spies, Maria; Houtman, Jon C. D.; Washington, M. Todd
2016-01-01
Y-family DNA polymerases, such as polymerase η, polymerase ι, and polymerase κ, catalyze the bypass of DNA damage during translesion synthesis. These enzymes are recruited to sites of DNA damage by interacting with the essential replication accessory protein proliferating cell nuclear antigen (PCNA) and the scaffold protein Rev1. In most Y-family polymerases, these interactions are mediated by one or more conserved PCNA-interacting protein (PIP) motifs that bind in a hydrophobic pocket on the front side of PCNA as well as by conserved Rev1-interacting region (RIR) motifs that bind in a hydrophobic pocket on the C-terminal domain of Rev1. Yeast polymerase η, a prototypical translesion synthesis polymerase, binds both PCNA and Rev1. It possesses a single PIP motif but not an RIR motif. Here we show that the PIP motif of yeast polymerase η mediates its interactions both with PCNA and with Rev1. Moreover, the PIP motif of polymerase η binds in the hydrophobic pocket on the Rev1 C-terminal domain. We also show that the RIR motif of human polymerase κ and the PIP motif of yeast Msh6 bind both PCNA and Rev1. Overall, these findings demonstrate that PIP motifs and RIR motifs have overlapping specificities and can interact with both PCNA and Rev1 in structurally similar ways. These findings also suggest that PIP motifs are a more versatile protein interaction motif than previously believed. PMID:26903512
-
NASA Astrophysics Data System (ADS)
Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich
2015-07-01
The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.
-
Measuring ribonucleotide incorporation into DNA in vitro and in vivo.
Clausen, Anders R; Williams, Jessica S; Kunkel, Thomas A
2015-01-01
Ribonucleotides are incorporated into genomes by DNA polymerases, they can be removed, and if not removed, they can have deleterious and beneficial consequences. Here, we describe an assay to quantify stable ribonucleotide incorporation by DNA polymerases in vitro, and an assay to probe for ribonucleotides in each of the two DNA strands of the yeast nuclear genome.
-
Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H
2011-03-01
Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.
-
Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F
2009-07-01
XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.
-
Human REV3 DNA Polymerase Zeta Localizes to Mitochondria and Protects the Mitochondrial Genome.
Singh, Bhupendra; Li, Xiurong; Owens, Kjerstin M; Vanniarajan, Ayyasamy; Liang, Ping; Singh, Keshav K
2015-01-01
To date, mitochondrial DNA polymerase γ (POLG) is the only polymerase known to be present in mammalian mitochondria. A dogma in the mitochondria field is that there is no other polymerase present in the mitochondria of mammalian cells. Here we demonstrate localization of REV3 DNA polymerase in the mammalian mitochondria. We demonstrate localization of REV3 in the mitochondria of mammalian tissue as well as cell lines. REV3 associates with POLG and mitochondrial DNA and protects the mitochondrial genome from DNA damage. Inactivation of Rev3 leads to reduced mitochondrial membrane potential, reduced OXPHOS activity, and increased glucose consumption. Conversely, inhibition of the OXPHOS increases expression of Rev3. Rev3 expression is increased in human primary breast tumors and breast cancer cell lines. Inactivation of Rev3 decreases cell migration and invasion, and localization of Rev3 in mitochondria increases survival and the invasive potential of cancer cells. Taken together, we demonstrate that REV3 functions in mammalian mitochondria and that mitochondrial REV3 is associated with the tumorigenic potential of cells.
-
Bjedov, Ivana; Dasgupta, Chitralekha Nag; Slade, Dea; Le Blastier, Sophie; Selva, Marjorie; Matic, Ivan
2007-01-01
Escherichia coli PolIV, a DNA polymerase capable of catalyzing synthesis past replication-blocking DNA lesions, belongs to the most ubiquitous branch of Y-family DNA polymerases. The goal of this study is to identify spontaneous DNA damage that is bypassed specifically and accurately by PolIV in vivo. We increased the amount of spontaneous DNA lesions using mutants deficient for different DNA repair pathways and measured mutation frequency in PolIV-proficient and -deficient backgrounds. We found that PolIV performs an error-free bypass of DNA damage that accumulates in the alkA tag genetic background. This result indicates that PolIV is involved in the error-free bypass of cytotoxic alkylating DNA lesions. When the amount of cytotoxic alkylating DNA lesions is increased by the treatment with chemical alkylating agents, PolIV is required for survival in an alkA tag-proficient genetic background as well. Our study, together with the reported involvement of the mammalian PolIV homolog, Polκ, in similar activity, indicates that Y-family DNA polymerases from the DinB branch can be added to the list of evolutionarily conserved molecular mechanisms that counteract cytotoxic effects of DNA alkylation. This activity is of major biological relevance because alkylating agents are continuously produced endogenously in all living cells and are also present in the environment. PMID:17483416
-
The replisome uses mRNA as a primer after colliding with RNA polymerase.
Pomerantz, Richard T; O'Donnell, Mike
2008-12-11
Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, K.H.; /Ohio State U.; Niebuhr, M.
2009-04-30
We report small-angle X-ray scattering (SAXS) and sedimentation velocity (SV) studies on the enzyme-DNA complexes of rat DNA polymerase {beta} (Pol {beta}) and African swine fever virus DNA polymerase X (ASFV Pol X) with one-nucleotide gapped DNA. The results indicated formation of a 2 : 1 Pol {beta}-DNA complex, whereas only 1 : 1 Pol X-DNA complex was observed. Three-dimensional structural models for the 2 : 1 Pol {beta}-DNA and 1 : 1 Pol X-DNA complexes were generated from the SAXS experimental data to correlate with the functions of the DNA polymerases. The former indicates interactions of the 8 kDamore » 5{prime}-dRP lyase domain of the second Pol {beta} molecule with the active site of the 1 : 1 Pol {beta}-DNA complex, while the latter demonstrates how ASFV Pol X binds DNA in the absence of DNA-binding motif(s). As ASFV Pol X has no 5{prime}-dRP lyase domain, it is reasonable not to form a 2 : 1 complex. Based on the enhanced activities of the 2 : 1 complex and the observation that the 8 kDa domain is not in an optimal configuration for the 5{prime}-dRP lyase reaction in the crystal structures of the closed ternary enzyme-DNA-dNTP complexes, we propose that the asymmetric 2 : 1 Pol {beta}-DNA complex enhances the function of Pol {beta}.« less
-
Trivedi, Ram N.; Wang, Xiao-hong; Jelezcova, Elena; Goellner, Eva M.; Tang, Jiangbo; Sobol, Robert W.
2014-01-01
Over-expression of N-methylpurine DNA glycosylase (MPG) has been suggested as a possible gene therapy approach to sensitize tumor cells to the cell killing effects of temozolomide, an imidazotetrazine-class chemotherapeutic alkylating agent. In the present study, we show that both elevated MPG expression and shRNA-mediated loss of Pol ß expression in human breast cancer cells increases cellular sensitivity to temozolomide. Resistance to temozolomide is restored by complementation of either wild-type human Pol ß or human Pol ß with an inactivating mutation specific to the polymerase active site yet functional for 5′dRP lyase activity. These genetic and cellular studies uniquely demonstrate that over-expression of MPG causes an imbalance in BER leading to an accumulation of cytotoxic 5′dRP lesions and that the 5′dRP lyase activity of Pol ß is required to restore resistance to temozolomide. These results imply that Pol ß dependent 5′dRP lyase activity is the rate-limiting step in BER in these cells and suggests that BER is a tightly balanced pathway for the repair of alkylated bases such as N7-MeG and N3-MeA. Further, we find that 5′dRP-mediated cell death is independent of caspase-3 activation and does not induce the formation of autophagosomes, as measured by GFP-LC3 localization. The experiments presented herein suggest that it will be important to investigate whether an active BER pathway could be partially responsible for the temozolomide-mediated resistance seen in some tumors and that balanced BER protein expression and overall BER capacity may help predict sensitivity to temozolomide. PMID:18477668
-
Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai
2014-01-01
Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327
-
Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente
2001-01-01
We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814
-
Wu, Eugene Y.; Beese, Lorena S.
2011-01-01
To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515
-
Mechanism for priming DNA synthesis by yeast DNA Polymerase α
Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca
2013-01-01
The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895
-
Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase.
Takahashi, Shuntaro; Brazier, John A; Sugimoto, Naoki
2017-09-05
Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases.
-
Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase
Takahashi, Shuntaro; Brazier, John A.; Sugimoto, Naoki
2017-01-01
Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases. PMID:28827350
-
Wendelsdorf, Katherine V.; Song, Zhuo; Cao, Yang; Samuels, David C.
2009-01-01
Nucleoside analogs used in antiretroviral treatment have been associated with mitochondrial toxicity. The polymerase-γ hypothesis states that this toxicity stems from the analogs' inhibition of the mitochondrial DNA polymerase (polymerase-γ) leading to mitochondrial DNA (mtDNA) depletion. We have constructed a computational model of the interaction of polymerase-γ with activated nucleoside and nucleotide analog drugs, based on experimentally measured reaction rates and base excision rates, together with the mtDNA genome size, the human mtDNA sequence, and mitochondrial dNTP concentrations. The model predicts an approximately 1000-fold difference in the activated drug concentration required for a 50% probability of mtDNA strand termination between the activated di-deoxy analogs d4T, ddC, and ddI (activated to ddA) and the activated forms of the analogs 3TC, TDF, AZT, FTC, and ABC. These predictions are supported by experimental and clinical data showing significantly greater mtDNA depletion in cell culture and patient samples caused by the di-deoxy analog drugs. For zidovudine (AZT) we calculated a very low mtDNA replication termination probability, in contrast to its reported mitochondrial toxicity in vitro and clinically. Therefore AZT mitochondrial toxicity is likely due to a mechanism that does not involve strand termination of mtDNA replication. PMID:19132079
-
Kinetics and thermodynamics of DNA polymerases with exonuclease proofreading
NASA Astrophysics Data System (ADS)
Gaspard, Pierre
2016-04-01
Kinetic theory and thermodynamics are applied to DNA polymerases with exonuclease activity, taking into account the dependence of the rates on the previously incorporated nucleotide. The replication fidelity is shown to increase significantly thanks to this dependence at the basis of the mechanism of exonuclease proofreading. In particular, this dependence can provide up to a 100-fold lowering of the error probability under physiological conditions. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.
-
Backbone assignment of the little finger domain of a Y-family DNA polymerase.
Ma, Dejian; Fowler, Jason D; Suo, Zucai
2011-10-01
Sulfolobus solfataricus DNA polymerase IV (Dpo4), a prototype Y-family DNA polymerase, contains a unique little finger domain besides a catalytic core. Here, we report the chemical shift assignments for the backbone nitrogens, α and β carbons, and amide protons of the little finger domain of Dpo4. This work and our published backbone assignment for the catalytic core provide the basis for investigating the conformational dynamics of Dpo4 during catalysis using solution NMR spectroscopy.
-
Donigan, Katherine A.; McLenigan, Mary P.; Yang, Wei; Goodman, Myron F.; Woodgate, Roger
2014-01-01
Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A “steric gate” pol ι mutant is considerably more active in the presence of Mn2+ compared with Mg2+ and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be “at risk” for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations. PMID:24532793
-
Siebler, Hollie M.; Lada, Artem G.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Pavlov, Youri I.
2014-01-01
Unrepaired DNA lesions often stall replicative DNA polymerases and are bypassed by translesion synthesis (TLS) to prevent replication fork collapse. Mechanisms of TLS are lesion- and species-specific, with a prominent role of specialized DNA polymerases with relaxed active sites. After nucleotide(s) are incorporated across from the altered base(s), the aberrant primer termini are typically extended by DNA polymerase ζ (pol ζ). As a result, pol ζ is responsible for most DNA damage-induced mutations. The mechanisms of sequential DNA polymerase switches in vivo remain unclear. The major replicative DNA polymerase δ (pol δ) shares two accessory subunits, called Pol31/Pol32 in yeast, with pol ζ. Inclusion of Pol31/Pol32 in the pol δ/pol ζ holoenzymes requires a [4Fe–4S] cluster in C-termini of the catalytic subunits. Disruption of this cluster in Pol ζ or deletion of POL32 attenuates induced mutagenesis. Here we describe a novel mutation affecting the catalytic subunit of pol ζ, rev3ΔC, which provides insight into the regulation of pol switches. Strains with Rev3ΔC, lacking the entire C-terminal domain and therefore the platform for Pol31/Pol32 binding, are partially proficient in Pol32-dependent UV-induced mutagenesis. This suggests an additional role of Pol32 in TLS, beyond being a pol ζ subunit, related to pol δ. In search for members of this regulatory pathway, we examined the effects of Maintenance of Genome Stability 1 (Mgs1) protein on mutagenesis in the absence of Rev3–Pol31/Pol32 interaction. Mgs1 may compete with Pol32 for binding to PCNA. Mgs1 overproduction suppresses induced mutagenesis, but had no effect on UV-mutagenesis in the rev3ΔC strain, suggesting that Mgs1 exerts its inhibitory effect by acting specifically on Pol32 bound to pol ζ. The evidence for differential regulation of Pol32 in pol δ and pol ζ emphasizes the complexity of polymerase switches. PMID:24819597
-
Cheng, Jinkui; Lai, Jinsheng; Gong, Zhizhong
2016-01-01
DNA polymerase δ plays crucial roles in DNA repair and replication as well as maintaining genomic stability. However, the function of POLD2, the second small subunit of DNA polymerase δ, has not been characterized yet in Arabidopsis (Arabidopsis thaliana). During a genetic screen for release of transcriptional gene silencing, we identified a mutation in POLD2. Whole-genome bisulfite sequencing indicated that POLD2 is not involved in the regulation of DNA methylation. POLD2 genetically interacts with Ataxia Telangiectasia-mutated and Rad3-related and DNA polymerase α. The pold2-1 mutant exhibits genomic instability with a high frequency of homologous recombination. It also exhibits hypersensitivity to DNA-damaging reagents and short telomere length. Whole-genome chromatin immunoprecipitation sequencing and RNA sequencing analyses suggest that pold2-1 changes H3K27me3 and H3K4me3 modifications, and these changes are correlated with the gene expression levels. Our study suggests that POLD2 is required for maintaining genome integrity and properly establishing the epigenetic markers during DNA replication to modulate gene expression. PMID:27208288
-
Optimization and evaluation of single-cell whole-genome multiple displacement amplification.
Spits, C; Le Caignec, C; De Rycke, M; Van Haute, L; Van Steirteghem, A; Liebaers, I; Sermon, K
2006-05-01
The scarcity of genomic DNA can be a limiting factor in some fields of genetic research. One of the methods developed to overcome this difficulty is whole genome amplification (WGA). Recently, multiple displacement amplification (MDA) has proved very efficient in the WGA of small DNA samples and pools of cells, the reaction being catalyzed by the phi29 or the Bst DNA polymerases. The aim of the present study was to develop a reliable, efficient, and fast protocol for MDA at the single-cell level. We first compared the efficiency of phi29 and Bst polymerases on DNA samples and single cells. The phi29 polymerase generated accurately, in a short time and from a single cell, sufficient DNA for a large set of tests, whereas the Bst enzyme showed a low efficiency and a high error rate. A single-cell protocol was optimized using the phi29 polymerase and was evaluated on 60 single cells; the DNA obtained DNA was assessed by 22 locus-specific PCRs. This new protocol can be useful for many applications involving minute quantities of starting material, such as forensic DNA analysis, prenatal and preimplantation genetic diagnosis, or cancer research. (c) 2006 Wiley-Liss, Inc.
-
DNA polymerase θ (POLQ) can extend from mismatches and from bases opposite a (6–4) photoproduct
Seki, Mineaki; Wood, Richard D.
2007-01-01
DNA polymerase θ (pol θ) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol θ and of Polq-defective mice have suggested that pol θ participates in DNA damage tolerance. For example, pol θ was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol θ extended relatively efficiently from matched termini as well as termini with A:G, A:T, and A:C mismatches, with less descrimination than a well-studied A family DNA polymerase, exonuclease-free pol I from E. coli. Although pol θ was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6–4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol θ was combined with DNA polymerase ι , an enzyme that can insert a base opposite a UV-induced (6–4) photoproduct, complete bypass of a (6–4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol θ is proficient at extension of unpaired termini. These results show the potential of pol θ to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol θ in somatic mutagenesis and genome instability. PMID:17920341
-
DNA polymerase theta (POLQ) can extend from mismatches and from bases opposite a (6-4) photoproduct.
Seki, Mineaki; Wood, Richard D
2008-01-01
DNA polymerase theta (pol theta) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol theta and of Polq-defective mice have suggested that pol theta participates in DNA damage tolerance. For example, pol theta was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol theta extended relatively efficiently from matched termini as well as termini with A:G, A:T and A:C mismatches, with less descrimination than a well-studied A-family DNA polymerase, exonuclease-free pol I from E. coli. Although pol theta was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6-4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol theta was combined with DNA polymerase iota, an enzyme that can insert a base opposite a UV-induced (6-4) photoproduct, complete bypass of a (6-4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol theta is proficient at extension of unpaired termini. These results show the potential of pol theta to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol theta in somatic mutagenesis and genome instability.
-
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
-
Ren, Zhong
2016-09-06
DNA polymerases in family B are workhorses of DNA replication that carry out the bulk of the job at a high speed with high accuracy. A polymerase in this family relies on a built-in exonuclease for proofreading. It has not been observed at the atomic resolution how the polymerase advances one nucleotide space on the DNA template strand after a correct nucleotide is incorporated, that is, a process known as translocation. It is even more puzzling how translocation is avoided after the primer strand is excised by the exonuclease and returned back to the polymerase active site once an error occurs. The structural events along the bifurcate pathways of translocation and proofreading have been unwittingly captured by hundreds of structures in Protein Data Bank. This study analyzes all available structures of a representative member in family B and reveals the orchestrated event sequence during translocation and proofreading. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Spiering, Michelle M.; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J.
2017-01-01
The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior—that is, the signaling mechanism—have not been definitively identified. We examined the role of RNA primer–primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer–primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer–primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer–primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes. PMID:28507156
-
Spiering, Michelle M; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J
2017-05-30
The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior-that is, the signaling mechanism-have not been definitively identified. We examined the role of RNA primer-primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer-primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer-primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer-primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes.
-
Taguchi, Takahiko; Kurata, Sumiko; Ohashi, Mochihiko
2002-09-01
Putrescine biosynthesis is elevated before DNA replication, and a stimulation of DNA synthesis by 20 mM putrescine has been found using an in vitro DNA synthesizing system. Furthermore, this stimulation of DNA synthesis by putrescine involves a particular factor (factor PA). This factor PA stimulates DNA polymerases alpha, beta, and gamma, and is present in nuclei and mitochondria but not in cytoplasm. Factor PA loses about 80% of its activity by heating at 45 degrees C for 15 min or by hydrolysis with 100 mg ml(-1) Enzygel trypsin. These properties indicate that factor PA is a protein. Its size is estimated to be about 2.1 S. DNA synthesis in nuclear and mitochondrial DNA polymerase extracts from tumour tissues and host livers of tumour-bearing rats are not stimulated by 20 mM putrescine. However, the addition of excess factor PA to DNA synthesizing systems using DNA polymerase extracts from proliferative tissues again results in a stimulation of DNA synthesis by exogenous putrescine. These findings indicate that the stimulatory effect of DNA synthesis in vitro by exogenous putrescine is controlled by the ratio between factor PA and endogenously synthesized putrescine in proliferative tissues or that sent by the bloodstream from proliferative tissues. These results suggest that a non-stimulatory effect of putrescine on DNA synthesis may be diagnostic in tumour-bearing patients. Copyright 2002 John Wiley & Sons, Ltd.
-
Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase η*
Su, Yan; Egli, Martin; Guengerich, F. Peter
2016-01-01
Ribonucleotides and 2′-deoxyribonucleotides are the basic units for RNA and DNA, respectively, and the only difference is the extra 2′-OH group on the ribonucleotide sugar. Cellular rNTP concentrations are much higher than those of dNTP. When copying DNA, DNA polymerases not only select the base of the incoming dNTP to form a Watson-Crick pair with the template base but also distinguish the sugar moiety. Some DNA polymerases use a steric gate residue to prevent rNTP incorporation by creating a clash with the 2′-OH group. Y-family human DNA polymerase η (hpol η) is of interest because of its spacious active site (especially in the major groove) and tolerance of DNA lesions. Here, we show that hpol η maintains base selectivity when incorporating rNTPs opposite undamaged DNA and the DNA lesions 7,8-dihydro-8-oxo-2′-deoxyguanosine and cyclobutane pyrimidine dimer but with rates that are 103-fold lower than for inserting the corresponding dNTPs. X-ray crystal structures show that the hpol η scaffolds the incoming rNTP to pair with the template base (dG) or 7,8-dihydro-8-oxo-2′-deoxyguanosine with a significant propeller twist. As a result, the 2′-OH group avoids a clash with the steric gate, Phe-18, but the distance between primer end and Pα of the incoming rNTP increases by 1 Å, elevating the energy barrier and slowing polymerization compared with dNTP. In addition, Tyr-92 was identified as a second line of defense to maintain the position of Phe-18. This is the first crystal structure of a DNA polymerase with an incoming rNTP opposite a DNA lesion. PMID:26740629
-
Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps
Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto
2015-01-01
The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050
-
Structural basis for the D-stereoselectivity of human DNA polymerase β
Vyas, Rajan; Reed, Andrew J.; Raper, Austin T.; Zahurancik, Walter J.; Wallenmeyer, Petra C.
2017-01-01
Abstract Nucleoside reverse transcriptase inhibitors (NRTIs) with L-stereochemistry have long been an effective treatment for viral infections because of the strong D-stereoselectivity exhibited by human DNA polymerases relative to viral reverse transcriptases. The D-stereoselectivity of DNA polymerases has only recently been explored structurally and all three DNA polymerases studied to date have demonstrated unique stereochemical selection mechanisms. Here, we have solved structures of human DNA polymerase β (hPolβ), in complex with single-nucleotide gapped DNA and L-nucleotides and performed pre-steady-state kinetic analysis to determine the D-stereoselectivity mechanism of hPolβ. Beyond a similar 180° rotation of the L-nucleotide ribose ring seen in other studies, the pre-catalytic ternary crystal structures of hPolβ, DNA and L-dCTP or the triphosphate forms of antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP) provide little structural evidence to suggest that hPolβ follows the previously characterized mechanisms of D-stereoselectivity. Instead, hPolβ discriminates against L-stereochemistry through accumulation of several active site rearrangements that lead to a decreased nucleotide binding affinity and incorporation rate. The two NRTIs escape some of the active site selection through the base and sugar modifications but are selected against through the inability of hPolβ to complete thumb domain closure. PMID:28402499
-
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
-
Jevtuševskaja, Jekaterina; Krõlov, Katrin; Tulp, Indrek; Langel, Ülo
2017-04-01
The use of rapid amplification methods to detect pathogens in biological samples is mainly limited by the amount of pathogens present in the sample and the presence of inhibiting substances. Inhibitors can affect the amplification efficiency by either binding to the polymerase, interacting with the DNA, or interacting with the polymerase during primer extension. Amplification is performed using DNA polymerase enzymes and even small changes in their activity can influence the sensitivity and robustness of molecular assays Methods: The main purpose of this research was to examine which compounds present in urine inhibit polymerases with strand displacement activity. To quantify the inhibition, we employed quantitative loop-mediated isothermal amplification Results: The authors found that the presence of BSA, Mg 2+, and urea at physiologically relevant concentrations, as well as acidic or alkaline conditions did not affect the activity of any of the tested polymerases. However, addition of salt significantly affected the activity of the tested polymerases. These findings may aid in the development of more sensitive, robust, cost effective isothermal amplification based molecular assays suitable for both point-of-care testing and on-site screening of pathogens directly from unprocessed urine which avoid the need for long and tedious DNA purification steps prior to amplification.
-
Time-lapse crystallography snapshots of a double-strand break repair polymerase in action.
Jamsen, Joonas A; Beard, William A; Pedersen, Lars C; Shock, David D; Moon, Andrea F; Krahn, Juno M; Bebenek, Katarzyna; Kunkel, Thomas A; Wilson, Samuel H
2017-08-15
DNA polymerase (pol) μ is a DNA-dependent polymerase that incorporates nucleotides during gap-filling synthesis in the non-homologous end-joining pathway of double-strand break repair. Here we report time-lapse X-ray crystallography snapshots of catalytic events during gap-filling DNA synthesis by pol μ. Unique catalytic intermediates and active site conformational changes that underlie catalysis are uncovered, and a transient third (product) metal ion is observed in the product state. The product manganese coordinates phosphate oxygens of the inserted nucleotide and PP i . The product metal is not observed during DNA synthesis in the presence of magnesium. Kinetic analyses indicate that manganese increases the rate constant for deoxynucleoside 5'-triphosphate insertion compared to magnesium. The likely product stabilization role of the manganese product metal in pol μ is discussed. These observations provide insight on structural attributes of this X-family double-strand break repair polymerase that impact its biological function in genome maintenance.DNA polymerase (pol) μ functions in DNA double-strand break repair. Here the authors use time-lapse X-ray crystallography to capture the states of pol µ during the conversion from pre-catalytic to product complex and observe a third transiently bound metal ion in the product state.
