Sample records for complement regulatory molecule

  1. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

    PubMed

    Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

  2. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion

    PubMed Central

    Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340

  3. Future perspectives in target-specific immunotherapies of myasthenia gravis

    PubMed Central

    Dalakas, Marinos C.

    2015-01-01

    Myasthenia gravis (MG) is an autoimmune disease caused by complement-fixing antibodies against acetylcholine receptors (AChR); antigen-specific CD4+ T cells, regulatory T cells (Tregs) and T helper (Th) 17+ cells are essential in antibody production. Target-specific therapeutic interventions should therefore be directed against antibodies, B cells, complement and molecules associated with T cell signaling. Even though the progress in the immunopathogenesis of the disease probably exceeds any other autoimmune disorder, MG is still treated with traditional drugs or procedures that exert a non-antigen specific immunosuppression or immunomodulation. Novel biological agents currently on the market, directed against the following molecular pathways, are relevant and specific therapeutic targets that can be tested in MG: (a) T cell intracellular signaling molecules, such as anti-CD52, anti-interleukin (IL) 2 receptors, anti- costimulatory molecules, and anti-Janus tyrosine kinases (JAK1, JAK3) that block the intracellular cascade associated with T-cell activation; (b) B cells and their trophic factors, directed against key B-cell molecules; (c) complement C3 or C5, intercepting the destructive effect of complement-fixing antibodies; (d) cytokines and cytokine receptors, such as those targeting IL-6 which promotes antibody production and IL-17, or the p40 subunit of IL-12/1L-23 that affect regulatory T cells; and (e) T and B cell transmigration molecules associated with lymphocyte egress from the lymphoid organs. All drugs against these molecular pathways require testing in controlled trials, although some have already been tried in small case series. Construction of recombinant AChR antibodies that block binding of the pathogenic antibodies, thereby eliminating complement and antibody-depended-cell-mediated cytotoxicity, are additional novel molecular tools that require exploration in experimental MG. PMID:26600875

  4. Novel Evasion Mechanisms of the Classical Complement Pathway

    PubMed Central

    Garcia, Brandon L.; Zwarthoff, Seline A.; Rooijakkers, Suzan H. M.; Geisbrecht, Brian V.

    2016-01-01

    Complement is a network of soluble and cell surface-associated proteins which gives rise to a self-amplifying, yet tightly regulated system with fundamental roles in immune surveillance and clearance. Complement becomes activated on the surface of ‘non-self’ cells by one of three initiating mechanisms known as the classical, lectin, or alternative pathways. Evasion of complement function is a hallmark of invasive pathogens and hematophagous organisms. While many complement inhibition strategies hinge on hijacking activities of endogenous complement regulatory proteins, an increasing number of uniquely evolved evasion molecules have been discovered over the past decade. In this review we focus on several recent investigations which have revealed mechanistically distinct inhibitors of the classical pathway. Because the classical pathway is an important and specific mediator of various autoimmune and inflammatory disorders, in-depth knowledge of novel evasion mechanisms could direct future development of therapeutic anti-inflammatory molecules. PMID:27591336

  5. Novel Evasion Mechanisms of the Classical Complement Pathway.

    PubMed

    Garcia, Brandon L; Zwarthoff, Seline A; Rooijakkers, Suzan H M; Geisbrecht, Brian V

    2016-09-15

    Complement is a network of soluble and cell surface-associated proteins that gives rise to a self-amplifying, yet tightly regulated system with fundamental roles in immune surveillance and clearance. Complement becomes activated on the surface of nonself cells by one of three initiating mechanisms known as the classical, lectin, and alternative pathways. Evasion of complement function is a hallmark of invasive pathogens and hematophagous organisms. Although many complement-inhibition strategies hinge on hijacking activities of endogenous complement regulatory proteins, an increasing number of uniquely evolved evasion molecules have been discovered over the past decade. In this review, we focus on several recent investigations that revealed mechanistically distinct inhibitors of the classical pathway. Because the classical pathway is an important and specific mediator of various autoimmune and inflammatory disorders, in-depth knowledge of novel evasion mechanisms could direct future development of therapeutic anti-inflammatory molecules. Copyright © 2016 by The American Association of Immunologists, Inc.

  6. Suppression of complement regulatory protein C1 inhibitor in vascular endothelial activation by inhibiting vascular cell adhesion molecule-1 action

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Haimou; Qin, Gangjian; Liang, Gang

    Increased expression of adhesion molecules by activated endothelium is a critical feature of vascular inflammation associated with the several diseases such as endotoxin shock and sepsis/septic shock. Our data demonstrated complement regulatory protein C1 inhibitor (C1INH) prevents endothelial cell injury. We hypothesized that C1INH has the ability of an anti-endothelial activation associated with suppression of expression of adhesion molecule(s). C1INH blocked leukocyte adhesion to endothelial cell monolayer in both static assay and flow conditions. In inflammatory condition, C1INH reduced vascular cell adhesion molecule (VCAM-1) expression associated with its cytoplasmic mRNA destabilization and nuclear transcription level. Studies exploring the underlying mechanismmore » of C1INH-mediated suppression in VCAM-1 expression were related to reduction of NF-{kappa}B activation and nuclear translocation in an I{kappa}B{alpha}-dependent manner. The inhibitory effects were associated with reduction of inhibitor I{kappa}B kinase activity and stabilization of the NF-{kappa}B inhibitor I{kappa}B. These findings indicate a novel role for C1INH in inhibition of vascular endothelial activation. These observations could provide the basis for new therapeutic application of C1INH to target inflammatory processes in different pathologic situations.« less

  7. Single-Molecule Studies of Actin Assembly and Disassembly Factors

    PubMed Central

    Smith, Benjamin A.; Gelles, Jeff; Goode, Bruce L.

    2014-01-01

    The actin cytoskeleton is very dynamic and highly regulated by multiple associated proteins in vivo. Understanding how this system of proteins functions in the processes of actin network assembly and disassembly requires methods to dissect the mechanisms of activity of individual factors and of multiple factors acting in concert. The advent of single-filament and single-molecule fluorescence imaging methods has provided a powerful new approach to discovering actin-regulatory activities and obtaining direct, quantitative insights into the pathways of molecular interactions that regulate actin network architecture and dynamics. Here we describe techniques for acquisition and analysis of single-molecule data, applied to the novel challenges of studying the filament assembly and disassembly activities of actin-associated proteins in vitro. We discuss the advantages of single-molecule analysis in directly visualizing the order of molecular events, measuring the kinetic rates of filament binding and dissociation, and studying the coordination among multiple factors. The methods described here complement traditional biochemical approaches in elucidating actin-regulatory mechanisms in reconstituted filamentous networks. PMID:24630103

  8. Mutational analysis of Kaposica reveals that bridging of MG2 and CUB domains of target protein is crucial for the cofactor activity of RCA proteins

    PubMed Central

    Gautam, Avneesh Kumar; Panse, Yogesh; Ghosh, Payel; Reza, Malik Johid; Mullick, Jayati; Sahu, Arvind

    2015-01-01

    The complement system has evolved to annul pathogens, but its improper regulation is linked with diseases. Efficient regulation of the system is primarily provided by a family of proteins termed regulators of complement activation (RCA). The knowledge of precise structural determinants of RCA proteins critical for imparting the regulatory activities and the molecular events underlying the regulatory processes, nonetheless, is still limited. Here, we have dissected the structural requirements of RCA proteins that are crucial for one of their two regulatory activities, the cofactor activity (CFA), by using the Kaposi’s sarcoma-associated herpesvirus RCA homolog Kaposica as a model protein. We have scanned the entire Kaposica molecule by sequential mutagenesis using swapping and site-directed mutagenesis, which identified residues critical for its interaction with C3b and factor I. Mapping of these residues onto the modeled structure of C3b–Kaposica–factor I complex supported the mutagenesis data. Furthermore, the model suggested that the C3b-interacting residues bridge the CUB (complement C1r-C1s, Uegf, Bmp1) and MG2 (macroglobulin-2) domains of C3b. Thus, it seems that stabilization of the CUB domain with respect to the core of the C3b molecule is central for its CFA. Identification of CFA-critical regions in Kaposica guided experiments in which the equivalent regions of membrane cofactor protein were swapped into decay-accelerating factor. This strategy allowed CFA to be introduced into decay-accelerating factor, suggesting that viral and human regulators use a common mechanism for CFA. PMID:26420870

  9. A small diffusible signal molecule is responsible for the global control of virulence and exoenzyme production in the plant pathogen Erwinia carotovora.

    PubMed Central

    Pirhonen, M; Flego, D; Heikinheimo, R; Palva, E T

    1993-01-01

    Virulence of the plant pathogen Erwinia carotovora subsp. carotovora is dependent on the production and secretion of a complex arsenal of plant cell wall-degrading enzymes. Production of these exoenzymes is controlled by a global regulatory mechanism. A virulent mutants in one of the regulatory loci, expI, show a pleiotropic defect in the growth phase-dependent transcriptional activation of exoenzyme gene expression. The expI gene encodes a 26 kDa polypeptide that is structurally and functionally related to the luxI gene product of Vibrio fischeri. Functional similarity of expI and luxI has been demonstrated by reciprocal genetic complementation experiments. LuxI controls bioluminescence in V.fischeri in a growth phase-dependent manner by directing the synthesis of the diffusible autoinducer, N-(3-oxohexanoyl) homoserine lactone. E.c. subsp. carotovora expI+ strains or Escherichia coli harboring the cloned expI gene excrete a small diffusible signal molecule that complements the expI mutation of Erwinia as well as a luxI mutation of V.fischeri. This extracellular complementation can also be achieved by E.coli harboring the luxI gene from V.fischeri or by adding the synthetic V.fischeri autoinducer. Both the production of the plant tissue-macerating exoenzymes and the ability of the bacteria to propagate in planta are restored in expI mutants by autoinducer addition. These data suggest that the same signal molecule is employed in control of such diverse processes as virulence in a plant pathogen and bioluminescence in a marine bacterium, and may represent a general mechanism by which bacteria modulate gene expression in response to changing environmental conditions. Images PMID:8508772

  10. A small diffusible signal molecule is responsible for the global control of virulence and exoenzyme production in the plant pathogen Erwinia carotovora.

    PubMed

    Pirhonen, M; Flego, D; Heikinheimo, R; Palva, E T

    1993-06-01

    Virulence of the plant pathogen Erwinia carotovora subsp. carotovora is dependent on the production and secretion of a complex arsenal of plant cell wall-degrading enzymes. Production of these exoenzymes is controlled by a global regulatory mechanism. A virulent mutants in one of the regulatory loci, expI, show a pleiotropic defect in the growth phase-dependent transcriptional activation of exoenzyme gene expression. The expI gene encodes a 26 kDa polypeptide that is structurally and functionally related to the luxI gene product of Vibrio fischeri. Functional similarity of expI and luxI has been demonstrated by reciprocal genetic complementation experiments. LuxI controls bioluminescence in V.fischeri in a growth phase-dependent manner by directing the synthesis of the diffusible autoinducer, N-(3-oxohexanoyl) homoserine lactone. E.c. subsp. carotovora expI+ strains or Escherichia coli harboring the cloned expI gene excrete a small diffusible signal molecule that complements the expI mutation of Erwinia as well as a luxI mutation of V.fischeri. This extracellular complementation can also be achieved by E.coli harboring the luxI gene from V.fischeri or by adding the synthetic V.fischeri autoinducer. Both the production of the plant tissue-macerating exoenzymes and the ability of the bacteria to propagate in planta are restored in expI mutants by autoinducer addition. These data suggest that the same signal molecule is employed in control of such diverse processes as virulence in a plant pathogen and bioluminescence in a marine bacterium, and may represent a general mechanism by which bacteria modulate gene expression in response to changing environmental conditions.

  11. Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway.

    PubMed

    Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine; Garred, Peter

    2017-01-01

    The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition molecules that bind specific patterns on microbial surfaces, a group of associated proteases that initiates the complement cascade, and a group of proteins that interact in proteolytic complexes or the terminal pore-forming complex. In addition, various regulatory proteins are important for controlling the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system. Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination.

  12. Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway

    PubMed Central

    Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine; Garred, Peter

    2017-01-01

    The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition molecules that bind specific patterns on microbial surfaces, a group of associated proteases that initiates the complement cascade, and a group of proteins that interact in proteolytic complexes or the terminal pore-forming complex. In addition, various regulatory proteins are important for controlling the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system. Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination. PMID:28553281

  13. Coupling complement regulators to immunoglobulin domains generates effective anti-complement reagents with extended half-life in vivo

    PubMed Central

    HARRIS, C L; WILLIAMS, A S; LINTON, S M; MORGAN, B P

    2002-01-01

    Complement activation and subsequent generation of inflammatory molecules and membrane attack complex contributes to the pathology of a number of inflammatory and degenerative diseases, including arthritis, glomerulonephritis and demyelination. Agents that specifically inhibit complement activation might prove beneficial in the treatment of these diseases. Soluble recombinant forms of the naturally occurring membrane complement regulatory proteins (CRP) have been exploited for this purpose. We have undertaken to design better therapeutics based on CRP. Here we describe the generation of soluble, recombinant CRP comprising rat decay accelerating factor (DAF) or rat CD59 expressed as Fc fusion proteins, antibody-like molecules comprising two CRP moieties in place of the antibody Fab arms (CRP-Ig). Reagents bearing DAF on each arm (DAF-Ig), CD59 on each arm (CD59-Ig) and a hybrid reagent containing both DAF and CD59 were generated. All three reagents inhibited C activation in vitro. Compared with soluble CRP lacking Fc domains, activity was reduced, but was fully restored by enzymatic release of the regulator from the Ig moiety, implicating steric constraints in reducing functional activity. In vivo studies showed that DAF-Ig, when compared to soluble DAF, had a much extended half-life in the circulation in rats and concomitantly caused a sustained reduction in plasma complement activity. When given intra-articularly to rats in a model of arthritis, DAF-Ig significantly reduced severity of disease. The data demonstrate the potential of CRP-Ig as reagents for sustained therapy of inflammatory disorders, including arthritis, but emphasize the need for careful design of fusion proteins to retain function. PMID:12165074

  14. Virulence Associated Gene 8 of Bordetella pertussis Enhances Contact System Activity by Inhibiting the Regulatory Function of Complement Regulator C1 Inhibitor

    PubMed Central

    Hovingh, Elise S.; de Maat, Steven; Cloherty, Alexandra P. M.; Johnson, Steven; Pinelli, Elena; Maas, Coen; Jongerius, Ilse

    2018-01-01

    Bordetella pertussis is a Gram-negative bacterium and the causative agent of whooping cough. Whooping cough is currently re-emerging worldwide and, therefore, still poses a continuous global health threat. B. pertussis expresses several virulence factors that play a role in evading the human immune response. One of these virulence factors is virulence associated gene 8 (Vag8). Vag8 is a complement evasion molecule that mediates its effects by binding to the complement regulator C1 inhibitor (C1-INH). This regulatory protein is a fluid phase serine protease that controls proenzyme activation and enzyme activity of not only the complement system but also the contact system. Activation of the contact system results in the generation of bradykinin, a pro-inflammatory peptide. Here, the activation of the contact system by B. pertussis was explored. We demonstrate that recombinant as well as endogenous Vag8 enhanced contact system activity by binding C1-INH and attenuating its inhibitory function. Moreover, we show that B. pertussis itself is able to activate the contact system. This activation was dependent on Vag8 production as a Vag8 knockout B. pertussis strain was unable to activate the contact system. These findings show a previously overlooked interaction between the contact system and the respiratory pathogen B. pertussis. Activation of the contact system by B. pertussis may contribute to its pathogenicity and virulence. PMID:29915576

  15. Virulence Associated Gene 8 of Bordetella pertussis Enhances Contact System Activity by Inhibiting the Regulatory Function of Complement Regulator C1 Inhibitor.

    PubMed

    Hovingh, Elise S; de Maat, Steven; Cloherty, Alexandra P M; Johnson, Steven; Pinelli, Elena; Maas, Coen; Jongerius, Ilse

    2018-01-01

    Bordetella pertussis is a Gram-negative bacterium and the causative agent of whooping cough. Whooping cough is currently re-emerging worldwide and, therefore, still poses a continuous global health threat. B. pertussis expresses several virulence factors that play a role in evading the human immune response. One of these virulence factors is virulence associated gene 8 (Vag8). Vag8 is a complement evasion molecule that mediates its effects by binding to the complement regulator C1 inhibitor (C1-INH). This regulatory protein is a fluid phase serine protease that controls proenzyme activation and enzyme activity of not only the complement system but also the contact system. Activation of the contact system results in the generation of bradykinin, a pro-inflammatory peptide. Here, the activation of the contact system by B. pertussis was explored. We demonstrate that recombinant as well as endogenous Vag8 enhanced contact system activity by binding C1-INH and attenuating its inhibitory function. Moreover, we show that B. pertussis itself is able to activate the contact system. This activation was dependent on Vag8 production as a Vag8 knockout B. pertussis strain was unable to activate the contact system. These findings show a previously overlooked interaction between the contact system and the respiratory pathogen B. pertussis . Activation of the contact system by B. pertussis may contribute to its pathogenicity and virulence.

  16. Mammalian synthetic biology for studying the cell

    PubMed Central

    Mathur, Melina; Xiang, Joy S.

    2017-01-01

    Synthetic biology is advancing the design of genetic devices that enable the study of cellular and molecular biology in mammalian cells. These genetic devices use diverse regulatory mechanisms to both examine cellular processes and achieve precise and dynamic control of cellular phenotype. Synthetic biology tools provide novel functionality to complement the examination of natural cell systems, including engineered molecules with specific activities and model systems that mimic complex regulatory processes. Continued development of quantitative standards and computational tools will expand capacities to probe cellular mechanisms with genetic devices to achieve a more comprehensive understanding of the cell. In this study, we review synthetic biology tools that are being applied to effectively investigate diverse cellular processes, regulatory networks, and multicellular interactions. We also discuss current challenges and future developments in the field that may transform the types of investigation possible in cell biology. PMID:27932576

  17. Mammalian synthetic biology for studying the cell.

    PubMed

    Mathur, Melina; Xiang, Joy S; Smolke, Christina D

    2017-01-02

    Synthetic biology is advancing the design of genetic devices that enable the study of cellular and molecular biology in mammalian cells. These genetic devices use diverse regulatory mechanisms to both examine cellular processes and achieve precise and dynamic control of cellular phenotype. Synthetic biology tools provide novel functionality to complement the examination of natural cell systems, including engineered molecules with specific activities and model systems that mimic complex regulatory processes. Continued development of quantitative standards and computational tools will expand capacities to probe cellular mechanisms with genetic devices to achieve a more comprehensive understanding of the cell. In this study, we review synthetic biology tools that are being applied to effectively investigate diverse cellular processes, regulatory networks, and multicellular interactions. We also discuss current challenges and future developments in the field that may transform the types of investigation possible in cell biology. © 2017 Mathur et al.