-
Transient expression and activity of human DNA polymerase iota in loach embryos.
Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E
2012-02-01
Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.
-
Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C M; Jansen, Jacob G; Hogenbirk, Marc A; de Wind, Niels; Jacobs, Heinz
2015-01-01
Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (Pcna(K164R)) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Regulation and Modulation of Human DNA Polymerase δ Activity and Function
Wang, Xiaoxiao; Zhang, Sufang; Zhang, Zhongtao; Lee, Ernest Y. C.
2017-01-01
This review focuses on the regulation and modulation of human DNA polymerase δ (Pol δ). The emphasis is on the mechanisms that regulate the activity and properties of Pol δ in DNA repair and replication. The areas covered are the degradation of the p12 subunit of Pol δ, which converts it from a heterotetramer (Pol δ4) to a heterotrimer (Pol δ3), in response to DNA damage and also during the cell cycle. The biochemical mechanisms that lead to degradation of p12 are reviewed, as well as the properties of Pol δ4 and Pol δ3 that provide insights into their functions in DNA replication and repair. The second focus of the review involves the functions of two Pol δ binding proteins, polymerase delta interaction protein 46 (PDIP46) and polymerase delta interaction protein 38 (PDIP38), both of which are multi-functional proteins. PDIP46 is a novel activator of Pol δ4, and the impact of this function is discussed in relation to its potential roles in DNA replication. Several new models for the roles of Pol δ3 and Pol δ4 in leading and lagging strand DNA synthesis that integrate a role for PDIP46 are presented. PDIP38 has multiple cellular localizations including the mitochondria, the spliceosomes and the nucleus. It has been implicated in a number of cellular functions, including the regulation of specialized DNA polymerases, mitosis, the DNA damage response, mouse double minute 2 homolog (Mdm2) alternative splicing and the regulation of the NADPH oxidase 4 (Nox4). PMID:28737709
-
Nojima, Kuniharu; Hochegger, Helfrid; Saberi, Alihossein; Fukushima, Toru; Kikuchi, Koji; Yoshimura, Michio; Orelli, Brian J; Bishop, Douglas K; Hirano, Seiki; Ohzeki, Mioko; Ishiai, Masamichi; Yamamoto, Kazuhiko; Takata, Minoru; Arakawa, Hiroshi; Buerstedde, Jean-Marie; Yamazoe, Mitsuyoshi; Kawamoto, Takuo; Araki, Kasumi; Takahashi, Jun A; Hashimoto, Nobuo; Takeda, Shunichi; Sonoda, Eiichiro
2005-12-15
Cross-linking agents that induce DNA interstrand cross-links (ICL) are widely used in anticancer chemotherapy. Yeast genetic studies show that nucleotide excision repair (NER), Rad6/Rad18-dependent postreplication repair, homologous recombination, and cell cycle checkpoint pathway are involved in ICL repair. To study the contribution of DNA damage response pathways in tolerance to cross-linking agents in vertebrates, we made a panel of gene-disrupted clones from chicken DT40 cells, each defective in a particular DNA repair or checkpoint pathway, and measured the sensitivities to cross-linking agents, including cis-diamminedichloroplatinum (II) (cisplatin), mitomycin C, and melphalan. We found that cells harboring defects in translesion DNA synthesis (TLS), Fanconi anemia complementation groups (FANC), or homologous recombination displayed marked hypersensitivity to all the cross-linking agents, whereas NER seemed to play only a minor role. This effect of replication-dependent repair pathways is distinctively different from the situation in yeast, where NER seems to play a major role in dealing with ICL. Cells deficient in Rev3, the catalytic subunit of TLS polymerase Polzeta, showed the highest sensitivity to cisplatin followed by fanc-c. Furthermore, epistasis analysis revealed that these two mutants work in the same pathway. Our genetic comprehensive study reveals a critical role for DNA repair pathways that release DNA replication block at ICLs in cellular tolerance to cross-linking agents and could be directly exploited in designing an effective chemotherapy.
-
Palin, Eino JH; Lesonen, Annamari; Farr, Carol L; Euro, Liliya; Suomalainen, Anu; Kaguni, Laurie S
2010-01-01
Mitochondrial DNA polymerase, POLG, is the sole DNA polymerase found in animal mitochondria. In humans, POLGα W748S in cis with an E1143G mutation has been linked to a new type of recessive ataxia, MIRAS, which is the most common inherited ataxia in Finland. We investigated the biochemical phenotypes of the W748S amino acid change, using recombinant human POLG. We measured processive and non-processive DNA polymerase activity, DNA binding affinity, enzyme processivity, and subunit interaction with recombinant POLGβ. In addition, we studied the effects of the W748S and E1143G mutations in primary human cell cultures using retroviral transduction. Here, we examined cell viability, mitochondrial DNA copy number, and products of mitochondrial translation. Our results indicate that the W748S mutant POLGα does not exhibit a clear biochemical phenotype, making it indistinguishable from wild type POLGα and as such, fail to replicate previously published results. Furthermore, results from the cell models were concurrent with the findings from patients, and support our biochemical findings. PMID:20153822
-
Protein Interactions in T7 DNA Replisome Facilitate DNA Damage Bypass.
Zou, Zhenyu; Chen, Ze; Xue, Qizhen; Xu, Ying; Xiong, Jingyuan; Yang, Ping; Le, Shuai; Zhang, Huidong
2018-06-14
DNA replisome inevitably encounters DNA damage during DNA replication. T7 DNA replisome contains DNA polymerase (gp5), the processivity factor thioredoxin (trx), helicase-primase (gp4), and ssDNA binding protein (gp2.5). T7 protein interactions mediate this DNA replication. However, whether the protein interactions could promote DNA damage bypass is still little addressed. In this study, we investigated the strand-displacement DNA synthesis past 8-oxoG or O6-MeG at the synthetic DNA fork by T7 DNA replisome. DNA damage does not obviously affect the binding affinities among helicase, polymerase, and DNA fork. Relative to unmodified G, both 8-oxoG and O6-MeG, as well as GC-rich template sequence clusters, inhibit the strand-displacement DNA synthesis and produce partial extension products. Relative to gp4 ΔC-tail, gp4 promotes the DNA damage bypass. The presence of gp2.5 further promotes this bypass. Thus, the interactions of polymerase with helicase and ssDNA binidng protein faciliate the DNA damage bypass. Similarly, accessory proteins in other complicated DNA replisomes also facilitate the DNA damage bypass. This work provides the novel mechanism information of DNA damage bypass by DNA replisome. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases
Su, Yan; Guengerich, F. Peter
2016-01-01
Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785
-
Leis, Jonathan P.; Hurwitz, Jerard
1972-01-01
The role of ribonucleic acid (RNA) in deoxyribonucleic acid (DNA) synthesis with the purified DNA polymerase from the avian myeloblastosis virus has been studied. The polymerase catalyzes the synthesis of DNA in the presence of four deoxynucleoside triphosphates, Mg2+, and a variety of RNA templates including those isolated from avian myeloblastosis, Rous sarcoma, and Rauscher leukemia viruses; phages f2, MS2, and Qβ; and synthetic homopolymers such as polyadenylate·polyuridylic acid. The enzyme does not initiate the synthesis of new chains but incorporates deoxynucleotides at 3′ hydroxyl ends of primer strands. The product is an RNA·DNA hybrid in which the two polynucleotide components are covalently linked. Free DNA has not been detected among the products formed with the purified enzyme in vitro. The DNA synthesized with avian myeloblastosis virus RNA after alkaline hydrolysis has a sedimentation coefficient of 6 to 7S. PMID:4333539
-
Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta
Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.
2014-01-01
Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323
-
Wang, Lijiang; Liu, Qingjun; Hu, Zhaoying; Zhang, Yuanfan; Wu, Chunsheng; Yang, Mo; Wang, Ping
2009-05-15
A novel biosensor based on single-stranded DNA (ssDNA) probe functionalized aluminum anodized oxide (AAO) nanopore membranes was demonstrated for Escherichia coli O157:H7 DNA detection. An original and dynamic polymerase-extending (PE) DNA hybridization procedure is proposed, where hybridization happens in the existence of Taq DNA polymerase and dNTPs under controlled reaction temperature. The probe strand would be extended as long as the target DNA strand, then the capability to block the ionic flow in the pores has been prominently enhanced by the double strand complex. We have investigated the variation of ionic conductivity during the fabrication of the film and the hybridization using cyclic voltammetry and impedance spectroscopy. The present approach provides low detection limit for DNA (a few hundreds of pmol), rapid label-free and easy-to-use bacteria detection, which holds the potential for future use in various ss-DNA analyses by integrated into a self-contained biochip.
-
Characteristics of Deoxyribonucleic Acid Polymerase Isolated from Spores of Rhizopus stolonifer1
Gong, Cheng-Shung; Dunkle, Larry D.; Van Etten, James L.
1973-01-01
Deoxyribonucleic acid (DNA)-dependent DNA polymerase was purified several hundredfold from germinated and ungerminated spores of the fungus Rhizopus stolonifer. The partially purified enzymes from both spore stages exhibited identical characteristics; incorporation of [3H]deoxythymidine monophosphate into DNA required Mg2+, DNA, a reducing agent, and the simultaneous presence of deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxyadenosine triphosphate. Heat-denatured and activated DNAs were better templates than were native DNAs. The buoyant density of the radioactive product of the reaction was similar to that of the template DNA. The enzyme is probably composed of a single polypeptide chain with an S value of 5.12 and an estimated molecular weight of 70,000 to 75,000. During the early stages of purification, the enzyme fraction from ungerminated spores required exogenous DNA for maximum activity, whereas the corresponding enzyme fraction from germinated spores did not require added DNA. Apparently DNA polymerase from germinated spores was more tightly bound to endogenous DNA than was the enzyme from ungerminated spores. PMID:4728271
-
Kinetic Analysis of the Bypass of a Bulky DNA Lesion Catalyzed by Human Y-family DNA Polymerases
Sherrer, Shanen M.; Sanman, Laura E.; Xia, Cynthia X.; Bolin, Eric R.; Malik, Chanchal K.; Efthimiopoulos, Georgia; Basu, Ashis K.; Suo, Zucai
2012-01-01
1-Nitropyrene (1-NP), a mutagen and potential carcinogen, is the most abundant nitro polyaromatic hydrocarbon in diesel exhaust, which reacts with DNA to form predominantly N-(deoxyguanosin-8-yl)-1-aminopyrene (dGAP). If not repaired, this DNA lesion is presumably bypassed in vivo by any of human Y-family DNA polymerases kappa (hPolκ), iota (hPolτ), eta (hPolη), and Rev1 (hRev1). Our running start assays demonstrated that each of these enzymes was indeed capable of traversing a site-specifically placed dGAP on a synthetic DNA template but hRev1 was stopped after lesion bypass. The time required to bypass 50% of the dGAP sites (t50bypass ) encountered by hPolη, hPolκ and hPolτ was determined to be 2.5 s, 4.1 s, and 106.5 s, respectively. The efficiency order of catalyzing translesion synthesis of dGAP (hPolη > hPolκ > hPolτ >> hRev1) is the same as the order for these human Y-family enzymes to elongate undamaged DNA. Although hPolη bypassed dGAP efficiently, replication by both hPolκ and hPolτ was strongly stalled at the lesion site and at a site immediately downstream from dGAP. By employing pre-steady state kinetic methods, a kinetic basis was established for polymerase pausing at these DNA template sites. Besides efficiency of bypass, the fidelity of those low-fidelity polymerases at these pause sites was also significantly decreased. Thus, if the translesion DNA synthesis of dGAP in vivo is catalyzed by a human Y-family DNA polymerase, e.g. hPolη, the process is certainly mutagenic. PMID:22324639
-
Gowda, A S Prakasha; Spratt, Thomas E
2016-03-21
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and N'-nitrosonornicotine (NNN) are important human carcinogens in tobacco products. They are metabolized to produce a variety 4-(3-pyridyl)-4-oxobutyl (POB) DNA adducts including O(2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O(2)-POB-dT), the most abundant POB adduct in NNK- and NNN-treated rodents. To evaluate the mutagenic properties of O(2)-POB-dT, we measured the rate of insertion of dNTPs opposite and extension past O(2)-POB-dT and O(2)-Me-dT by purified human DNA polymerases η, κ, ι, and yeast polymerase ζ in vitro. Under conditions of polymerase in excess, polymerase η was most effective at the insertion of dNTPs opposite O(2)-alkyl-dTs. The time courses were biphasic suggesting the formation of inactive DNA-polymerase complexes. The kpol parameter was reduced approximately 100-fold in the presence of the adduct for pol η, κ, and ι. Pol η was the most reactive polymerase for the adducts due to a higher burst amplitude. For all three polymerases, the nucleotide preference was dATP > dTTP ≫ dGTP and dCTP. Yeast pol ζ was most effective in bypassing the adducts; the kcat/Km values were reduced only 3-fold in the presence of the adducts. The identity of the nucleotide opposite the O(2)-alkyl-dT did not significantly affect the ability of pol ζ to bypass the adducts. The data support a model in which pol η inserts ATP or dTTP opposite O(2)-POB-dT, and then, pol ζ extends past the adduct.
-
RNA Polymerase Collision versus DNA Structural Distortion: Twists and Turns Can Cause Break Failure
Pannunzio, Nicholas R.; Lieber, Michael R.
2016-01-01
Summary The twisting of DNA due to the movement of RNA polymerases is the basis of numerous classic experiments in molecular biology. Recent mouse genetic models indicate that chromosomal breakage is common at sites of transcriptional turbulence. Two key studies on this point mapped breakpoints to sites of either convergent or divergent transcription, but arrived at different conclusions as to which is more detrimental and why. The issue turns on whether DNA strand separation is the basis for the chromosomal instability or collision of RNA polymerases? PMID:27153532
-
Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun
2016-01-01
DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057
-
Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA
NASA Astrophysics Data System (ADS)
Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.
2016-06-01
The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.
-
Conformational transitions in DNA polymerase I revealed by single-molecule FRET
Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.
2010-01-01
The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740
-
Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang
2005-01-01
Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387
-
Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi
2016-01-01
DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions. PMID:26400504
-
Brown, K B; Nelson, N F; Brown, D G
1975-01-01
1. The interaction of polyamines and methylglyoxal bis(guanythydrazone) (1, 1'-[(methylethanediylidene)-dinitrilo]diguanidine) with isolated rat liver nuclei was investigated by electron microscopy. 2. At 4mM, putrescine was without effect; however, spermidine, spermine or methylglyoxal bis(guanythydrazone) resulted in dispersed chromatin and alterations in nucleolar structure. In addition, spermidine or methylglyoxal bis(guanylhydrazone) caused marked aggregation of interchromatin granules. 3. The DNA template property of calf thymus DNA was examined by using DNA polymerases from Escherichia coli, Micrococcus lysodeikticus and calf thymus in the presence of 0-5 mM-amine. 4. In the presence of DNA polymerase, spermine or methylglyoxal bis(guanylhydrazone) inhibited activity, whereas putrescine or spermidine had much less effect or in some cases stimulated [3H]dTMP incorporation. 5. Template activity which was inhibited by spermine or methylglyoxal bis(guanylhydrazone) could be partially restored by additional DNA or enzyme. 6. When mixed with calf thymus DNA, calf thymus histone inhibited template activity as measured with E. coli DNA polymerase. The template activity of such a 'histone-nucleate' could not be restored by putrescine, spermidine, spermine or methylglyoxal bis(guanylhydrazone). 7. DNA template activity of isolated rat liver nuclei was tested by using E. coli DNA polymerase. None of the amines was able to increase the template activity of the nuclear DNA in vitro. Images PLATE 1 PMID:1218090
-
Brown, K B; Nelson, N F; Brown, D G
1975-12-01
1. The interaction of polyamines and methylglyoxal bis(guanythydrazone) (1, 1'-[(methylethanediylidene)-dinitrilo]diguanidine) with isolated rat liver nuclei was investigated by electron microscopy. 2. At 4mM, putrescine was without effect; however, spermidine, spermine or methylglyoxal bis(guanythydrazone) resulted in dispersed chromatin and alterations in nucleolar structure. In addition, spermidine or methylglyoxal bis(guanylhydrazone) caused marked aggregation of interchromatin granules. 3. The DNA template property of calf thymus DNA was examined by using DNA polymerases from Escherichia coli, Micrococcus lysodeikticus and calf thymus in the presence of 0-5 mM-amine. 4. In the presence of DNA polymerase, spermine or methylglyoxal bis(guanylhydrazone) inhibited activity, whereas putrescine or spermidine had much less effect or in some cases stimulated [3H]dTMP incorporation. 5. Template activity which was inhibited by spermine or methylglyoxal bis(guanylhydrazone) could be partially restored by additional DNA or enzyme. 6. When mixed with calf thymus DNA, calf thymus histone inhibited template activity as measured with E. coli DNA polymerase. The template activity of such a 'histone-nucleate' could not be restored by putrescine, spermidine, spermine or methylglyoxal bis(guanylhydrazone). 7. DNA template activity of isolated rat liver nuclei was tested by using E. coli DNA polymerase. None of the amines was able to increase the template activity of the nuclear DNA in vitro.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.
2012-06-27
Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase atmore » the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.« less
-
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
-
Problem-Solving Test: Pyrosequencing
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2013-01-01
Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…
-
Jeppesen, C; Nielsen, P E
1989-01-01
Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811
-
Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X
2016-12-01
A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.
-
Biological Characterization of Novel Inhibitors of the Gram-Positive DNA Polymerase IIIC Enzyme
Kuhl, Alexander; Svenstrup, Niels; Ladel, Christoph; Otteneder, Michael; Binas, Annegret; Schiffer, Guido; Brands, Michael; Lampe, Thomas; Ziegelbauer, Karl; Rübsamen-Waigmann, Helga; Haebich, Dieter; Ehlert, Kerstin
2005-01-01
Novel N-3-alkylated 6-anilinouracils have been identified as potent and selective inhibitors of bacterial DNA polymerase IIIC, the enzyme essential for the replication of chromosomal DNA in gram-positive bacteria. A nonradioactive assay measuring the enzymatic activity of the DNA polymerase IIIC in gram-positive bacteria has been assembled. The 6-anilinouracils described inhibited the polymerase IIIC enzyme at concentrations in the nanomolar range in this assay and displayed good in vitro activity (according to their MICs) against staphylococci, streptococci, and enterococci. The MICs of the most potent derivatives were about 4 μg/ml for this panel of bacteria. The 50% effective dose of the best compound (6-[(3-ethyl-4-methylphenyl)amino]-3-{[1-(isoxazol-5-ylcarbonyl)piperidin-4-yl]methyl}uracil) was 10 mg/kg of body weight after intravenous application in a staphylococcal sepsis model in mice, from which in vivo pharmacokinetic data were also acquired. PMID:15728893
-
Jin, Zhinan; Johnson, Kenneth A.
2011-01-01
A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284
-
Mirzakhanyan, Yeva; Gershon, Paul D
2017-09-01
The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.
-
Lawler, Jessica L; Mukherjee, Purba; Coen, Donald M
2018-03-01
The catalytic subunit (Pol) of herpes simplex virus 1 (HSV-1) DNA polymerase has been extensively studied both as a model for other family B DNA polymerases and for its differences from these enzymes as an antiviral target. Among the activities of HSV-1 Pol is an intrinsic RNase H activity that cleaves RNA from RNA-DNA hybrids. There has long been a controversy regarding whether this activity is due to the 3'-to-5' exonuclease of Pol or whether it is a separate activity, possibly acting on 5' RNA termini. To investigate this issue, we compared wild-type HSV-1 Pol and a 3'-to-5' exonuclease-deficient mutant, D368A Pol, for DNA polymerase activity, 3'-to-5' exonuclease activity, and RNase H activity in vitro Additionally, we assessed the RNase H activity using differentially end-labeled templates with 5' or 3' RNA termini. The mutant enzyme was at most modestly impaired for DNA polymerase activity but was drastically impaired for 3'-to-5' exonuclease activity, with no activity detected even at high enzyme-to-DNA substrate ratios. Importantly, the mutant showed no detectable ability to excise RNA with either a 3' or 5' terminus, while the wild-type HSV-1 Pol was able to cleave RNA from the annealed RNA-DNA hairpin template, but only detectably with a 3' RNA terminus in a 3'-to-5' direction and at a rate lower than that of the exonuclease activity. These results suggest that HSV-1 Pol does not have an RNase H separable from its 3'-to-5' exonuclease activity and that this activity prefers DNA degradation over degradation of RNA from RNA-DNA hybrids. IMPORTANCE Herpes simplex virus 1 (HSV-1) is a member of the Herpesviridae family of DNA viruses, several of which cause morbidity and mortality in humans. Although the HSV-1 DNA polymerase has been studied for decades and is a crucial target for antivirals against HSV-1 infection, several of its functions remain to be elucidated. A hypothesis suggesting the existence of a 5'-to-3' RNase H activity intrinsic to this enzyme that could remove RNA primers from Okazaki fragments has been particularly controversial. In this study, we were unable to identify RNase H activity of HSV-1 DNA polymerase on RNA-DNA hybrids with 5' RNA termini. We detected RNase H activity on hybrids with 3' termini, but this was due to the 3'-to-5' exonuclease. Thus, HSV-1 is unlikely to use this method to remove RNA primers during DNA replication but may use pathways similar to those used in eukaryotic Okazaki fragment maturation. Copyright © 2018 American Society for Microbiology.
-
Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian
2013-12-01
Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
-
Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal
2017-11-01
5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
The p21 and PCNA partnership: a new twist for an old plot.
Prives, Carol; Gottifredi, Vanesa
2008-12-15
The contribution of error-prone DNA polymerases to the DNA damage response has been a subject of great interest in the last decade. Error-prone polymerases are required for translesion DNA synthesis (TLS), a process that involves synthesis past a DNA lesion. Under certain circumstances, TLS polymerases can achieve bypass with good efficiency and fidelity. However, they can also in some cases be mutagenic, and so negative regulators of TLS polymerases would have the important function of inhibiting their recruitment to undamaged DNA templates. Recent work from Livneh's and our groups have provided evidence regarding the role of the cyclin kinase inhibitor p21 as a negative regulator of TLS. Interestingly, both the cyclin dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) binding domains of p21 are involved in different aspects of the modulation of TLS, affecting both the interaction between PCNA and the TLS-specific pol eta as well as PCNA ubiquitination status. In line with this, p21 was shown to reduce the efficiency but increase the accuracy of TLS. Hence, in absence of DNA damage p21 may work to impede accidental loading of pol eta to undamaged DNA and avoid consequential mutagenesis. After UV irradiation, when TLS plays a decisive role, p21 is progressively degraded. This might allow gradual release of replication fork blockage by TLS polymerases. For these reasons, in higher eukaryotes p21 might represent a key regulator of the equilibrium between mutagenesis and cell survival.
-
A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.
Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai
2010-01-15
During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.
-
Andrade, B S; Góes-Neto, A
2015-10-30
The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stokes, M.A.M.
1985-01-01
The in vitro activities of the purified poliovirus RNA polymerase were investigated in this study. The polymerase was shown to be a strict RNA dependent RNA polymerase. It only copied RNA templates but used either a DNA or RNA primer to initiate RNA synthesis. Partially purified polymerase has some DNA polymerase activities. Additional purification of the enzyme and studies with a mutant poliovirus RNA polymerase indicated that the DNA polymerase activities were due to a cellular polymerase. The fidelity of RNA replication in vitro by the purified poliovirus RNA polymerase was studied by measuring the rate of misincorporation of noncomplementarymore » ribonucleotide monophosphates on synthetic homopolymeric RNA templates. The results showed that the ratio of noncomplementary to complementary ribonucleotides incorporated was 1-5 x 10/sup -3/. The viral polymerase of a poliovirus temperature sensitive RNA-negative mutant, Ts 10, was isolated. This study confirmed that the mutant was viable 33/sup 0/, but was RNA negative at 39/sup 0/. Characterization of the Ts 10 polymerase showed it was significantly more sensitive to heat inactivation than was the old-type polymerase. Highly purified poliovirions were found to contain several noncapsid proteins. At least two of these proteins were labeled by (/sup 35/S)methionine infected cells and appeared to be virally encoded proteins. One of these proteins was immunoprecipitated by anti-3B/sup vpg/ antiserum. This protein had the approximate Mr = 50,000 and appeared to be one of the previously identified 3B/sup vpg/ precursor proteins.« less
-
Overcoming a nucleosomal barrier to replication
Chang, Han-Wen; Pandey, Manjula; Kulaeva, Olga I.; Patel, Smita S.; Studitsky, Vasily M.
2016-01-01
Efficient overcoming and accurate maintenance of chromatin structure and associated histone marks during DNA replication are essential for normal functioning of the daughter cells. However, the molecular mechanisms of replication through chromatin are unknown. We have studied traversal of uniquely positioned mononucleosomes by T7 replisome in vitro. Nucleosomes present a strong, sequence-dependent barrier for replication, with particularly strong pausing of DNA polymerase at the +(31–40) and +(41–65) regions of the nucleosomal DNA. The exonuclease activity of T7 DNA polymerase increases the overall rate of progression of the replisome through a nucleosome, likely by resolving nonproductive complexes. The presence of nucleosome-free DNA upstream of the replication fork facilitates the progression of DNA polymerase through the nucleosome. After replication, at least 50% of the nucleosomes assume an alternative conformation, maintaining their original positions on the DNA. Our data suggest a previously unpublished mechanism for nucleosome maintenance during replication, likely involving transient formation of an intranucleosomal DNA loop. PMID:27847876
-
Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G.; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E.; Takeda, Shunichi
2015-01-01
The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356
-
Al-Khouri, Anna Maria; Paule, Marvin R.
2002-01-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852
-
Al-Khouri, Anna Maria; Paule, Marvin R
2002-02-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.
-
Roles of exonucleases and translesion synthesis DNA polymerases during mitotic gap repair in yeast
Guo, Xiaoge; Jinks-Robertson, Sue
2013-01-01
Transformation-based gap-repair assays have long been used to model the repair of mitotic double-strand breaks (DSBs) by homologous recombination in yeast. In the current study, we examine genetic requirements of two key processes involved in DSB repair: (1) the processive 5′-end resection that is required to efficiently engage a repair template and (2) the filling of resected ends by DNA polymerases. The specific gap-repair assay used allows repair events resolved as crossover versus noncrossover products to be distinguished, as well as the extent of heteroduplex DNA formed during recombination to be measured. To examine end resection, the efficiency and outcome of gap repair were monitored in the absence of the Exo1 exonuclease and the Sgs1 helicase. We found that either Exo1 or Sgs1 presence is sufficient to inhibit gap-repair efficiency over 10-fold, consistent with resection-mediated destruction of the introduced plasmid. In terms of DNA polymerase requirements for gap repair, we focused specifically on potential roles of the Pol ζ and Pol η translesion synthesis DNA polymerases. We found that both Pol ζ and Pol η are necessary for efficient gap repair and that each functions independently of the other. These polymerases may be either in the initiation of DNA synthesis from the an invading end, or in a gap-filling process that is required to complete recombination. PMID:24210827
-
In Vitro Lesion Bypass Studies of O(4)-Alkylthymidines with Human DNA Polymerase η.
Williams, Nicole L; Wang, Pengcheng; Wu, Jiabin; Wang, Yinsheng
2016-04-18
Environmental exposure and endogenous metabolism can give rise to DNA alkylation. Among alkylated nucleosides, O(4)-alkylthymidine (O(4)-alkyldT) lesions are poorly repaired in mammalian systems and may compromise the efficiency and fidelity of cellular DNA replication. To cope with replication-stalling DNA lesions, cells are equipped with translesion synthesis DNA polymerases that are capable of bypassing various DNA lesions. In this study, we assessed human DNA polymerase η (Pol η)-mediated bypass of various O(4)-alkyldT lesions, with the alkyl group being Me, Et, nPr, iPr, nBu, iBu, (R)-sBu, or (S)-sBu, in template DNA by conducting primer extension and steady-state kinetic assays. Our primer extension assay results revealed that human Pol η, but not human polymerases κ and ι or yeast polymerase ζ, was capable of bypassing all O(4)-alkyldT lesions and extending the primer to generate full-length replication products. Data from steady-state kinetic measurements showed that Pol η preferentially misincorporated dGMP opposite O(4)-alkyldT lesions with a straight-chain alkyl group. The nucleotide misincorporation opposite most lesions with a branched-chain alkyl group was, however, not selective, where dCMP, dGMP, and dTMP were inserted at similar efficiencies opposite O(4)-iPrdT, O(4)-iBudT, and O(4)-(R)-sBudT. These results provide important knowledge about the effects of the length and structure of the alkyl group in O(4)-alkyldT lesions on the fidelity and efficiency of DNA replication mediated by human Pol η.
-
Yuan, Quan; McHenry, Charles S
2009-11-13
In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.
-
Mendez, Frances; Kozin, Elliott; Bases, Robert
2003-01-01
Base excision repair (BER) of damaged deoxyribonucleic acid (DNA) is a multistep process during which potentially lethal abasic sites temporarily exist. Repair of these lesions is greatly stimulated by heat shock protein 70 (Hsp70), which enhances strand incision and removal of the abasic sites by human apurinic-apyrimidinic endonuclease (HAP1). The resulting single-strand gaps must then be filled in. Here, we show that Hsp70 and its 48- and 43-kDa N-terminal domains greatly stimulated filling in the single-strand gaps by DNA polymerase β, a novel finding that extends the role of Hsps in DNA repair. Incorporation of deoxyguanosine monophosphate (dGMP) to fill in single-strand gaps in DNA phagemid pBKS by DNA polymerase β was stimulated by Hsp70. Truncated proteins derived from the C-terminus of Hsp70 as well as unrelated proteins were less effective, but proteins derived from the N-terminus of Hsp70 remained efficient stimulators of DNA polymerase β repair of DNA single-strand gaps. In agreement with these results, repair of a gap in a 30-bp oligonucleotide by polymerase β also was strongly stimulated by Hsp70 although not by a truncated protein from the C-terminus of Hsp70. Sealing of the repaired site in the oligonucleotide by human DNA ligase 1 was not specifically stimulated by Hsp-related proteins. Results presented here now implicate and extend the role of Hsp70 as a partner in the enzymatic repair of damaged DNA. The participation of Hsp70 jointly with base excision enzymes improves repair efficiency by mechanisms that are not yet understood. PMID:14627201
-
DNA damage mediated transcription arrest: Step back to go forward.
Mullenders, Leon
2015-12-01
The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.
-
A possible role for chromium(III) in genotoxicity.
Snow, E T
1991-05-01
Chromium is found in the environment in two major forms: reduced CrIII and CrVI, or chromate. Chromate, the most biologically active species, is readily taken up by living cells and reduced intracellularly, via reactive intermediates, to stable CrIII species. CrIII, the most abundant form of chromium in the environment, does not readily cross cell membranes and is relatively inactive in vivo. However, intracellular CrIII can react slowly with both nucleic acids and proteins and can be genotoxic. We have investigated the genotoxicity of CrIII in vitro using a DNA replication assay and in vivo by CaCl2-mediated transfection of chromium-treated DNA into Escherichia coli. When DNA replication was measured on a CrIII-treated template using purified DNA polymerases (either bacterial or mammalian), both the rate of DNA replication and the amount of incorporation per polymerase binding event (processivity) were greatly increased relative to controls. When transfected into E. coli, CrIII-treated M13mp2 bacteriophage DNA showed a dose-dependent increase in mutation frequency. These results suggest that CrIII alters the interaction between the DNA template and the polymerase such that the binding strength of the DNA polymerase is increased and the fidelity of DNA replication is decreased. These interactions may contribute to the mutagenicity of chromium ions in vivo and suggest that CrIII can contribute to chromium-mediated carcinogenesis.
-
Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A
2010-12-01
Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.
-
Enzyme-free detection and quantification of double-stranded nucleic acids.
Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle
2012-08-01
We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.
-
Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli
Kato, Jun-ichi; Katayama, Tsutomu
2001-01-01
The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the β-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA+, as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA+ proteins that comprise the apparatus regulating the activity of the initiator of replication. PMID:11483528
-
Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.
Kato , J; Katayama, T
2001-08-01
The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the beta-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA(+), as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA(+) proteins that comprise the apparatus regulating the activity of the initiator of replication.
-
Makarova, Alena V.; Burgers, Peter M.
2015-01-01
This review focuses on eukaryotic DNA polymerase ζ (Pol ζ), the enzyme responsible for the bulk of mutagenesis in eukaryotic cells in response to DNA damage. Pol ζ is also responsible for a large portion of mutagenesis during normal cell growth, in response to spontaneous damage or to certain DNA structures and other blocks that stall DNA replication forks. Novel insights in mutagenesis have been derived from recent advances in the elucidation of the subunit structure of Pol ζ. The lagging strand DNA polymerase δ shares the small Pol31 and Pol32 subunits with the Rev3-Rev7 core assembly giving a four subunit Pol ζ complex that is the active form in mutagenesis. Furthermore, Pol ζ forms essential interactions with the mutasome assembly factor Rev1 and with proliferating cell nuclear antigen (PCNA). These interactions are modulated by posttranslational modifications such as ubiquitination and phosphorylation that enhance translesion synthesis (TLS) and mutagenesis. PMID:25737057
-
Pozhidaeva, Alexandra; Pustovalova, Yulia; D'Souza, Sanjay; Bezsonova, Irina; Walker, Graham C.; Korzhnev, Dmitry M.
2013-01-01
Rev1 is a translesion synthesis (TLS) DNA polymerase essential for DNA damage tolerance in eukaryotes. In the process of TLS stalled high-fidelity replicative DNA polymerases are temporarily replaced by specialized TLS enzymes that can bypass sites of DNA damage (lesions), thus allowing replication to continue or postreplicational gaps to be filled. Despite its limited catalytic activity, human Rev1 plays a key role in TLS by serving as a scaffold that provides an access of Y-family TLS polymerases polη, ι, and κ to their cognate DNA lesions and facilitates their subsequent exchange to polζ that extends the distorted DNA primer-template. Rev1 interaction with the other major human TLS polymerases, polη, ι, κ and the regulatory subunit Rev7 of polζ, is mediated by Rev1 C-terminal domain (Rev1-CT). We used NMR spectroscopy to determine the spatial structure of the Rev1-CT domain (residues 1157-1251) and its complex with Rev1 interacting region (RIR) from polη (residues 524-539). The domain forms a four-helix bundle with a well-structured N-terminal β-hairpin docking against helices 1 and 2, creating a binding pocket for the two conserved Phe residues of the RIR motif that upon binding folds into an α-helix. NMR spin-relaxation and NMR relaxation dispersion measurements suggest that free Rev1-CT and Rev1-CT/polη-RIR complex exhibit μs-ms conformational dynamics encompassing the RIR binding site, which might facilitate selection of the molecular configuration optimal for binding. These results offer new insights into the control of TLS in human cells by providing a structural basis for understanding the recognition of the Rev1-CT by Y-family DNA polymerases. PMID:22691049
-
Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós
2017-12-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.
-
NASA Astrophysics Data System (ADS)
Digard, Paul; Williams, Kevin P.; Hensley, Preston; Brooks, Ian S.; Dahl, Charles E.; Coen, Donald M.
1995-02-01
The herpes simplex virus DNA polymerase consists of two subunits-a catalytic subunit and an accessory subunit, UL42, that increases processivity. Mutations affecting the extreme C terminus of the catalytic subunit specifically disrupt subunit interactions and ablate virus replication, suggesting that new antiviral drugs could be rationally designed to interfere with polymerase heterodimerization. To aid design, we performed circular dichroism (CD) spectroscopy and analytical ultracentrifugation studies, which revealed that a 36-residue peptide corresponding to the C terminus of the catalytic subunit folds into a monomeric structure with partial α-helical character. CD studies of shorter peptides were consistent with a model where two separate regions of α-helix interact to form a hairpin-like structure. The 36-residue peptide and a shorter peptide corresponding to the C-terminal 18 residues blocked UL42-dependent long-chain DNA synthesis at concentrations that had no effect on synthesis by the catalytic subunit alone or by calf thymus DNA polymerase δ and its processivity factor. These peptides, therefore, represent a class of specific inhibitors of herpes simplex virus DNA polymerase that act by blocking accessory-subunit-dependent synthesis. These peptides or their structures may form the basis for the synthesis of clinically effective drugs.
-
Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.
2001-01-01
We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035
-
Off-Target Effects of Drugs that Disrupt Human Mitochondrial DNA Maintenance
Young, Matthew J.
2017-01-01
Nucleoside reverse transcriptase inhibitors (NRTIs) were the first drugs used to treat human immunodeficiency virus (HIV) the cause of acquired immunodeficiency syndrome. Development of severe mitochondrial toxicity has been well documented in patients infected with HIV and administered NRTIs. In vitro biochemical experiments have demonstrated that the replicative mitochondrial DNA (mtDNA) polymerase gamma, Polg, is a sensitive target for inhibition by metabolically active forms of NRTIs, nucleotide reverse transcriptase inhibitors (NtRTIs). Once incorporated into newly synthesized daughter strands NtRTIs block further DNA polymerization reactions. Human cell culture and animal studies have demonstrated that cell lines and mice exposed to NRTIs display mtDNA depletion. Further complicating NRTI off-target effects on mtDNA maintenance, two additional DNA polymerases, Pol beta and PrimPol, were recently reported to localize to mitochondria as well as the nucleus. Similar to Polg, in vitro work has demonstrated both Pol beta and PrimPol incorporate NtRTIs into nascent DNA. Cell culture and biochemical experiments have also demonstrated that antiviral ribonucleoside drugs developed to treat hepatitis C infection act as off-target substrates for POLRMT, the mitochondrial RNA polymerase and primase. Accompanying the above-mentioned topics, this review examines: (1) mtDNA maintenance in human health and disease, (2) reports of DNA polymerases theta and zeta (Rev3) localizing to mitochondria, and (3) additional drugs with off-target effects on mitochondrial function. Lastly, mtDNA damage may induce cell death; therefore, the possibility of utilizing compounds that disrupt mtDNA maintenance to kill cancer cells is discussed. PMID:29214156
-
Genna, Vito; Gaspari, Roberto; Dal Peraro, Matteo; De Vivo, Marco
2016-04-07
Trans-lesion synthesis polymerases, like DNA Polymerase-η (Pol-η), are essential for cell survival. Pol-η bypasses ultraviolet-induced DNA damages via a two-metal-ion mechanism that assures DNA strand elongation, with formation of the leaving group pyrophosphate (PPi). Recent structural and kinetics studies have shown that Pol-η function depends on the highly flexible and conserved Arg61 and, intriguingly, on a transient third ion resolved at the catalytic site, as lately observed in other nucleic acid-processing metalloenzymes. How these conserved structural features facilitate DNA replication, however, is still poorly understood. Through extended molecular dynamics and free energy simulations, we unravel a highly cooperative and dynamic mechanism for DNA elongation and repair, which is here described by an equilibrium ensemble of structures that connect the reactants to the products in Pol-η catalysis. We reveal that specific conformations of Arg61 help facilitate the recruitment of the incoming base and favor the proper formation of a pre-reactive complex in Pol-η for efficient DNA editing. Also, we show that a third transient metal ion, which acts concertedly with Arg61, serves as an exit shuttle for the leaving PPi. Finally, we discuss how this effective and cooperative mechanism for DNA repair may be shared by other DNA-repairing polymerases. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi
2016-02-01
DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
-
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
-
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
-
Kozmin, Stanislav G; Pavlov, Youri I; Kunkel, Thomas A; Sage, Evelyne
2003-08-01
Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase eta (Poleta) and polymerase zeta (Polzeta), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310-1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Delta, rev3Delta and rev3Delta rad30Delta strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6-4) photoproducts derived from studies with UVC. They further suggest that Poleta participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polzeta is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polzeta, Poleta contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine.
-
Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis
Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai
2010-01-01
The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817
-
Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P
1983-01-01
A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366
-
Emergence of a replicating species from an in vitro RNA evolution reaction
NASA Technical Reports Server (NTRS)
Breaker, R. R.; Joyce, G. F.
1994-01-01
The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.
-
Shcherbakov, V. P.; Plugina, L. A.; Kudryashova, E. A.
1995-01-01
Recombinational effects of the antimutator allele tsL42 of gene 43 of phage T4, encoding DNA polymerase, were studied in crosses between rIIB mutants. Recombination under tsL42-restricted conditions differed from the normal one in several respects: (1) basic recombination was enhanced, especially within very short distances; (2) mismatch repair tracts were shortened, while the contribution of mismatch repair to recombination was not changed; (3) marker interference at very short distances was augmented. We infer that the T4 DNA polymerase is directly involved in mismatch repair, performing both excision of a nonmatched single strand (by its 3' -> 5' exonuclease) and filling the resulting gap. A pathway for the mismatch repair was substantiated; it includes sequential action of endo VII (gp49) -> 3'->5' exonuclease (gp43) -> DNA polymerase (gp43) -> DNA ligase (gp30). It is argued that the marker interference at very short distances may result from the same sequence of events during the final processing of recombinational intermediates. PMID:7635281
-
Xuan, Feng; Luo, Xiaoteng; Hsing, I-Ming
2012-05-15
A highly sensitive electrochemical DNA sensor that requires no probe immobilization has been developed based on a target recycling mechanism utilizing a DNA polymerase with a strand displacement activity. The electrochemical detection is realized by taking advantage of the difference in diffusivity between a free ferrocene-labeled peptide nucleic acid (Fc-PNA) and a Fc-PNA hybridized with a complementary DNA, while the DNA polymerase-assisted target recycling leads to signal generation and amplification. The hybridization of the target DNA opens up a stem-loop template DNA with the Fc-PNA hybridized to its extruded 5' end and allows a DNA primer to anneal and be extended by the DNA polymerase, which results in sequential displacement of the target DNA and the Fc-PNA from the template DNA. The displaced target DNA will hybridize with another template DNA, triggering another round of primer extension and strand displacement. The released Fc-PNA, due to its neutral backbone, has much higher diffusivity towards a negatively charged electrode, compared to that when it is hybridized with a negatively charged DNA. Therefore, a significantly enhanced signal of Fc can be observed. The outstanding sensitivity and simplicity make this approach a promising candidate for next-generation electrochemical DNA sensing technologies. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.
2015-01-01
Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
-
Mitochondrial DNA replication: a PrimPol perspective
Bailey, Laura J.
2017-01-01
PrimPol, (primase–polymerase), the most recently identified eukaryotic polymerase, has roles in both nuclear and mitochondrial DNA maintenance. PrimPol is capable of acting as a DNA polymerase, with the ability to extend primers and also bypass a variety of oxidative and photolesions. In addition, PrimPol also functions as a primase, catalysing the preferential formation of DNA primers in a zinc finger-dependent manner. Although PrimPol's catalytic activities have been uncovered in vitro, we still know little about how and why it is targeted to the mitochondrion and what its key roles are in the maintenance of this multicopy DNA molecule. Unlike nuclear DNA, the mammalian mitochondrial genome is circular and the organelle has many unique proteins essential for its maintenance, presenting a differing environment within which PrimPol must function. Here, we discuss what is currently known about the mechanisms of DNA replication in the mitochondrion, the proteins that carry out these processes and how PrimPol is likely to be involved in assisting this vital cellular process. PMID:28408491
-
Allosteric transcriptional regulation via changes in the overall topology of the core promoter
Philips, Steven J.; Canalizo-Hernandez, Monica; Yildirim, Ilyas; ...
2015-08-21
Many transcriptional activators act at a distance from core promoter elements and work by recruiting RNA polymerase through protein-protein interactions. We show here how the prokaryotic regulatory protein CueR both represses and activates transcription by differentially modulating local DNA structure within the promoter. Structural studies reveal that the repressor state slightly bends the promoter DNA, precluding optimal RNA polymerase-promoter recognition. Upon binding a metal ion in the allosteric site, CueR switches into an activator conformation. It maintains all protein-DNA contacts but introduces torsional stresses that kink and undertwist the promoter, stabilizing an A-DNA-like conformation. Finally, these factors switch on andmore » off transcription by exerting dynamic control of DNA stereochemistry, reshaping the core promoter and making it a better or worse substrate for polymerase.« less
-
Besmer, Eva; Market, Eleonora; Papavasiliou, F. Nina
2006-01-01
Activation-induced cytidine deaminase (AID) is a single-stranded DNA deaminase required for somatic hypermutation of immunoglobulin (Ig) genes, a key process in the development of adaptive immunity. Transcription provides a single-stranded DNA substrate for AID, both in vivo and in vitro. We present here an assay which can faithfully replicate all of the molecular features of the initiation of hypermutation of Ig genes in vivo. In this assay, which detects AID-mediated deamination in the context of transcription by Escherichia coli RNA polymerase, deamination targets either strand and declines in efficiency as the distance from the promoter increases. We show that AID binds DNA exposed by the transcribing polymerase, implicating the polymerase itself as the vehicle which distributes AID on DNA as it moves away from the promoter. PMID:16705187
-
Stumpf, Jeffrey D.; Copeland, William C.
2014-01-01
Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but suppresses MMS-induced mutagenesis. These results suggest a novel mechanism wherein mutations that lead to hypermutation by DNA base-damaging agents and associate with mitochondrial disease may contribute to previously unexplained phenomena, such as the wide variation of age of disease onset and acquired mitochondrial toxicities. PMID:25340760
-
Stumpf, Jeffrey D; Copeland, William C
2014-10-01
Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but suppresses MMS-induced mutagenesis. These results suggest a novel mechanism wherein mutations that lead to hypermutation by DNA base-damaging agents and associate with mitochondrial disease may contribute to previously unexplained phenomena, such as the wide variation of age of disease onset and acquired mitochondrial toxicities.
-
Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.
1999-01-01
Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307
-
Capella, Cristina; Beltejar, Michael-John; Brown, Caitlin; Fong, Vincent; Daddacha, Waaqo; Kim, Baek
2012-01-01
Mutations that reduce the efficiency of deoxynucleoside (dN) triphosphate (dNTP) substrate utilization by the HIV-1 DNA polymerase prevent viral replication in resting cells, which contain low dNTP concentrations, but not in rapidly dividing cells such as cancer cells, which contain high levels of dNTPs. We therefore tested whether mutations in regions of the adenovirus type 5 (Ad5) DNA polymerase that interact with the dNTP substrate or DNA template could alter virus replication. The majority of the mutations created, including conservative substitutions, were incompatible with virus replication. Five replication-competent mutants were recovered from 293 cells, but four of these mutants failed to replicate in A549 lung carcinoma cells and Wi38 normal lung cells. Purified polymerase proteins from these viruses exhibited only a 2- to 4-fold reduction in their dNTP utilization efficiency but nonetheless could not be rescued, even when intracellular dNTP concentrations were artificially raised by the addition of exogenous dNs to virus-infected A549 cells. The fifth mutation (I664V) reduced biochemical dNTP utilization by the viral polymerase by 2.5-fold. The corresponding virus replicated to wild-type levels in three different cancer cell lines but was significantly impaired in all normal cell lines in which it was tested. Efficient replication and virus-mediated cell killing were rescued by the addition of exogenous dNs to normal lung fibroblasts (MRC5 cells), confirming the dNTP-dependent nature of the polymerase defect. Collectively, these data provide proof-of-concept support for the notion that conditionally replicating, tumor-selective adenovirus vectors can be created by modifying the efficiency with which the viral DNA polymerase utilizes dNTP substrates. PMID:22811532
-
Functional conservation of RNA polymerase II in fission and budding yeasts.
Shpakovski, G V; Gadal, O; Labarre-Mariotte, S; Lebedenko, E N; Miklos, I; Sakurai, H; Proshkin, S A; Van Mullem, V; Ishihama, A; Thuriaux, P
2000-02-04
The complementary DNAs of the 12 subunits of fission yeast (Schizosaccharomyces pombe) RNA polymerase II were expressed from strong promoters in Saccharomyces cerevisiae and tested for heterospecific complementation by monitoring their ability to replace in vivo the null mutants of the corresponding host genes. Rpb1 and Rpb2, the two largest subunits and Rpb8, a small subunit shared by all three polymerases, failed to support growth in S. cerevisiae. The remaining nine subunits were all proficient for heterospecific complementation and led in most cases to a wild-type level of growth. The two alpha-like subunits (Rpb3 and Rpb11), however, did not support growth at high (37 degrees C) or low (25 degrees C) temperatures. In the case of Rpb3, growth was restored by increasing the gene dosage of the host Rpb11 or Rpb10 subunits, confirming previous evidence of a close genetic interaction between these three subunits. Copyright 2000 Academic Press.