  18. Preeclampsia in autologous and oocyte donation pregnancy: is there a different pathophysiology?

    PubMed

    Lashley, Lisa E E L O; Buurma, Aletta; Swings, Godelieve M J S; Eikmans, Michael; Anholts, Jacqueline D H; Bakker, Jaap A; Claas, Frans H J

    2015-06-01

    Oocyte donation (OD) is a specific method of artificial reproductive technology that is accompanied by a higher risk of preeclampsia during pregnancy. The pathophysiological mechanism underlying preeclampsia in OD pregnancies is thought to differ from preeclampsia in autologous pregnancies. As preeclampsia in autologous pregnancies is suggested to be associated with complement activation, we studied C4d deposition, circulating complement components and placental complement regulatory proteins in preeclamptic OD pregnancies. Women with uncomplicated and preeclamptic pregnancies after OD or spontaneous conception were selected. We stained the placentas for C4d, marker for complement activation, measured complement factors C1q, C3 and C4 in maternal sera and quantified the placental mRNA expression of complement regulatory proteins CD46, CD55 and CD59. A significantly (p < 0.03) higher incidence of C4d deposition was observed in placentas from women with preeclampsia compared with uncomplicated pregnancies, both OD and autologous. The level of complement factors in serum did not differ between the groups. Children born in the autologous preeclampsia group were significantly lower in birth weight (p < 10th percentile) compared with the preeclamptic OD group. In addition, the placental mRNA expression level of complement regulatory proteins was significantly lower in uncomplicated and preeclamptic OD compared with the autologous pregnancies. In line with autologous preeclampsia pregnancies, there is excessive activation of complement in preeclamptic OD pregnancies. However, in contrast to autologous pregnancies this is not associated with counterbalancing upregulation of complement regulatory proteins. Furthermore, C4d deposition in OD pregnancies is not related to the severity of preeclampsia, suggesting another trigger or regulatory mechanism of placental C4d deposition in preeclamptic OD pregnancies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Non-coding RNAs and plant male sterility: current knowledge and future prospects.

    PubMed

    Mishra, Ankita; Bohra, Abhishek

    2018-02-01

    Latest outcomes assign functional role to non-coding (nc) RNA molecules in regulatory networks that confer male sterility to plants. Male sterility in plants offers great opportunity for improving crop performance through application of hybrid technology. In this respect, cytoplasmic male sterility (CMS) and sterility induced by photoperiod (PGMS)/temperature (TGMS) have greatly facilitated development of high-yielding hybrids in crops. Participation of non-coding (nc) RNA molecules in plant reproductive development is increasingly becoming evident. Recent breakthroughs in rice definitively associate ncRNAs with PGMS and TGMS. In case of CMS, the exact mechanism through which the mitochondrial ORFs exert influence on the development of male gametophyte remains obscure in several crops. High-throughput sequencing has enabled genome-wide discovery and validation of these regulatory molecules and their target genes, describing their potential roles performed in relation to CMS. Discovery of ncRNA localized in plant mtDNA with its possible implication in CMS induction is intriguing in this respect. Still, conclusive evidences linking ncRNA with CMS phenotypes are currently unavailable, demanding complementing genetic approaches like transgenics to substantiate the preliminary findings. Here, we review the recent literature on the contribution of ncRNAs in conferring male sterility to plants, with an emphasis on microRNAs. Also, we present a perspective on improved understanding about ncRNA-mediated regulatory pathways that control male sterility in plants. A refined understanding of plant male sterility would strengthen crop hybrid industry to deliver hybrids with improved performance.

  20. Complement Evasion by Pathogenic Leptospira.

    PubMed

    Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva

    2016-01-01

    Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira . Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira , have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host.

  1. Complement Evasion by Pathogenic Leptospira

    PubMed Central

    Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva

    2016-01-01

    Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira. Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira, have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host. PMID:28066433

  2. Identification of C3b-Binding Small-Molecule Complement Inhibitors Using Cheminformatics.

    PubMed

    Garcia, Brandon L; Skaff, D Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K; Wyckoff, Gerald J; Geisbrecht, Brian V

    2017-05-01

    The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of more than two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology, such as acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases, which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small-molecule inhibitors, small-molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study, we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies, we identified 45 small molecules that putatively bind C3b near ligand-guided functional hot spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand that guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small-molecule complement inhibitors and, to our knowledge, provides the first demonstration of cheminformatics-based, complement-directed drug discovery. Copyright © 2017 by The American Association of Immunologists, Inc.

  3. Identification of C3b-binding Small Molecule Complement Inhibitors Using Cheminformatics

    PubMed Central

    Garcia, Brandon L.; Skaff, D. Andrew; Chatterjee, Arindam; Hanning, Anders; Walker, John K.; Wyckoff, Gerald J.; Geisbrecht, Brian V.

    2017-01-01

    The complement system is an elegantly regulated biochemical cascade formed by the collective molecular recognition properties and proteolytic activities of over two dozen membrane-bound or serum proteins. Complement plays diverse roles in human physiology which include acting as a sentry against invading microorganisms, priming of the adaptive immune response, and removal of immune complexes. However, dysregulation of complement can serve as a trigger for a wide range of human diseases which include autoimmune, inflammatory, and degenerative conditions. Despite several potential advantages of modulating complement with small molecule inhibitors, small molecule drugs are highly underrepresented in the current complement-directed therapeutics pipeline. In this study we have employed a cheminformatics drug discovery approach based on the extensive structural and functional knowledge available for the central proteolytic fragment of the cascade, C3b. Using parallel in silico screening methodologies we identified 45 small molecules which putatively bind C3b near ligand-guided functional hot-spots. Surface plasmon resonance experiments resulted in the validation of seven dose-dependent C3b-binding compounds. Competition-based biochemical assays demonstrated the ability of several C3b-binding compounds to interfere with binding of the original C3b ligand which guided their discovery. In vitro assays of complement function identified a single complement inhibitory compound, termed cmp-5, and mechanistic studies of the cmp-5 inhibitory mode revealed it acts at the level of C5 activation. This study has led to the identification of a promising new class of C3b-binding small molecule complement inhibitors, and to our knowledge, provides the first demonstration of cheminformatics-based complement-directed drug discovery. PMID:28298523

  4. Solving the Schroedinger Equation of Atoms and Molecules without Analytical Integration Based on the Free Iterative-Complement-Interaction Wave Function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakatsuji, H.; Nakashima, H.; Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University, Nishikyo-ku, Kyoto 615-8510

    2007-12-14

    A local Schroedinger equation (LSE) method is proposed for solving the Schroedinger equation (SE) of general atoms and molecules without doing analytic integrations over the complement functions of the free ICI (iterative-complement-interaction) wave functions. Since the free ICI wave function is potentially exact, we can assume a flatness of its local energy. The variational principle is not applicable because the analytic integrations over the free ICI complement functions are very difficult for general atoms and molecules. The LSE method is applied to several 2 to 5 electron atoms and molecules, giving an accuracy of 10{sup -5} Hartree in total energy.more » The potential energy curves of H{sub 2} and LiH molecules are calculated precisely with the free ICI LSE method. The results show the high potentiality of the free ICI LSE method for developing accurate predictive quantum chemistry with the solutions of the SE.« less

  5. Smallpox Inhibitor of Complement Enzymes (SPICE): Dissecting Functional Sites and Abrogating Activity1

    PubMed Central

    Liszewski, M. Kathryn; Leung, Marilyn K.; Hauhart, Richard; Fang, Celia J.; Bertram, Paula; Atkinson, John P.

    2010-01-01

    Although smallpox was eradicated as a global illness more than 30 years ago, variola virus and other related pathogenic poxviruses, such as monkeypox, remain potential bioterrorist weapons or could re-emerge as natural infections. Poxviruses express virulence factors that down-modulate the host’s immune system. We previously compared functional profiles of the poxviral complement inhibitors of smallpox, vaccinia, and monkeypox known as SPICE, VCP (or VICE), and MOPICE, respectively. SPICE was the most potent regulator of human complement and attached to cells via glycosaminoglycans. The major goals of the present study were to further characterize the complement regulatory and heparin binding sites of SPICE and to evaluate a mAb that abrogates its function. Using substitution mutagenesis, we established that (1) elimination of the three heparin binding sites severely decreases but does not eliminate glycosaminoglycan binding, (2) there is a hierarchy of activity for heparin binding among the three sites, and (3) complement regulatory sites overlap with each of the three heparin binding motifs. By creating chimeras with interchanges of SPICE and VCP residues, a combination of two SPICE amino acids (H77 plus K120) enhances VCP activity ~200-fold. Also, SPICE residue L131 is critical for both complement regulatory function and accounts for the electrophoretic differences between SPICE and VCP. An evolutionary history for these structure-function adaptations of SPICE is proposed. Finally, we identified and characterized a mAb that inhibits the complement regulatory activity of SPICE, MOPICE, and VCP and thus could be used as a therapeutic agent. PMID:19667083

  6. Enhanced CDC of B cell chronic lymphocytic leukemia cells mediated by rituximab combined with a novel anti-complement factor H antibody.

    PubMed

    Winkler, Mark T; Bushey, Ryan T; Gottlin, Elizabeth B; Campa, Michael J; Guadalupe, Eross S; Volkheimer, Alicia D; Weinberg, J Brice; Patz, Edward F

    2017-01-01

    Rituximab therapy for B cell chronic lymphocytic leukemia (B-CLL) has met with mixed success. Among several factors to which resistance can be attributed is failure to activate complement dependent cytotoxicity (CDC) due to protective complement regulatory proteins, including the soluble regulator complement factor H (CFH). We hypothesized that rituximab killing of non-responsive B-CLL cells could be augmented by a novel human monoclonal antibody against CFH. The B cells from 11 patients with B-CLL were tested ex vivo in CDC assays with combinations of CFH monoclonal antibody, rituximab, and a negative control antibody. CDC of rituximab non-responsive malignant B cells from CLL patients could in some cases be augmented by the CFH monoclonal antibody. Antibody-mediated cytotoxicity of cells was dependent upon functional complement. In one case where B-CLL cells were refractory to CDC by the combination of rituximab plus CFH monoclonal antibody, additionally neutralizing the membrane complement regulatory protein CD59 allowed CDC to occur. Inhibiting CDC regulatory proteins such as CFH holds promise for overcoming resistance to rituximab therapy in B-CLL.

  7. Complement activation on the surface of cell-derived microparticles during cardiac surgery with cardiopulmonary bypass - is retransfusion of pericardial blood harmful?

    PubMed

    Biró, E; van den Goor, J M; de Mol, B A; Schaap, M C; Ko, L-Y; Sturk, A; Hack, C E; Nieuwland, R

    2011-01-01

    To investigate whether cell-derived microparticles play a role in complement activation in pericardial blood of patients undergoing cardiac surgery with cardiopulmonary bypass (CPB) and whether microparticles in pericardial blood contribute to systemic complement activation upon retransfusion. Pericardial blood of 13 patients was retransfused in 9 and discarded in 4 cases. Microparticles were isolated from systemic blood collected before anesthesia (T1) and at the end of CPB (T2), and from pericardial blood. The microparticles were analyzed by flow cytometry for bound complement components C1q, C4 and C3, and bound complement activator molecules C-reactive protein (CRP), serum amyloid P-component (SAP), immunoglobulin (Ig)M and IgG. Fluid-phase complement activation products (C4b/c, C3b/c) and activator molecules were determined by ELISA. Compared with systemic T1 blood, pericardial blood contained increased C4b/c and C3b/c, and increased levels of microparticles with bound complement components. In systemic T1 samples, microparticle-bound CRP, whereas in pericardial blood, microparticle-bound SAP and IgM were associated with complement activation. At the end of CPB, increased C3b/c (but not C4b/c) was present in systemic T2 blood compared with T1, while concentrations of microparticles binding complement components and of those binding complement activator molecules were similar. Concentrations of fluid-phase complement activation products and microparticles were similar in patients whether or not retransfused with pericardial blood. In pericardial blood of patients undergoing cardiac surgery with CPB, microparticles contribute to activation of the complement system via bound SAP and IgM. Retransfusion of pericardial blood, however, does not contribute to systemic complement activation.

  8. Phylogenetic aspects of the complement system.

    PubMed

    Zarkadis, I K; Mastellos, D; Lambris, J D

    2001-01-01

    During evolution two general systems of immunity have emerged: innate or, natural immunity and adaptive (acquired), or specific immunity. The innate system is phylogenetically older and is found in some form in all multicellular organisms, whereas the adaptive system appeared about 450 million years ago and is found in all vertebrates except jawless fish. The complement system in higher vertebrates plays an important role as an effector of both the innate and the acquired immune response, and also participates in various immunoregulatory processes. In lower vertebrates complement is activated by the alternative and lectin pathways and is primarily involved in the opsonization of foreign material. The Agnatha (the most primitive vertebrate species) possess the alternative and lectin pathways while cartilaginous fish are the first species in which the classical pathway appears following the emergence of immunoglobulins. The rest of the poikilothermic species, ranging from teleosts to reptilians, appear to contain a well-developed complement system resembling that of the homeothermic vertebrates. It seems that most of the complement components have appeared after the duplication of primordial genes encoding C3/C4/C5, fB/C2, C1s/C1r/MASP-1/MASP-2, and C6/C7/C8/C9 molecules, in a process that led to the formation of distinct activation pathways. However, unlike homeotherms, several species of poikilotherms (e.g. trout) have recently been shown to possess multiple forms of complement components (C3, factor B) that are structurally and functionally more diverse than those of higher vertebrates. We hypothesize that this remarkable diversity has allowed these animals to expand their innate capacity for immune recognition and response. Recent studies have also indicated the possible presence of complement receptors in protochordates and lower vertebrates. In conclusion, there is considerable evidence suggesting that the complement system is present in the entire lineage of deuterostomes, and regulatory complement components have been identified in all species beyond the protochordates, indicating that the mechanisms of complement activation and regulation have developed in parallel.

  9. Reconstitution of wild type viral DNA in simian cells transfected with early and late SV40 defective genomes.

    PubMed

    O'Neill, F J; Gao, Y; Xu, X

    1993-11-01

    The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant monomolecular genomes. These and other findings indicate that the bipartite genome state can sustain many mutations which wtSV40 cannot directly sustain. However, the mutations can later be introduced into the wild type genomes when the E- and L-SV40 DNAs recombine to generate a new monomolecular genome structure.

  10. Microfibrillar associated protein 4 mfap4 genes in catfish play a novel role in innate immune responses

    USDA-ARS?s Scientific Manuscript database

    The lectin pathway of the complement system is characterized by two groups of soluble pattern recognition molecules, mannose-binding lectins (MBLs) and ficolins. These molecules recognize and bind carbohydrates in pathogens and activate complement leading to opsonization, leukocyte activation, and d...

  11. Functional annotation of regulatory pathways.

    PubMed

    Pandey, Jayesh; Koyutürk, Mehmet; Kim, Yohan; Szpankowski, Wojciech; Subramaniam, Shankar; Grama, Ananth

    2007-07-01

    Standardized annotations of biomolecules in interaction networks (e.g. Gene Ontology) provide comprehensive understanding of the function of individual molecules. Extending such annotations to pathways is a critical component of functional characterization of cellular signaling at the systems level. We propose a framework for projecting gene regulatory networks onto the space of functional attributes using multigraph models, with the objective of deriving statistically significant pathway annotations. We first demonstrate that annotations of pairwise interactions do not generalize to indirect relationships between processes. Motivated by this result, we formalize the problem of identifying statistically overrepresented pathways of functional attributes. We establish the hardness of this problem by demonstrating the non-monotonicity of common statistical significance measures. We propose a statistical model that emphasizes the modularity of a pathway, evaluating its significance based on the coupling of its building blocks. We complement the statistical model by an efficient algorithm and software, Narada, for computing significant pathways in large regulatory networks. Comprehensive results from our methods applied to the Escherichia coli transcription network demonstrate that our approach is effective in identifying known, as well as novel biological pathway annotations. Narada is implemented in Java and is available at http://www.cs.purdue.edu/homes/jpandey/narada/.

  12. Cell-derived microparticles and complement activation in preeclampsia versus normal pregnancy.

    PubMed

    Biró, E; Lok, C A R; Hack, C E; van der Post, J A M; Schaap, M C L; Sturk, A; Nieuwland, R

    2007-01-01

    Inflammation plays a major role in the vascular dysfunction seen in preeclampsia, and several studies suggest involvement of the complement system. To investigate whether complement activation on the surface of microparticles is increased in plasma of preeclamptic patients versus healthy pregnant controls. Microparticles from plasma of preeclamptic (n=10), healthy pregnant (n=10) and healthy nonpregnant (n=10) women were analyzed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C-reactive protein [CRP], serum amyloid P component [SAP], immunoglobulin [Ig]M, IgG). Fluid phase complement activation products and activator molecules were also determined. Levels of microparticles with bound complement components showed no increase in complement activation on the microparticle surface in preeclamptic women, in line with levels of fluid phase complement activation products. In healthy nonpregnant and pregnant women, bound CRP was associated with classical pathway activation on the microparticle surface, and in healthy pregnant women IgM and IgG molecules also contributed. In preeclamptic women, microparticles with bound SAP and those with IgG seemed to contribute to C1q binding without a clear association to further classical pathway activation. Furthermore, significantly increased levels of microparticles with bound CRP were present in preeclamptic compared with healthy pregnant women (median 178x10(6)/L versus 47x10(6)/L, P<0.01), but without concomitant increases in complement activation. We found no evidence of increased complement activation on the microparticle surface in preeclamptic women. Microparticles with bound CRP were significantly increased, but in contrast to healthy pregnant and nonpregnant women, this was not associated with increased classical pathway activation on the surface of the microparticles.

  13. Complement evasion by Bordetella pertussis: implications for improving current vaccines.

    PubMed

    Jongerius, Ilse; Schuijt, Tim J; Mooi, Frits R; Pinelli, Elena

    2015-04-01

    Bordetella pertussis causes whooping cough or pertussis, a highly contagious disease of the respiratory tract. Despite high vaccination coverage, reported cases of pertussis are rising worldwide and it has become clear that the current vaccines must be improved. In addition to the well-known protective role of antibodies and T cells during B. pertussis infection, innate immune responses such as the complement system play an essential role in B. pertussis killing. In order to evade this complement activation and colonize the human host, B. pertussis expresses several molecules that inhibit complement activation. Interestingly, one of the known complement evasion proteins, autotransporter Vag8, is highly expressed in the recently emerged B. pertussis isolates. Here, we describe the current knowledge on how B. pertussis evades complement-mediated killing. In addition, we compare this to complement evasion strategies used by other bacterial species. Finally, we discuss the consequences of complement evasion by B. pertussis on adaptive immunity and how identification of the bacterial molecules and the mechanisms involved in complement evasion might help improve pertussis vaccines.

  14. STIM1 signaling controls store operated calcium entry required for development and contractile function in skeletal muscle

    PubMed Central

    Stiber, Jonathan; Hawkins, April; Zhang, Zhu-Shan; Wang, Sunny; Burch, Jarrett; Graham, Victoria; Ward, Cary C.; Seth, Malini; Finch, Elizabeth; Malouf, Nadia; Williams, R. Sanders; Eu, Jerry P.; Rosenberg, Paul

    2009-01-01

    It is now well established that stromal interaction molecule 1 (STIM1) is the calcium sensor of endoplasmic reticulum (ER) stores required to activate store-operated calcium entry (SOC) channels at the surface of non-excitable cells. Yet little is known about STIM1 in excitable cells such as striated muscle where the complement of calcium regulatory molecules is rather disparate from that of non-excitable cells. Here, we show that STIM1 is expressed in both myotubes and adult skeletal muscle. Myotubes lacking functional STIM1 fail to exhibit SOC and fatigue rapidly. Moreover, mice lacking functional STIM1 die perinatally from a skeletal myopathy. In addition, STIM1 haploinsufficiency confers a contractile defect only under conditions where rapid refilling of stores would be needed. These findings provide novel insight to the role of STIM1 in skeletal muscle and suggest that STIM1 has a universal role as an ER/SR calcium sensor in both excitable and non-excitable cells. PMID:18488020

  15. "Platelet-associated regulatory system (PARS)" with particular reference to female reproduction.

    PubMed

    Bódis, József; Papp, Szilárd; Vermes, István; Sulyok, Endre; Tamás, Péter; Farkas, Bálint; Zámbó, Katalin; Hatzipetros, Ioannis; Kovács, Gábor L

    2014-01-01

    Blood platelets play an essential role in hemostasis, thrombosis and coagulation of blood. Beyond these classic functions their involvement in inflammatory, neoplastic and immune processes was also investigated. It is well known, that platelets have an armament of soluble molecules, factors, mediators, chemokines, cytokines and neurotransmitters in their granules, and have multiple adhesion molecules and receptors on their surface. Selected relevant literature and own views and experiences as clinical observations have been used. Considering that platelets are indispensable in numerous homeostatic endocrine functions, it is reasonable to suppose that a platelet-associated regulatory system (PARS) may exist; internal or external triggers and/or stimuli may complement and connect regulatory pathways aimed towards target tissues and/or cells. The signal (PAF, or other tissue/cell specific factors) comes from the stimulated (by the e.g., hypophyseal hormones, bacteria, external factors, etc.) organs or cells, and activates platelets. Platelet activation means their aggregation, sludge formation, furthermore the release of the for-mentioned biologically very powerful factors, which can locally amplify and deepen the tissue specific cell reactions. If this process is impaired or inhibited for any reason, the specifically stimulated organ shows hypofunction. When PARS is upregulated, organ hyperfunction may occur that culminate in severe diseases. Based on clinical and experimental evidences we propose that platelets modulate the function of hypothalamo-hypophyseal-ovarian system. Specifically, hypothalamic GnRH releases FSH from the anterior pituitary, which induces and stimulates follicular and oocyte maturation and steroid hormone secretion in the ovary. At the same time follicular cells enhance PAF production. Through these pathways activated platelets are accumulated in the follicular vessels surrounding the follicle and due to its released soluble molecules (factors, mediators, chemokines, cytokines, neurotransmitters) locally increase oocyte maturation and hormone secretion. Therefore we suggest that platelets are not only a small participant but may be the conductor or active mediator of this complex regulatory system which has several unrevealed mechanisms. In other words platelets are corpuscular messengers, or are more than a member of the family providing hemostasis.

  16. Activated complement components and complement activator molecules on the surface of cell‐derived microparticles in patients with rheumatoid arthritis and healthy individuals

    PubMed Central

    Biró, Éva; Nieuwland, Rienk; Tak, Paul P; Pronk, Loes M; Schaap, Marianne C L; Sturk, Augueste; Hack, C Erik

    2007-01-01

    Objectives In vitro, microparticles can activate complement via the classical pathway. If demonstrable ex vivo, this mechanism may contribute to the pathogenesis of rheumatoid arthritis (RA). We therefore investigated the presence of activated complement components and complement activator molecules on the surface of cell‐derived microparticles of RA patients and healthy individuals. Methods Microparticles from synovial fluid (n = 8) and plasma (n = 9) of 10 RA patients and plasma of sex‐ and age‐matched healthy individuals (n = 10) were analysed by flow cytometry for bound complement components (C1q, C4, C3) and complement activator molecules (C‐reactive protein (CRP), serum amyloid P component (SAP), immunoglobulin (Ig) M, IgG). Results Microparticles with bound C1q, C4, and/or C3 were abundant in RA synovial fluid, while in RA and control plasma much lower levels were present. Microparticles with bound C1q correlated with those with bound C3 in synovial fluid (r = 0.961, p = 0.0001), and with those with bound C4 in plasma (RA: r = 0.908, p = 0.0007; control: r = 0.632, p = 0.0498), indicating classical pathway activation. In synovial fluid, microparticles with IgM and IgG correlated with those with C1q (r = 0.728, p = 0.0408; r = 0.952, p = 0.0003, respectively), and in plasma, microparticles with CRP correlated with those with C1q (RA: r = 0.903, p = 0.0021; control: r = 0.683, p = 0.0296), implicating IgG and IgM in the classical pathway activation in RA synovial fluid, and CRP in the low level classical pathway activation in plasma. Conclusions This study demonstrates the presence of bound complement components and activator molecules on microparticles ex vivo, and supports their role in low grade complement activation in plasma and increased complement activation in RA synovial fluid. PMID:17261534

  17. Interruption of the Sequential Release of Small and Large Molecules from Tumor Cells by Low Temperature During Cytolysis Mediated by Immune T-Cells or Complement

    PubMed Central

    Martz, Eric; Burakoff, Steven J.; Benacerraf, Baruj

    1974-01-01

    Specific lysis of tumor cells by thymus-derived lymphocytes from alloimmunized mice (T-effector specific lysis) was studied with target cells labeled with isotopes attached to both small (14C-labeled nicotinamide) and large (51Cr-labeled) molecules. The results confirm and extend previous reports that target cells release small molecules considerably earlier than large molecules during T-effector specific lysis. After interruption of T-effector specific lysis by specific antibody and complement directed against the killer cells, or by ethylenediaminetetraacetic acid, release of both isotopes continued, eventually reaching identical levels of specific release, the value of which represents the fraction of the target cell population which had been committed to die at the time these treatments were applied. On the other hand, release of both isotopes during T-effector specific lysis stops immediately when the cultures are cooled to 0°. Thus, while ethylenediaminetetraacetic acid or specific complement-mediated lysis of the killer cells merely prevents the initiation of any new damage to target cells, cooling to 0° also stops the lytic process in already-damaged target cells. The colloid osmotic phase of target cell lysis induced by specific antibody and complement was similarly stopped at 0° in tumor cells, but not in erythrocytes. Thus, in tumor target cells, both T-effector specific lysis and complement cause a sequential release of progressively larger molecules which can be immediately stopped at any point by cooling to 0°. PMID:4359327

  18. Ectromelia virus inhibitor of complement enzymes protects intracellular mature virus and infected cells from mouse complement.

    PubMed

    Moulton, Elizabeth A; Bertram, Paula; Chen, Nanhai; Buller, R Mark L; Atkinson, John P

    2010-09-01

    Poxviruses produce complement regulatory proteins to subvert the host's immune response. Similar to the human pathogen variola virus, ectromelia virus has a limited host range and provides a mouse model where the virus and the host's immune response have coevolved. We previously demonstrated that multiple components (C3, C4, and factor B) of the classical and alternative pathways are required to survive ectromelia virus infection. Complement's role in the innate and adaptive immune responses likely drove the evolution of a virus-encoded virulence factor that regulates complement activation. In this study, we characterized the ectromelia virus inhibitor of complement enzymes (EMICE). Recombinant EMICE regulated complement activation on the surface of CHO cells, and it protected complement-sensitive intracellular mature virions (IMV) from neutralization in vitro. It accomplished this by serving as a cofactor for the inactivation of C3b and C4b and by dissociating the catalytic domain of the classical pathway C3 convertase. Infected murine cells initiated synthesis of EMICE within 4 to 6 h postinoculation. The levels were sufficient in the supernatant to protect the IMV, upon release, from complement-mediated neutralization. EMICE on the surface of infected murine cells also reduced complement activation by the alternative pathway. In contrast, classical pathway activation by high-titer antibody overwhelmed EMICE's regulatory capacity. These results suggest that EMICE's role is early during infection when it counteracts the innate immune response. In summary, ectromelia virus produced EMICE within a few hours of an infection, and EMICE in turn decreased complement activation on IMV and infected cells.

  19. Identification and cloning of a regulatory gene for nitrogen assimilation in the cyanobacterium Synechococcus sp. strain PCC 7942.

    PubMed Central

    Vega-Palas, M A; Madueño, F; Herrero, A; Flores, E

    1990-01-01

    Twenty-seven mutants that were unable to assimilate nitrate were isolated from Synechococcus sp. strain PCC 7942. In addition to mutants that lacked nitrate reductase or nitrite reductase, seven pleiotropic mutants impaired in both reductases, glutamine synthetase, and methylammonium transport were also isolated. One of the pleiotropic mutants was complemented by transformation with a cosmid gene bank from wild-type strain PCC 7942. Three complementing cosmids were isolated, and a 3.1-kilobase-pair DNA fragment that was still able to complement the mutant was identified. The regulatory gene that was cloned (ntcA) appeared to be required for full expression of proteins subject to ammonium repression in Synechococcus sp. PMID:1967601

  20. BIOSENSORS FOR ENVIRONMENTAL MONITORING: A REGULATORY PERSPECTIVE

    EPA Science Inventory

    Biosensors show the potential to complement laboratory-based analytical methods for environmental applications. Although biosensors for potential environmental-monitoring applications have been reported for a wide range of environmental pollutants, from a regulatory perspective, ...

  1. Human L-ficolin, a recognition molecule of the lectin activation pathway of complement, activates complement by binding to pneumolysin, the major toxin of Streptococcus pneumoniae.

    PubMed

    Ali, Youssif M; Kenawy, Hany I; Muhammad, Adnan; Sim, Robert B; Andrew, Peter W; Schwaeble, Wilhelm J

    2013-01-01

    The complement system is an essential component of the immune response, providing a critical line of defense against different pathogens including S. pneumoniae. Complement is activated via three distinct pathways: the classical (CP), the alternative (AP) and the lectin pathway (LP). The role of Pneumolysin (PLY), a bacterial toxin released by S. pneumoniae, in triggering complement activation has been studied in vitro. Our results demonstrate that in both human and mouse sera complement was activated via the CP, initiated by direct binding of even non-specific IgM and IgG3 to PLY. Absence of CP activity in C1q(-/-) mouse serum completely abolished any C3 deposition. However, C1q depleted human serum strongly opsonized PLY through abundant deposition of C3 activation products, indicating that the LP may have a vital role in activating the human complement system on PLY. We identified that human L-ficolin is the critical LP recognition molecule that drives LP activation on PLY, while all of the murine LP recognition components fail to bind and activate complement on PLY. This work elucidates the detailed interactions between PLY and complement and shows for the first time a specific role of the LP in PLY-mediated complement activation in human serum.

  2. Human L-ficolin, a Recognition Molecule of the Lectin Activation Pathway of Complement, Activates Complement by Binding to Pneumolysin, the Major Toxin of Streptococcus pneumoniae

    PubMed Central

    Ali, Youssif M.; Kenawy, Hany I.; Muhammad, Adnan; Sim, Robert B.

    2013-01-01

    The complement system is an essential component of the immune response, providing a critical line of defense against different pathogens including S. pneumoniae. Complement is activated via three distinct pathways: the classical (CP), the alternative (AP) and the lectin pathway (LP). The role of Pneumolysin (PLY), a bacterial toxin released by S. pneumoniae, in triggering complement activation has been studied in vitro. Our results demonstrate that in both human and mouse sera complement was activated via the CP, initiated by direct binding of even non-specific IgM and IgG3 to PLY. Absence of CP activity in C1q−/− mouse serum completely abolished any C3 deposition. However, C1q depleted human serum strongly opsonized PLY through abundant deposition of C3 activation products, indicating that the LP may have a vital role in activating the human complement system on PLY. We identified that human L-ficolin is the critical LP recognition molecule that drives LP activation on PLY, while all of the murine LP recognition components fail to bind and activate complement on PLY. This work elucidates the detailed interactions between PLY and complement and shows for the first time a specific role of the LP in PLY-mediated complement activation in human serum. PMID:24349316

  3. Complement Depletion Protects Lupus-prone Mice from Ischemia-reperfusion-initiated Organ Injury

    DTIC Science & Technology

    2012-10-25

    injury, we sought to evaluate whether complement inhibition mitigates organ damage. We found that complement deple- tion with cobra venom factor... venom factor and C5a receptor antagonist were able to protect mice from local tissue damage, treatment with C5a receptor antagonist was not able to...Complement depletion or blockage of the complement pathway using molecules such as cobra venom factor (CVF) (24, 33) and C5a receptor antagonists (C5aRA

  4. GARP: a surface molecule of regulatory T cells that is involved in the regulatory function and TGF-β releasing.

    PubMed

    Sun, Liping; Jin, Hao; Li, Hui

    2016-07-05

    There are many molecules that define regulatory T cells (Tregs) phenotypically and functionally. Glycoprotein A repetitions predominant (GARP) is a transmembrane protein containing leucine rich repeats. Recently, GARP is found to express highly on the surface of activated Tregs. The combination of GARP and other surface molecules isolates Tregs with higher purity. Besides, GARP is a cell surface molecule of Tregs that maintains their regulatory function and homeosatsis. GARP has also been proved to promote the activation and secretion of transforming growth factor β (TGF-β). Moreover, its potential value in cancer immunotherapy is also discussed in this work.

  5. Method to transform algae, materials therefor, and products produced thereby

    DOEpatents

    Dunahay, T.G.; Roessler, P.G.; Jarvis, E.E.

    1997-08-26

    Disclosed is a method to transform chlorophyll C-containing algae. The method includes introducing a recombinant molecule comprising a nucleic acid molecule encoding a dominant selectable marker operatively linked to an algal regulatory control sequence into a chlorophyll C-containing alga in such a manner that the marker is produced by the alga. In a preferred embodiment the algal regulatory control sequence is derived from a diatom and preferably Cyclotella cryptica. Also disclosed is a chimeric molecule having one or more regulatory control sequences derived from one or more chlorophyll C-containing algae operatively linked to a nucleic acid molecule encoding a selectable marker, an RNA molecule and/or a protein, wherein the nucleic acid molecule does not normally occur with one or more of the regulatory control sequences. Further, specifically disclosed are molecules pACCNPT10, pACCNPT4.8 and pACCNPT5.1. The methods and materials of the present invention provide the ability to accomplish stable genetic transformation of chlorophyll C-containing algae. 2 figs.

  6. Method to transform algae, materials therefor, and products produced thereby

    DOEpatents

    Dunahay, Terri Goodman; Roessler, Paul G.; Jarvis, Eric E.

    1997-01-01

    Disclosed is a method to transform chlorophyll C-containing algae which includes introducing a recombinant molecule comprising a nucleic acid molecule encoding a dominant selectable marker operatively linked to an algal regulatory control sequence into a chlorophyll C-containing alga in such a manner that the marker is produced by the alga. In a preferred embodiment the algal regulatory control sequence is derived from a diatom and preferably Cyclotella cryptica. Also disclosed is a chimeric molecule having one or more regulatory control sequences derived from one or more chlorophyll C-containing algae operatively linked to a nucleic acid molecule encoding a selectable marker, an RNA molecule and/or a protein, wherein the nucleic acid molecule does not normally occur with one or more of the regulatory control sequences. Further specifically disclosed are molecules pACCNPT10, pACCNPT4.8 and pACCNPT5.1. The methods and materials of the present invention provide the ability to accomplish stable genetic transformation of chlorophyll C-containing algae.

  7. In the right place at the right time: visualizing and understanding mRNA localization

    PubMed Central

    Buxbaum, Adina R.; Haimovich, Gal

    2015-01-01

    The spatial regulation of protein translation is an efficient way to create functional and structural asymmetries in cells. Recent research has furthered our understanding of how individual cells spatially organize protein synthesis, by applying innovative technology to characterize the relationship between mRNAs and their regulatory proteins, single-mRNA trafficking dynamics, physiological effects of abrogating mRNA localization in vivo and for endogenous mRNA labelling. The implementation of new imaging technologies has yielded valuable information on mRNA localization, for example, by observing single molecules in tissues. The emerging movements and localization patterns of mRNAs in morphologically distinct unicellular organisms and in neurons have illuminated shared and specialized mechanisms of mRNA localization, and this information is complemented by transgenic and biochemical techniques that reveal the biological consequences of mRNA mislocalization. PMID:25549890

  8. Identification of a central role for complement in osteoarthritis

    PubMed Central

    Wang, Qian; Rozelle, Andrew L.; Lepus, Christin M.; Scanzello, Carla R.; Song, Jason J.; Larsen, D. Meegan; Crish, James F.; Bebek, Gurkan; Ritter, Susan Y.; Lindstrom, Tamsin M.; Hwang, Inyong; Wong, Heidi H.; Punzi, Leonardo; Encarnacion, Angelo; Shamloo, Mehrdad; Goodman, Stuart B.; Wyss-Coray, Tony; Goldring, Steven R.; Banda, Nirmal K.; Thurman, Joshua M.; Gobezie, Reuben; Crow, Mary K.; Holers, V. Michael; Lee, David M.; Robinson, William H.