-
Ubiquitin mediates the physical and functional interaction between human DNA polymerases η and ι
McIntyre, Justyna; Vidal, Antonio E.; McLenigan, Mary P.; Bomar, Martha G.; Curti, Elena; McDonald, John P.; Plosky, Brian S.; Ohashi, Eiji; Woodgate, Roger
2013-01-01
Human DNA polymerases η and ι are best characterized for their ability to facilitate translesion DNA synthesis (TLS). Both polymerases (pols) co-localize in ‘replication factories’ in vivo after cells are exposed to ultraviolet light and this co-localization is mediated through a physical interaction between the two TLS pols. We have mapped the polη-ι interacting region to their respective ubiquitin-binding domains (UBZ in polη and UBM1 and UBM2 in polι), and demonstrate that ubiquitination of either TLS polymerase is a prerequisite for their physical and functional interaction. Importantly, while monoubiquitination of polη precludes its ability to interact with proliferating cell nuclear antigen (PCNA), it enhances its interaction with polι. Furthermore, a polι-ubiquitin chimera interacts avidly with both polη and PCNA. Thus, the ubiquitination status of polη, or polι plays a key regulatory function in controlling the protein partners with which each polymerase interacts, and in doing so, determines the efficiency of targeting the respective polymerase to stalled replication forks where they facilitate TLS. PMID:23248005
-
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Shoudeng; Rufiange, Anne; Huang, Hongda
Cells use specific mechanisms such as histone chaperones to abrogate the inherent barrier that the nucleosome poses to transcribing polymerases. The current model postulates that nucleosomes can be transiently disrupted to accommodate passage of RNA polymerases and that histones H3 and H4 possess their own chaperones dedicated to the recovery of nucleosomes. Here, we determined the crystal structure of the conserved C terminus of human Suppressors of Ty insertions 2 (hSpt2C) chaperone bound to an H3/H4 tetramer. The structural studies demonstrate that hSpt2C is bound to the periphery of the H3/H4 tetramer, mimicking the trajectory of nucleosomal-bound DNA. These structuralmore » studies have been complemented with in vitro binding and in vivo functional studies on mutants that disrupt key intermolecular contacts involving two acidic patches and hydrophobic residues on Spt2C. We show that contacts between both human and yeast Spt2C with the H3/H4 tetramer are required for the suppression of H3/ H4 exchange as measured by H3K56ac and new H3 deposition. Furthermore, these interactions are also crucial for the inhibition of spurious transcription from within coding regions. In conclusion, together, our data indicate that Spt2 interacts with the periphery of the H3/H4 tetramer and promotes its recycling in the wake of RNA polymerase.« less
-
Chen, Shoudeng; Rufiange, Anne; Huang, Hongda; ...
2015-06-15
Cells use specific mechanisms such as histone chaperones to abrogate the inherent barrier that the nucleosome poses to transcribing polymerases. The current model postulates that nucleosomes can be transiently disrupted to accommodate passage of RNA polymerases and that histones H3 and H4 possess their own chaperones dedicated to the recovery of nucleosomes. Here, we determined the crystal structure of the conserved C terminus of human Suppressors of Ty insertions 2 (hSpt2C) chaperone bound to an H3/H4 tetramer. The structural studies demonstrate that hSpt2C is bound to the periphery of the H3/H4 tetramer, mimicking the trajectory of nucleosomal-bound DNA. These structuralmore » studies have been complemented with in vitro binding and in vivo functional studies on mutants that disrupt key intermolecular contacts involving two acidic patches and hydrophobic residues on Spt2C. We show that contacts between both human and yeast Spt2C with the H3/H4 tetramer are required for the suppression of H3/ H4 exchange as measured by H3K56ac and new H3 deposition. Furthermore, these interactions are also crucial for the inhibition of spurious transcription from within coding regions. In conclusion, together, our data indicate that Spt2 interacts with the periphery of the H3/H4 tetramer and promotes its recycling in the wake of RNA polymerase.« less
-
JPRS Report, Science and Technology USSR: Life Sciences.
1990-07-16
4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data
-
Regulatory Control of Breast Tumor Cell Poly (ADP-Ribose) Polymerase
2002-08-01
DNA replication complex (designated the DNA synthesome) from a variety of non-malignant and malignant tumor cells including breast cancer cells. We have shown that poly(ADP-ribose) polymerase PARP is among the components of the DNA synthesome. The transformation of a non-malignant human breast cell to a malignant state was accompanied by a significant alteration in the 2-D PAGE profile of specific protein components of the DNA synthesome (such as PCNA) together with a 6-8 decrease in the replication fidelity of the DNA
-
Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V
2003-12-01
This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.
-
Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel
1991-01-01
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.
-
DNA polymerase η mutational signatures are found in a variety of different types of cancer.
Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I
2018-01-01
DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.
-
Transcription in Yeast: Separation and Properties of Multiple RNA Polymerases
Adman, Ray; Schultz, Loren D.; Hall, Benjamin D.
1972-01-01
Four peaks of DNA-directed RNA polymerase activity are resolved by salt gradient elution of a sonicated yeast cell extract on DEAE-Sephadex. The enzymes, which are named IA, IB, II, and III in order of elution, all appear to come from cell nuclei. Only enzyme II is sensitive to α-amanitin. All enzymes are more active with Mn++ than with Mg++ as divalent ion. Enzymes IB and II have salt optima in the range 0.05-0.10 M (NH4)2SO4, whereas enzyme III is maximally active at 0.20-0.25 M (NH4)2SO4. With optimal salt concentration and saturating DNA, the template preference ratio, activity on native calfthymus DNA divided by activity on denatured calf-thymus DNA, is 2.2 for IB, 0.4 for II, and 3.5 for III. None of the yeast polymerases was inhibited by rifamycin SV. Rifamycin AF/013 effectively inhibited polymerases IB, II, and III. PMID:4558656
-
Julkunen, Heikki; Ekblom-Kullberg, Susanne; Miettinen, Aaro
2012-08-01
Associations of different assays for antibodies to C1q (anti-C1q) and to dsDNA (anti-dsDNA) and of complements C3 and C4 with disease activity in patients with systemic lupus erythematosus (SLE) were studied. The clinical manifestations of 223 SLE patients were recorded, and the disease activity was assessed by the SLEDAI score. Anti-C1q were determined by two enzyme-linked immunosorbent assays (ELISA) and anti-dsDNA by a radioimmunoassay (RIA), a Crithidia immunofluorescence (IF) assay and three ELISA assays using human telomere DNA, plasmid DNA circles, or calf thymus DNA as antigens, respectively. Complement C3 and C4 were determined by nephelometry. Control sera were obtained from 98 blood donors. In patients with SLE, the prevalence of anti-C1q was 17-18% and that of anti-dsDNA was 36-69%. Anti-C1q, anti-dsDNA, and complement C3 and C4 correlated well with the overall activity of SLE (r = 0.323-0.351, 0.353-0.566, and -0.372-0.444, respectively; P < 0.001). Sensitivity, specificity, positive predictive value, and negative predictive value for active lupus nephritis among SLE patients were 40-44, 92, 29, and 91-92% for anti-C1q and 48-68, 29-66, 11-16, and 86-91% for anti-dsDNA, respectively. Patients with active nephritis had higher levels of anti-C1q and lower levels of C3 and C4 than patients with inactive nephritis (P = 0.003-0.018). The corresponding associations of anti-dsDNA were somewhat weaker (P = 0.023-0.198). Hematological parameters reflecting disease activity correlated clearly better with anti-dsDNA and complement C3 and C4 than with anti-C1q. Anti-C1q is inferior to anti-dsDNA as a diagnostic test in SLE and in the evaluation of overall clinical activity of the disease. Anti-C1q together with complement C3 and C4 may offer useful additional information to monitor lupus nephritis activity. There are no practical differences between different assays for anti-C1q and anti-dsDNA.
-
Interactions and Localization of Escherichia coli Error-Prone DNA Polymerase IV after DNA Damage.
Mallik, Sarita; Popodi, Ellen M; Hanson, Andrew J; Foster, Patricia L
2015-09-01
Escherichia coli's DNA polymerase IV (Pol IV/DinB), a member of the Y family of error-prone polymerases, is induced during the SOS response to DNA damage and is responsible for translesion bypass and adaptive (stress-induced) mutation. In this study, the localization of Pol IV after DNA damage was followed using fluorescent fusions. After exposure of E. coli to DNA-damaging agents, fluorescently tagged Pol IV localized to the nucleoid as foci. Stepwise photobleaching indicated ∼60% of the foci consisted of three Pol IV molecules, while ∼40% consisted of six Pol IV molecules. Fluorescently tagged Rep, a replication accessory DNA helicase, was recruited to the Pol IV foci after DNA damage, suggesting that the in vitro interaction between Rep and Pol IV reported previously also occurs in vivo. Fluorescently tagged RecA also formed foci after DNA damage, and Pol IV localized to them. To investigate if Pol IV localizes to double-strand breaks (DSBs), an I-SceI endonuclease-mediated DSB was introduced close to a fluorescently labeled LacO array on the chromosome. After DSB induction, Pol IV localized to the DSB site in ∼70% of SOS-induced cells. RecA also formed foci at the DSB sites, and Pol IV localized to the RecA foci. These results suggest that Pol IV interacts with RecA in vivo and is recruited to sites of DSBs to aid in the restoration of DNA replication. DNA polymerase IV (Pol IV/DinB) is an error-prone DNA polymerase capable of bypassing DNA lesions and aiding in the restart of stalled replication forks. In this work, we demonstrate in vivo localization of fluorescently tagged Pol IV to the nucleoid after DNA damage and to DNA double-strand breaks. We show colocalization of Pol IV with two proteins: Rep DNA helicase, which participates in replication, and RecA, which catalyzes recombinational repair of stalled replication forks. Time course experiments suggest that Pol IV recruits Rep and that RecA recruits Pol IV. These findings provide in vivo evidence that Pol IV aids in maintaining genomic stability not only by bypassing DNA lesions but also by participating in the restoration of stalled replication forks. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Linear nicking endonuclease-mediated strand-displacement DNA amplification.
Joneja, Aric; Huang, Xiaohua
2011-07-01
We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.
-
Linear nicking endonuclease-mediated strand displacement DNA amplification
Joneja, Aric; Huang, Xiaohua
2011-01-01
We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654
-
Faller, Maximilian; Wilhelmsson, Peter; Kjelland, Vivian; Andreassen, Åshild; Dargis, Rimtas; Quarsten, Hanne; Dessau, Ram; Fingerle, Volker; Margos, Gabriele; Noraas, Sølvi; Ornstein, Katharina; Petersson, Ann-Cathrine; Matussek, Andreas; Lindgren, Per-Eric; Henningsson, Anna J.
2017-01-01
Introduction Lyme borreliosis (LB) is the most common tick transmitted disease in Europe. The diagnosis of LB today is based on the patient´s medical history, clinical presentation and laboratory findings. The laboratory diagnostics are mainly based on antibody detection, but in certain conditions molecular detection by polymerase chain reaction (PCR) may serve as a complement. Aim The purpose of this study was to evaluate the analytical sensitivity, analytical specificity and concordance of eight different real-time PCR methods at five laboratories in Sweden, Norway and Denmark. Method Each participating laboratory was asked to analyse three different sets of samples (reference panels; all blinded) i) cDNA extracted and transcribed from water spiked with cultured Borrelia strains, ii) cerebrospinal fluid spiked with cultured Borrelia strains, and iii) DNA dilution series extracted from cultured Borrelia and relapsing fever strains. The results and the method descriptions of each laboratory were systematically evaluated. Results and conclusions The analytical sensitivities and the concordance between the eight protocols were in general high. The concordance was especially high between the protocols using 16S rRNA as the target gene, however, this concordance was mainly related to cDNA as the type of template. When comparing cDNA and DNA as the type of template the analytical sensitivity was in general higher for the protocols using DNA as template regardless of the use of target gene. The analytical specificity for all eight protocols was high. However, some protocols were not able to detect Borrelia spielmanii, Borrelia lusitaniae or Borrelia japonica. PMID:28937997
-
Redrejo-Rodríguez, Modesto; Ordóñez, Carlos D; Berjón-Otero, Mónica; Moreno-González, Juan; Aparicio-Maldonado, Cristian; Forterre, Patrick; Salas, Margarita; Krupovic, Mart
2017-11-07
Family B DNA polymerases (PolBs) play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB), that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
-
Human PrimPol activity is enhanced by RPA.
Martínez-Jiménez, María I; Lahera, Antonio; Blanco, Luis
2017-04-10
Human PrimPol is a primase belonging to the AEP superfamily with the unique ability to synthesize DNA primers de novo, and a non-processive DNA polymerase able to bypass certain DNA lesions. PrimPol facilitates both mitochondrial and nuclear replication fork progression either acting as a conventional TLS polymerase, or repriming downstream of blocking lesions. In vivo assays have shown that PrimPol is rapidly recruited to sites of DNA damage by interaction with the human replication protein A (RPA). In agreement with previous findings, we show here that the higher affinity of RPA for ssDNA inhibits PrimPol activities in short ssDNA templates. In contrast, once the amount of ssDNA increases up to a length in which both proteins can simultaneously bind ssDNA, as expected during replicative stress conditions, PrimPol and RPA functionally interact, and their binding capacities are mutually enhanced. When using M13 ssDNA as template, RPA stimulated both the primase and polymerase activities of PrimPol, either alone or in synergy with Polε. These new findings supports the existence of a functional PrimPol/RPA association that allows repriming at the exposed ssDNA regions formed in the leading strand upon replicase stalling.
-
Stochastic resetting in backtrack recovery by RNA polymerases
NASA Astrophysics Data System (ADS)
Roldán, Édgar; Lisica, Ana; Sánchez-Taltavull, Daniel; Grill, Stephan W.
2016-06-01
Transcription is a key process in gene expression, in which RNA polymerases produce a complementary RNA copy from a DNA template. RNA polymerization is frequently interrupted by backtracking, a process in which polymerases perform a random walk along the DNA template. Recovery of polymerases from the transcriptionally inactive backtracked state is determined by a kinetic competition between one-dimensional diffusion and RNA cleavage. Here we describe backtrack recovery as a continuous-time random walk, where the time for a polymerase to recover from a backtrack of a given depth is described as a first-passage time of a random walker to reach an absorbing state. We represent RNA cleavage as a stochastic resetting process and derive exact expressions for the recovery time distributions and mean recovery times from a given initial backtrack depth for both continuous and discrete-lattice descriptions of the random walk. We show that recovery time statistics do not depend on the discreteness of the DNA lattice when the rate of one-dimensional diffusion is large compared to the rate of cleavage.
-
[Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].
Shematorova, E K; Shpakovskiĭ, G V
2002-01-01
In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.
-
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1991-03-26
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.
-
Kannouche, Patricia; Broughton, Bernard C.; Volker, Marcel; Hanaoka, Fumio; Mullenders, Leon H.F.; Lehmann, Alan R.
2001-01-01
DNA polymerase η carries out translesion synthesis past UV photoproducts and is deficient in xeroderma pigmentosum (XP) variants. We report that polη is mostly localized uniformly in the nucleus but is associated with replication foci during S phase. Following treatment of cells with UV irradiation or carcinogens, it accumulates at replication foci stalled at DNA damage. The C-terminal third of polη is not required for polymerase activity. However, the C-terminal 70 aa are needed for nuclear localization and a further 50 aa for relocalization into foci. Polη truncations lacking these domains fail to correct the defects in XP-variant cells. Furthermore, we have identified mutations in two XP variant patients that leave the polymerase motifs intact but cause loss of the localization domains. PMID:11157773
-
Kozmin, Stanislav G.; Pavlov, Youri I.; Kunkel, Thomas A.; Sage, Evelyne
2003-01-01
Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase η (Polη) and polymerase ζ (Polζ), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310–1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Δ, rev3Δ and rev3Δ rad30Δ strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6–4) photoproducts derived from studies with UVC. They further suggest that Polη participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polζ is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polζ, Polη contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine. PMID:12888515
-
Killelea, Tom; Ghosh, Samantak; Tan, Samuel S; Heslop, Pauline; Firbank, Susan J; Kool, Eric T; Connolly, Bernard A
2010-07-13
Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describe uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at position 2 explains the stimulation of the polymerase 3'-5' proofreading exonuclease, observed with deaminated bases at this location. A beta-hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double-stranded DNA. This denatures the two complementary primer bases and directs the resulting 3' single-stranded extension toward the exonuclease active site. Finally, the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using nonpolar isosteres. Affinity for both 2,4-difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine, respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4-difluorobenzene is seen, confirming a role for shape recognition.
-
Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.
Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail
2014-01-01
Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.
-
Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.
2001-01-01
The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027
-
Identification of amino acid residues involved in the dRP-lyase activity of human Pol ι.
Miropolskaya, Nataliya; Petushkov, Ivan; Kulbachinskiy, Andrey; Makarova, Alena V
2017-08-31
Besides X-family DNA polymerases (first of all, Pol β) several other human DNA polymerases from Y- and A- families were shown to possess the dRP-lyase activity and could serve as backup polymerases in base excision repair (Pol ι, Rev1, Pol γ and Pol θ). However the exact position of the active sites and the amino acid residues involved in the dRP-lyase activity in Y- and A- family DNA polymerases are not known. Here we carried out functional analysis of fifteen amino acid residues possibly involved in the dRP-lyase activity of human Pol ι. We show that substitutions of residues Q59, K60 and K207 impair the dRP-lyase activity of Pol ι while residues in the HhH motif of the thumb domain are dispensable for this activity. While both K60G and K207A substitutions decrease Schiff-base intermediate formation during dRP group cleavage, the latter substitution also strongly affects the DNA polymerase activity of Pol ι, suggesting that it may impair DNA binding. These data are consistent with an important role of the N-terminal region in the dRP-lyase activity of Pol ι, with possible involvement of residues from the finger domain in the dRP group cleavage.
-
Juhas, Mario; Ajioka, James W
2017-11-01
The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
-
Structure and mechanism of human DNA polymerase [eta
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji
2010-11-03
The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assistmore » translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.« less
-
Euro, Liliya; Haapanen, Outi; Róg, Tomasz; Vattulainen, Ilpo; Suomalainen, Anu; Sharma, Vivek
2017-03-07
DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform in the "intrinsic processivity" subdomain of the enzyme. Our data indicate that noncatalytic mutations may disrupt replisomal interactions, thereby causing Pol γ-associated neurodegenerative disorders.
-
Covalent trapping of human DNA polymerase beta by the oxidative DNA lesion 2-deoxyribonolactone.
DeMott, Michael S; Beyret, Ergin; Wong, Donny; Bales, Brian C; Hwang, Jae-Taeg; Greenberg, Marc M; Demple, Bruce
2002-03-08
Oxidized abasic residues in DNA constitute a major class of radiation and oxidative damage. Free radical attack on the nucleotidyl C-1' carbon yields 2-deoxyribonolactone (dL) as a significant lesion. Although dL residues are efficiently incised by the main human abasic endonuclease enzyme Ape1, we show here that subsequent excision by human DNA polymerase beta is impaired at dL compared with unmodified abasic sites. This inhibition is accompanied by accumulation of a protein-DNA cross-link not observed in reactions of polymerase beta with unmodified abasic sites, although a similar form can be trapped by reduction with sodium borohydride. The formation of the stably cross-linked species with dL depends on the polymerase lysine 72 residue, which forms a Schiff base with the C-1 aldehyde during excision of an unmodified abasic site. In the case of a dL residue, attack on the lactone C-1 by lysine 72 proceeds more slowly and evidently produces an amide linkage, which resists further processing. Consequently dL residues may not be readily repaired by "short-patch" base excision repair but instead function as suicide substrates in the formation of protein-DNA cross-links that may require alternative modes of repair.
-
Sale, Julian E.; Batters, Christopher; Edmunds, Charlotte E.; Phillips, Lara G.; Simpson, Laura J.; Szüts, Dávid
2008-01-01
By temporarily deferring the repair of DNA lesions encountered during replication, the bypass of DNA damage is critical to the ability of cells to withstand genomic insults. Damage bypass can be achieved either by recombinational mechanisms that are generally accurate or by a process called translesion synthesis. Translesion synthesis involves replacing the stalled replicative polymerase with one of a number of specialized DNA polymerases whose active sites are able to tolerate a distorted or damaged DNA template. While this property allows the translesion polymerases to synthesize across damaged bases, it does so with the trade-off of an increased mutation rate. The deployment of these enzymes must therefore be carefully regulated. In addition to their important role in general DNA damage tolerance and mutagenesis, the translesion polymerases play a crucial role in converting the products of activation induced deaminase-catalysed cytidine deamination to mutations during immunoglobulin gene somatic hypermutation. In this paper, we specifically consider the control of translesion synthesis in the context of the timing of lesion bypass relative to replication fork progression and arrest at sites of DNA damage. We then examine how recent observations concerning the control of translesion synthesis might help refine our view of the mechanisms of immunoglobulin gene somatic hypermutation. PMID:19008194
-
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η.
O'Flaherty, D K; Patra, A; Su, Y; Guengerich, F P; Egli, M; Wilds, C J
2016-08-01
DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O 4 -Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4- O 4 bond on processing by human DNA polymerase η (hPol η ) was studied for oligonucleotides containing O 4 -methylthymidine, O 4 -ethylthymidine, and analogs restricting the O 4 -methylene group in an anti -orientation. Primer extension assays revealed that the O 4 -alkyl orientation influences hPol η bypass. Crystal structures of hPol η •DNA•dNTP ternary complexes with O 4 -methyl- or O 4 -ethylthymidine in the template strand showed the nucleobase of the former lodged near the ceiling of the active site, with the syn - O 4 -methyl group engaged in extensive hydrophobic interactions. This unique arrangement for O 4 -methylthymidine with hPol η , inaccessible for the other analogs due to steric/conformational restriction, is consistent with differences observed for nucleotide incorporation and supports the concept that lesion conformation influences extension across DNA damage. Together, these results provide mechanistic insights on the mutagenicity of O 4 MedT and O 4 EtdT when acted upon by hPol η .
-
Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J.; Berdis, Anthony J.
2016-01-01
This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. PMID:26717984
-
BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription
Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna
2012-01-01
Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380
-
BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.
Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna
2012-03-01
Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.
-
Localized Cerebral Energy Failure in DNA Polymerase Gamma-Associated Encephalopathy Syndromes
ERIC Educational Resources Information Center
Tzoulis, Charalampos; Neckelmann, Gesche; Mork, Sverre J.; Engelsen, Bernt E.; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A.
2010-01-01
Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that…
-
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1987-08-28
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.
-
Delagoutte, Emmanuelle; Goellner, Geoffrey M.; Guo, Jie; Baldacci, Giuseppe; McMurray, Cynthia T.
2008-01-01
Small insertions and deletions of trinucleotide repeats (TNRs) can occur by polymerase slippage and hairpin formation on either template or newly synthesized strands during replication. Although not predicted by a slippage model, deletions occur preferentially when 5′-CTG is in the lagging strand template and are highly favored over insertion events in rapidly replicating cells. The mechanism for the deletion bias and the orientation dependence of TNR instability is poorly understood. We report here that there is an orientation-dependent impediment to polymerase progression on 5′-CAG and 5′-CTG repeats that can be relieved by the binding of single-stranded DNA-binding protein. The block depends on the primary sequence of the TNR but does not correlate with the thermodynamic stability of hairpins. The orientation-dependent block of polymerase passage is the strongest when 5′-CAG is the template. We propose a “template-push” model in which the slow speed of DNA polymerase across the 5′-CAG leading strand template creates a threat to helicase-polymerase coupling. To prevent uncoupling, the TNR template is pushed out and by-passed. Hairpins do not cause the block, but appear to occur as a consequence of polymerase pass-over. PMID:18263578
-
Zahurancik, Walter J.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Suo, Zucai
2015-01-01
Numerous genetic studies have provided compelling evidence to establish DNA polymerase ε (Polε) as the primary DNA polymerase responsible for leading strand synthesis during eukaryotic nuclear genome replication. Polε is a heterotetramer consisting of a large catalytic subunit that contains the conserved polymerase core domain as well as a 3′ → 5′ exonuclease domain common to many replicative polymerases. In addition, Polε possesses three small subunits that lack a known catalytic activity but associate with components involved in a variety of DNA replication and maintenance processes. Previous enzymatic characterization of the Polε heterotetramer from budding yeast suggested that the small subunits slightly enhance DNA synthesis by Polε in vitro. However, similar studies of the human Polε heterote-tramer (hPolε) have been limited by the difficulty of obtaining hPolε in quantities suitable for thorough investigation of its catalytic activity. Utilization of a baculovirus expression system for overexpression and purification of hPolε from insect host cells has allowed for isolation of greater amounts of active hPolε, thus enabling a more detailed kinetic comparison between hPolε and an active N-terminal fragment of the hPolε catalytic subunit (p261N), which is readily overexpressed in Escherichia coli. Here, we report the first pre-steady-state studies of fully-assembled hPolε. We observe that the small subunits increase DNA binding by hPolε relative to p261N, but do not increase processivity during DNA synthesis on a single-stranded M13 template. Interestingly, the 3′ → 5′ exonuclease activity of hPolε is reduced relative to p261N on matched and mismatched DNA substrates, indicating that the presence of the small subunits may regulate the proofreading activity of hPolε and sway hPolε toward DNA synthesis rather than proofreading. PMID:25684708
-
The Balancing Act of Ribonucleotides in DNA
Cerritelli, Susana M.; Crouch, Robert J.