    2011-01-01

    Osteoarthritis, characterized by the breakdown of articular cartilage in synovial joints, has long been viewed as the result of “wear and tear”1. Although low-grade inflammation is detected in osteoarthritis, its role is unclear2–4. Here we identify a central role for the inflammatory complement system in the pathogenesis of osteoarthritis. Through proteomic and transcriptomic analyses of synovial fluids and membranes from individuals with osteoarthritis, we find that expression and activation of complement is abnormally high in human osteoarthritic joints. Using mice genetically deficient in C5, C6, or CD59a, we show that complement, and specifically the membrane attack complex (MAC)-mediated arm of complement, is critical to the development of arthritis in three different mouse models of osteoarthritis. Pharmacological modulation of complement in wild-type mice confirmed the results obtained with genetically deficient mice. Expression of inflammatory and degradative molecules was lower in chondrocytes from destabilized joints of C5-deficient mice than C5-sufficient mice, and MAC induced production of these molecules in cultured chondrocytes. Furthermore, MAC co-localized with matrix metalloprotease (MMP)-13 and with activated extracellular signal-regulated kinase (ERK) around chondrocytes in human osteoarthritic cartilage. Our findings indicate that dysregulation of complement in synovial joints plays a critical role in the pathogenesis of osteoarthritis. PMID:22057346

  9. Cobra venom factor immunoconjugates: effects of carbohydrate-directed versus amino group-directed conjugation.

    PubMed

    Zara, J; Pomato, N; McCabe, R P; Bredehorst, R; Vogel, C W

    1995-01-01

    Human IgM monoclonal antibody 16-88, derived from patients immunized with autologous colon carcinoma cells, was derivatized with two different cross-linkers, S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH), which is carbohydrate-directed, and N-succinimidyl-3-(2- pyridyldithio)propionate (SPDP), which is amino group-directed. Two antibody functions, antigen binding and complement activation, were assayed upon derivatization with TPCH and SPDP. TPCH allowed for extensive modification (up to 17 TPCH molecules per antibody) without impairment of antigen binding activity, while this function was significantly compromised upon derivatization with SPDP. Antibody molecules derivatized with 16 SPDP residues showed almost complete loss of their antigen binding function. The complement activating ability of antibody 16-88 was significantly decreased after derivatization with TPCH or SPDP. In the case of SPDP derivatization, this decrease of the complement activating ability is predominantly a consequence of the impaired binding function. Upon conjugation of cobra venom factor (CVF), a nontoxic 137-kDa glycoprotein which is capable of activating the alternative pathway of complement, the antigen binding activity of SPDP-derivatized antibody was further compromised, whereas that of TPCH-derivatized antibody remained unaffected even after attachment of three or four CVF molecules per antibody. In both conjugates CVF retained good functional activity. CVF was slightly more active when attached to SPDP-derivatized antibody, suggesting a better accessibility of amino group-coupled CVF for its interaction with other complement proteins. These results indicate that carbohydrate-directed conjugation compromises the antibody function of complement activation, but allows for the generation of immunoconjugates with unimpaired antigen binding capability.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Quantitative assessment of cellular uptake and cytosolic access of antibody in living cells by an enhanced split GFP complementation assay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Ji-sun; Choi, Dong-Ki; Park, Seong-wook

    Considering the number of cytosolic proteins associated with many diseases, development of cytosol-penetrating molecules from outside of living cells is highly in demand. To gain access to the cytosol after cellular uptake, cell-penetrating molecules should be released from intermediate endosomes prior to the lysosomal degradation. However, it is very challenging to distinguish the pool of cytosolic-released molecules from those trapped in the endocytic vesicles. Here we describe a method to directly demonstrate the cytosolic localization and quantification of cytosolic amount of a cytosol-penetrating IgG antibody, TMab4, based on enhanced split GFP complementation system. We generated TMab4 genetically fused with onemore » GFP fragment and separately established HeLa cells expressing the other GFP fragment in the cytosol such that the complemented GFP fluorescence is observed only when extracellular-treated TMab4 reaches the cytosol after cellular internalization. The high affinity interactions between streptavidin-binding peptide 2 and streptavidin was employed as respective fusion partners of GFP fragments to enhance the sensitivity of GFP complementation. With this method, cytosolic concentration of TMab4 was estimated to be about 170 nM after extracellular treatment of HeLa cells with 1 μM TMab4 for 6 h. We also found that after cellular internalization into living cells, nearly 1.3–4.3% of the internalized TMab4 molecules escaped into the cytosol from the endocytic vesicles. Our enhanced split GFP complementation assay provides a useful tool to directly quantify cytosolic amount of cytosol-penetrating agents and allows cell-based high-throughput screening for cytosol-penetrating agents with increased endosomal-escaping activity.« less

  11. Quantitative assessment of cellular uptake and cytosolic access of antibody in living cells by an enhanced split GFP complementation assay.

    PubMed

    Kim, Ji-sun; Choi, Dong-Ki; Park, Seong-wook; Shin, Seung-Min; Bae, Jeomil; Kim, Dong-Myung; Yoo, Tae Hyeon; Kim, Yong-Sung

    2015-11-27

    Considering the number of cytosolic proteins associated with many diseases, development of cytosol-penetrating molecules from outside of living cells is highly in demand. To gain access to the cytosol after cellular uptake, cell-penetrating molecules should be released from intermediate endosomes prior to the lysosomal degradation. However, it is very challenging to distinguish the pool of cytosolic-released molecules from those trapped in the endocytic vesicles. Here we describe a method to directly demonstrate the cytosolic localization and quantification of cytosolic amount of a cytosol-penetrating IgG antibody, TMab4, based on enhanced split GFP complementation system. We generated TMab4 genetically fused with one GFP fragment and separately established HeLa cells expressing the other GFP fragment in the cytosol such that the complemented GFP fluorescence is observed only when extracellular-treated TMab4 reaches the cytosol after cellular internalization. The high affinity interactions between streptavidin-binding peptide 2 and streptavidin was employed as respective fusion partners of GFP fragments to enhance the sensitivity of GFP complementation. With this method, cytosolic concentration of TMab4 was estimated to be about 170 nM after extracellular treatment of HeLa cells with 1 μM TMab4 for 6 h. We also found that after cellular internalization into living cells, nearly 1.3-4.3% of the internalized TMab4 molecules escaped into the cytosol from the endocytic vesicles. Our enhanced split GFP complementation assay provides a useful tool to directly quantify cytosolic amount of cytosol-penetrating agents and allows cell-based high-throughput screening for cytosol-penetrating agents with increased endosomal-escaping activity. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria.

    PubMed

    Gelderman, Grant; Sivakumar, Anusha; Lipp, Sarah; Contreras, Lydia

    2015-02-01

    sRNAs play a significant role in controlling and regulating cellular metabolism. One of the more interesting aspects of certain sRNAs is their ability to make global changes in the cell by interacting with regulatory proteins. In this work, we demonstrate the use of an in vivo Tri-molecular Fluorescence Complementation assay to detect and visualize the central regulatory sRNA-protein interaction of the Carbon Storage Regulatory system in E. coli. The Carbon Storage Regulator consists primarily of an RNA binding protein, CsrA, that alters the activity of mRNA targets and of an sRNA, CsrB, that modulates the activity of CsrA. We describe the construction of a fluorescence complementation system that detects the interactions between CsrB and CsrA. Additionally, we demonstrate that the intensity of the fluorescence of this system is able to detect changes in the affinity of the CsrB-CsrA interaction, as caused by mutations in the protein sequence of CsrA. While previous methods have adopted this technique to study mRNA or RNA localization, this is the first attempt to use this technique to study the sRNA-protein interaction directly in bacteria. This method presents a potentially powerful tool to study complex bacterial RNA protein interactions in vivo. © 2014 Wiley Periodicals, Inc.

  13. Membrane cofactor protein (CD46) is a keratinocyte receptor for the M protein of the group A streptococcus.

    PubMed

    Okada, N; Liszewski, M K; Atkinson, J P; Caparon, M

    1995-03-28

    The pathogenic Gram-positive bacterium Streptococcus pyogenes (group A streptococcus) is the causative agent of numerous suppurative diseases of human skin. The M protein of S. pyogenes mediates the adherence of the bacterium to keratinocytes, the most numerous cell type in the epidermis. In this study, we have constructed and analyzed a series of mutant M proteins and have shown that the C repeat domain of the M molecule is responsible for cell recognition. The binding of factor H, a serum regulator of complement activation, to the C repeat region of M protein blocked bacterial adherence. Factor H is a member of a large family of complement regulatory proteins that share a homologous structural motif termed the short consensus repeat. Membrane cofactor protein (MCP), or CD46, is a short consensus repeat-containing protein found on the surface of keratinocytes, and purified MCP could competitively inhibit the adherence of S. pyogenes to these cells. Furthermore, the M protein was found to bind directly to MCP, whereas mutant M proteins that lacked the C repeat domain did not bind MCP, suggesting that recognition of MCP plays an important role in the ability of the streptococcus to adhere to keratinocytes.

  14. Small-molecule factor D inhibitors selectively block the alternative pathway of complement in paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome.

    PubMed

    Yuan, Xuan; Gavriilaki, Eleni; Thanassi, Jane A; Yang, Guangwei; Baines, Andrea C; Podos, Steven D; Huang, Yongqing; Huang, Mingjun; Brodsky, Robert A

    2017-03-01

    Paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome are diseases of excess activation of the alternative pathway of complement that are treated with eculizumab, a humanized monoclonal antibody against the terminal complement component C5. Eculizumab must be administered intravenously, and moreover some patients with paroxysmal nocturnal hemoglobinuria on eculizumab have symptomatic extravascular hemolysis, indicating an unmet need for additional therapeutic approaches. We report the activity of two novel small-molecule inhibitors of the alternative pathway component Factor D using in vitro correlates of both paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome. Both compounds bind human Factor D with high affinity and effectively inhibit its proteolytic activity against purified Factor B in complex with C3b. When tested using the traditional Ham test with cells from paroxysmal nocturnal hemoglobinuria patients, the Factor D inhibitors significantly reduced complement-mediated hemolysis at concentrations as low as 0.01 μM. Additionally the compound ACH-4471 significantly decreased C3 fragment deposition on paroxysmal nocturnal hemoglobinuria erythrocytes, indicating a reduced potential relative to eculizumab for extravascular hemolysis. Using the recently described modified Ham test with serum from patients with atypical hemolytic uremic syndrome, the compounds reduced the alternative pathway-mediated killing of PIGA -null reagent cells, thus establishing their potential utility for this disease of alternative pathway of complement dysregulation and validating the modified Ham test as a system for pre-clinical drug development for atypical hemolytic uremic syndrome. Finally, ACH-4471 blocked alternative pathway activity when administered orally to cynomolgus monkeys. In conclusion, the small-molecule Factor D inhibitors show potential as oral therapeutics for human diseases driven by the alternative pathway of complement, including paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome. Copyright© Ferrata Storti Foundation.

  15. Streptococcus pyogenes Endopeptidase O Contributes to Evasion from Complement-mediated Bacteriolysis via Binding to Human Complement Factor C1q*

    PubMed Central

    Honda-Ogawa, Mariko; Sumitomo, Tomoko; Mori, Yasushi; Hamd, Dalia Talat; Ogawa, Taiji; Yamaguchi, Masaya; Nakata, Masanobu; Kawabata, Shigetada

    2017-01-01

    Streptococcus pyogenes secretes various virulence factors for evasion from complement-mediated bacteriolysis. However, full understanding of the molecules possessed by this organism that interact with complement C1q, an initiator of the classical complement pathway, remains elusive. In this study, we identified an endopeptidase of S. pyogenes, PepO, as an interacting molecule, and investigated its effects on complement immunity and pathogenesis. Enzyme-linked immunosorbent assay and surface plasmon resonance analysis findings revealed that S. pyogenes recombinant PepO bound to human C1q in a concentration-dependent manner under physiological conditions. Sites of inflammation are known to have decreased pH levels, thus the effects of PepO on bacterial evasion from complement immunity was analyzed in a low pH condition. Notably, under low pH conditions, PepO exhibited a higher affinity for C1q as compared with IgG, and PepO inhibited the binding of IgG to C1q. In addition, pepO deletion rendered S. pyogenes more susceptible to the bacteriocidal activity of human serum. Also, observations of the morphological features of the pepO mutant strain (ΔpepO) showed damaged irregular surfaces as compared with the wild-type strain (WT). WT-infected tissues exhibited greater severity and lower complement activity as compared with those infected by ΔpepO in a mouse skin infection model. Furthermore, WT infection resulted in a larger accumulation of C1q than that with ΔpepO. Our results suggest that interaction of S. pyogenes PepO with C1q interferes with the complement pathway, which enables S. pyogenes to evade complement-mediated bacteriolysis under acidic conditions, such as seen in inflammatory sites. PMID:28154192

  16. Modular supramolecular approach for co-crystallization of donors and acceptors into ordered networks

    DOEpatents

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alex K.; Tayi, Alok S.; Sue, Andrew C. H.; Narayanan, Ashwin

    2016-09-20

    Organic charge-transfer (CT) co-crystals in a mixed stack system are disclosed, wherein a donor molecule (D) and an acceptor molecule (A) occupy alternating positions (DADADA) along the CT axis. A platform is provided which amplifies the molecular recognition of donors and acceptors and produces co-crystals at ambient conditions, wherein the platform comprises (i) a molecular design of the first constituent (.alpha.-complement), (ii) a molecular design of the second compound (.beta.-complement), and (iii) a solvent system that promotes co-crystallization.

  17. Modular supramolecular approach for co-crystallization of donors and acceptors into ordered networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.

    Organic charge-transfer (CT) co-crystals in a mixed stack system are disclosed, wherein a donor molecule (D) and an acceptor molecule (A) occupy alternating positions (DADADA) along the CT axis. A platform is provided which amplifies the molecular recognition of donors and acceptors and produces co-crystals at ambient conditions, wherein the platform comprises (i) a molecular design of the first constituent (.alpha.-complement), (ii) a molecular design of the second compound (.beta.-complement), and (iii) a solvent system that promotes co-crystallization.

  18. Genome-Scale Architecture of Small Molecule Regulatory Networks and the Fundamental Trade-Off between Regulation and Enzymatic Activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reznik, Ed; Christodoulou, Dimitris; Goldford, Joshua E.

    Metabolic flux is in part regulated by endogenous small molecules that modulate the catalytic activity of an enzyme, e.g., allosteric inhibition. In contrast to transcriptional regulation of enzymes, technical limitations have hindered the production of a genome-scale atlas of small molecule-enzyme regulatory interactions. Here, we develop a framework leveraging the vast, but fragmented, biochemical literature to reconstruct and analyze the small molecule regulatory network (SMRN) of the model organism Escherichia coli, including the primary metabolite regulators and enzyme targets. Using metabolic control analysis, we prove a fundamental trade-off between regulation and enzymatic activity, and we combine it with metabolomic measurementsmore » and the SMRN to make inferences on the sensitivity of enzymes to their regulators. By generalizing the analysis to other organisms, we identify highly conserved regulatory interactions across evolutionarily divergent species, further emphasizing a critical role for small molecule interactions in the maintenance of metabolic homeostasis.« less

  19. Genome-Scale Architecture of Small Molecule Regulatory Networks and the Fundamental Trade-Off between Regulation and Enzymatic Activity

    DOE PAGES

    Reznik, Ed; Christodoulou, Dimitris; Goldford, Joshua E.; ...

    2017-09-12

    Metabolic flux is in part regulated by endogenous small molecules that modulate the catalytic activity of an enzyme, e.g., allosteric inhibition. In contrast to transcriptional regulation of enzymes, technical limitations have hindered the production of a genome-scale atlas of small molecule-enzyme regulatory interactions. Here, we develop a framework leveraging the vast, but fragmented, biochemical literature to reconstruct and analyze the small molecule regulatory network (SMRN) of the model organism Escherichia coli, including the primary metabolite regulators and enzyme targets. Using metabolic control analysis, we prove a fundamental trade-off between regulation and enzymatic activity, and we combine it with metabolomic measurementsmore » and the SMRN to make inferences on the sensitivity of enzymes to their regulators. By generalizing the analysis to other organisms, we identify highly conserved regulatory interactions across evolutionarily divergent species, further emphasizing a critical role for small molecule interactions in the maintenance of metabolic homeostasis.« less

  20. Update on hemolytic uremic syndrome: Diagnostic and therapeutic recommendations

    PubMed Central

    Salvadori, Maurizio; Bertoni, Elisabetta

    2013-01-01

    Hemolytic uremic syndrome (HUS) is a rare disease. In this work the authors review the recent findings on HUS, considering the different etiologic and pathogenetic classifications. New findings in genetics and, in particular, mutations of genes that encode the complement-regulatory proteins have improved our understanding of atypical HUS. Similarly, the complement proteins are clearly involved in all types of thrombotic microangiopathy: typical HUS, atypical HUS and thrombotic thrombocytopenic purpura (TTP). Furthermore, several secondary HUS appear to be related to abnormalities in complement genes in predisposed patients. The authors highlight the therapeutic aspects of this rare disease, examining both “traditional therapy” (including plasma therapy, kidney and kidney-liver transplantation) and “new therapies”. The latter include anti-Shiga-toxin antibodies and anti-C5 monoclonal antibody “eculizumab”. Eculizumab has been recently launched for the treatment of the atypical HUS, but it appears to be effective in the treatment of typical HUS and in TTP. Future therapies are in phases I and II. They include anti-C5 antibodies, which are more purified, less immunogenic and absorbed orally and, anti-C3 antibodies, which are more powerful, but potentially less safe. Additionally, infusions of recombinant complement-regulatory proteins are a potential future therapy. PMID:24255888

  1. Complement Activation in Inflammatory Skin Diseases

    PubMed Central

    Giang, Jenny; Seelen, Marc A. J.; van Doorn, Martijn B. A.; Rissmann, Robert; Prens, Errol P.; Damman, Jeffrey

    2018-01-01

    The complement system is a fundamental part of the innate immune system, playing a crucial role in host defense against various pathogens, such as bacteria, viruses, and fungi. Activation of complement results in production of several molecules mediating chemotaxis, opsonization, and mast cell degranulation, which can contribute to the elimination of pathogenic organisms and inflammation. Furthermore, the complement system also has regulating properties in inflammatory and immune responses. Complement activity in diseases is rather complex and may involve both aberrant expression of complement and genetic deficiencies of complement components or regulators. The skin represents an active immune organ with complex interactions between cellular components and various mediators. Complement involvement has been associated with several skin diseases, such as psoriasis, lupus erythematosus, cutaneous vasculitis, urticaria, and bullous dermatoses. Several triggers including auto-antibodies and micro-organisms can activate complement, while on the other hand complement deficiencies can contribute to impaired immune complex clearance, leading to disease. This review provides an overview of the role of complement in inflammatory skin diseases and discusses complement factors as potential new targets for therapeutic intervention. PMID:29713318

  2. Complement, a target for therapy in inflammatory and degenerative diseases.

    PubMed

    Morgan, B Paul; Harris, Claire L

    2015-12-01

    The complement system is a key innate immune defence against infection and an important driver of inflammation; however, these very properties can also cause harm. Inappropriate or uncontrolled activation of complement can cause local and/or systemic inflammation, tissue damage and disease. Complement provides numerous options for drug development as it is a proteolytic cascade that involves nine specific proteases, unique multimolecular activation and lytic complexes, an arsenal of natural inhibitors, and numerous receptors that bind to activation fragments. Drug design is facilitated by the increasingly detailed structural understanding of the molecules involved in the complement system. Only two anti-complement drugs are currently on the market, but many more are being developed for diseases that include infectious, inflammatory, degenerative, traumatic and neoplastic disorders. In this Review, we describe the history, current landscape and future directions for anti-complement therapies.