2016-01-01
The abundance of ribonucleotides in DNA remained undetected until recently because they are efficiently removed by the Ribonucleotides Excision Repair pathway, a process similar to Okazaki fragment processing after incision by RNase H2. All DNA polymerases incorporate ribonucleotides during DNA synthesis. How many, when and why they are incorporated has been the focus of intense work during recent years by many labs. In this review, we discuss recent advances in ribonucleotide incorporation by eukaryotic DNA polymerases that suggest an evolutionarily conserved role for ribonucleotides in DNA and review the data that indicate that removal of ribonucleotides plays an important role in maintaining genome stability. PMID:26996833
-
Unlocking the Sugar ‘Steric Gate’ of DNA Polymerases†
Brown, Jessica A.; Suo, Zucai
2011-01-01
To maintain genomic stability, ribonucleotide incorporation during DNA synthesis is controlled predominantly at the DNA polymerase level. A steric clash between the 2′-hydroxyl of an incoming ribonucleotide and a bulky active site residue, known as the ‘steric gate’, establishes an effective mechanism for most DNA polymerases to selectively insert deoxyribonucleotides. Recent kinetic, structural, and in vivo studies have illuminated novel features about ribonucleotide exclusion and the mechanistic consequences of ribonucleotide misincorporation on downstream events, such as the bypass of a ribonucleotide in a DNA template and the subsequent extension of the DNA lesion bypass product. These important findings are summarized in this review article. PMID:21226515
-
Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta
2015-07-13
We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.
-
Blinkowa, A
1976-01-01
The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.
-
PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.
Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi
2009-07-01
Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.
-
Kemp, Michael G.; Sancar, Aziz
2016-01-01
ATR (ataxia telangiectasia and Rad-3-related) is a protein kinase that maintains genome stability and halts cell cycle phase transitions in response to DNA lesions that block DNA polymerase movement. These DNA replication-associated features of ATR function have led to the emergence of ATR kinase inhibitors as potential adjuvants for DNA-damaging cancer chemotherapeutics. However, whether ATR affects the genotoxic stress response in non-replicating, non-cycling cells is currently unknown. We therefore used chemical inhibition of ATR kinase activity to examine the role of ATR in quiescent human cells. Although ATR inhibition had no obvious effects on the viability of non-cycling cells, inhibition of ATR partially protected non-replicating cells from the lethal effects of UV and UV mimetics. Analyses of various DNA damage response signaling pathways demonstrated that ATR inhibition reduced the activation of apoptotic signaling by these agents in non-cycling cells. The pro-apoptosis/cell death function of ATR is likely due to transcription stress because the lethal effects of compounds that block RNA polymerase movement were reduced in the presence of an ATR inhibitor. These results therefore suggest that whereas DNA polymerase stalling at DNA lesions activates ATR to protect cell viability and prevent apoptosis, the stalling of RNA polymerases instead activates ATR to induce an apoptotic form of cell death in non-cycling cells. These results have important implications regarding the use of ATR inhibitors in cancer chemotherapy regimens. PMID:26940878
-
Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.
Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A
2004-03-26
Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.
-
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
-
In vitro fluorescence studies of transcription factor IIB-DNA interaction.
Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta
2015-01-01
General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.
-
NASA Technical Reports Server (NTRS)
1997-01-01
T7-RNA Polymerase grown on STS-81. Structure-Function Relationships of RNA Polymerase: DNA-dependent RNA polymerase is the key enzyme responsible for the biosynthesis of RNA, a process known as transcription. Principal Investigator's include Dr. Dan Carter, Dr. B.C. Wang, and Dr. John Rose of New Century Pharmaceuticals.
-
Vallerga, María Belén; Mansilla, Sabrina F.; Federico, María Belén; Bertolin, Agustina P.; Gottifredi, Vanesa
2015-01-01
After UV irradiation, DNA polymerases specialized in translesion DNA synthesis (TLS) aid DNA replication. However, it is unclear whether other mechanisms also facilitate the elongation of UV-damaged DNA. We wondered if Rad51 recombinase (Rad51), a factor that escorts replication forks, aids replication across UV lesions. We found that depletion of Rad51 impairs S-phase progression and increases cell death after UV irradiation. Interestingly, Rad51 and the TLS polymerase polη modulate the elongation of nascent DNA in different ways, suggesting that DNA elongation after UV irradiation does not exclusively rely on TLS events. In particular, Rad51 protects the DNA synthesized immediately before UV irradiation from degradation and avoids excessive elongation of nascent DNA after UV irradiation. In Rad51-depleted samples, the degradation of DNA was limited to the first minutes after UV irradiation and required the exonuclease activity of the double strand break repair nuclease (Mre11). The persistent dysregulation of nascent DNA elongation after Rad51 knockdown required Mre11, but not its exonuclease activity, and PrimPol, a DNA polymerase with primase activity. By showing a crucial contribution of Rad51 to the synthesis of nascent DNA, our results reveal an unanticipated complexity in the regulation of DNA elongation across UV-damaged templates. PMID:26627254
-
Wang, Yi-Ping; Du, Wen-Juan; Huang, Li-Ping; Wei, Yan-Wu; Wu, Hong-Li; Feng, Li; Liu, Chang-Ming
2016-01-01
Pseudorabies virus (PRV) DNA replication occurs in the nuclei of infected cells and requires the viral DNA polymerase. The PRV DNA polymerase comprises a catalytic subunit, UL30, and an accessory subunit, UL42, that confers processivity to the enzyme. Its nuclear localization is a prerequisite for its enzymatic function in the initiation of viral DNA replication. However, the mechanisms by which the PRV DNA polymerase holoenzyme enters the nucleus have not been determined. In this study, we characterized the nuclear import pathways of the PRV DNA polymerase catalytic and accessory subunits. Immunofluorescence analysis showed that UL42 localizes independently in the nucleus, whereas UL30 alone predominantly localizes in the cytoplasm. Intriguingly, the localization of UL30 was completely shifted to the nucleus when it was coexpressed with UL42, demonstrating that nuclear transport of UL30 occurs in an UL42-dependent manner. Deletion analysis and site-directed mutagenesis of the two proteins showed that UL42 contains a functional and transferable bipartite nuclear localization signal (NLS) at amino acids 354–370 and that K354, R355, and K367 are important for the NLS function, whereas UL30 has no NLS. Coimmunoprecipitation assays verified that UL42 interacts with importins α3 and α4 through its NLS. In vitro nuclear import assays demonstrated that nuclear accumulation of UL42 is a temperature- and energy-dependent process and requires both importins α and β, confirming that UL42 utilizes the importin α/β-mediated pathway for nuclear entry. In an UL42 NLS-null mutant, the UL42/UL30 heterodimer was completely confined to the cytoplasm when UL42 was coexpressed with UL30, indicating that UL30 utilizes the NLS function of UL42 for its translocation into the nucleus. Collectively, these findings suggest that UL42 contains an importin α/β-mediated bipartite NLS that transports the viral DNA polymerase holoenzyme into the nucleus in an in vitro expression system. PMID:26913023
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henderson, S.L.; Ryan, K.; Sollner-Webb, B.
1989-02-01
We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less
-
Winter, S; Weller, M
2000-06-16
Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.
-
DNA polymerase ɛ and δ exonuclease domain mutations in endometrial cancer
Church, David N.; Briggs, Sarah E.W.; Palles, Claire; Domingo, Enric; Kearsey, Stephen J.; Grimes, Jonathon M.; Gorman, Maggie; Martin, Lynn; Howarth, Kimberley M.; Hodgson, Shirley V.; Kaur, Kulvinder; Taylor, Jenny; Tomlinson, Ian P.M.
2013-01-01
Accurate duplication of DNA prior to cell division is essential to suppress mutagenesis and tumour development. The high fidelity of eukaryotic DNA replication is due to a combination of accurate incorporation of nucleotides into the nascent DNA strand by DNA polymerases, the recognition and removal of mispaired nucleotides (proofreading) by the exonuclease activity of DNA polymerases δ and ɛ, and post-replication surveillance and repair of newly synthesized DNA by the mismatch repair (MMR) apparatus. While the contribution of defective MMR to neoplasia is well recognized, evidence that faulty DNA polymerase activity is important in cancer development has been limited. We have recently shown that germline POLE and POLD1 exonuclease domain mutations (EDMs) predispose to colorectal cancer (CRC) and, in the latter case, to endometrial cancer (EC). Somatic POLE mutations also occur in 5–10% of sporadic CRCs and underlie a hypermutator, microsatellite-stable molecular phenotype. We hypothesized that sporadic ECs might also acquire somatic POLE and/or POLD1 mutations. Here, we have found that missense POLE EDMs with good evidence of pathogenic effects are present in 7% of a set of 173 endometrial cancers, although POLD1 EDMs are uncommon. The POLE mutations localized to highly conserved residues and were strongly predicted to affect proofreading. Consistent with this, POLE-mutant tumours were hypermutated, with a high frequency of base substitutions, and an especially large relative excess of G:C>T:A transversions. All POLE EDM tumours were microsatellite stable, suggesting that defects in either DNA proofreading or MMR provide alternative mechanisms to achieve genomic instability and tumourigenesis. PMID:23528559
-
Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA
NASA Astrophysics Data System (ADS)
Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio
2016-12-01
Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting.
-
Laser crosslinking of E. coli RNA polymerase and T7 DNA.
Harrison, C A; Turner, D H; Hinkle, D C
1982-01-01
The first photochemical crosslinking of a protein to a nucleic acid using laser excitation is reported. A single, 120 mJ, 20 ns pulse at 248 nm crosslinks about 10% of bound E. coli RNA polymerase to T7 DNA under the conditions studied. The crosslinking yield depends on mercaptoethanol concentration, and is a linear function of laser intensity. The protein subunits crosslinked to DNA are beta, beta' and sigma. PMID:7045809
-
1980-01-01
genetics (Hayes 1968). This marvelous process is important in providing us with the breadth of phenotypic diversity that one sees within a single plant or...separate overall pro- cesses, but may share common components of DNA metabolism, such as winding/unwinding enzymes, ligase, polymerases , various nucle...incorpuoted DNA segmnent are re- paired by DNA polymerase and ligase. Any diffoernces (base mispairing’S, nil- cleotide additions or deletions) between
-
Kelly, Richard D. W.; Mahmud, Arsalan; McKenzie, Matthew; Trounce, Ian A.; St John, Justin C.
2012-01-01
DNA methylation is an essential mechanism controlling gene expression during differentiation and development. We investigated the epigenetic regulation of the nuclear-encoded, mitochondrial DNA (mtDNA) polymerase γ catalytic subunit (PolgA) by examining the methylation status of a CpG island within exon 2 of PolgA. Bisulphite sequencing identified low methylation levels (<10%) within exon 2 of mouse oocytes, blastocysts and embryonic stem cells (ESCs), while somatic tissues contained significantly higher levels (>40%). In contrast, induced pluripotent stem (iPS) cells and somatic nuclear transfer ESCs were hypermethylated (>20%), indicating abnormal epigenetic reprogramming. Real time PCR analysis of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) immunoprecipitated DNA suggests active DNA methylation and demethylation within exon 2 of PolgA. Moreover, neural differentiation of ESCs promoted de novo methylation and demethylation at the exon 2 locus. Regression analysis demonstrates that cell-specific PolgA expression levels were negatively correlated with DNA methylation within exon 2 and mtDNA copy number. Finally, using chromatin immunoprecipitation (ChIP) against RNA polymerase II (RNApII) phosphorylated on serine 2, we show increased DNA methylation levels are associated with reduced RNApII transcriptional elongation. This is the first study linking nuclear DNA epigenetic regulation with mtDNA regulation during differentiation and cell specialization. PMID:22941637
-
Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.
MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M
2000-09-01
The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.
-
Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.
Moore, Jessica M; Correa, Raul; Rosenberg, Susan M; Hastings, P J
2017-07-01
Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS oxidation of DNA potentially regulated by ROS regulators.
-
Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli
Moore, Jessica M.; Correa, Raul; Rosenberg, Susan M.
2017-01-01
Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS oxidation of DNA potentially regulated by ROS regulators. PMID:28727736
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.
1987-11-01
The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
-
Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V
2006-10-15
The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.
-
KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail
2018-06-20
Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.
-
Engineering of a DNA Polymerase for Direct m6 A Sequencing.
Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas
2018-01-08
Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
-
Killelea, Tom; Ghosh, Samantak; Tan, Samuel S.; Heslop, Pauline; Firbank, Susan; Kool, Eric T.; Connolly, Bernard A.
2010-01-01
Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describes uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at the +2 position explains the stimulation of the polymerase 3′-5′ proof reading exonuclease, observed with deaminated bases at this location. A β hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double stranded DNA. This denatures the two complementary primer bases and directs the resulting 3′ single-stranded extension towards the exonuclease active site. Finally the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using non-polar isosteres. Affinity for both 2,4 difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4 difluorobenzene is seen, confirming a role for shape recognition. PMID:20527806
-
Downstream DNA Tension Regulates the Stability of the T7 RNA Polymerase Initiation Complex
Skinner, Gary M.; Kalafut, Bennett S.; Visscher, Koen
2011-01-01
Gene transcription by the enzyme RNA polymerase is tightly regulated. In many cases, such as in the lac operon in Escherichia coli, this regulation is achieved through the action of protein factors on DNA. Because DNA is an elastic polymer, its response to enzymatic processing can lead to mechanical perturbations (e.g., linear stretching and supercoiling) that can affect the operation of other DNA processing complexes acting elsewhere on the same substrate molecule. Using an optical-tweezers assay, we measured the binding kinetics between single molecules of bacteriophage T7 RNA polymerase and DNA, as a function of tension. We found that increasing DNA tension under conditions that favor formation of the open complex results in destabilization of the preinitiation complex. Furthermore, with zero ribonucleotides present, when the closed complex is favored, we find reduced tension sensitivity, implying that it is predominantly the open complex that is sensitive. This result strongly supports the “scrunching” model for T7 transcription initiation, as the applied tension acts against the movement of the DNA into the scrunched state, and introduces linear DNA tension as a potential regulatory quantity for transcription initiation. PMID:21320448
-
Ctf4 Is a Hub in the Eukaryotic Replisome that Links Multiple CIP-Box Proteins to the CMG Helicase.
Villa, Fabrizio; Simon, Aline C; Ortiz Bazan, Maria Angeles; Kilkenny, Mairi L; Wirthensohn, David; Wightman, Mel; Matak-Vinkovíc, Dijana; Pellegrini, Luca; Labib, Karim
2016-08-04
Replisome assembly at eukaryotic replication forks connects the DNA helicase to DNA polymerases and many other factors. The helicase binds the leading-strand polymerase directly, but is connected to the Pol α lagging-strand polymerase by the trimeric adaptor Ctf4. Here, we identify new Ctf4 partners in addition to Pol α and helicase, all of which contain a "Ctf4-interacting-peptide" or CIP-box. Crystallographic analysis classifies CIP-boxes into two related groups that target different sites on Ctf4. Mutations in the CIP-box motifs of the Dna2 nuclease or the rDNA-associated protein Tof2 do not perturb DNA synthesis genome-wide, but instead lead to a dramatic shortening of chromosome 12 that contains the large array of rDNA repeats. Our data reveal unexpected complexity of Ctf4 function, as a hub that connects multiple accessory factors to the replisome. Most strikingly, Ctf4-dependent recruitment of CIP-box proteins couples other processes to DNA synthesis, including rDNA copy-number regulation. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
-
Grover, Abhinav; Agrawal, Vibhuti; Shandilya, Ashutosh; Bisaria, Virendra S; Sundar, Durai
2011-01-01
Herpes Simplex Virus 1 and 2 causes several infections in humans including cold sores and encephalitis. Previous antiviral studies on herpes viruses have focussed on developing nucleoside analogues that can inhibit viral polymerase and terminate the replicating viral DNA. However, these drugs bear an intrinsic non-specificity as they can also inhibit cellular polymerase apart from the viral one. The present study is an attempt to elucidate the action mechanism of naturally occurring withaferin A in inhibiting viral DNA polymerase, thus providing an evidence for its development as a novel anti-herpetic drug. Withaferin A was found to bind very similarly to that of the previously reported 4-oxo-DHQ inhibitor. Withaferin A was observed binding to the residues Gln 617, Gln 618, Asn 815 and Tyr 818, all of which are crucial to the proper functioning of the polymerase. A comparison of the conformation obtained from docking and the molecular dynamics simulations shows that substantial changes in the binding conformations have occurred. These results indicate that the initial receptor-ligand interaction observed after docking can be limited due to the receptor rigid docking algorithm and that the conformations and interactions observed after simulation runs are more energetically favoured. We have performed docking and molecular dynamics simulation studies to elucidate the binding mechanism of prospective herbal drug withaferin A onto the structure of DNA polymerase of Herpes simplex virus. Our docking simulations results give high binding affinity of the ligand to the receptor. Long de novo MD simulations for 10 ns performed allowed us to evaluate the dynamic behaviour of the system studied and corroborate the docking results, as well as identify key residues in the enzyme-inhibitor interactions. The present MD simulations support the hypothesis that withaferin A is a potential ligand to target/inhibit DNA polymerase of the Herpes simplex virus. Results of these studies will also guide the design of selective inhibitors of DNA POL with high specificity and potent activity in order to strengthen the therapeutic arsenal available today against the dangerous biological warfare agent represented by Herpes Simplex Virus.
-
2011-01-01
Background Herpes Simplex Virus 1 and 2 causes several infections in humans including cold sores and encephalitis. Previous antiviral studies on herpes viruses have focussed on developing nucleoside analogues that can inhibit viral polymerase and terminate the replicating viral DNA. However, these drugs bear an intrinsic non-specificity as they can also inhibit cellular polymerase apart from the viral one. The present study is an attempt to elucidate the action mechanism of naturally occurring withaferin A in inhibiting viral DNA polymerase, thus providing an evidence for its development as a novel anti-herpetic drug. Results Withaferin A was found to bind very similarly to that of the previously reported 4-oxo-DHQ inhibitor. Withaferin A was observed binding to the residues Gln 617, Gln 618, Asn 815 and Tyr 818, all of which are crucial to the proper functioning of the polymerase. A comparison of the conformation obtained from docking and the molecular dynamics simulations shows that substantial changes in the binding conformations have occurred. These results indicate that the initial receptor-ligand interaction observed after docking can be limited due to the receptor rigid docking algorithm and that the conformations and interactions observed after simulation runs are more energetically favoured. Conclusions We have performed docking and molecular dynamics simulation studies to elucidate the binding mechanism of prospective herbal drug withaferin A onto the structure of DNA polymerase of Herpes simplex virus. Our docking simulations results give high binding affinity of the ligand to the receptor. Long de novo MD simulations for 10 ns performed allowed us to evaluate the dynamic behaviour of the system studied and corroborate the docking results, as well as identify key residues in the enzyme-inhibitor interactions. The present MD simulations support the hypothesis that withaferin A is a potential ligand to target/inhibit DNA polymerase of the Herpes simplex virus. Results of these studies will also guide the design of selective inhibitors of DNA POL with high specificity and potent activity in order to strengthen the therapeutic arsenal available today against the dangerous biological warfare agent represented by Herpes Simplex Virus. PMID:22373101
-
Santillán, Orlando; Ramírez-Romero, Miguel A; Lozano, Luis; Checa, Alberto; Encarnación, Sergio M; Dávila, Guillermo
2016-01-01
Sigma factors are RNA polymerase subunits engaged in promoter recognition and DNA strand separation during transcription initiation in bacteria. Primary sigma factors are responsible for the expression of housekeeping genes and are essential for survival. RpoD, the primary sigma factor of Escherichia coli, a γ-proteobacteria, recognizes consensus promoter sequences highly similar to those of some α-proteobacteria species. Despite this resemblance, RpoD is unable to sustain transcription from most of the α-proteobacterial promoters tested so far. In contrast, we have found that SigA, the primary sigma factor of Rhizobium etli, an α-proteobacteria, is able to transcribe E. coli promoters, although it exhibits only 48% identity (98% coverage) to RpoD. We have called this the transcriptional laxity phenomenon. Here, we show that SigA partially complements the thermo-sensitive deficiency of RpoD285 from E. coli strain UQ285 and that the SigA region σ4 is responsible for this phenotype. Sixteen out of 74 residues (21.6%) within region σ4 are variable between RpoD and SigA. Mutating these residues significantly improves SigA ability to complement E. coli UQ285. Only six of these residues fall into positions already known to interact with promoter DNA and to comprise a helix-turn-helix motif. The remaining variable positions are located on previously unexplored sites inside region σ4, specifically into the first two α-helices of the region. Neither of the variable positions confined to these helices seem to interact directly with promoter sequence; instead, we adduce that these residues participate allosterically by contributing to correct region folding and/or positioning of the HTH motif. We propose that transcriptional laxity is a mechanism for ensuring transcription in spite of naturally occurring mutations from endogenous promoters and/or horizontally transferred DNA sequences, allowing survival and fast environmental adaptation of α-proteobacteria.
-
Santillán, Orlando; Ramírez-Romero, Miguel A.; Lozano, Luis; Checa, Alberto; Encarnación, Sergio M.; Dávila, Guillermo
2016-01-01
Sigma factors are RNA polymerase subunits engaged in promoter recognition and DNA strand separation during transcription initiation in bacteria. Primary sigma factors are responsible for the expression of housekeeping genes and are essential for survival. RpoD, the primary sigma factor of Escherichia coli, a γ-proteobacteria, recognizes consensus promoter sequences highly similar to those of some α-proteobacteria species. Despite this resemblance, RpoD is unable to sustain transcription from most of the α-proteobacterial promoters tested so far. In contrast, we have found that SigA, the primary sigma factor of Rhizobium etli, an α-proteobacteria, is able to transcribe E. coli promoters, although it exhibits only 48% identity (98% coverage) to RpoD. We have called this the transcriptional laxity phenomenon. Here, we show that SigA partially complements the thermo-sensitive deficiency of RpoD285 from E. coli strain UQ285 and that the SigA region σ4 is responsible for this phenotype. Sixteen out of 74 residues (21.6%) within region σ4 are variable between RpoD and SigA. Mutating these residues significantly improves SigA ability to complement E. coli UQ285. Only six of these residues fall into positions already known to interact with promoter DNA and to comprise a helix-turn-helix motif. The remaining variable positions are located on previously unexplored sites inside region σ4, specifically into the first two α-helices of the region. Neither of the variable positions confined to these helices seem to interact directly with promoter sequence; instead, we adduce that these residues participate allosterically by contributing to correct region folding and/or positioning of the HTH motif. We propose that transcriptional laxity is a mechanism for ensuring transcription in spite of naturally occurring mutations from endogenous promoters and/or horizontally transferred DNA sequences, allowing survival and fast environmental adaptation of α-proteobacteria. PMID:27468278
-
Bjourson, A J; Stone, C E; Cooper, J E
1992-01-01
A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166
-
CyDNA: synthesis and replication of highly Cy-dye substituted DNA by an evolved polymerase.
Ramsay, Nicola; Jemth, Ann-Sofie; Brown, Anthony; Crampton, Neal; Dear, Paul; Holliger, Philipp
2010-04-14
DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting "CyDNA" displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties.
-
Gadkari, Varun V.; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2014-01-01
3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2’-deoxyguanosin-8-yl)-3-aminobenzanthrone (dGC8-N-ABA). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dGC8-N-ABA is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dGC8-N-ABA on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dGC8-N-ABA lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dGC8-N-ABA lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dGC8-N-ABA bypass catalyzed by Dpo4. PMID:25048879
-
Gadkari, Varun V; Tokarsky, E John; Malik, Chanchal K; Basu, Ashis K; Suo, Zucai
2014-09-01
3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone (dG(C8-N-ABA)). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dG(C8-N-ABA) is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dG(C8-N-ABA) on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dG(C8-N-ABA) lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dG(C8-N-ABA) lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dG(C8-N-ABA) bypass catalyzed by Dpo4. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Partial Purification of a Megadalton DNA Replication Complex by Free Flow Electrophoresis.
Li, Caroline M; Miao, Yunan; Lingeman, Robert G; Hickey, Robert J; Malkas, Linda H
2016-01-01
We describe a gentle and rapid method to purify the intact multiprotein DNA replication complex using free flow electrophoresis (FFE). In particular, we applied FFE to purify the human cell DNA synthesome, which is a multiprotein complex that is fully competent to carry-out all phases of the DNA replication process in vitro using a plasmid containing the simian virus 40 (SV40) origin of DNA replication and the viral large tumor antigen (T-antigen) protein. The isolated native DNA synthesome can be of use in studying the mechanism by which mammalian DNA replication is carried-out and how anti-cancer drugs disrupt the DNA replication or repair process. Partially purified extracts from HeLa cells were fractionated in a native, liquid based separation by FFE. Dot blot analysis showed co-elution of many proteins identified as part of the DNA synthesome, including proliferating cell nuclear antigen (PCNA), DNA topoisomerase I (topo I), DNA polymerase δ (Pol δ), DNA polymerase ɛ (Pol ɛ), replication protein A (RPA) and replication factor C (RFC). Previously identified DNA synthesome proteins co-eluted with T-antigen dependent and SV40 origin-specific DNA polymerase activity at the same FFE fractions. Native gels show a multiprotein PCNA containing complex migrating with an apparent relative mobility in the megadalton range. When PCNA containing bands were excised from the native gel, mass spectrometric sequencing analysis identified 23 known DNA synthesome associated proteins or protein subunits.
-
Biochemical analysis of active site mutations of human polymerase η.
Suarez, Samuel C; Beardslee, Renee A; Toffton, Shannon M; McCulloch, Scott D
2013-01-01
DNA polymerase η (pol η) plays a critical role in suppressing mutations caused by the bypass of cis-syn cyclobutane pyrimidine dimers (CPD) that escape repair. There is evidence this is also the case for the oxidative lesion 7,8-dihydro-8-oxo-guanine (8-oxoG). Both of these lesions cause moderate to severe blockage of synthesis when encountered by replicative polymerases, while pol η displays little no to pausing during translesion synthesis. However, since lesion bypass does not remove damaged DNA from the genome and can possibly be accompanied by errors in synthesis during bypass, the process is often called 'damage tolerance' to delineate it from classical DNA repair pathways. The fidelity of lesion bypass is therefore of importance when determining how pol η suppresses mutations after DNA damage. As pol η has been implicated in numerous in vivo pathways other than lesion bypass, we wanted to better understand the molecular mechanisms involved in the relatively low-fidelity synthesis displayed by pol η. To that end, we have created a set of mutant pol η proteins each containing a single amino acid substitution in the active site and closely surrounding regions. We determined overall DNA synthesis ability as well as the efficiency and fidelity of bypass of thymine-thymine CPD (T-T CPD) and 8-oxoG containing DNA templates. Our results show that several amino acids are critical for normal polymerase function, with changes in overall activity and fidelity being observed. Of the mutants that retain polymerase activity, we demonstrate that amino acids Q38, Y52, and R61 play key roles in determining polymerase fidelity, with substation of alanine causing both increases and decreases in fidelity. Remarkably, the Q38A mutant displays increased fidelity during synthesis opposite 8-oxoG but decreased fidelity during synthesis opposite a T-T CPD. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao Hongbin; Banh, Alice; Kwok, Shirley
Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less
-
Choi, Jung-Suk; Dasari, Anvesh; Hu, Peter; Benkovic, Stephen J; Berdis, Anthony J
2016-02-18
This report evaluates the pro-mutagenic behavior of 8-oxo-guanine (8-oxo-G) by quantifying the ability of high-fidelity and specialized DNA polymerases to incorporate natural and modified nucleotides opposite this lesion. Although high-fidelity DNA polymerases such as pol δ and the bacteriophage T4 DNA polymerase replicating 8-oxo-G in an error-prone manner, they display remarkably low efficiencies for TLS compared to normal DNA synthesis. In contrast, pol η shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties are consistent with a pro-mutagenic role for pol η when replicating this DNA lesion. Studies using modified nucleotide analogs show that pol η relies heavily on hydrogen-bonding interactions during translesion DNA synthesis. However, nucleobase modifications such as alkylation to the N2 position of guanine significantly increase error-prone synthesis catalyzed by pol η when replicating 8-oxo-G. Molecular modeling studies demonstrate the existence of a hydrophobic pocket in pol η that participates in the increased utilization of certain hydrophobic nucleotides. A model is proposed for enhanced pro-mutagenic replication catalyzed by pol η that couples efficient incorporation of damaged nucleotides opposite oxidized DNA lesions created by reactive oxygen species. The biological implications of this model toward increasing mutagenic events in lung cancer are discussed. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zahn, Karl E.; Averill, April; Wallace, Susan S.
5-Hydroxycytosine (5-OHC) is a stable oxidation product of cytosine associated with an increased frequency of C {yields} T transition mutations. When this lesion escapes recognition by the base excision repair pathway and persists to serve as a templating base during DNA synthesis, replicative DNA polymerases often misincorporate dAMP at the primer terminus, which can lead to fixation of mutations and subsequent disease. To characterize the dynamics of DNA synthesis opposite 5-OHC, we initiated a comparison of unmodified dCMP to 5-OHC, 5-fluorocytosine (5-FC), and 5-methylcytosine (5-MEC) in which these bases act as templates in the active site of RB69 gp43, amore » high-fidelity DNA polymerase sharing homology with human replicative DNA polymerases. This study presents the first crystal structure of any DNA polymerase binding this physiologically important premutagenic DNA lesion, showing that while dGMP is stabilized by 5-OHC through normal Watson-Crick base pairing, incorporation of dAMP leads to unstacking and instability in the template. Furthermore, the electronegativity of the C5 substituent appears to be important in the miscoding potential of these cytosine-like templates. While dAMP is incorporated opposite 5-OHC {approx}5 times more efficiently than opposite unmodified dCMP, an elevated level of incorporation is also observed opposite 5-FC but not 5-MEC. Taken together, these data imply that the nonuniform templating by 5-OHC is due to weakened stacking capabilities, which allows dAMP incorporation to proceed in a manner similar to that observed opposite abasic sites.« less
-
2015-01-01
Numerous kinetic, structural, and theoretical studies have established that DNA polymerases adjust their domain structures to enclose nucleotides in their active sites and then rearrange critical active site residues and substrates for catalysis, with the latter conformational change acting to kinetically limit the correct nucleotide incorporation rate. Additionally, structural studies have revealed a large conformational change between the apoprotein and the DNA–protein binary state for Y-family DNA polymerases. In previous studies [Xu, C., Maxwell, B. A., Brown, J. A., Zhang, L., and Suo, Z. (2009) PLoS Biol.7, e1000225], a real-time Förster resonance energy transfer (FRET) method was developed to monitor the global conformational transitions of DNA polymerase IV from Sulfolobus solfataricus (Dpo4), a prototype Y-family enzyme, during nucleotide binding and incorporation by measuring changes in distance between locations on the enzyme and the DNA substrate. To elucidate further details of the conformational transitions of Dpo4 during substrate binding and catalysis, in this study, the real-time FRET technique was used to monitor changes in distance between various pairs of locations in the protein itself. In addition to providing new insight into the conformational changes as revealed in previous studies, the results here show that the previously described conformational change between the apo and DNA-bound states of Dpo4 occurs in a mechanistic step distinct from initial formation or dissociation of the binary complex of Dpo4 and DNA. PMID:24568554
-
Janowska, Beata; Kurpios-Piec, Dagmara; Prorok, Paulina; Szparecki, Grzegorz; Komisarski, Marek; Kowalczyk, Paweł; Janion, Celina; Tudek, Barbara
2012-01-03
One of the major lipid peroxidation products trans-4-hydroxy-2-nonenal (HNE), forms cyclic propano- or ethenoadducts bearing six- or seven-carbon atom side chains to G>C≫A>T. To specify the role of SOS DNA polymerases in HNE-induced mutations, we tested survival and mutation spectra in the lacZα gene of M13mp18 phage, whose DNA was treated in vitro with HNE, and which was grown in uvrA(-)Escherichia coli strains, carrying one, two or all three SOS DNA polymerases. When Pol IV was the only DNA SOS polymerase in the bacterial host, survival of HNE-treated M13 DNA was similar to, but mutation frequency was lower than in the strain containing all SOS DNA polymerases. When only Pol II or Pol V were present in host bacteria, phage survival decreased dramatically. Simultaneously, mutation frequency was substantially increased, but exclusively in the strain carrying only Pol V, suggesting that induction of mutations by HNE is mainly dependent on Pol V. To determine the role of Pol II and Pol IV in HNE induced mutagenesis, Pol II or Pol IV were expressed together with Pol V. This resulted in decrease of mutation frequency, suggesting that both enzymes can compete with Pol V, and bypass HNE-DNA adducts in an error-free manner. However, HNE-DNA adducts were easily bypassed by Pol IV and only infrequently by Pol II. Mutation spectrum established for strains expressing only Pol V, showed that in uvrA(-) bacteria the frequency of base substitutions and recombination increased in relation to NER proficient strains, particularly mutations at adenine sites. Among base substitutions A:T→C:G, A:T→G:C, G:C→A:T and G:C→T:A prevailed. The results suggest that Pol V can infrequently bypass HNE-DNA adducts inducing mutations at G, C and A sites, while bypass by Pol IV and Pol II is error-free, but for Pol II infrequent. Copyright © 2011 Elsevier B.V. All rights reserved.
-
Livneh, Zvi
2006-09-01
To overcome DNA lesions that block replication the cell employs translesion DNA synthesis (TLS) polymerases, a group of low fidelity DNA polymerases that have the capacity to bypass a wide range of DNA lesions. This TLS process is also termed error-prone repair, due to its inherent mutagenic nature. We have recently shown that the tumor suppressor p53 and the cell cycle inhibitor p21 are global regulators of TLS. When these proteins are missing or nonfunctional, TLS gets out of control: its extent increases to very high levels, and its fidelity decreases, causing an overall increase in mutation load. This may be explained by the loss of selectivity in the bypass of specific DNA lesions by their cognate specialized polymerases, such that lesion bypass continues to a maximum, regardless of the price paid in increased mutations. The p53 and p21 proteins are also required for efficient UV light-induced monoubiquitination of PCNA, which is consistent with a model in which this modification of PCNA is necessary but not sufficient for the normal activity of TLS. This regulation suggests that TLS evolved in mammals as a system that balances gain in survival with a tolerable mutational cost, and that disturbing this balance causes a potentially harmful increase in mutations, which might play a role in carcinogenesis.
-
Lombardi, Anne J.; Hoskins, Elizabeth E.; Foglesong, Grant D.; Wikenheiser-Brokamp, Kathryn A.; Wiesmüller, Lisa; Hanenberg, Helmut; Andreassen, Paul R.; Jacobs, Allison J.; Olson, Susan B.; Keeble, Winifred W.; Hays, Laura E.; Wells, Susanne I.
2015-01-01
Purpose Fanconi anemia (FA) is an inherited disorder associated with a constitutional defect in the FA DNA repair machinery that is essential for resolution of DNA interstrand crosslinks. Individuals with FA are predisposed to formation of head and neck squamous cell carcinomas (HNSCCs) at a young age. Prognosis is poor, partly due to patient intolerance of chemotherapy and radiation requiring dose reduction, which may lead to early recurrence of disease. Experimental Design Using HNSCC cell lines derived from the tumors of FA patients, and murine HNSCC cell lines derived from the tumors of wild type and Fancc−/− mice, we sought to define FA-dependent chemosensitivity and DNA repair characteristics. We utilized DNA repair reporter assays to explore the preference of FA HNSCC cells for non-homologous end joining (NHEJ). Results Surprisingly, interstrand crosslinker (ICL) sensitivity was not necessarily FA-dependent in human or murine cell systems. Our results suggest that the increased Ku-dependent NHEJ that is expected in FA cells did not mediate relative ICL resistance. ICL exposure resulted in increased DNA damage sensing and repair by poly(ADP-ribose) polymerase (PARP) in FA-deficient cells. Moreover, human and murine FA HNSCC cells were sensitive to PARP inhibition, and sensitivity of human cells was attenuated by FA gene complementation. Conclusions The observed reliance upon PARP-mediated mechanisms reveals a means by which FA HNSCCs can acquire relative resistance to the ICL-based chemotherapy that is a foundation of HNSCC treatment, as well as a potential target for overcoming chemoresistance in the chemosensitive individual. PMID:25609062
-
XRCC3 Thr241Met Polymorphism is not Associated with Lung Cancer Risk in a Romanian Population.
Catana, Andreea; Pop, Monica; Marginean, Dragos Horea; Blaga, Ioana Cristina; Porojan, Mihai Dumitru; Popp, Radu Anghel; Pop, Ioan Victor
2016-01-01
Deoxyribonucleic Acid (DNA) repair mechanisms play a critical role in protecting the cellular genome against carcinogens. X-ray cross-complementing gene 3 (XRCC3) is involved in DNA repair and therefore certain genetic polymorphisms that occur in DNA repair genes may affect the ability to repair DNA defects and may represent a risk factor in carcinogenesis. The purpose of our study was to investigate the association between XRCC3 gene substitution of Threonine with Methionine in codon 241 of XRCC3 gene (Thr241Met) polymorphism and the risk of lung cancer, in a Romanian population. We recruited 93 healthy controls and 85 patients with lung cancer, all smokers. Thr241Met, XRCC3 gene genotyping was determined by multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). Statistical analysis (OR, recessive model), did not revealed an increased risk for lung cancer, for the variant 241Met allele and Thr241Met genotypes (p=0.138, OR=0.634, CI=0.348-1.157; p=0.023, OR=0.257, CI=0.085-6.824). Also, there were no positive statistical associations between Thr241Met polymorphism of XRCC3 gene, gender, tobacco and various histopathological tumor type of lung cancer. In conclusion, the results of the study suggest that the XRCC3 gene Thr241Met polymorphism is not associated with an increased risk for the development of lung cancer in this Romanian group.
-
A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches
Bruno, John G.
2013-01-01
The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q) to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA) or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies. PMID:24276022
-
Long, Xi-Dai; Ma, Yun; Zhou, Yuan-Feng; Ma, Ai-Min; Fu, Guo-Hui
2010-10-01
Genetic polymorphisms in DNA repair genes may influence individual variations in DNA repair capacity, and this may be associated with the risk and outcome of hepatocellular carcinoma (HCC) related to aflatoxin B1 (AFB1) exposure. In this study, we focused on the polymorphism of xeroderma pigmentosum complementation group C (XPC) codon 939 (rs#2228001), which is involved in nucleotide excision repair. We conducted a case-control study including 1156 HCC cases and 1402 controls without any evidence of hepatic disease to evaluate the associations between this polymorphism and HCC risk and prognosis in the Guangxi population. AFB1 DNA adduct levels, XPC genotypes, and XPC protein levels were tested with a comparative enzyme-linked immunosorbent assay, TaqMan polymerase chain reaction for XPC genotypes, and immunohistochemistry, respectively. Higher AFB1 exposure was observed among HCC patients versus the control group [odds ratio (OR) = 9.88 for AFB1 exposure years and OR = 6.58 for AFB1 exposure levels]. The XPC codon 939 Gln alleles significantly increased HCC risk [OR = 1.25 (95% confidence interval = 1.03-1.52) for heterozygotes of the XPC codon 939 Lys and Gln alleles (XPC-LG) and OR = 1.81 (95% confidence interval = 1.36-2.40) for homozygotes of the XPC codon 939 Gln alleles (XPC-GG)]. Significant interactive effects between genotypes and AFB1 exposure status were also observed in the joint-effects analysis. This polymorphism, moreover, was correlated with XPC expression levels in cancerous tissues (r = -0.369, P < 0.001) and with the overall survival of HCC patients (the median survival times were 30, 25, and 19 months for patients with homozygotes of the XPC codon 939 Lys alleles, XPC-LG, and XPC-GG, respectively), especially under high AFB1 exposure conditions. Like AFB1 exposure, the XPC codon 939 polymorphism was an independent prognostic factor influencing the survival of HCC. Additionally, this polymorphism multiplicatively interacted with the xeroderma pigmentosum complementation group D codon 751 polymorphism with respect to HCC risk (OR(interaction) = 1.71). These results suggest that the XPC codon 939 polymorphism may be associated with the risk and outcome of AFB1-related HCC in the Guangxi population and may interact with AFB1 exposure in the process of HCC induction by AFB1.
-
Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard
2017-06-06
Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richardson, C.C.
1993-12-31
This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less
-
Barnes, W M
1994-01-01
A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376
-
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
-
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
-
Recessive Twinkle mutations in early onset encephalopathy with mtDNA depletion.
Hakonen, Anna H; Isohanni, Pirjo; Paetau, Anders; Herva, Riitta; Suomalainen, Anu; Lönnqvist, Tuula
2007-11-01
Twinkle is a mitochondrial replicative helicase, the mutations of which have been associated with autosomal dominant progressive external ophthalmoplegia (adPEO), and recessively inherited infantile onset spinocerebellar ataxia (IOSCA). We report here a new phenotype in two siblings with compound heterozygous Twinkle mutations (A318T and Y508C), characterized by severe early onset encephalopathy and signs of liver involvement. The clinical manifestations included hypotonia, athetosis, sensory neuropathy, ataxia, hearing deficit, ophthalmoplegia, intractable epilepsy and elevation of serum transaminases. The liver showed mtDNA depletion, whereas the muscle mtDNA was only slightly affected. Alpers-Huttenlocher syndrome has previously been associated with mutations of polymerase gamma, a replicative polymerase of mtDNA. We show here that recessive mutations of the close functional partner of the polymerase, the Twinkle helicase, can also manifest as early encephalopathy with liver involvement, a phenotype reminiscent of Alpers syndrome, and are a new genetic cause underlying tissue-specific mtDNA depletion.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
R Vasquez-Del Carpio; T Silverstein; S Lone
Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase {Kappa} (Pol{Kappa}), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Pol{Kappa} in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure revealsmore » a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Pol{Kappa} in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo.« less
-
The transcription fidelity factor GreA impedes DNA break repair.
Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe
2017-10-12
Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.
-
DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae
Boiteux, Serge; Jinks-Robertson, Sue
2013-01-01
DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164
-
Fox, C J; Taylor, M I; Pereyra, R; Villasana, M I; Rico, C
2005-03-01
Recent substantial declines in northeastern Atlantic cod stocks necessitate improved biological knowledge and the development of techniques to complement standard stock assessment methods (which largely depend on accurate commercial catch data). In 2003, an ichthyoplankton survey was undertaken in the Irish Sea and subsamples of 'cod-like' eggs were analysed using a TaqMan multiplex, PCR (polymerase chain reaction) assay (with specific probes for cod, haddock and whiting). The TaqMan method was readily applied to the large number of samples (n = 2770) generated during the survey and when combined with a manual DNA extraction protocol had a low failure rate of 6%. Of the early stage 'cod-like' eggs (1.2-1.75 mm diameter) positively identified: 34% were cod, 8% haddock and 58% whiting. As previous stock estimates based on egg surveys for Irish Sea cod assumed that the majority of 'cod-like' eggs were from cod, the TaqMan results confirm that there was probably substantial contamination by eggs of whiting and haddock that would have inflated estimates of the stock biomass.
-
Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA.
Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel
2017-07-07
Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase θ (Pol θ) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase θ and canonical non-homologous DNA end joining are devoid of any integration events, demonstrating that these two mechanisms define random integration. In contrast, homologous recombination is not reduced in these cells and gene targeting is improved to 100% efficiency. Such complete reversal of integration outcome, from predominately random integration to exclusively gene targeting, provides a rational way forward to improve the efficacy and safety of DNA delivery and gene correction approaches.Random off-target integration events can impair precise gene targeting and poses a safety risk for gene therapy. Here the authors show that repression of polymerase θ and classical non-homologous recombination eliminates random integration.
-
Wang, Guoping; Ding, Xiong; Hu, Jiumei; Wu, Wenshuai; Sun, Jingjing; Mu, Ying
2017-10-24
Existing isothermal nucleic acid amplification (INAA) relying on the strand displacement activity of DNA polymerase usually requires at least two primers. However, in this paper, we report an unusual isothermal multimerization and amplification (UIMA) which only needs one primer and is efficiently initiated by the strand-displacing DNA polymerases with reverse transcription activities. On electrophoresis, the products of UIMA present a cascade-shape band and they are confirmed to be multimeric DNAs with repeated target sequences. In contrast to current methods, UIMA is simple to product multimeric DNA, due to the independent of multiple primers and rolling circle structures. Through assaying the synthesized single-stranded DNA targets, UIMA performs high sensitivity and specificity, as well as the universality. In addition, a plausible mechanism of UIMA is proposed, involving short DNA bending, mismatch extension, and template slippage. UIMA is a good explanation for why nonspecific amplification easily happens in existing INAAs. As the simplest INAA till now, UIMA provides a new insight for deeply understanding INAA and opens a new avenue for thoroughly addressing nonspecific amplification.
-
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
-
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaur, G.P.; Athwal, R.S.
1993-01-01
Complementation of DNA excision repair defect in xeroderma pigmentosum cells of group C (XP-C) has been achieved by the transfer of human chromosome 5. Individual human chromosomes tagged with a selectable marker were transferred to XP-C cells by microcell fusion from mouse-human hybrid cell lines each bearing a single different human chromosome. Analysis of the chromosome transfer clones revealed that introduction of chromosome 5 into XP-C cells corrected the DNA repair defect as well as UV-sensitive phenotypes, while chromosomes 2, 6, 7, 9, 13, 15, 17, and 21 failed to complement. The introduced chromosome 5 in complemented UV[sup r] clonesmore » was distinguished from the parental XP-C chromosomes by polymorphism for dinucleotide (CA)[sub n] repeats at two loci, D5S117 and D5S209. In addition, an intact marked chromosome 5 was rescued into mouse cells from a complemented UV[sup r] clone by microcell fusion. Five subclones of a complemented clone that had lost the marked chromosome 5 exhibited UV-sensitive and repair-deficient phenotypes identical to parental XP-C cells. Concordant loss of the transferred chromosome and reappearance of XP-C phenotype further confirmed the presence of a DNA repair gene on human chromosome 5. 38 refs., 7 figs., 1 tab.« less
-
Pedroza-Garcia, José Antonio; Domenichini, Séverine; Mazubert, Christelle; Bourge, Mickael; White, Charles; Hudik, Elodie; Bounon, Rémi; Tariq, Zakia; Delannoy, Etienne; Del Olmo, Ivan; Piñeiro, Manuel; Jarillo, Jose Antonio; Bergounioux, Catherine; Benhamed, Moussa; Raynaud, Cécile
2016-09-06
Faithful DNA replication maintains genome stability in dividing cells and from one generation to the next. This is particularly important in plants because the whole plant body and reproductive cells originate from meristematic cells that retain their proliferative capacity throughout the life cycle of the organism. DNA replication involves large sets of proteins whose activity is strictly regulated, and is tightly linked to the DNA damage response to detect and respond to replication errors or defects. Central to this interconnection is the replicative polymerase DNA Polymerase ϵ (Pol ϵ) which participates in DNA replication per se, as well as replication stress response in animals and in yeast. Surprisingly, its function has to date been little explored in plants, and notably its relationship with DNA Damage Response (DDR) has not been investigated. Here, we have studied the role of the largest regulatory sub-unit of Arabidopsis DNA Pol ϵ: DPB2, using an over-expression strategy. We demonstrate that excess accumulation of the protein impairs DNA replication and causes endogenous DNA stress. Furthermore, we show that Pol ϵ dysfunction has contrasting outcomes in vegetative and reproductive cells and leads to the activation of distinct DDR pathways in the two cell types. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
CyDNA: Synthesis and Replication of Highly Cy-Dye Substituted DNA by an Evolved Polymerase
2010-01-01
DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting “CyDNA” displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties. PMID:20235594
-
Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann
2011-02-04
La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.
-
Kazachenko, Konstantin Y; Miropolskaya, Nataliya A; Gening, Leonid V; Tarantul, Vyacheslav Z; Makarova, Alena V
2017-02-01
Y-family DNA polymerase iota (Pol ι) possesses both DNA polymerase and dRP lyase activities and was suggested to be involved in DNA translesion synthesis and base excision repair in mammals. The 129 strain of mice and its derivatives have a natural nonsense codon mutation in the second exon of the Pol ι gene resulting in truncation of the Pol ι protein. These mice were widely used as a Pol ι-null model for in vivo studies of the Pol ι function. However whether 129-derived strains of mice are fully deficient in the Pol ι functions was a subject of discussion since Pol ι mRNA undergoes alternative splicing at exon 2. Here we report purification of mouse Pol ι lacking the region encoded by exon 2, which includes several conserved residues involved in catalysis. We show that the deletion abrogates both the DNA polymerase and dRP lyase activities of Pol ι in the presence of either Mg 2+ or Mn 2+ ions. Thus, 129-derived strains of mice express catalytically inactive alternatively spliced Pol ι variant, whose cellular functions, if any exist, remain to be established. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
-
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Mechanical Properties of Transcription
NASA Astrophysics Data System (ADS)
Sevier, Stuart A.; Levine, Herbert
2017-06-01
The mechanical properties of transcription have recently been shown to play a central role in gene expression. However, a full physical characterization of this central biological process is lacking. In this Letter, we introduce a simple description of the basic physical elements of transcription where RNA elongation, RNA polymerase rotation, and DNA supercoiling are coupled. The resulting framework describes the relative amount of RNA polymerase rotation and DNA supercoiling that occurs during RNA elongation. Asymptotic behavior is derived and can be used to experimentally extract unknown mechanical parameters of transcription. Mechanical limits to transcription are incorporated through the addition of a DNA supercoiling-dependent RNA polymerase velocity. This addition can lead to transcriptional stalling and resulting implications for gene expression, chromatin structure and genome organization are discussed.
-
Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos
2018-01-01
Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486
-
Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H
2012-02-01
The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.