  3. Translational Mini-Review Series on Complement Factor H: Structural and functional correlations for factor H

    PubMed Central

    Schmidt, C Q; Herbert, A P; Hocking, H G; Uhrín, D; Barlow, P N

    2008-01-01

    The 155-kDa glycoprotein, complement factor H (CFH), is a regulator of complement activation that is abundant in human plasma. Three-dimensional structures of over half the 20 complement control protein (CCP) modules in CFH have been solved in the context of single-, double- and triple-module segments. Proven binding sites for C3b occupy the N and C termini of this elongated molecule and may be brought together by a bend in CFH mediated by its central CCP modules. The C-terminal CCP 20 is key to the ability of the molecule to adhere to polyanionic markers on self-surfaces where CFH acts to regulate amplification of the alternative pathway of complement. The surface patch on CCP 20 that binds to model glycosaminoglycans has been mapped using nuclear magnetic resonance (NMR), as has a second glycosaminoglycan-binding patch on CCP 7. These patches include many of the residue positions at which sequence variations have been linked to three complement-mediated disorders: dense deposit disease, age-related macular degeneration and atypical haemolytic uraemic syndrome. In one plausible model, CCP 20 anchors CFH to self-surfaces via a C3b/polyanion composite binding site, CCP 7 acts as a ‘proof-reader’ to help discriminate self- from non-self patterns of sulphation, and CCPs 1–4 disrupt C3/C5 convertase formation and stability. PMID:18081691

  4. Caenorhabditis elegans chemical biology: lessons from small molecules

    USDA-ARS?s Scientific Manuscript database

    How can we complement Caenorhabditis elegans genomics and proteomics with a comprehensive structural and functional annotation of its metabolome? Several lines of evidence indicate that small molecules of largely undetermined structure play important roles in C. elegans biology, including key pathw...

  5. Complement Evasion Strategies of Viruses: An Overview

    PubMed Central

    Agrawal, Palak; Nawadkar, Renuka; Ojha, Hina; Kumar, Jitendra; Sahu, Arvind

    2017-01-01

    Being a major first line of immune defense, the complement system keeps a constant vigil against viruses. Its ability to recognize large panoply of viruses and virus-infected cells, and trigger the effector pathways, results in neutralization of viruses and killing of the infected cells. This selection pressure exerted by complement on viruses has made them evolve a multitude of countermeasures. These include targeting the recognition molecules for the avoidance of detection, targeting key enzymes and complexes of the complement pathways like C3 convertases and C5b-9 formation – either by encoding complement regulators or by recruiting membrane-bound and soluble host complement regulators, cleaving complement proteins by encoding protease, and inhibiting the synthesis of complement proteins. Additionally, viruses also exploit the complement system for their own benefit. For example, they use complement receptors as well as membrane regulators for cellular entry as well as their spread. Here, we provide an overview on the complement subversion mechanisms adopted by the members of various viral families including Poxviridae, Herpesviridae, Adenoviridae, Flaviviridae, Retroviridae, Picornaviridae, Astroviridae, Togaviridae, Orthomyxoviridae and Paramyxoviridae. PMID:28670306

  6. Streptococcus pyogenes Endopeptidase O Contributes to Evasion from Complement-mediated Bacteriolysis via Binding to Human Complement Factor C1q.

    PubMed

    Honda-Ogawa, Mariko; Sumitomo, Tomoko; Mori, Yasushi; Hamd, Dalia Talat; Ogawa, Taiji; Yamaguchi, Masaya; Nakata, Masanobu; Kawabata, Shigetada

    2017-03-10

    Streptococcus pyogenes secretes various virulence factors for evasion from complement-mediated bacteriolysis. However, full understanding of the molecules possessed by this organism that interact with complement C1q, an initiator of the classical complement pathway, remains elusive. In this study, we identified an endopeptidase of S. pyogenes , PepO, as an interacting molecule, and investigated its effects on complement immunity and pathogenesis. Enzyme-linked immunosorbent assay and surface plasmon resonance analysis findings revealed that S. pyogenes recombinant PepO bound to human C1q in a concentration-dependent manner under physiological conditions. Sites of inflammation are known to have decreased pH levels, thus the effects of PepO on bacterial evasion from complement immunity was analyzed in a low pH condition. Notably, under low pH conditions, PepO exhibited a higher affinity for C1q as compared with IgG, and PepO inhibited the binding of IgG to C1q. In addition, pepO deletion rendered S. pyogenes more susceptible to the bacteriocidal activity of human serum. Also, observations of the morphological features of the pepO mutant strain (Δ pepO ) showed damaged irregular surfaces as compared with the wild-type strain (WT). WT-infected tissues exhibited greater severity and lower complement activity as compared with those infected by Δ pepO in a mouse skin infection model. Furthermore, WT infection resulted in a larger accumulation of C1q than that with Δ pepO. Our results suggest that interaction of S. pyogenes PepO with C1q interferes with the complement pathway, which enables S. pyogenes to evade complement-mediated bacteriolysis under acidic conditions, such as seen in inflammatory sites. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Immunophenotypic analysis of mast cells in mastocytosis: When and how to do it. Proposals of the Spanish Network on Mastocytosis (REMA).

    PubMed

    Escribano, Luis; Diaz-Agustin, Beatriz; López, Antonio; Núñez López, Rosa; García-Montero, Andrés; Almeida, Julia; Prados, Aranzazu; Angulo, Miguel; Herrero, Sonia; Orfao, Alberto

    2004-03-01

    Mastocytosis is a term used for a heterogeneous group of disorders characterized by an abnormal proliferation and accumulation of mast cells (MCs) in one or multiple tissues including skin, bone marrow, liver, spleen, and lymph nodes, among others. In recent years, multiparameter flow cytometric studies have shown that pathologic MCs from patients with mastocytosis display unique aberrant immunophenotypic characteristics as compared with normal MCs. Among other features, pathologic MCs show aberrant expression of CD25 and CD2 antigens and abnormally high levels of the CD11c and CD35 complement receptors, the CD59 complement regulatory molecule, the CD63 lysosomal membrane antigen, and the CD69 early-activation antigen. In addition, MCs from mastocytosis express abnormally low levels of CD117 and unexpectedly high light scatter and autofluorescence characteristics. These aberrant immunophenotypic features are of great relevance for the assessment of tissue involvement in mastocytosis with consequences in the diagnosis, classification, and follow-up of the disease and in its differential diagnosis with other entities. In this paper we provide the reader with information for the objective and reproducible identification of pathologic MCs by using quantitative multiparametric flow cytometry, information for their phenotypic characterization, and the criteria currently used for a correct interpretation of the immunophenotypic results obtained. Copyright 2004 Wiley-Liss, Inc.

  8. The Lectin Complement Pathway Is Involved in Protection Against Enteroaggregative Escherichia coli Infection.

    PubMed

    Adler Sørensen, Camilla; Rosbjerg, Anne; Hebbelstrup Jensen, Betina; Krogfelt, Karen Angeliki; Garred, Peter

    2018-01-01

    Enteroaggregative Escherichia coli (EAEC) causes acute and persistent diarrhea worldwide. Still, the involvement of host factors in EAEC infections is unresolved. Binding of recognition molecules from the lectin pathway of complement to EAEC strains have been observed, but the importance is not known. Our aim was to uncover the involvement of these molecules in innate complement dependent immune protection toward EAEC. Binding of mannose-binding lectin, ficolin-1, -2, and -3 to four prototypic EAEC strains, and ficolin-2 binding to 56 clinical EAEC isolates were screened by a consumption-based ELISA method. Flow cytometry was used to determine deposition of C4b, C3b, and the bactericidal C5b-9 membrane attack complex (MAC) on the bacteria in combination with different complement inhibitors. In addition, the direct serum bactericidal effect was assessed. Screening of the prototypic EAEC strains revealed that ficolin-2 was the major binder among the lectin pathway recognition molecules. However, among the clinical EAEC isolates only a restricted number ( n  = 5) of the isolates bound ficolin-2. Using the ficolin-2 binding isolate C322-17 as a model, we found that incubation with normal human serum led to deposition of C4b, C3b, and to MAC formation. No inhibition of complement deposition was observed when a C1q inhibitor was added, while partial inhibition was observed when ficolin-2 or factor D inhibitors were used separately. Combining the inhibitors against ficolin-2 and factor D led to virtually complete inhibition of complement deposition and protection against direct bacterial killing. These results demonstrate that ficolin-2 may play an important role in innate immune protection against EAEC when an appropriate ligand is exposed, but many EAEC strains evade lectin pathway recognition and may, therefore, circumvent this strategy of innate host immune protection.

  9. Gene for ataxia-telangiectasia complementation group D (ATDC)

    DOEpatents

    Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

    1995-03-07

    Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

  10. Targeting C-reactive protein for the treatment of cardiovascular disease

    NASA Astrophysics Data System (ADS)

    Pepys, Mark B.; Hirschfield, Gideon M.; Tennent, Glenys A.; Ruth Gallimore, J.; Kahan, Melvyn C.; Bellotti, Vittorio; Hawkins, Philip N.; Myers, Rebecca M.; Smith, Martin D.; Polara, Alessandra; Cobb, Alexander J. A.; Ley, Steven V.; Andrew Aquilina, J.; Robinson, Carol V.; Sharif, Isam; Gray, Gillian A.; Sabin, Caroline A.; Jenvey, Michelle C.; Kolstoe, Simon E.; Thompson, Darren; Wood, Stephen P.

    2006-04-01

    Complement-mediated inflammation exacerbates the tissue injury of ischaemic necrosis in heart attacks and strokes, the most common causes of death in developed countries. Large infarct size increases immediate morbidity and mortality and, in survivors of the acute event, larger non-functional scars adversely affect long-term prognosis. There is thus an important unmet medical need for new cardioprotective and neuroprotective treatments. We have previously shown that human C-reactive protein (CRP), the classical acute-phase protein that binds to ligands exposed in damaged tissue and then activates complement, increases myocardial and cerebral infarct size in rats subjected to coronary or cerebral artery ligation, respectively. Rat CRP does not activate rat complement, whereas human CRP activates both rat and human complement. Administration of human CRP to rats is thus an excellent model for the actions of endogenous human CRP. Here we report the design, synthesis and efficacy of 1,6-bis(phosphocholine)-hexane as a specific small-molecule inhibitor of CRP. Five molecules of this palindromic compound are bound by two pentameric CRP molecules, crosslinking and occluding the ligand-binding B-face of CRP and blocking its functions. Administration of 1,6-bis(phosphocholine)-hexane to rats undergoing acute myocardial infarction abrogated the increase in infarct size and cardiac dysfunction produced by injection of human CRP. Therapeutic inhibition of CRP is thus a promising new approach to cardioprotection in acute myocardial infarction, and may also provide neuroprotection in stroke. Potential wider applications include other inflammatory, infective and tissue-damaging conditions characterized by increased CRP production, in which binding of CRP to exposed ligands in damaged cells may lead to complement-mediated exacerbation of tissue injury.

  11. Complement in Non-Antibody-Mediated Kidney Diseases

    PubMed Central

    Angeletti, Andrea; Reyes-Bahamonde, Joselyn; Cravedi, Paolo; Campbell, Kirk N.

    2017-01-01

    The complement system is part of the innate immune response that plays important roles in protecting the host from foreign pathogens. The complement components and relative fragment deposition have long been recognized to be strongly involved also in the pathogenesis of autoantibody-related kidney glomerulopathies, leading to direct glomerular injury and recruitment of infiltrating inflammation pathways. More recently, unregulated complement activation has been shown to be associated with progression of non-antibody-mediated kidney diseases, including focal segmental glomerulosclerosis, C3 glomerular disease, thrombotic microangiopathies, or general fibrosis generation in progressive chronic kidney diseases. Some of the specific mechanisms associated with complement activation in these diseases were recently clarified, showing a dominant role of alternative activation pathway. Over the last decade, a growing number of anticomplement agents have been developed, and some of them are being approved for clinical use or already in use. Therefore, anticomplement therapies represent a realistic choice of therapeutic approaches for complement-related diseases. Herein, we review the complement system activation, regulatory mechanisms, their involvement in non-antibody-mediated glomerular diseases, and the recent advances in complement-targeting agents as potential therapeutic strategies. PMID:28748184

  12. Factor H-related proteins.

    PubMed

    Józsi, Mihály; Meri, Seppo

    2014-01-01

    Factor H-related proteins (CFHRs) are plasma glycoproteins related in structure and antigenicity to each other and to the complement inhibitory protein factor H. Such proteins are found in most mammals but their number and domain composition vary. This chapter summarizes our current knowledge on the human factor H-related proteins. In contrast to factor H, they have no strong complement inhibitory activity, although for some of them regulatory or complement modulatory activity has been reported. A common feature of CFHRs is that they bind to the C3b component of complement. Novel links between CFHRs and various diseases (C3 glomerulopathies, atypical hemolytic uremic syndrome and age-related macular degeneration) have been revealed in recent years, but we are still far from understanding their biological function.

  13. Triatoma infestans Calreticulin: Gene Cloning and Expression of a Main Domain That Interacts with the Host Complement System.

    PubMed

    Weinberger, Katherine; Collazo, Norberto; Aguillón, Juan Carlos; Molina, María Carmen; Rosas, Carlos; Peña, Jaime; Pizarro, Javier; Maldonado, Ismael; Cattan, Pedro E; Apt, Werner; Ferreira, Arturo

    2017-02-08

    Triatoma infestans is an important hematophagous vector of Chagas disease, a neglected chronic illness affecting approximately 6 million people in Latin America. Hematophagous insects possess several molecules in their saliva that counteract host defensive responses. Calreticulin (CRT), a multifunctional protein secreted in saliva, contributes to the feeding process in some insects. Human CRT (HuCRT) and Trypanosoma cruzi CRT (TcCRT) inhibit the classical pathway of complement activation, mainly by interacting through their central S domain with complement component C1. In previous studies, we have detected CRT in salivary gland extracts from T. infestans We have called this molecule TiCRT. Given that the S domain is responsible for C1 binding, we have tested its role in the classical pathway of complement activation in vertebrate blood. We have cloned and characterized the complete nucleotide sequence of CRT from T. infestans , and expressed its S domain. As expected, this S domain binds to human C1 and, as a consequence, it inhibits the classical pathway of complement, at its earliest stage of activation, namely the generation of C4b. Possibly, the presence of TiCRT in the salivary gland represents an evolutionary adaptation in hematophagous insects to control a potential activation of complement proteins, present in the massive blood meal that they ingest, with deleterious consequences at least on the anterior digestive tract of these insects. © The American Society of Tropical Medicine and Hygiene.

  14. Plasmin cleaves fibrinogen and the human complement proteins C3b and C5 in the presence of Leptospira interrogans proteins: A new role of LigA and LigB in invasion and complement immune evasion.

    PubMed

    Castiblanco-Valencia, Mónica Marcela; Fraga, Tatiana Rodrigues; Pagotto, Ana Helena; Serrano, Solange Maria de Toledo; Abreu, Patricia Antonia Estima; Barbosa, Angela Silva; Isaac, Lourdes

    2016-05-01

    Plasminogen is a single-chain glycoprotein found in human plasma as the inactive precursor of plasmin. When converted to proteolytically active plasmin, plasmin(ogen) regulates both complement and coagulation cascades, thus representing an important target for pathogenic microorganisms. Leptospira interrogans binds plasminogen, which is converted to active plasmin. Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules that interact with extracellular matrix components and complement regulators, including proteins of the FH family and C4BP. In this work, we demonstrate that these multifunctional molecules also bind plasminogen through both N- and C-terminal domains. These interactions are dependent on lysine residues and are affected by ionic strength. Competition assays suggest that plasminogen does not share binding sites with C4BP or FH on Lig proteins at physiological molar ratios. Plasminogen bound to Lig proteins is converted to proteolytic active plasmin in the presence of urokinase-type plasminogen activator (uPA). Lig-bound plasmin is able to cleave the physiological substrates fibrinogen and the complement proteins C3b and C5. Taken together, our data point to a new role of LigA and LigB in leptospiral invasion and complement immune evasion. Plasmin(ogen) acquisition by these versatile proteins may contribute to Leptospira infection, favoring bacterial survival and dissemination inside the host. Copyright © 2016. Published by Elsevier GmbH.

  15. Non-specific adsorption of complement proteins affects complement activation pathways of gold nanomaterials.

    PubMed

    Quach, Quang Huy; Kah, James Chen Yong

    2017-04-01

    The complement system is a key humoral component of innate immunity, serving as the first line of defense against intruders, including foreign synthetic nanomaterials. Although gold nanomaterials (AuNMs) are widely used in nanomedicine, their immunological response is not well understood. Using AuNMs of three shapes commonly used in biomedical applications: spherical gold nanoparticles, gold nanostars and gold nanorods, we demonstrated that AuNMs activated whole complement system, leading to the formation of SC5b-9 complex. All three complement pathways were simultaneously activated by all the AuNMs. Recognition molecules of the complement system interacted with all AuNMs in vitro, except for l-ficolin, but the correlation between these interactions and corresponding complement pathway activation was only observed in the classical and alternative pathways. We also observed the mediating role of complement activation in cellular uptake of all AuNMs by human U937 promonocytic cells, which expresses complement receptors. Taken together, our results highlighted the potential immunological challenges for clinical applications of AuNMs that were often overlooked.

  16. THE PATHOPHYSIOLOGY OF GEOGRAPHIC ATROPHY SECONDARY TO AGE-RELATED MACULAR DEGENERATION AND THE COMPLEMENT PATHWAY AS A THERAPEUTIC TARGET

    PubMed Central

    Schmidt-Erfurth, Ursula; van Lookeren Campagne, Menno; Henry, Erin C.; Brittain, Christopher

    2017-01-01

    Purpose: Geographic atrophy (GA) is an advanced, vision-threatening form of age-related macular degeneration (AMD) affecting approximately five million individuals worldwide. To date, there are no approved therapeutics for GA treatment; however, several are in clinical trials. This review focuses on the pathophysiology of GA, particularly the role of complement cascade dysregulation and emerging therapies targeting the complement cascade. Methods: Primary literature search on PubMed for GA, complement cascade in age-related macular degeneration. ClinicalTrials.gov was searched for natural history studies in GA and clinical trials of drugs targeting the complement cascade for GA. Results: Cumulative damage to the retina by aging, environmental stress, and other factors triggers inflammation via multiple pathways, including the complement cascade. When regulatory components in these pathways are compromised, as with several GA-linked genetic risk factors in the complement cascade, chronic inflammation can ultimately lead to the retinal cell death characteristic of GA. Complement inhibition has been identified as a key candidate for therapeutic intervention, and drugs targeting the complement pathway are currently in clinical trials. Conclusion: The complement cascade is a strategic target for GA therapy. Further research, including on natural history and genetics, is crucial to expand the understanding of GA pathophysiology and identify effective therapeutic targets. PMID:27902638

  17. Functional Evolution of a cis-Regulatory Module

    PubMed Central

    Palsson, Arnar; Alekseeva, Elena; Bergman, Casey M; Nathan, Janaki; Kreitman, Martin

    2005-01-01

    Lack of knowledge about how regulatory regions evolve in relation to their structure–function may limit the utility of comparative sequence analysis in deciphering cis-regulatory sequences. To address this we applied reverse genetics to carry out a functional genetic complementation analysis of a eukaryotic cis-regulatory module—the even-skipped stripe 2 enhancer—from four Drosophila species. The evolution of this enhancer is non-clock-like, with important functional differences between closely related species and functional convergence between distantly related species. Functional divergence is attributable to differences in activation levels rather than spatiotemporal control of gene expression. Our findings have implications for understanding enhancer structure–function, mechanisms of speciation and computational identification of regulatory modules. PMID:15757364

  18. Gene for ataxia-telangiectasia complementation group D (ATDC)

    DOEpatents

    Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

    1995-03-07

    Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

  19. Complement Involvement in Periodontitis: Molecular Mechanisms and Rational Therapeutic Approaches.

    PubMed

    Hajishengallis, George; Maekawa, Tomoki; Abe, Toshiharu; Hajishengallis, Evlambia; Lambris, John D

    2015-01-01

    The complement system is a network of interacting fluid-phase and cell surface-associated molecules that trigger, amplify, and regulate immune and inflammatory signaling pathways. Dysregulation of this finely balanced network can destabilize host-microbe homeostasis and cause inflammatory tissue damage. Evidence from clinical and animal model-based studies suggests that complement is implicated in the pathogenesis of periodontitis, a polymicrobial community-induced chronic inflammatory disease that destroys the tooth-supporting tissues. This review discusses molecular mechanisms of complement involvement in the dysbiotic transformation of the periodontal microbiome and the resulting destructive inflammation, culminating in loss of periodontal bone support. These mechanistic studies have additionally identified potential therapeutic targets. In this regard, interventional studies in preclinical models have provided proof-of-concept for using complement inhibitors for the treatment of human periodontitis.

  20. Downregulation of membrane complement inhibitors CD55 and CD59 by siRNA sensitises uterine serous carcinoma overexpressing Her2/neu to complement and antibody-dependent cell cytotoxicity in vitro: implications for trastuzumab-based immunotherapy.

    PubMed

    Bellone, S; Roque, D; Cocco, E; Gasparrini, S; Bortolomai, I; Buza, N; Abu-Khalaf, M; Silasi, D-A; Ratner, E; Azodi, M; Schwartz, P E; Rutherford, T J; Pecorelli, S; Santin, A D

    2012-04-24

    We evaluated the expression of CD46, CD55 and CD59 membrane-bound complement-regulatory proteins (mCRPs) in primary uterine serous carcinoma (USC) and the ability of small interfering RNA (siRNA) against these mCRPs to sensitise USC to complement-dependent cytotoxicity (CDC) and antibody (trastuzumab)-dependent cellular cytotoxicity (ADCC) in vitro. Membrane-bound complement-regulatory proteins expression was evaluated using real-time PCR (RT-PCR) and flow cytometry, whereas Her2/neu expression and c-erbB2 gene amplification were assessed using immunohistochemistry, flow cytometry and fluorescent in-situ hybridisation. The biological effect of siRNA-mediated knockdown of mCRPs on HER2/neu-overexpressing USC cell lines was evaluated in CDC and ADCC 4-h chromium-release assays. High expression of mCRPs was found in USC cell lines when compared with normal endometrial cells (P<0.05). RT-PCR and FACS analyses demonstrated that anti-mCRP siRNAs were effective in reducing CD46, CD55 and CD59 expression on USC (P<0.05). Baseline complement-dependent cytotoxicity (CDC) against USC cell lines was low (mean ± s.e.m.=6.8 ± 0.9%) but significantly increased upon CD55 and CD59 knockdown (11.6 ± 0.8% and 10.7 ± 0.9%, respectively, P<0.05). Importantly, in the absence of complement, both CD55 and CD59, but not CD46, knockdowns significantly augmented ADCC against USC overexpressing Her2/neu. Uterine serous carcinoma express high levels of the mCRPs CD46, CD55 and CD59. Small interfering RNA inhibition of CD55 and CD59, but not CD46, sensitises USC to both CDC and ADCC in vitro, and if specifically targeted to tumour cells, may significantly increase trastuzumab-mediated therapeutic effect in vivo.

  1. High-Mobility Group Box 1-Induced Complement Activation Causes Sterile Inflammation.

    PubMed

    Kim, Sook Young; Son, Myoungsun; Lee, Sang Eun; Park, In Ho; Kwak, Man Sup; Han, Myeonggil; Lee, Hyun Sook; Kim, Eun Sook; Kim, Jae-Young; Lee, Jong Eun; Choi, Ji Eun; Diamond, Betty; Shin, Jeon-Soo

    2018-01-01

    High-mobility group box 1 (HMGB1), a well-known danger-associated molecular pattern molecule, acts as a pro-inflammatory molecule when secreted by activated immune cells or released after necrotic cell damage. HMGB1 binds to immunogenic bacterial components and augments septic inflammation. In this study, we show how HMGB1 mediates complement activation, promoting sterile inflammation. We show that HMGB1 activates the classical pathway of complement system in an antibody-independent manner after binding to C1q. The C3a complement activation product in human plasma and C5b-9 membrane attack complexes on cell membrane surface are detected after the addition of HMGB1. In an acetaminophen (APAP)-induced hepatotoxicity model, APAP injection reduced HMGB1 levels and elevated C3 levels in C1q-deficient mouse serum samples, compared to that in wild-type (WT) mice. APAP-induced C3 consumption was inhibited by sRAGE treatment in WT mice. Moreover, in a mouse model of brain ischemia-reperfusion injury based on middle cerebral arterial occlusion, C5b-9 complexes were deposited on vessels where HMGB1 was accumulated, an effect that was suppressed upon HMGB1 neutralization. We propose that the HMGB1 released after cell necrosis and in ischemic condition can trigger the classical pathway of complement activation to exacerbate sterile inflammation.

  2. High-Mobility Group Box 1-Induced Complement Activation Causes Sterile Inflammation

    PubMed Central

    Kim, Sook Young; Son, Myoungsun; Lee, Sang Eun; Park, In Ho; Kwak, Man Sup; Han, Myeonggil; Lee, Hyun Sook; Kim, Eun Sook; Kim, Jae-Young; Lee, Jong Eun; Choi, Ji Eun; Diamond, Betty; Shin, Jeon-Soo

    2018-01-01

    High-mobility group box 1 (HMGB1), a well-known danger-associated molecular pattern molecule, acts as a pro-inflammatory molecule when secreted by activated immune cells or released after necrotic cell damage. HMGB1 binds to immunogenic bacterial components and augments septic inflammation. In this study, we show how HMGB1 mediates complement activation, promoting sterile inflammation. We show that HMGB1 activates the classical pathway of complement system in an antibody-independent manner after binding to C1q. The C3a complement activation product in human plasma and C5b-9 membrane attack complexes on cell membrane surface are detected after the addition of HMGB1. In an acetaminophen (APAP)-induced hepatotoxicity model, APAP injection reduced HMGB1 levels and elevated C3 levels in C1q-deficient mouse serum samples, compared to that in wild-type (WT) mice. APAP-induced C3 consumption was inhibited by sRAGE treatment in WT mice. Moreover, in a mouse model of brain ischemia–reperfusion injury based on middle cerebral arterial occlusion, C5b-9 complexes were deposited on vessels where HMGB1 was accumulated, an effect that was suppressed upon HMGB1 neutralization. We propose that the HMGB1 released after cell necrosis and in ischemic condition can trigger the classical pathway of complement activation to exacerbate sterile inflammation. PMID:29696019

  3. Embryonic Explant Culture: Studying Effects of Regulatory Molecules on Gene Expression in Craniofacial Tissues.

    PubMed

    Närhi, Katja

    2017-01-01

    The ex vivo culture of embryonic tissue explants permits the continuous monitoring of growth and morphogenesis at specific embryonic stages. The functions of soluble regulatory molecules can be analyzed by introducing them into culture medium or locally with beads to the tissue. Gene expression in the manipulated tissue explants can be analyzed using in situ hybridization, quantitative PCR, and reporter constructs combined to organ culture to examine the functions of the signaling molecules.

  4. The use of small-molecule structures to complement protein–ligand crystal structures in drug discovery

    PubMed Central

    Cole, Jason C.

    2017-01-01

    Many ligand-discovery stories tell of the use of structures of protein–ligand complexes, but the contribution of structural chemistry is such a core part of finding and improving ligands that it is often overlooked. More than 800 000 crystal structures are available to the community through the Cambridge Structural Database (CSD). Individually, these structures can be of tremendous value and the collection of crystal structures is even more helpful. This article provides examples of how small-molecule crystal structures have been used to complement those of protein–ligand complexes to address challenges ranging from affinity, selectivity and bioavailability though to solubility. PMID:28291759

  5. Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

    PubMed Central

    Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

  6. Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

    PubMed

    Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

  7. Expression of endogenous and foreign ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) genes in a RubisCO deletion mutant of Rhodobacter sphaeroides.

    PubMed Central

    Falcone, D L; Tabita, F R

    1991-01-01

    A Rhodobacter sphaeroides ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) deletion strain was constructed that was complemented by plasmids containing either the form I or form II CO2 fixation gene cluster. This strain was also complemented by genes encoding foreign RubisCO enzymes expressed from a Rhodospirillum rubrum RubisCO promoter. In R. sphaeroides, the R. rubrum promoter was regulated, resulting in variable levels of disparate RubisCO molecules under different growth conditions. Photosynthetic growth of the R. sphaeroides deletion strain complemented with cyanobacterial RubisCO revealed physiological properties reflective of the unique cellular environment of the cyanobacterial enzyme. The R. sphaeroides RubisCO deletion strain and R. rubrum promoter system may be used to assess the properties of mutagenized proteins in vivo, as well as provide a potential means to select for altered RubisCO molecules after random mutagenesis of entire genes or gene regions encoding RubisCO enzymes. Images PMID:1900508

  8. The Lectin Pathway of Complement and Rheumatic Heart Disease

    PubMed Central

    Beltrame, Marcia Holsbach; Catarino, Sandra Jeremias; Goeldner, Isabela; Boldt, Angelica Beate Winter; de Messias-Reason, Iara José

    2014-01-01

    The innate immune system is the first line of host defense against infection and is comprised of humoral and cellular mechanisms that recognize potential pathogens within minutes or hours of entry. The effector components of innate immunity include epithelial barriers, phagocytes, and natural killer cells, as well as cytokines and the complement system. Complement plays an important role in the immediate response against microorganisms, including Streptococcus sp. The lectin pathway is one of three pathways by which the complement system can be activated. This pathway is initiated by the binding of mannose-binding lectin (MBL), collectin 11 (CL-K1), and ficolins (Ficolin-1, Ficolin-2, and Ficolin-3) to microbial surface oligosaccharides and acetylated residues, respectively. Upon binding to target molecules, MBL, CL-K1, and ficolins form complexes with MBL-associated serine proteases 1 and 2 (MASP-1 and MASP-2), which cleave C4 and C2 forming the C3 convertase (C4b2a). Subsequent activation of complement cascade leads to opsonization, phagocytosis, and lysis of target microorganisms through the formation of the membrane-attack complex. In addition, activation of complement may induce several inflammatory effects, such as expression of adhesion molecules, chemotaxis and activation of leukocytes, release of reactive oxygen species, and secretion of cytokines and chemokines. In this chapter, we review the general aspects of the structure, function, and genetic polymorphism of lectin-pathway components and discuss most recent understanding on the role of the lectin pathway in the predisposition and clinical progression of Rheumatic Fever. PMID:25654073

  9. Structural basis for the stabilization of the complement alternative pathway C3 convertase by properdin

    PubMed Central

    Alcorlo, Martín; Tortajada, Agustín; Rodríguez de Córdoba, Santiago; Llorca, Oscar

    2013-01-01

    Complement is an essential component of innate immunity. Its activation results in the assembly of unstable protease complexes, denominated C3/C5 convertases, leading to inflammation and lysis. Regulatory proteins inactivate C3/C5 convertases on host surfaces to avoid collateral tissue damage. On pathogen surfaces, properdin stabilizes C3/C5 convertases to efficiently fight infection. How properdin performs this function is, however, unclear. Using electron microscopy we show that the N- and C-terminal ends of adjacent monomers in properdin oligomers conform a curly vertex that holds together the AP convertase, interacting with both the C345C and vWA domains of C3b and Bb, respectively. Properdin also promotes a large displacement of the TED (thioester-containing domain) and CUB (complement protein subcomponents C1r/C1s, urchin embryonic growth factor and bone morphogenetic protein 1) domains of C3b, which likely impairs C3-convertase inactivation by regulatory proteins. The combined effect of molecular cross-linking and structural reorganization increases stability of the C3 convertase and facilitates recruitment of fluid-phase C3 convertase to the cell surfaces. Our model explains how properdin mediates the assembly of stabilized C3/C5-convertase clusters, which helps to localize complement amplification to pathogen surfaces. PMID:23901101

  10. Why Do Promising Therapies Stall in Development and How Can We Move Them Forward?

    PubMed

    Wegner, Craig D; Goodwin, Andrew; Cook, Jon C; Allamneni, Krishna; Sohn, Jane; McVean, Maralee

    There are many reasons that molecules fail to progress to market and various principles of risk-benefit decisions that can help drive the molecule through development. This symposium included discussions on global strategies involved in pushing promising molecules to market, what to do when a molecule stalls in its progress to market, and options for rescuing the molecule and pushing it forward again. Innovative partnerships that bring stalled drugs back into clinical development were also addressed. A regulatory perspective on common reasons for a molecule to fail in its forward progress was presented. In addition, situations arise when a third-party advisory committee can provide input to help overcome issues identified by a regulatory agency. Using examples from the private and public domain, presentations centered on how to repurpose a molecule and when more science is needed.

  11. SALSA-A dance on a slippery floor with changing partners.

    PubMed

    Reichhardt, M P; Holmskov, U; Meri, S

    2017-09-01

    It is becoming increasingly clear that the connections between our immune system and the microbiota colonizing us have a tremendous impact on human health. A number of innate molecular defence mechanisms cooperate to selectively target unwanted microorganisms at the mucosal surfaces. Amongst others these include the complement system, IgA and the SALSA molecule. The salivary scavenger and agglutinin (SALSA), also known as deleted in malignant brain tumors 1 (DMBT1), salivary agglutinin (SAG) or gp340 is a multifunctional molecule with important functions in innate immunity, inflammation and epithelial homeostasis. The SALSA protein is expressed at most mucosal surfaces, where it is one of the most abundant proteins. In the fetal meconium and infant intestine it may constitute even up to 10% of the total protein amount. SALSA is found either directly associated with the epithelial surface or secreted into the lining fluids. In the fluid-phase SALSA interacts with a number of bacterial and viral organisms, as well as with endogenous ligands, including IgA, lactoferrin, surfactant proteins and complement components. While complement has been shown to impact the mucosal environment, this remains an area of limited research. The multiple interactions of the SALSA molecule provide a scaffold, where this potent defence system may engage in cooperative microbial clearance together with corresponding mucosal host ligands. With its high abundance, and multiple effects on both host and microbes, the SALSA molecule is a key player in maintaining the immunological balance at the mucosal surfaces. This is further supported by observations linking the expression of different SALSA isoforms to the development of chronic inflammatory conditions, such as Crohn's disease and ulcerative colitis. This review describes the latest advances in understanding functions of SALSA and its different isoforms. Recently recognized functions are related to complement activation and regulation, endothelial development and epithelial homeostasis. In addition, we suggest mechanisms how SALSA regulates inflammation at the mucosal surfaces. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Advancing Sensor Technology to Monitor Wildfires

    EPA Pesticide Factsheets

    EPA and partners are looking at ways to use miniature sensors to monitor air quality near wildfires. Data from these small sensors can complement measurements obtained from more complex regulatory-grade monitors that are stationary.

  13. Statistical Inference and Reverse Engineering of Gene Regulatory Networks from Observational Expression Data

    PubMed Central

    Emmert-Streib, Frank; Glazko, Galina V.; Altay, Gökmen; de Matos Simoes, Ricardo

    2012-01-01

    In this paper, we present a systematic and conceptual overview of methods for inferring gene regulatory networks from observational gene expression data. Further, we discuss two classic approaches to infer causal structures and compare them with contemporary methods by providing a conceptual categorization thereof. We complement the above by surveying global and local evaluation measures for assessing the performance of inference algorithms. PMID:22408642

  14. Therapeutic concentration of lithium stimulates complement C3 production in dendritic cells and microglia via GSK-3 inhibition.