-
Schnapp, A; Schnapp, G; Erny, B; Grummt, I
1993-11-01
Alterations in the rate of cell proliferation are accompanied by changes in the transcription of rRNA genes. In mammals, this growth-dependent regulation of transcription of genes coding for rRNA (rDNA) is due to reduction of the amount or activity of an essential transcription factor, called TIF-IA. Extracts prepared from quiescent cells lack this factor activity and, therefore, are transcriptionally inactive. We have purified TIF-IA from exponentially growing cells and have shown that it is a polypeptide with a molecular mass of 75 kDa which exists as a monomer in solution. Using a reconstituted transcription system consisting of purified transcription factors, we demonstrate that TIF-IA is a bona fide transcription initiation factor which interacts with RNA polymerase I. Preinitiation complexes can be assembled in the absence of TIF-IA, but formation of the first phosphodiester bonds of nascent rRNA is precluded. After initiation, TIF-IA is liberated from the initiation complex and facilitates transcription from templates bearing preinitiation complexes which lack TIF-IA. Despite the pronounced species specificity of class I gene transcription, this growth-dependent factor has been identified not only in mouse but also in human cells. Murine TIF-IA complements extracts from both growth-inhibited mouse and human cells. The analogous human activity appears to be similar or identical to that of TIF-IA. Therefore, despite the fact that the RNA polymerase transcription system has evolved sufficiently rapidly that an rDNA promoter from one species will not function in another species, the basic mechanisms that adapt ribosome synthesis to cell proliferation have been conserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stark, M.; Naiman, T.; Canaani, D.
1989-08-15
In a previous work, an immortal xeroderma pigmentosum cell line belonging to complementation group C was complemented to a UV-resistant phenotype by transfection with a human cDNA clone library. We now report that the primary transformants selected for UV-resistance also acquired normal levels of DNA repair. This was assessed both by measurement of UV-induced ({sup 3}H)thymidine incorporation and by equilibrium sedimentation analysis of repair-DNA synthesis. Therefore, the transduced DNA element which confers normal UV-resistance also corrects the excision repair defect of the xeroderma pigmentosum group C cell line.
-
TopBP1-mediated DNA processing during mitosis.
Gallina, Irene; Christiansen, Signe Korbo; Pedersen, Rune Troelsgaard; Lisby, Michael; Oestergaard, Vibe H
2016-01-01
Maintenance of genome integrity is crucial to avoid cancer and other genetic diseases. Thus faced with DNA damage, cells mount a DNA damage response to avoid genome instability. The DNA damage response is partially inhibited during mitosis presumably to avoid erroneous processing of the segregating chromosomes. Yet our recent study shows that TopBP1-mediated DNA processing during mitosis is highly important to reduce transmission of DNA damage to daughter cells. (1) Here we provide an overview of the DNA damage response and DNA repair during mitosis. One role of TopBP1 during mitosis is to stimulate unscheduled DNA synthesis at underreplicated regions. We speculated that such genomic regions are likely to hold stalled replication forks or post-replicative gaps, which become the substrate for DNA synthesis upon entry into mitosis. Thus, we addressed whether the translesion pathways for fork restart or post-replicative gap filling are required for unscheduled DNA synthesis in mitosis. Using genetics in the avian DT40 cell line, we provide evidence that unscheduled DNA synthesis in mitosis does not require the translesion synthesis scaffold factor Rev1 or PCNA ubiquitylation at K164, which serve to recruit translesion polymerases to stalled forks. In line with this finding, translesion polymerase η foci do not colocalize with TopBP1 or FANCD2 in mitosis. Taken together, we conclude that TopBP1 promotes unscheduled DNA synthesis in mitosis independently of the examined translesion polymerases.
-
Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.
Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G
2010-06-01
The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.
-
Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong
2016-01-01
Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149
-
Synthetic polymers as substrates for a DNA-sliding clamp protein.
van Dongen, S F M; Clerx, J; van den Boomen, O I; Pervaiz, M; Trakselis, M A; Ritschel, T; Schoonen, L; Schoenmakers, D C; Nolte, R J M
2018-04-26
The clamp protein (gp45) of the DNA polymerase III of the bacteriophage T4 is known to bind to DNA and stay attached to it in order to facilitate the process of DNA copying by the polymerase. As part of a project aimed at developing new biomimetic data-encoding systems we have investigated the binding of gp45 to synthetic polymers, that is, rigid, helical polyisocyanopeptides. Molecular modelling studies suggest that the clamp protein may interact with the latter polymers. Experiments aimed at verifying these interactions are presented and discussed. © 2018 The Authors Biopolymers Published by Wiley Periodicals, Inc.
-
Iterated function systems for DNA replication
NASA Astrophysics Data System (ADS)
Gaspard, Pierre
2017-10-01
The kinetic equations of DNA replication are shown to be exactly solved in terms of iterated function systems, running along the template sequence and giving the statistical properties of the copy sequences, as well as the kinetic and thermodynamic properties of the replication process. With this method, different effects due to sequence heterogeneity can be studied, in particular, a transition between linear and sublinear growths in time of the copies, and a transition between continuous and fractal distributions of the local velocities of the DNA polymerase along the template. The method is applied to the human mitochondrial DNA polymerase γ without and with exonuclease proofreading.
-
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
-
Role of Human DNA Polymerase and Its Accessory Proteins in Breast Cancer
2000-09-01
10, 13, 15, and 19 are abnormal and indicate mutants in POLD1 gene . Determination of NIRCA detected mutations by DNA sequencing NIRCA detected...CAGCAA; GnGln) in codon 461. Table III. Summary of mutation identified in the Exo motif of POLD1 Gene from breast cancer. Patient/Cell line Nucleotide...the gene for human DNA polymerase 8 catalytic p125 (POLDI) and p50 ( POLD2 ) subunits (Chang et al., 1995, Perez et al., 2000).. Normal and breast
-
Structural basis of human PCNA sliding on DNA
NASA Astrophysics Data System (ADS)
de March, Matteo; Merino, Nekane; Barrera-Vilarmau, Susana; Crehuet, Ramon; Onesti, Silvia; Blanco, Francisco J.; de Biasio, Alfredo
2017-01-01
Sliding clamps encircle DNA and tether polymerases and other factors to the genomic template. However, the molecular mechanism of clamp sliding on DNA is unknown. Using crystallography, NMR and molecular dynamics simulations, here we show that the human clamp PCNA recognizes DNA through a double patch of basic residues within the ring channel, arranged in a right-hand spiral that matches the pitch of B-DNA. We propose that PCNA slides by tracking the DNA backbone via a `cogwheel' mechanism based on short-lived polar interactions, which keep the orientation of the clamp invariant relative to DNA. Mutation of residues at the PCNA-DNA interface has been shown to impair the initiation of DNA synthesis by polymerase δ (pol δ). Therefore, our findings suggest that a clamp correctly oriented on DNA is necessary for the assembly of a replication-competent PCNA-pol δ holoenzyme.
-
Blood cell mRNAs and microRNAs: optimized protocols for extraction and preservation.
Eikmans, Michael; Rekers, Niels V; Anholts, Jacqueline D H; Heidt, Sebastiaan; Claas, Frans H J
2013-03-14
Assessing messenger RNA (mRNA) and microRNA levels in peripheral blood cells may complement conventional parameters in clinical practice. Working with small, precious samples requires optimal RNA yields and minimal RNA degradation. Several procedures for RNA extraction and complementary DNA (cDNA) synthesis were compared for their efficiency. The effect on RNA quality of freeze-thawing peripheral blood cells and storage in preserving reagents was investigated. In terms of RNA yield and convenience, quality quantitative polymerase chain reaction signals per nanogram of total RNA and using NucleoSpin and mirVana columns is preferable. The SuperScript III protocol results in the highest cDNA yields. During conventional procedures of storing peripheral blood cells at -180°C and thawing them thereafter, RNA integrity is maintained. TRIzol preserves RNA in cells stored at -20°C. Detection of mRNA levels significantly decreases in degraded RNA samples, whereas microRNA molecules remain relatively stable. When standardized to reference targets, mRNA transcripts and microRNAs can be reliably quantified in moderately degraded (quality index 4-7) and severely degraded (quality index <4) RNA samples, respectively. We describe a strategy for obtaining high-quality and quantity RNA from fresh and stored cells from blood. The results serve as a guideline for sensitive mRNA and microRNA expression assessment in clinical material.
-
Uncommonly isolated clinical Pseudomonas: identification and phylogenetic assignation.
Mulet, M; Gomila, M; Ramírez, A; Cardew, S; Moore, E R B; Lalucat, J; García-Valdés, E
2017-02-01
Fifty-two Pseudomonas strains that were difficult to identify at the species level in the phenotypic routine characterizations employed by clinical microbiology laboratories were selected for genotypic-based analysis. Species level identifications were done initially by partial sequencing of the DNA dependent RNA polymerase sub-unit D gene (rpoD). Two other gene sequences, for the small sub-unit ribosonal RNA (16S rRNA) and for DNA gyrase sub-unit B (gyrB) were added in a multilocus sequence analysis (MLSA) study to confirm the species identifications. These sequences were analyzed with a collection of reference sequences from the type strains of 161 Pseudomonas species within an in-house multi-locus sequence analysis database. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analyses of these strains complemented the DNA sequenced-based phylogenetic analyses and were observed to be in accordance with the results of the sequence data. Twenty-three out of 52 strains were assigned to 12 recognized species not commonly detected in clinical specimens and 29 (56 %) were considered representatives of at least ten putative new species. Most strains were distributed within the P. fluorescens and P. aeruginosa lineages. The value of rpoD sequences in species-level identifications for Pseudomonas is emphasized. The correct species identifications of clinical strains is essential for establishing the intrinsic antibiotic resistance patterns and improved treatment plans.
-
Sulfolobus chromatin proteins modulate strand displacement by DNA polymerase B1
Sun, Fei; Huang, Li
2013-01-01
Strand displacement by a DNA polymerase serves a key role in Okazaki fragment maturation, which involves displacement of the RNA primer of the preexisting Okazaki fragment into a flap structure, and subsequent flap removal and fragment ligation. We investigated the role of Sulfolobus chromatin proteins Sso7d and Cren7 in strand displacement by DNA polymerase B1 (PolB1) from the hyperthermophilic archaeon Sulfolobus solfataricus. PolB1 showed a robust strand displacement activity and was capable of synthesizing thousands of nucleotides on a DNA-primed 72-nt single-stranded circular DNA template. This activity was inhibited by both Sso7d and Cren7, which limited the flap length to 3–4 nt at saturating concentrations. However, neither protein inhibited RNA displacement on an RNA-primed single-stranded DNA minicircle by PolB1. Strand displacement remained sensitive to modulation by the chromatin proteins when PolB1 was in association with proliferating cell nuclear antigen. Inhibition of DNA instead of RNA strand displacement by the chromatin proteins is consistent with the finding that double-stranded DNA was more efficiently bound and stabilized than an RNA:DNA duplex by these proteins. Our results suggest that Sulfolobus chromatin proteins modulate strand displacement by PolB1, permitting efficient removal of the RNA primer while inhibiting excessive displacement of the newly synthesized DNA strand during Okazaki fragment maturation. PMID:23821667
-
Eukaryotic DNA Replication Fork.
Burgers, Peter M J; Kunkel, Thomas A
2017-06-20
This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.
-
[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].
Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng
2004-11-01
To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Nteeba, Jackson, E-mail: nteeba@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu
7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6more » (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Corda, Y.; Job, D.; Anin, M.F.
1992-02-25
Two duplexes (20-mers) were constructed containing either a single cis-(Pt(NH{sub 3}){sub 2}(d(GpG))) or cis-(Pt(NH{sub 3}){sub 2}(d(ApG))) intrastrand cross-link, the major DNA adducts of the antitumor drug cis-diamminedichloroplatinum(II). These synthetic duplexes were multimerized and the resultant polymers used as templates in single-step addition reactions of condensation of a single nucleoside triphosphate substrate to a dinucleotide primer (abortive elongation reaction) catalyzed by prokaryotic or eukaryotic RNA polymerases. Primer-substrate combinations were selected so as to direct trinucleotide product formation within the platinated bases of the templates. Transcription experiments established that cis-DDP-DNA adducts formed at d(ApG) or d(GpG) sites are not an absolute blockmore » to formation of a single phosphodiester bond by either Escherichia coli RNA polymerase or wheat germ RNA polymerase II. Furthermore, the kinetic data indicate that single-step addition reactions are much more impeded at the platinated d(GpG) than at the platinated d(ApG) site and that the mechanisms of inhibition of RNA polymerase activity are different at the two platinated sites. In particular, binding affinity between E. coli RNA polymerase and the d(GpG)-containing platinated template is lowered, as the apparent K{sub m} of enzyme for the platinated polymer is increased by a factor of 4-5. These results are discussed in reaction to the distortions induced in DNA by the two adducts.« less
-
Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase
Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2015-01-01
1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169
-
Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko
2013-05-01
Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
-
Heyduk, E; Baichoo, N; Heyduk, T
2001-11-30
The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle
2012-12-14
In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctionalmore » in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.« less
-
A role for the RNA pol II–associated PAF complex in AID-induced immune diversification
Willmann, Katharina L.; Milosevic, Sara; Pauklin, Siim; Schmitz, Kerstin-Maike; Rangam, Gopinath; Simon, Maria T.; Maslen, Sarah; Skehel, Mark; Robert, Isabelle; Heyer, Vincent; Schiavo, Ebe; Reina-San-Martin, Bernardo
2012-01-01
Antibody diversification requires the DNA deaminase AID to induce DNA instability at immunoglobulin (Ig) loci upon B cell stimulation. For efficient cytosine deamination, AID requires single-stranded DNA and needs to gain access to Ig loci, with RNA pol II transcription possibly providing both aspects. To understand these mechanisms, we isolated and characterized endogenous AID-containing protein complexes from the chromatin of diversifying B cells. The majority of proteins associated with AID belonged to RNA polymerase II elongation and chromatin modification complexes. Besides the two core polymerase subunits, members of the PAF complex, SUPT5H, SUPT6H, and FACT complex associated with AID. We show that AID associates with RNA polymerase-associated factor 1 (PAF1) through its N-terminal domain, that depletion of PAF complex members inhibits AID-induced immune diversification, and that the PAF complex can serve as a binding platform for AID on chromatin. A model is emerging of how RNA polymerase II elongation and pausing induce and resolve AID lesions. PMID:23008333
-
A structural role for the PHP domain in E. coli DNA polymerase III.
Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H
2013-05-14
In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.
-
Teixeira, M M; Campaner, M; Camargo, E P
1994-01-01
To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
-
Jean, L; Risler, J L; Nagase, T; Coulouarn, C; Nomura, N; Salier, J P
1999-03-05
Poly(ADP-ribose)polymerase is a nuclear NAD-dependent enzyme and an essential nick sensor involved in cellular processes where nicking and rejoining of DNA strands are required. The inter-alpha-inhibitor family is comprized of several plasma proteins that all harbor one or more so-called heavy chains designated H1-H4. The latter originate from precursor polypeptides H1P-H4P whose upper two thirds are highly homologous. We now describe a novel protein that includes (i) a so-called BRCT domain found in many proteins involved in DNA repair, (ii) an area that is homologous to the NAD-dependent catalytic domain of poly(ADP-ribose)polymerase, (iii) an area that is homologous to the upper two thirds of precursor polypeptides H1P-H4P and (iv) a proline-rich region with a potential nuclear localization signal. This protein now designated PH5P points to as yet unsuspected links between poly(ADP-ribose)polymerase and the inter-alpha-inhibitor family and is likely to be involved in DNA repair.
-
Pei, De-Sheng; Yang, Xiao-Jie; Liu, Wei; Guikema, Jeroen E. J.; Schrader, Carol E.; Strauss, Phyllis R.
2011-01-01
DNA repair is required to maintain genome stability in stem cells and early embryos. At critical junctures, oxidative damage to DNA requires the base excision repair (BER) pathway. Since early zebrafish embryos lack the major polymerase in BER, DNA polymerase ß, repair proceeds via replicative polymerases, even though there is ample polb mRNA. Here, we report that Polb protein fails to appear at the appropriate time in development when AP endonuclease 1 (Apex), the upstream protein in BER, is knocked down. Because polb contains a Creb1 binding site, we examined whether knockdown of Apex affects creb1. Apex knockdown results in loss of Creb1 and Creb complex members but not Creb1 phosphorylation. This effect is independent of p53. Although both apex and creb1 mRNA rescue Creb1 and Polb after Apex knockdown, Apex is not a co-activator of creb1 transcription. This observation has broad significance, as similar results occur when Apex is inhibited in B cells from apex+/− mice. These results describe a novel regulatory circuit involving Apex, Creb1 and Polb and provide a mechanism for lethality of Apex loss in higher eukaryotes. PMID:21172930
-
Structural basis for the suppression of skin cancers by DNA polymerase [eta
DOE Office of Scientific and Technical Information (OSTI.GOV)
Silverstein, Timothy D.; Johnson, Robert E.; Jain, Rinku
2010-09-13
DNA polymerase {eta} (Pol{eta}) is unique among eukaryotic polymerases in its proficient ability for error-free replication through ultraviolet-induced cyclobutane pyrimidine dimers, and inactivation of Pol{eta} (also known as POLH) in humans causes the variant form of xeroderma pigmentosum (XPV). We present the crystal structures of Saccharomyces cerevisiae Pol{eta} (also known as RAD30) in ternary complex with a cis-syn thymine-thymine (T-T) dimer and with undamaged DNA. The structures reveal that the ability of Pol{eta} to replicate efficiently through the ultraviolet-induced lesion derives from a simple and yet elegant mechanism, wherein the two Ts of the T-T dimer are accommodated in anmore » active site cleft that is much more open than in other polymerases. We also show by structural, biochemical and genetic analysis that the two Ts are maintained in a stable configuration in the active site via interactions with Gln55, Arg73 and Met74. Together, these features define the basis for Pol{eta}'s action on ultraviolet-damaged DNA that is crucial in suppressing the mutagenic and carcinogenic consequences of sun exposure, thereby reducing the incidence of skin cancers in humans.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
B Akabayov; C Richardson
Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less
-
Structural and mechanistic studies of polymerase η bypass of phenanthriplatin DNA damage.
Gregory, Mark T; Park, Ga Young; Johnstone, Timothy C; Lee, Young-Sam; Yang, Wei; Lippard, Stephen J
2014-06-24
Platinum drugs are a mainstay of anticancer chemotherapy. Nevertheless, tumors often display inherent or acquired resistance to platinum-based treatments, prompting the search for new compounds that do not exhibit cross-resistance with current therapies. Phenanthriplatin, cis-diamminephenanthridinechloroplatinum(II), is a potent monofunctional platinum complex that displays a spectrum of activity distinct from those of the clinically approved platinum drugs. Inhibition of RNA polymerases by phenanthriplatin lesions has been implicated in its mechanism of action. The present study evaluates the ability of phenanthriplatin lesions to inhibit DNA replication, a function disrupted by traditional platinum drugs. Phenanthriplatin lesions effectively inhibit DNA polymerases ν, ζ, and κ and the Klenow fragment. In contrast to results obtained with DNA damaged by cisplatin, all of these polymerases were capable of inserting a base opposite a phenanthriplatin lesion, but only Pol η, an enzyme efficient in translesion synthesis, was able to fully bypass the adduct, albeit with low efficiency. X-ray structural characterization of Pol η complexed with site-specifically platinated DNA at both the insertion and +1 extension steps reveals that phenanthriplatin on DNA interacts with and inhibits Pol η in a manner distinct from that of cisplatin-DNA adducts. Unlike cisplatin and oxaliplatin, the efficacies of which are influenced by Pol η expression, phenanthriplatin is highly toxic to both Pol η+ and Pol η- cells. Given that increased expression of Pol η is a known mechanism by which cells resist cisplatin treatment, phenanthriplatin may be valuable in the treatment of cancers that are, or can easily become, resistant to cisplatin.
-
Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S.
2013-01-01
Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3’-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotide and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologs of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both, in an M. smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5’-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ. PMID:23198659
-
Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Y.; Dunn, J.; Gao, S.
2008-10-31
Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less
-
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-01-01
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614
-
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-02-10
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.
-
Directed evolution of polymerase function by compartmentalized self-replication.
Ghadessy, F J; Ong, J L; Holliger, P
2001-04-10
We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.
-
The mitochondrial genome of Moniliophthora roreri, the frosty pod rot pathogen of cacao.
Costa, Gustavo G L; Cabrera, Odalys G; Tiburcio, Ricardo A; Medrano, Francisco J; Carazzolle, Marcelo F; Thomazella, Daniela P T; Schuster, Stephen C; Carlson, John E; Guiltinan, Mark J; Bailey, Bryan A; Mieczkowski, Piotr; Pereira, Gonçalo A G; Meinhardt, Lyndel W
2012-05-01
In this study, we report the sequence of the mitochondrial (mt) genome of the Basidiomycete fungus Moniliophthora roreri, which is the etiologic agent of frosty pod rot of cacao (Theobroma cacao L.). We also compare it to the mtDNA from the closely-related species Moniliophthora perniciosa, which causes witches' broom disease of cacao. The 94 Kb mtDNA genome of M. roreri has a circular topology and codes for the typical 14 mt genes involved in oxidative phosphorylation. It also codes for both rRNA genes, a ribosomal protein subunit, 13 intronic open reading frames (ORFs), and a full complement of 27 tRNA genes. The conserved genes of M. roreri mtDNA are completely syntenic with homologous genes of the 109 Kb mtDNA of M. perniciosa. As in M. perniciosa, M. roreri mtDNA contains a high number of hypothetical ORFs (28), a remarkable feature that make Moniliophthoras the largest reservoir of hypothetical ORFs among sequenced fungal mtDNA. Additionally, the mt genome of M. roreri has three free invertron-like linear mt plasmids, one of which is very similar to that previously described as integrated into the main M. perniciosa mtDNA molecule. Moniliophthora roreri mtDNA also has a region of suspected plasmid origin containing 15 hypothetical ORFs distributed in both strands. One of these ORFs is similar to an ORF in the mtDNA gene encoding DNA polymerase in Pleurotus ostreatus. The comparison to M. perniciosa showed that the 15 Kb difference in mtDNA sizes is mainly attributed to a lower abundance of repetitive regions in M. roreri (5.8 Kb vs 20.7 Kb). The most notable differences between M. roreri and M. perniciosa mtDNA are attributed to repeats and regions of plasmid origin. These elements might have contributed to the rapid evolution of mtDNA. Since M. roreri is the second species of the genus Moniliophthora whose mtDNA genome has been sequenced, the data presented here contribute valuable information for understanding the evolution of fungal mt genomes among closely-related species. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
-
Benedetti, Michele; Romano, Alessandro; De Castro, Federica; Girelli, Chiara R; Antonucci, Daniela; Migoni, Danilo; Verri, Tiziano; Fanizzi, Francesco P
2016-10-01
In this work, we assessed the capacity of RNA polymerases to use platinated ribonucleotides as substrates for RNA synthesis by testing the incorporation of the model compound [Pt(dien)(N7-5'-GTP)] (dien=diethylenetriamine; GTP=5'-guanosine triphosphate) into a natural RNA sequence. The yield of in vitro transcription operated by T7 RNA polymerase, on the LacZ (Escherichia coli gene encoding for β-galactosidase) sequence, decreases progressively with decreasing the concentration of natural GTP, in favor of the platinated nucleotide, [Pt(dien)(N7-5'-GTP)]. Comparison of the T7 RNA polymerase transcription activities for [Pt(dien)(N7-5'-GTP)] compound incorporation reaction test, with respect to the effect of a decreasing concentration of natural GTP, showed no major differences. A specific inhibitory effect of compound [Pt(dien)(N7-5'-GTP)] (which may pair the complementary base on the DNA strand, without being incorporated in the RNA by the T7 RNA polymerase) was evidenced. Our findings therefore suggest that RNA polymerases, unlike DNA polymerases, are unable to incorporate N7-platinated nucleotides into newly synthesized nucleic acids. In this respect, specifically designed N7-platinated nucleotides based compounds could be used in alternative to the classical platinum based drugs. This approach may offer a possible strategy to target specifically DNA, without affecting RNA, and is potentially able to better modulate pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai Heqiao; Liu Jianying; Malkas, Linda H.