    PubMed

    Yu, Zhiqian; Ono, Chiaki; Aiba, Setsuya; Kikuchi, Yoshie; Sora, Ichiro; Matsuoka, Hiroo; Tomita, Hiroaki

    2015-02-01

    Evidence indicates that widely prescribed mood stabilizer, lithium (Li), mediates cellular functions of differentiated monocytic cells, including microglial migration, monocyte-derived dendritic cell (MoDC) differentiation, and amelioration of monocytic malfunctions observed in neuropsychiatric diseases. Here, we surveyed molecules which take major roles in regulating these monocytic cellular functions. MoDCs treated with 1 and 5 mM Li, and microglia separated from Li-treated mice were subjected to microarray-based comprehensive gene expression analyses. Findings were validated using multiple experiments, including quantitative PCR, ELISA and immunostaining studies. Differing effects of Li on the two cell types were observed. Inflammation- and chemotaxis-relevant genes were significantly over-represented among Li-induced genes in MoDCs, whereas no specific category of genes was over-represented in microglia. The third component of complement (C3) was the only gene which was significantly induced by a therapeutic concentration of Li in both MoDCs and microglia. C3 production was increased by Li via GSK-3 inhibition. Li-induced C3 production was seen only in differentiated monocytic cells, but not in circulating monocytes. Our findings highlight a link between Li treatment and C3 production in differentiated monocytic cells, and reveal a regulatory role of GSK-3 in C3 production. Induction of microglial C3 production might be a novel neuroprotective mechanism of Li via regulating interactions between microglia and neurons. GLIA 2015;63:257-270. © 2014 Wiley Periodicals, Inc.

  15. A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design.

    PubMed

    Smith, Robin P; Riesenfeld, Samantha J; Holloway, Alisha K; Li, Qiang; Murphy, Karl K; Feliciano, Natalie M; Orecchia, Lorenzo; Oksenberg, Nir; Pollard, Katherine S; Ahituv, Nadav

    2013-07-18

    Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries.

  16. IgG Fc domains that bind C1q but not effector Fcγ receptors delineate the importance of complement-mediated effector functions.

    PubMed

    Lee, Chang-Han; Romain, Gabrielle; Yan, Wupeng; Watanabe, Makiko; Charab, Wissam; Todorova, Biliana; Lee, Jiwon; Triplett, Kendra; Donkor, Moses; Lungu, Oana I; Lux, Anja; Marshall, Nicholas; Lindorfer, Margaret A; Goff, Odile Richard-Le; Balbino, Bianca; Kang, Tae Hyun; Tanno, Hidetaka; Delidakis, George; Alford, Corrine; Taylor, Ronald P; Nimmerjahn, Falk; Varadarajan, Navin; Bruhns, Pierre; Zhang, Yan Jessie; Georgiou, George

    2017-08-01

    Engineered crystallizable fragment (Fc) regions of antibody domains, which assume a unique and unprecedented asymmetric structure within the homodimeric Fc polypeptide, enable completely selective binding to the complement component C1q and activation of complement via the classical pathway without any concomitant engagement of the Fcγ receptor (FcγR). We used the engineered Fc domains to demonstrate in vitro and in mouse models that for therapeutic antibodies, complement-dependent cell-mediated cytotoxicity (CDCC) and complement-dependent cell-mediated phagocytosis (CDCP) by immunological effector molecules mediated the clearance of target cells with kinetics and efficacy comparable to those of the FcγR-dependent effector functions that are much better studied, while they circumvented certain adverse reactions associated with FcγR engagement. Collectively, our data highlight the importance of CDCC and CDCP in monoclonal-antibody function and provide an experimental approach for delineating the effect of complement-dependent effector-cell engagement in various therapeutic settings.

  17. Exopolysaccharides Isolated from Hydrothermal Vent Bacteria Can Modulate the Complement System

    PubMed Central

    Courtois, Anthony; Berthou, Christian; Guézennec, Jean

    2014-01-01

    The complement system is involved in the defence against bacterial infection, or in the elimination of tumour cells. However, disturbances in this system contributes to the pathogenesis of various inflammatory diseases. The efficiency of therapeutic anti-tumour antibodies is enhanced when the complement system is stimulated. In contrast, cancer cells are able to inhibit the complement system and thus proliferate. Some marine molecules are currently being developed as new drugs for use in humans. Among them, known exopolyssacharides (EPSs) generally originate from fungi, but few studies have been performed on bacterial EPSs and even fewer on EPSs extracted from deep-sea hydrothermal vent microbes. For use in humans, these high molecular weight EPSs must be depolymerised. Furthermore, the over-sulphation of EPSs can modify their biological activity. The aim of this study was to investigate the immunodulation of the complement system by either native or over-sulphated low molecular weight EPSs isolated from vent bacteria in order to find pro or anti-activators of complement. PMID:24736648

  18. Parasitic scabies mites and associated bacteria joining forces against host complement defence.

    PubMed

    Swe, P M; Reynolds, S L; Fischer, K

    2014-11-01

    Scabies is a ubiquitous and contagious skin disease caused by the parasitic mite Sarcoptes scabiei Epidemiological studies have identified scabies as a causative agent for secondary skin infections caused by Staphylococcus aureus and Streptococcus pyogenes. This is an important notion, as such bacterial infections can lead to serious downstream life-threatening complications. As the complement system is the first line of host defence that confronts invading pathogens, both the mite and bacteria produce a large array of molecules that inhibit the complement cascades. It is hypothesised that scabies mite complement inhibitors may play an important role in providing a favourable micro-environment for the establishment of secondary bacterial infections. This review aims to bring together the current literature on complement inhibition by scabies mites and bacteria associated with scabies and to discuss the proposed molecular link between scabies and bacterial co-infections. © 2014 John Wiley & Sons Ltd.

  19. Regulatory roles of mast cells in immune responses.

    PubMed

    Morita, Hideaki; Saito, Hirohisa; Matsumoto, Kenji; Nakae, Susumu

    2016-09-01

    Mast cells are important immune cells for host defense through activation of innate immunity (via toll-like receptors or complement receptors) and acquired immunity (via FcεRI). Conversely, mast cells also act as effector cells that exacerbate development of allergic or autoimmune disorders. Yet, several lines of evidence show that mast cells act as regulatory cells to suppress certain inflammatory diseases. Here, we review the mechanisms by which mast cells suppress diseases.

  20. Induction of Inhibitory Receptors on T Cells During Plasmodium vivax Malaria Impairs Cytokine Production

    PubMed Central

    Costa, Pedro A. C.; Leoratti, Fabiana M. S.; Figueiredo, Maria M.; Tada, Mauro S.; Pereira, Dhelio B.; Junqueira, Caroline; Soares, Irene S.; Barber, Daniel L.; Gazzinelli, Ricardo T.; Antonelli, Lis R. V.

    2015-01-01

    The function and regulation of the immune response triggered during malaria is complex and poorly understood, and there is a particular paucity of studies conducted in humans infected with Plasmodium vivax. While it has been proposed that T-cell-effector responses are crucial for protection against blood-stage malaria in mice, the mechanisms behind this in humans remain poorly understood. Experimental models of malaria have shown that the regulatory molecules, cytotoxic T-lymphocyte attenuator-4 (CTLA-4), lymphocyte activation gene-3 (LAG-3), and programmed death-1 (PD-1) are involved in the functional impairment of T cells during infection. Our goal was to define the role of these molecules during P. vivax malaria. We demonstrate that infection triggers the expression of regulatory molecules on T cells. The pattern of expression differs in CD4+ and CD8+ T cells. Higher frequencies of CD4+ express more than 1 regulatory molecule compared to CD8+ T cells. Moreover, lower proportions of CD4+ T cells coexpress regulatory molecules, but are still able to proliferate. Importantly, simultaneously blockade of the CLTA-4, PD-1, and T-cell immunoglobulin and mucin–3 signaling restores the cytokine production by antigen-specific cells. These data support the hypothesis that upregulation of inhibitory receptors on T cells during P. vivax malaria impairs parasite-specific T-cell effector function. PMID:26019284

  1. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

    PubMed

    Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

    2016-12-01

    Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    PubMed Central

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  3. Brain innate immunity in the regulation of neuroinflammation: therapeutic strategies by modulating CD200-CD200R interaction involve the cannabinoid system.

    PubMed

    Hernangómez, Miriam; Carrillo-Salinas, Francisco J; Mecha, Miriam; Correa, Fernando; Mestre, Leyre; Loría, Frida; Feliú, Ana; Docagne, Fabian; Guaza, Carmen

    2014-01-01

    The central nervous system (CNS) innate immune response includes an arsenal of molecules and receptors expressed by professional phagocytes, glial cells and neurons that is involved in host defence and clearance of toxic and dangerous cell debris. However, any uncontrolled innate immune responses within the CNS are widely recognized as playing a major role in the development of autoimmune disorders and neurodegeneration, with multiple sclerosis (MS) Alzheimer's disease (AD) being primary examples. Hence, it is important to identify the key regulatory mechanisms involved in the control of CNS innate immunity and which could be harnessed to explore novel therapeutic avenues. Neuroimmune regulatory proteins (NIReg) such as CD95L, CD200, CD47, sialic acid, complement regulatory proteins (CD55, CD46, fH, C3a), HMGB1, may control the adverse immune responses in health and diseases. In the absence of these regulators, when neurons die by apoptosis, become infected or damaged, microglia and infiltrating immune cells are free to cause injury as well as an adverse inflammatory response in acute and chronic settings. We will herein provide new emphasis on the role of the pair CD200-CD200R in MS and its experimental models: experimental autoimmune encephalomyelitis (EAE) and Theiler's virus induced demyelinating disease (TMEV-IDD). The interest of the cannabinoid system as inhibitor of inflammation prompt us to introduce our findings about the role of endocannabinoids (eCBs) in promoting CD200-CD200 receptor (CD200R) interaction and the benefits caused in TMEV-IDD. Finally, we also review the current data on CD200-CD200R interaction in AD, as well as, in the aging brain.

  4. Innate immunity and protective neuroinflammation: new emphasis on the role of neuroimmune regulatory proteins.

    PubMed

    Griffiths, M; Neal, J W; Gasque, P

    2007-01-01

    Brain inflammation due to infection, hemorrhage, and aging is associated with activation of the local innate immune system as expressed by infiltrating cells, resident glial cells, and neurons. The innate immune response relies on the detection of "nonself" and "danger-self" ligands behaving as "eat me signals" by a plethora of pattern recognition receptors (PRRs) expressed by professional and amateur phagocytes to promote the clearance of pathogens, toxic cell debris (amyloid fibrils, aggregated synucleins, prions), and apoptotic cells accumulating within the brain parenchyma and the cerebrospinal fluid (CSF). These PRRs (e.g., complement, TLR, CD14, scavenger receptors) are highly conserved between vertebrates and invertebrates and may represent the most ancestral innate scavenging system involved in tissue homeostasis. However, in some diseases, these protective mechanisms lead to neurodegeneration on the ground that several innate immune molecules have neurocytotoxic activities. The response is a "double-edged sword" representing a fine balance between protective and detrimental effects. Several key regulatory mechanisms have now been evidenced in the control of CNS innate immunity, and these could be harnessed to explore novel therapeutic avenues. We will herein provide new emphasis on the role of neuroimmune regulatory proteins (NIRegs), such as CD95L, TNF, CD200, CD47, sialic acids, CD55, CD46, fH, C3a, HMGB1, which are involved in silencing innate immunity at the cellular and molecular levels and suppression of inflammation. For instance, NIRegs may play an important role in controlling lymphocyte/macrophage/microglia hyperinflammatory responses, while sparing host defense and repair mechanisms. Moreover, NIRegs have direct beneficial effects on neurogenesis and contributing to brain tissue remodeling.

  5. The Reconstruction and Analysis of Gene Regulatory Networks.

    PubMed

    Zheng, Guangyong; Huang, Tao

    2018-01-01

    In post-genomic era, an important task is to explore the function of individual biological molecules (i.e., gene, noncoding RNA, protein, metabolite) and their organization in living cells. For this end, gene regulatory networks (GRNs) are constructed to show relationship between biological molecules, in which the vertices of network denote biological molecules and the edges of network present connection between nodes (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). Biologists can understand not only the function of biological molecules but also the organization of components of living cells through interpreting the GRNs, since a gene regulatory network is a comprehensively physiological map of living cells and reflects influence of genetic and epigenetic factors (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). In this paper, we will review the inference methods of GRN reconstruction and analysis approaches of network structure. As a powerful tool for studying complex diseases and biological processes, the applications of the network method in pathway analysis and disease gene identification will be introduced.

  6. Variola virus immune evasion proteins.

    PubMed

    Dunlop, Lance R; Oehlberg, Katherine A; Reid, Jeremy J; Avci, Dilek; Rosengard, Ariella M

    2003-09-01

    Variola virus, the causative agent of smallpox, encodes approximately 200 proteins. Over 80 of these proteins are located in the terminal regions of the genome, where proteins associated with host immune evasion are encoded. To date, only two variola proteins have been characterized. Both are located in the terminal regions and demonstrate immunoregulatory functions. One protein, the smallpox inhibitor of complement enzymes (SPICE), is homologous to a vaccinia virus virulence factor, the vaccinia virus complement-control protein (VCP), which has been found experimentally to be expressed early in the course of vaccinia infection. Both SPICE and VCP are similar in structure and function to the family of mammalian complement regulatory proteins, which function to prevent inadvertent injury to adjacent cells and tissues during complement activation. The second variola protein is the variola virus high-affinity secreted chemokine-binding protein type II (CKBP-II, CBP-II, vCCI), which binds CC-chemokine receptors. The vaccinia homologue of CKBP-II is secreted both early and late in infection. CKBP-II proteins are highly conserved among orthopoxviruses, sharing approximately 85% homology, but are absent in eukaryotes. This characteristic sets it apart from other known virulence factors in orthopoxviruses, which share sequence homology with known mammalian immune regulatory gene products. Future studies of additional variola proteins may help illuminate factors associated with its virulence, pathogenesis and strict human tropism. In addition, these studies may also assist in the development of targeted therapies for the treatment of both smallpox and human immune-related diseases.

  7. Characterization of noncoding regulatory DNA in the human genome.

    PubMed

    Elkon, Ran; Agami, Reuven

    2017-08-08

    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  8. The role of MicroRNA molecules and MicroRNA-regulating machinery in the pathogenesis and progression of epithelial ovarian cancer.

    PubMed

    Wang, Xiyin; Ivan, Mircea; Hawkins, Shannon M

    2017-11-01

    MicroRNA molecules are small, single-stranded RNA molecules that function to regulate networks of genes. They play important roles in normal female reproductive tract biology, as well as in the pathogenesis and progression of epithelial ovarian cancer. DROSHA, DICER, and Argonaute proteins are components of the microRNA-regulatory machinery and mediate microRNA production and function. This review discusses aberrant expression of microRNA molecules and microRNA-regulating machinery associated with clinical features of epithelial ovarian cancer. Understanding the regulation of microRNA molecule production and function may facilitate the development of novel diagnostic and therapeutic strategies to improve the prognosis of women with epithelial ovarian cancer. Additionally, understanding microRNA molecules and microRNA-regulatory machinery associations with clinical features may influence prevention and early detection efforts. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Expression of decay-accelerating factor (CD55), membrane cofactor protein (CD46) and CD59 in the human astroglioma cell line, D54-MG, and primary rat astrocytes.

    PubMed

    Yang, C; Jones, J L; Barnum, S R

    1993-09-01

    In this report, we have shown the expression of the complement regulatory proteins decay-accelerating factor (DAF, CD55), membrane cofactor protein (MCP, CD46) and CD59 on human D54-MG astroglioma cells by several methods, including immunofluorescence, flow cytometry and Western blotting and Northern blot analysis. These studies demonstrate that all three proteins are structurally and antigenically similar to their counterparts expressed on HepG2 and SW480 cells (hepatocyte and epithelial cell lines, respectively). D54-MG cells express mRNA for all three proteins of the appropriate size(s). The phosphatidylinositol-specific enzyme, PIPLC, cleaved DAF from the surface of D54-MG cells, demonstrating that DAF is linked by a glycophospholipid anchor as has been shown for other cell types. Flow cytometry demonstrates that primary rat astrocytes also constitutively express all three regulatory proteins. These data are the first to demonstrate the expression of CD59 on astrocytes, and the presence of all three regulatory proteins on astrocytes suggests that regulation of complement activation in the central nervous system is important in neural host defense mechanisms.

  10. Molecular and expression analysis of complement component C5 in the nurse shark (Ginglymostoma cirratum) and its predicted functional role.

    PubMed

    Graham, Matthew; Shin, Dong-Ho; Smith, Sylvia L

    2009-07-01

    We present the complete cDNA sequence of shark (Ginglymostoma cirratum) pro-C5 and its molecular characterization with a descriptive analysis of the structural elements necessary for its potential functional role as a potent mediator of inflammation (fragment C5a) and initiator molecule (fragment C5b) for the assembly of the membrane attack complex (MAC) upon activation by C5 convertase. In mammals the three complement activation cascades, the classical, alternative and lectin pathways, converge at the activation of C3, a pivotal complement protein. It is, however, the subsequent activation of the next complement component, C5, which is the focal point at which the initiation of the terminal lytic pathway takes place and involves the stepwise assembly of the MAC. The effector cytolytic function of complement occurs with the insertion of MAC into target membranes causing dough-nut like holes and cell leakage. The lytic activity of shark complement results in structurally similar holes in target membranes suggesting the assembly of a shark MAC that likely involves a functional analogue of C5. The composition of shark MAC remains unresolved and to date conclusive evidence has been lacking for shark C5. The gene has not been cloned nor has the serum protein been characterized for any elasmobranch species. This report is the first to confirm the presence of C5 homologue in the shark. GcC5 is remarkably similar to human C5 in overall structure and domain arrangement. The GcC5 cDNA measured 5160-bp with 5' and 3' UTRs of 35 bp and 79 bp, respectively. Structural analysis of the derived protein sequence predicts a molecule that is a two-chain structure which lacks a thiolester bond and contains a C5 convertase cleavage site indicating that activation will generate two peptides, akin to C5b and C5a. The putative GcC5 molecule also contains the C-terminal C345C/Netrin module that characterizes C3, C4 and C5. Multiple alignment of deduced amino acid sequences shows that GcC5 shares more amino acid identities/similarities with mammals than that with bony fish. We conclude that at the time of emergence of sharks the elaborate mosaic structure of C5 had already evolved.