2009-04-15
Hexavalent chromium Cr(VI) is known to be a carcinogenic metal ion, with a complicated mechanism of action. It can be found within our environment in soil and water contaminated by manufacturing processes. Cr(VI) ion is readily taken up by cells, and is recognized to be both genotoxic and cytotoxic; following its reduction to the stable trivalent form of the ion, chromium(Cr(III)), within cells. This form of the ion is known to impede the activity of cellular DNA polymerase and polymerase-mediated DNA replication. Here, we report the effects of chromium on the activity and fidelity of the DNA replication process mediatedmore » by the human cell DNA synthesome. The DNA synthesome is a functional multiprotein complex that is fully competent to carry-out each phase of the DNA replication process. The IC{sub 50} of Cr(III) toward the activity of DNA synthesome-associated DNA polymerases {alpha}, {delta} and {epsilon} is 15, 45 and 125 {mu}M, respectively. Cr(III) inhibits synthesome-mediated DNA synthesis (IC{sub 50} = 88 {mu}M), and significantly reduces the fidelity of synthesome-mediated DNA replication. The mutation frequency induced by the different concentrations of Cr(III) ion used in our assays ranges from 2-13 fold higher than that which occurs spontaneously, and the types of mutations include single nucleotide substitutions, insertions, and deletions. Single nucleotide substitutions are the predominant type of mutation, and they occur primarily at GC base-pairs. Cr(III) ion produces a lower number of transition and a higher number of transversion mutations than occur spontaneously. Unlike Cr(III), Cr(VI) ion has little effect on the in vitro DNA synthetic activity and fidelity of the DNA synthesome, but does significantly inhibit DNA synthesis in intact cells. Cell growth and proliferation is also arrested by increasing concentrations of Cr(VI) ion. Our studies provide evidence indicating that the chromium ion induced decrease in the fidelity and activity of synthesome mediated DNA replication correlates with the genotoxic and cytotoxic effects of this metal ion; and promotes cell killing via inhibition of the DNA polymerase activity mediating the DNA replication and repair processes utilized by human cells.« less
-
Dai, Heqiao; Liu, Jianying; Malkas, Linda H.; Catalano, Jennifer; Alagharu, Srilakshmi; Hickey, Robert J.
2009-01-01
Hexavalent chromium Cr(VI) is known to be a carcinogenic metal ion, with a complicated mechanism of action. It can be found within our environment in soil and water contaminated by manufacturing processes. Cr(VI) ion is readily taken up by cells, and is recognized to be both genotoxic and cytotoxic; following its reduction to the stable trivalent form of the ion, chromium(Cr(III)), within cells. This form of the ion is known to impede the activity of cellular DNA polymerase and polymerase-mediated DNA replication. Here, we report the effects of chromium on the activity and fidelity of the DNA replication process mediated by the human cell DNA synthesome. The DNA synthesome is a functional multiprotein complex that is fully competent to carry-out each phase of the DNA replication process. The IC50 of Cr(III) toward the activity of DNA synthesome-associated DNA polymerases α, δ and ε is 15, 45 and 125 μM, respectively. Cr(III) inhibits synthesome-mediated DNA synthesis (IC50 =88 μM), and significantly reduces the fidelity of synthesome-mediated DNA replication. The mutation frequency induced by the different concentrations of Cr(III) ion used in our assays ranges from 2–13 fold higher than that which occurs spontaneously, and the types of mutations include single nucleotide substitutions, insertions, and deletions. Single nucleotide substitutions are the predominant type of mutation, and they occur primarily at GC base-pairs. Cr(III) ion produces a lower number of transition and a higher number of transversion mutations than occur spontaneously. Unlike Cr (III), Cr(VI) ion has little effect on the in vitro DNA synthetic activity and fidelity of the DNA synthesome, but does significantly inhibit DNA synthesis in intact cells. Cell growth and proliferation is also arrested by increasing concentrations of Cr(VI) ion. Our studies provide evidence indicating that the chromium ion induced decrease in the fidelity and activity of synthesome mediated DNA replication correlates with the genotoxic and cytotoxic effects of this metal ion; and promotes cell killing via inhibition of the DNA polymerase activity mediating the DNA replication and repair processes utilized by human cells. PMID:19371627
-
Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.
Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter
2018-04-01
Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.
-
Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions
NASA Astrophysics Data System (ADS)
Millar, David P.; Carver, Theodore E.
1994-08-01
Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.
-
A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†
Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai
2009-01-01
During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463
-
Gene 1.7 of bacteriophage T7 confers sensitivity of phage growth to dideoxythymidine.
Tran, Ngoc Q; Rezende, Lisa F; Qimron, Udi; Richardson, Charles C; Tabor, Stanley
2008-07-08
Bacteriophage T7 DNA polymerase efficiently incorporates dideoxynucleotides into DNA, resulting in chain termination. Dideoxythymidine (ddT) present in the medium at levels not toxic to Escherichia coli inhibits phage T7. We isolated 95 T7 phage mutants that were resistant to ddT. All contained a mutation in T7 gene 1.7, a nonessential gene of unknown function. When gene 1.7 was expressed from a plasmid, T7 phage resistant to ddT still arose; analysis of 36 of these mutants revealed that all had a single mutation in gene 5, which encodes T7 DNA polymerase. This mutation changes tyrosine-526 to phenylalanine, which is known to increase dramatically the ability of T7 DNA polymerase to discriminate against dideoxynucleotides. DNA synthesis in cells infected with wild-type T7 phage was inhibited by ddT, suggesting that it resulted in chain termination of DNA synthesis in the presence of gene 1.7 protein. Overexpression of gene 1.7 from a plasmid rendered E. coli cells sensitive to ddT, indicating that no other T7 proteins are required to confer sensitivity to ddT.
-
Alkylating agent (MNU)-induced mutation in space environment
NASA Astrophysics Data System (ADS)
Ohnishi, T.; Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.
2001-01-01
In recent years, some contradictory data about the effects of microgravity on radiation-induced biological responses in space experiments have been reported. We prepared a damaged template DNA produced with an alkylating agent (N-methyl-N-nitroso urea; MNU) to measure incorrect base-incorporation during DNA replication in microgravity. We examined whether mutation frequency is affected by microgravity during DNA replication for a DNA template damaged by an alkylating agent. Using an in vitro enzymatic reaction system, DNA synthesis by Taq polymerase or polymerase III was done during a US space shuttle mission (Discovery, STS-91). After the flight, DNA replication and mutation frequencies were measured. We found that there was almost no effect of microgravity on DNA replication and mutation frequency. It is suggested that microgravity might not affect at the stage of substrate incorporation in induced-mutation frequency.
-
Wong, Kwong-Kwok
2000-01-01
The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.
-
Structural basis for inhibition of DNA replication by aphidicolin
Baranovskiy, A. G.; Babayeva, N. D.; Suwa, Y.; ...
2014-11-27
Natural tetracyclic diterpenoid aphidicolin is a potent and specific inhibitor of B-family DNA polymerases, haltering replication and possessing a strong antimitotic activity in human cancer cell lines. Clinical trials revealed limitations of aphidicolin as an antitumor drug because of its low solubility and fast clearance from human plasma. The absence of structural information hampered the improvement of aphidicolin-like inhibitors: more than 50 modifications have been generated so far, but all have lost the inhibitory and antitumor properties. Here we report the crystal structure of the catalytic core of human DNA polymerase α (Pol α) in the ternary complex with anmore » RNA-primed DNA template and aphidicolin. The inhibitor blocks binding of dCTP by docking at the Pol α active site and by rotating the template guanine. The structure provides a plausible mechanism for the selectivity of aphidicolin incorporation opposite template guanine and explains why previous modifications of aphidicolin failed to improve its affinity for Pol α. With new structural information, aphidicolin becomes an attractive lead compound for the design of novel derivatives with enhanced inhibitory properties for B-family DNA polymerases.« less
-
Baños, Benito; Lázaro, José M; Villar, Laurentino; Salas, Margarita; de Vega, Miguel
2008-10-01
Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolX(Bs)), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolX(Bs) possesses an intrinsic 3'-5' exonuclease activity specialized in resecting unannealed 3'-termini in a gapped DNA substrate. Biochemical analysis of a PolX(Bs) deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3'-5' exonuclease activity of PolX(Bs) resides in its PHP domain. Furthermore, site-directed mutagenesis of PolX(Bs) His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3'-termini resection by the 3'-5' exonuclease activity of PolX(Bs) in the DNA repair context are discussed.
-
Mansilla, Sabrina F; Bertolin, Agustina P; Bergoglio, Valérie; Pillaire, Marie-Jeanne; González Besteiro, Marina A; Luzzani, Carlos; Miriuka, Santiago G; Hoffmann, Jean-Sébastien; Gottifredi, Vanesa
2016-01-01
The levels of the cyclin-dependent kinase (CDK) inhibitor p21 are low in S phase and insufficient to inhibit CDKs. We show here that endogenous p21, instead of being residual, it is functional and necessary to preserve the genomic stability of unstressed cells. p21depletion slows down nascent DNA elongation, triggers permanent replication defects and promotes the instability of hard-to-replicate genomic regions, namely common fragile sites (CFS). The p21’s PCNA interacting region (PIR), and not its CDK binding domain, is needed to prevent the replication defects and the genomic instability caused by p21 depletion. The alternative polymerase kappa is accountable for such defects as they were not observed after simultaneous depletion of both p21 and polymerase kappa. Hence, in CDK-independent manner, endogenous p21 prevents a type of genomic instability which is not triggered by endogenous DNA lesions but by a dysregulation in the DNA polymerase choice during genomic DNA synthesis. DOI: http://dx.doi.org/10.7554/eLife.18020.001 PMID:27740454
-
Pustovalova, Yulia; Magalhães, Mariana T. Q.; D’Souza, Sanjay; Rizzo, Alessandro A.; Korza, George; Walker, Graham C.; Korzhnev, Dmitry M.
2016-01-01
Translesion synthesis (TLS) is a mutagenic branch of cellular DNA damage tolerance that enables bypass replication over DNA lesions carried out by specialized low-fidelity DNA polymerases. The replicative bypass of most types of DNA damage is performed in a two-step process of Rev1/Polζ-dependent TLS. In the first step, a Y-family TLS enzyme, typically Polη, Polι or Polκ, inserts a nucleotide across DNA lesion. In the second step, a four-subunit B-family DNA polymerase Polζ (Rev3/Rev7/PolD2/PolD3 complex) extends the distorted DNA primer-template. The coordinated action of error-prone TLS enzymes is regulated through their interactions with the two scaffold proteins, the sliding clamp PCNA and the TLS polymerase Rev1. Rev1 interactions with all other TLS enzymes are mediated by its C-terminal domain (Rev1-CT), which can simultaneously bind the Rev7 subunit of Polζ and Rev1-interacting regions (RIRs) from Polη, Polι or Polκ. In this work, we identified a previously unknown RIR motif in the C-terminal part of PolD3 subunit of Polζ whose interaction with the Rev1-CT is among the tightest mediated by RIR motifs. Three-dimensional structure of the Rev1-CT/PolD3-RIR complex determined by NMR spectroscopy revealed a structural basis for the relatively high affinity of this interaction. The unexpected discovery of PolD3-RIR motif suggests a mechanism of 'inserter' to 'extender' DNA polymerase switch upon Rev1/Polζ-dependent TLS, in which the PolD3-RIR binding to the Rev1-CT (i) helps displace the 'inserter' Polη, Polι or Polκ from its complex with Rev1, and (ii) facilitates assembly of the four-subunit 'extender' Polζ through simultaneous interaction of Rev1-CT with Rev7 and PolD3 subunits. PMID:26982350
-
Contesto-Richefeu, Céline; Tarbouriech, Nicolas; Brazzolotto, Xavier; Betzi, Stéphane; Morelli, Xavier; Burmeister, Wim P.; Iseni, Frédéric
2014-01-01
Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase E9, the uracil-DNA glycosylase D4 and A20, a protein with no known enzymatic activity. The D4/A20 heterodimer is the DNA polymerase co-factor whose function is essential for processive DNA synthesis. Genetic and biochemical data have established that residues located in the N-terminus of A20 are critical for binding to D4. However, no information regarding the residues of D4 involved in A20 binding is yet available. We expressed and purified the complex formed by D4 and the first 50 amino acids of A20 (D4/A201–50). We showed that whereas D4 forms homodimers in solution when expressed alone, D4/A201–50 clearly behaves as a heterodimer. The crystal structure of D4/A201–50 solved at 1.85 Å resolution reveals that the D4/A20 interface (including residues 167 to 180 and 191 to 206 of D4) partially overlaps the previously described D4/D4 dimer interface. A201–50 binding to D4 is mediated by an α-helical domain with important leucine residues located at the very N-terminal end of A20 and a second stretch of residues containing Trp43 involved in stacking interactions with Arg167 and Pro173 of D4. Point mutations of the latter residues disturb D4/A201–50 formation and reduce significantly thermal stability of the complex. Interestingly, small molecule docking with anti-poxvirus inhibitors selected to interfere with D4/A20 binding could reproduce several key features of the D4/A201–50 interaction. Finally, we propose a model of D4/A201–50 in complex with DNA and discuss a number of mutants described in the literature, which affect DNA synthesis. Overall, our data give new insights into the assembly of the poxvirus DNA polymerase cofactor and may be useful for the design and rational improvement of antivirals targeting the D4/A20 interface. PMID:24603707
-
DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis
Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra
2016-01-01
Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227
-
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
-
Carbocyclic nucleoside analogues: classification, target enzymes, mechanisms of action and synthesis
NASA Astrophysics Data System (ADS)
Matyugina, E. S.; Khandazhinskaya, A. P.; Kochetkov, Sergei N.
2012-08-01
Key biological targets (S-adenosyl-L-homocysteine hydrolase, telomerase, human immunodeficiency virus reverse transcriptase, herpes virus DNA polymerase and hepatitis B virus DNA polymerase) and the mechanisms of action of carbocyclic nucleoside analogues are considered. Structural types of analogues are discussed. Methods of synthesis for the most promising compounds and the spectrum of their biological activities are described. The bibliography includes 126 references.
-
Schraufstatter, I U; Hyslop, P A; Hinshaw, D B; Spragg, R G; Sklar, L A; Cochrane, C G
1986-01-01
H2O2, in concentrations achieved in the proximity of stimulated leukocytes, induces injury and lysis of target cells. This may be an important aspect of inflammatory injury of tissues. Cell lysis in two target cells, the murine macrophage-like tumor cell line P388D1 and human peripheral lymphocytes, was found to be associated with activation of poly(ADP-ribose) polymerase (EC 2.4.2.30), a nuclear enzyme. This enzyme is activated under various conditions of DNA damage. Poly(ADP-ribose) polymerase utilizes nicotinamide adenine dinucleotide (NAD) as substrate and has been previously shown to consume NAD during exposure of cells to oxidants that was associated with inhibition of glycolysis, a decrease in cellular ATP, and cell death. In the current studies, inhibition of poly(ADP-ribose) polymerase by 3-aminobenzamide, nicotinamide, or theophylline in cells exposed to lethal concentrations of H2O2 prevented the sequence of events that eventually led to cell lysis--i.e., the decrease in NAD, followed by depletion of ATP, influx of extracellular Ca2+, actin polymerization and, finally, cell death. DNA damage, the initial stimulus for poly(ADP-ribose) polymerase activation, occurred despite the inhibition of this enzyme. Cells exposed to oxidant in the presence of the poly(ADP-ribose) polymerase inhibitor 3-aminobenzamide failed to demonstrate repair of DNA strand breaks. PMID:2941760
-
2011-11-16
protein A (Rpa2), the minichromosome maintenance complex component genes which encode helicases, DNA ligase (Lig1), DNA polymerase e ( Pole and Pole2...and DNA polymerase d ( Pold1 and Pold2 ) are all up-regulated as a result of exposure to chromium (Figure 6), suggesting that there is an increase in...Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line Matthew G
-
Strand displacement synthesis by yeast DNA polymerase ε
Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik
2016-01-01
DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747
-
Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast.
Chen, Miao; Gartenberg, Marc R
2014-05-01
tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC-tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs.
-
Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast
Chen, Miao; Gartenberg, Marc R.
2014-01-01
tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC–tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs. PMID:24788517
-
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-04-01
To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.
-
Dapa, Tanja; Fleurier, Sébastien; Bredeche, Marie-Florence; Matic, Ivan
2017-07-01
Mitomycin C (MMC) is a genotoxic agent that induces DNA cross-links, DNA alkylation, and the production of reactive oxygen species (ROS). MMC induces the SOS response and RpoS regulons in Escherichia coli SOS-encoded functions are required for DNA repair, whereas the RpoS regulon is typically induced by metabolic stresses that slow growth. Thus, induction of the RpoS regulon by MMC may be coincidental, because DNA damage slows growth; alternatively, the RpoS regulon may be an adaptive response contributing to cell survival. In this study, we show that the RpoS regulon is primarily induced by MMC-induced ROS production. We also show that RpoS regulon induction is required for the survival of MMC-treated growing cells. The major contributor to RpoS-dependent resistance to MMC treatment is DNA polymerase Pol II, which is encoded by the polB gene belonging to the SOS regulon. The observation that polB gene expression is controlled by the two major stress response regulons that are required to maximize survival and fitness further emphasizes the key role of this DNA polymerase as an important factor in genome stability. Copyright © 2017 by the Genetics Society of America.
-
Optical tweezers reveal how proteins alter replication
NASA Astrophysics Data System (ADS)
Chaurasiya, Kathy
Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.
-
Nickel(II) affects poly(ADP-ribose) polymerase-mediated DNA repair in normal and cancer cells.
Wozniak, Katarzyna; Czechowska, Agnieszka; Blasiak, Janusz
2006-01-01
Nickel(II) can be genotoxic, but the mechanism of its genotoxicity is not fully understood and the process of DNA repair may be considered as its potential target. We studied the effect of nickel chloride on the poly(ADP-ribose) polymerase (PARP)-mediated repair of DNA damaged by gamma-radiation and idarubicin with the alkaline comet assay in normal and cancer cells. Our results indicate that nickel chloride at very low, non-cytotoxic concentration of 1 microM can affect PARP-mediated DNA repair of lesions evoked by idarubicin and gamma-radiation. We also suggest that in the quiescent lymphocytes treated with gamma-radiation, nickel(II) could interfere with DNA repair process independent of PARP.
-
Ciesielski, Grzegorz L; Hytönen, Vesa P; Kaguni, Laurie S
2016-01-01
A lack of effective treatment for mitochondrial diseases prompts scientists to investigate the molecular processes that underlie their development. The major cause of mitochondrial diseases is dysfunction of the sole mitochondrial DNA polymerase, DNA polymerase γ (Pol γ). The development of treatment strategies will require a detailed characterization of the molecular properties of Pol γ. A novel technique, biolayer interferometry, allows one to monitor molecular interactions in real time, thus providing an insight into the kinetics of the process. Here, we present an application of the biolayer interferometry technique to characterize the fundamental reactions that Pol γ undergoes during the initiation phase of mitochondrial DNA replication: holoenzyme formation and binding to the primer-template.
-
Ciesielski, Grzegorz L.; Hytönen, Vesa P.; Kaguni, Laurie S.
2015-01-01
A lack of effective treatment for mitochondrial diseases prompts scientists to investigate the molecular processes that underlie their development. The major cause of mitochondrial diseases is dysfunction of the sole mitochondrial DNA polymerase, DNA polymerase γ (Pol γ). The development of treatment strategies will require a detailed characterization of the molecular properties of Pol γ. A novel technique, biolayer interferometry, allows one to monitor molecular interactions in real time, thus providing an insight into the kinetics of the process. Here, we present an application of the biolayer interferometry technique to characterize the fundamental reactions that Pol γ undergoes during the initiation phase of mitochondrial DNA replication: holoenzyme formation and binding to the primer-template. PMID:26530686
-
Interactions of Escherichia coli σ70 within the transcription elongation complex
Daube, Shirley S.; von Hippel, Peter H.
1999-01-01
A functional transcription elongation complex can be formed without passing through a promoter by adding a complementary RNA primer and core Escherichia coli RNA polymerase in trans to an RNA-primed synthetic bubble-duplex DNA framework. This framework consists of a double-stranded DNA sequence with an internal noncomplementary DNA “bubble” containing a hybridized RNA primer. On addition of core polymerase and the requisite NTPs, the RNA primer is extended in a process that manifests most of the properties of in vitro transcription elongation. This synthetic elongation complex can also be assembled by using holo rather than core RNA polymerase, and in this study we examine the interactions and fate of the σ70 specificity subunit of the holopolymerase in the assembly process. We show that the addition of holopolymerase to the bubble-duplex construct triggers the dissociation of the sigma factor from some complexes, whereas in others the RNA oligomer is released into solution instead. These results are consistent with an allosteric competition between σ70 and the nascent RNA strand within the elongation complex and suggest that both cannot be bound to the core polymerase simultaneously. However, the dissociation of σ70 from the complex can also be stimulated by binding of the holopolymerase to the DNA bubble duplex in the absence of a hybridized RNA primer, suggesting that the binding of the core polymerase to the bubble-duplex construct also triggers a conformational change that additionally weakens the sigma–core interaction. PMID:10411885
-
Andrei, Graciela; Gillemot, Sarah; Topalis, Dimitrios; Snoeck, Robert
2018-02-14
Genital herpes is an important cofactor for acquisition of human immunodeficiency virus (HIV) infection, and effective prophylaxis is a helpful strategy to halt both HIV and herpes simplex virus (HSV) transmission. The antiretroviral agent tenofovir, formulated as a vaginal microbicide gel, was shown to reduce the risk of HIV and HSV type 2 (HSV-2) acquisition. HSV type 1 (HSV-1) and HSV-2 mutants were selected for resistance to tenofovir and PMEO-DAPy (6-phosphonylmethoxyethoxy-2,4-diaminopyrimidine, an acyclic nucleoside phosphonate with dual anti-HSV and anti-HIV activity) by stepwise dose escalation. Several plaque-purified viruses were characterized phenotypically (drug resistance profiling) and genotypically (sequencing of the viral DNA polymerase gene). Tenofovir resistant and PMEO-DAPy-resistant viruses harbored specific amino acid substitutions associated with resistance not only to tenofovir and PMEO-DAPy but also to acyclovir and foscarnet. These amino acid changes (A719V, S724N, and L802F [HSV-1] and M789T and A724V [HSV-2]) were also found in clinical isolates recovered from patients refractory to acyclovir and/or foscarnet therapy or in laboratory-derived strains. A total of 10 (HSV-1) and 18 (HSV-2) well-characterized DNA polymerase mutants had decreased susceptibility to tenofovir and PMEO-DAPy. Tenofovir and PMEO-DAPy target the HSV DNA polymerase, and clinical isolates with DNA polymerase mutations emerging under acyclovir and/or foscarnet therapy showed cross-resistance to tenofovir and PMEO-DAPy. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
-
Müller, M; Schnitzler, P; Koonin, E V; Darai, G
1995-05-01
Cytoplasmic DNA viruses encode a DNA-dependent RNA polymerase (DdRP) that is essential for transcription of viral genes. The amino acid sequences of the known largest subunits of DdRPs from different species contain highly conserved regions. Oligonucleotide primers, deduced from two conserved domains (RQP[T/S]LH and NADFDGDE) were used for detecting the corresponding gene of fish lymphocystis disease virus (FLCDV), a member of the family Iridoviridae, which replicates in the cytoplasm of infected cells of flatfish. The gene coding for the largest subunit of the DdRP was identified using a PCR-derived probe. The screening of the complete EcoRI gene library of the viral genome led to the identification of the gene locus of the largest subunit of the DdRP within the EcoRI DNA fragment B (12.4 kbp, 0.034 to 0.165 map units). The nucleotide sequence of a part (8334 bp) of the EcoRI DNA fragment B was determined and a large ORF on the lower strand (ATG = 5787; TAA = 2190) was detected which encodes a protein of 1199 amino acids. Comparison of the amino acid sequences of the largest subunits of the DdRP (RPO1) of FLCDV and Chilo iridescent virus (CIV) revealed a dramatic difference in their domain organization. Unlike the 1051 aa RPO1 of CIV, which lacks the C-terminal domain conserved in eukaryotic, eubacterial and other viral RNA polymerases, the 1199 aa RPO1 of FLCDV is fully collinear with its cellular and viral homologues. Despite this difference, comparative analysis of the amino acid sequences of viral and cellular RNA polymerases suggests a common origin for the largest RNA polymerase subunits of FLCDV and CIV.
-
Single-molecule visualization of fast polymerase turnover in the bacterial replisome
Lewis, Jacob S; Spenkelink, Lisanne M; Jergic, Slobodan; Wood, Elizabeth A; Monachino, Enrico; Horan, Nicholas P; Duderstadt, Karl E; Cox, Michael M; Robinson, Andrew; Dixon, Nicholas E; van Oijen, Antoine M
2017-01-01
The Escherichia coli DNA replication machinery has been used as a road map to uncover design rules that enable DNA duplication with high efficiency and fidelity. Although the enzymatic activities of the replicative DNA Pol III are well understood, its dynamics within the replisome are not. Here, we test the accepted view that the Pol III holoenzyme remains stably associated within the replisome. We use in vitro single-molecule assays with fluorescently labeled polymerases to demonstrate that the Pol III* complex (holoenzyme lacking the β2 sliding clamp), is rapidly exchanged during processive DNA replication. Nevertheless, the replisome is highly resistant to dilution in the absence of Pol III* in solution. We further show similar exchange in live cells containing labeled clamp loader and polymerase. These observations suggest a concentration-dependent exchange mechanism providing a balance between stability and plasticity, facilitating replacement of replisomal components dependent on their availability in the environment. DOI: http://dx.doi.org/10.7554/eLife.23932.001 PMID:28432790