  11. Molecular and expression analysis of complement component C5 in the nurse shark (Ginglymostoma cirratum) and its predicted functional role

    PubMed Central

    Graham, Matthew; Shin, Dong-Ho; Smith, Sylvia L.

    2009-01-01

    We present the complete cDNA sequence of shark (Ginglymostoma cirratum) pro-C5 and its molecular characterization with a descriptive analysis of the structural elements necessary for its potential functional role as a potent mediator of inflammation (fragment C5a) and initiator molecule (fragment C5b) for the assembly of the membrane attack complex (MAC) upon activation by C5 convertase. In mammals the three complement activation cascades, the classical, alternative and lectin pathways, converge at the activation of C3, a pivotal complement protein. It is, however, the subsequent activation of the next complement component, C5, which is the focal point at which the initiation of the terminal lytic pathway takes place and involves the stepwise assembly of the MAC. The effector cytolytic function of complement occurs with the insertion of MAC into target membranes causing dough-nut like holes and cell leakage. The lytic activity of shark complement results in structurally similar holes in target membranes suggesting the assembly of a shark MAC that likely involves a functional analogue of C5. The composition of shark MAC remains unresolved and to date conclusive evidence has been lacking for shark C5. The gene has not been cloned nor has the serum protein been characterized for any elasmobranch species. This report is the first to confirm the presence of C5 homologue in the shark. GcC5 is remarkably similar to human C5 in overall structure and domain arrangement. The GcC5 cDNA measured 5160-bp with 5′ and 3′ UTRs of 35bp and 79bp, respectively. Structural analysis of the derived protein sequence predicts a molecule that is a two-chain structure which lacks a thiolester bond and contains a C5 convertase cleavage site indicating that activation will generate two peptides, akin to C5b and C5a. The putative GcC5 molecule also contains the C-terminal C345C/Netrin module that characterizes C3, C4 and C5. Multiple alignment of deduced amino acid sequences show that GcC5 shares more amino acid identities/similarities with mammals than that with bony fish. We conclude that at the time of emergence of sharks the elaborate mosaic structure of C5 had already evolved. PMID:19410004

  12. Complement in Lupus Nephritis: New Perspectives.

    PubMed

    Bao, Lihua; Cunningham, Patrick N; Quigg, Richard J

    2015-09-01

    Systemic lupus erythematosus (SLE) is an autoimmune disorder caused by loss of tolerance to self-antigens, the production of autoantibodies and deposition of complement-fixing immune complexes (ICs) in injured tissues. SLE is characterized by a wide range of clinical manifestations and targeted organs, with lupus nephritis being one of the most serious complications. The complement system consists of three pathways and is tightly controlled by a set of regulatory proteins to prevent injudicious complement activation on host tissue. The involvement of the complement system in the pathogenesis of SLE is well accepted; yet, its exact role is still not clear. Complement plays dual roles in the pathogenesis of SLE. On the one hand, the complement system appears to have protective features in that hereditary homozygous deficiencies of classical pathway components, such as C1q and C4, are associated with an increased risk for SLE. On the other hand, IC-mediated activation of complement in affected tissues is clearly evident in both experimental and human SLE along with pathological features that are logical consequences of complement activation. Studies in genetically altered mice have shown that lack of complement inhibitors, such as complement factor H (CFH) or decay-accelerating factor (DAF) accelerates the development of experimental lupus nephritis, while treatment with recombinant protein inhibitors, such as Crry-Ig, CR2-Crry, CR2-DAF and CR2-CFH, ameliorates the disease development. Complement-targeted drugs, including soluble complement receptor 1 (TP10), C1 esterase inhibitor and a monoclonal anti-C5 antibody (eculizumab), have been shown to inhibit complement safely, and are now being investigated in a variety of clinical conditions. SLE is an autoimmune disorder which targets multiple systems. Complement is centrally involved and plays dual roles in the pathogenesis of SLE. Studies from experimental lupus models and clinical trials support the use of complement-targeted therapy in the treatment of SLE.

  13. Modelling and analysis of gene regulatory network using feedback control theory

    NASA Astrophysics Data System (ADS)

    El-Samad, H.; Khammash, M.

    2010-01-01

    Molecular pathways are a part of a remarkable hierarchy of regulatory networks that operate at all levels of organisation. These regulatory networks are responsible for much of the biological complexity within the cell. The dynamic character of these pathways and the prevalence of feedback regulation strategies in their operation make them amenable to systematic mathematical analysis using the same tools that have been used with success in analysing and designing engineering control systems. In this article, we aim at establishing this strong connection through various examples where the behaviour exhibited by gene networks is explained in terms of their underlying control strategies. We complement our analysis by a survey of mathematical techniques commonly used to model gene regulatory networks and analyse their dynamic behaviour.

  14. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)

    PubMed Central

    Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.

    1996-01-01

    The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146

  15. A novel L-ficolin/mannose-binding lectin chimeric molecule with enhanced activity against Ebola virus.

    PubMed

    Michelow, Ian C; Dong, Mingdong; Mungall, Bruce A; Yantosca, L Michael; Lear, Calli; Ji, Xin; Karpel, Marshall; Rootes, Christina L; Brudner, Matthew; Houen, Gunnar; Eisen, Damon P; Kinane, T Bernard; Takahashi, Kazue; Stahl, Gregory L; Olinger, Gene G; Spear, Gregory T; Ezekowitz, R Alan B; Schmidt, Emmett V

    2010-08-06

    Ebola viruses constitute a newly emerging public threat because they cause rapidly fatal hemorrhagic fevers for which no treatment exists, and they can be manipulated as bioweapons. We targeted conserved N-glycosylated carbohydrate ligands on viral envelope surfaces using novel immune therapies. Mannose-binding lectin (MBL) and L-ficolin (L-FCN) were selected because they function as opsonins and activate complement. Given that MBL has a complex quaternary structure unsuitable for large scale cost-effective production, we sought to develop a less complex chimeric fusion protein with similar ligand recognition and enhanced effector functions. We tested recombinant human MBL and three L-FCN/MBL variants that contained the MBL carbohydrate recognition domain and varying lengths of the L-FCN collagenous domain. Non-reduced chimeric proteins formed predominantly nona- and dodecameric oligomers, whereas recombinant human MBL formed octadecameric and larger oligomers. Surface plasmon resonance revealed that L-FCN/MBL76 had the highest binding affinities for N-acetylglucosamine-bovine serum albumin and mannan. The same chimeric protein displayed superior complement C4 cleavage and binding to calreticulin (cC1qR), a putative receptor for MBL. L-FCN/MBL76 reduced infection by wild type Ebola virus Zaire significantly greater than the other molecules. Tapping mode atomic force microscopy revealed that L-FCN/MBL76 was significantly less tall than the other molecules despite similar polypeptide lengths. We propose that alterations in the quaternary structure of L-FCN/MBL76 resulted in greater flexibility in the collagenous or neck region. Similarly, a more pliable molecule might enhance cooperativity between the carbohydrate recognition domains and their cognate ligands, complement activation, and calreticulin binding dynamics. L-FCN/MBL chimeric proteins should be considered as potential novel therapeutics.

  16. Cyclosporine Induces Endothelial Cell Release of Complement-Activating Microparticles

    PubMed Central

    Renner, Brandon; Klawitter, Jelena; Goldberg, Ryan; McCullough, James W.; Ferreira, Viviana P.; Cooper, James E.; Christians, Uwe

    2013-01-01

    Defective control of the alternative pathway of complement is an important risk factor for several renal diseases, including atypical hemolytic uremic syndrome. Infections, drugs, pregnancy, and hemodynamic insults can trigger episodes of atypical hemolytic uremic syndrome in susceptible patients. Although the mechanisms linking these clinical events with disease flares are unknown, recent work has revealed that each of these clinical conditions causes cells to release microparticles. We hypothesized that microparticles released from injured endothelial cells promote intrarenal complement activation. Calcineurin inhibitors cause vascular and renal injury and can trigger hemolytic uremic syndrome. Here, we show that endothelial cells exposed to cyclosporine in vitro and in vivo release microparticles that activate the alternative pathway of complement. Cyclosporine-induced microparticles caused injury to bystander endothelial cells and are associated with complement-mediated injury of the kidneys and vasculature in cyclosporine-treated mice. Cyclosporine-induced microparticles did not bind factor H, an alternative pathway regulatory protein present in plasma, explaining their complement-activating phenotype. Finally, we found that in renal transplant patients, the number of endothelial microparticles in plasma increases 2 weeks after starting tacrolimus, and treatment with tacrolimus associated with increased C3 deposition on endothelial microparticles in the plasma of some patients. These results suggest that injury-associated release of endothelial microparticles is an important mechanism by which systemic insults trigger intravascular complement activation and complement-dependent renal diseases. PMID:24092930

  17. [Construction of enterohemorrhagic Escherichia coli O157:H7 strains with espF gene deletion and complementation].

    PubMed

    Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong

    2015-11-01

    To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.

  18. Single-Molecule Electronics: Chemical and Analytical Perspectives.

    PubMed

    Nichols, Richard J; Higgins, Simon J

    2015-01-01

    It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

  19. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    DTIC Science & Technology

    2017-12-01

    using isogenic (mutant/complemented) human cell line pairs from patients with Fanconi anemia (FA), a heritable human bone marrow failure (BMF) syndrome ...small molecules could be therapeutically useful in reducing the risk of BMF in diseases such as Fanconi anemia, and perhaps after radiation exposure...damage-repair, DNA damage response, Fanconi anemia and associated bone marrow failure syndromes and environmental and molecular toxicology will all be

  20. Sexual dimorphism of liver metastasis by murine pancreatic neuroendocrine tumors is affected by expression of complement C5.

    PubMed

    Contractor, Tanupriya; Kobayashi, Shinta; da Silva, Edaise; Clausen, Richard; Chan, Chang; Vosburgh, Evan; Tang, Laura H; Levine, Arnold J; Harris, Chris R

    2016-05-24

    In a mouse model for neuroendocrine tumors of the pancreas (PanNETs), liver metastasis occurred at a higher frequency in males. Male mice also had higher serum and intratumoral levels of the innate immunity protein complement C5. In mice that lost the ability to express complement C5, there was a lower frequency of metastasis, and males no longer had a higher frequency of metastasis than females. Treatment with PMX53, a small molecule antagonist of C5aR1/CD88, the receptor for complement C5a, also reduced metastasis. Mice lacking a functional gene for complement C5 had smaller primary tumors, which were less invasive and lacked the CD68+ macrophages that have previously been associated with metastasis in this type of tumor. This is the first report of a gene that causes sexual dimorphism of metastasis in a mouse model. In the human disease, which also shows sexual dimorphism for metastasis, clinically advanced tumors expressed more complement C5 than less advanced tumors.

  1. Regulatory states in the developmental control of gene expression.

    PubMed

    Peter, Isabelle S

    2017-09-01

    A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Free iterative-complement-interaction calculations of the hydrogen molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurokawa, Yusaku; Nakashima, Hiroyuki; Nakatsuji, Hiroshi

    2005-12-15

    The free iterative-complement-interaction (ICI) method based on the scaled Schroedinger equation proposed previously has been applied to the calculations of very accurate wave functions of the hydrogen molecule in an analytical expansion form. All the variables were determined with the variational principle by calculating the necessary integrals analytically. The initial wave function and the scaling function were changes to see the effects on the convergence speed of the ICI calculations. The free ICI wave functions that were generated automatically were different from the existing wave functions, and this difference was shown to be physically important. The best wave function reportedmore » in this paper seems to be the best worldwide in the literature from the variational point of view. The quality of the wave function was examined by calculating the nuclear and electron cusps.« less

  3. Dual-Color Luciferase Complementation for Chemokine Receptor Signaling.

    PubMed

    Luker, Kathryn E; Luker, Gary D

    2016-01-01

    Chemokine receptors may share common ligands, setting up potential competition for ligand binding, and association of activated receptors with downstream signaling molecules such as β-arrestin. Determining the "winner" of competition for shared effector molecules is essential for understanding integrated functions of chemokine receptor signaling in normal physiology, disease, and response to therapy. We describe a dual-color click beetle luciferase complementation assay for cell-based analysis of interactions of two different chemokine receptors, CXCR4 and ACKR3, with the intracellular scaffolding protein β-arrestin 2. This assay provides real-time quantification of receptor activation and signaling in response to chemokine CXCL12. More broadly, this general imaging strategy can be applied to quantify interactions of any set of two proteins that interact with a common binding partner. © 2016 Elsevier Inc. All rights reserved.

  4. Mesophilic Aeromonas sp. serogroup O:11 resistance to complement-mediated killing.

    PubMed Central

    Merino, S; Rubires, X; Aguilar, A; Albertí, S; Hernandez-Allés, S; Benedí, V J; Tomas, J M

    1996-01-01

    The complement activation by and resistance to complement-mediated killing of Aeromonas sp. strains from serogroup O:11 were investigated by using different wild-type strains (with an S-layer characteristic of this serogroup) and their isogenic mutants characterized for their surface components (S-layer and lipopolysaccharide [LPS]). All of the Aeromonas sp. serogroup O:11 wild-type strains are unable to activate complement, which suggested that the S-layer completely covered the LPS molecules. We found that the classical complement pathway is involved in serum killing of susceptible Aeromonas sp. mutant strains of serogroup O11, while the alternative complement pathway seems not to be involved, and that the complement activation seems to be independent of antibody. The smooth mutant strains devoid of the S-layer (S-layer isogenic mutants) or isogenic LPS mutant strains with a complete or rather complete LPS core (also without the S-layer) are able to activate complement but are resistant to complement-mediated killing. The reasons for this resistance are that C3b is rapidly degraded, and therefore the lytic membrane attack complex (C5b-9) is not formed. Isogenic LPS rough mutants with an incomplete LPS core are serum sensitive because they bind more C3b than the resistant strains, the C3b is not completely degraded, and therefore the lytic complex (C5b-9) is formed. PMID:8945581

  5. Complement Component 3C3 and C3a Receptor Are Required in Chitin-Dependent Allergic Sensitization to Aspergillus fumigatus but Dispensable in Chitin-Induced Innate Allergic Inflammation

    PubMed Central

    Roy, René M.; Paes, Hugo C.; Nanjappa, Som G.; Sorkness, Ron; Gasper, David; Sterkel, Alana; Wüthrich, Marcel; Klein, Bruce S.

    2013-01-01

    ABSTRACT Levels of the anaphylatoxin C3a are increased in patients with asthma compared with those in nonasthmatics and increase further still during asthma exacerbations. However, the role of C3a during sensitization to allergen is poorly understood. Sensitization to fungal allergens, such as Aspergillus fumigatus, is a strong risk factor for the development of asthma. Exposure to chitin, a structural polysaccharide of the fungal cell wall, induces innate allergic inflammation and may promote sensitization to fungal allergens. Here, we found that coincubation of chitin with serum or intratracheal administration of chitin in mice resulted in the generation of C3a. We established a model of chitin-dependent sensitization to soluble Aspergillus antigens to test the contribution of complement to these events. C3−/− and C3aR−/− mice were protected from chitin-dependent sensitization to Aspergillus and had reduced lung eosinophilia and type 2 cytokines and serum IgE. In contrast, complement-deficient mice were not protected against chitin-induced innate allergic inflammation. In sensitized mice, plasmacytoid dendritic cells from complement-deficient animals acquired a tolerogenic profile associated with enhanced regulatory T cell responses and suppressed Th2 and Th17 responses specific for Aspergillus. Thus, chitin induces the generation of C3a in the lung, and chitin-dependent allergic sensitization to Aspergillus requires C3aR signaling, which suppresses regulatory dendritic cells and T cells and induces allergy-promoting T cells. PMID:23549917

  6. 2016 White Paper on recent issues in bioanalysis: focus on biomarker assay validation (BAV) (Part 1 - small molecules, peptides and small molecule biomarkers by LCMS).

    PubMed

    Yang, Eric; Welink, Jan; Cape, Stephanie; Woolf, Eric; Sydor, Jens; James, Christopher; Goykhman, Dina; Arnold, Mark; Addock, Neil; Bauer, Ronald; Buonarati, Michael; Ciccimaro, Eugene; Dodda, Raj; Evans, Christopher; Garofolo, Fabio; Hughes, Nicola; Islam, Rafiq; Nehls, Corey; Wilson, Amanda; Briscoe, Chad; Bustard, Mark; Coppola, Laura; Croft, Stephanie; Drexler, Dieter; Ferrari, Luca; Fraier, Daniela; Jenkins, Rand; Kadavil, John; King, Lloyd; Li, Wenkui; Lima Santos, Gustavo Mendes; Musuku, Adrien; Ramanathan, Ragu; Saito, Yoshiro; Savoie, Natasha; Summerfield, Scott; Sun, Rachel; Tampal, Nilufer; Vinter, Steve; Wakelin-Smith, Jason; Yue, Qin

    2016-10-07

    The 2016 10 th Workshop on Recent Issues in Bioanalysis (10 th WRIB) took place in Orlando, Florida with participation of close to 700 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations, and regulatory agencies worldwide. WRIB was once again a 5-day, weeklong event - A Full Immersion Week of Bioanalysis including Biomarkers and Immunogenicity. As usual, it was specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small and large molecule analysis involving LCMS, hybrid LBA/LCMS, and LBA approaches, with the focus on biomarkers and immunogenicity. This 2016 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. This white paper is published in 3 parts due to length. This part (Part 1) discusses the recommendations for small molecules, peptides and small molecule biomarkers by LCMS. Part 2 (Hybrid LBA/LCMS and regulatory inputs from major global health authorities) and Part 3 (large molecule bioanalysis using LBA, biomarkers and immunogenicity) will be published in the Bioanalysis journal, issue 23.

  7. Transcriptional regulatory proteins as biosensing tools.

    PubMed

    Turner, Kendrick; Joel, Smita; Feliciano, Jessika; Feltus, Agatha; Pasini, Patrizia; Wynn, Daniel; Dau, Peter; Dikici, Emre; Deo, Sapna K; Daunert, Sylvia

    2017-06-22

    We have developed sensing systems employing different classes of transcriptional regulatory proteins genetically and chemically modified to incorporate a fluorescent reporter molecule for detection of arsenic, hydroxylated polychlorinated biphenyls (OH-PCBs), and cyclic AMP (cAMP). These are the first examples of optical sensing systems based on transcriptional regulatory proteins.

  8. Targeting signal transduction pathways of cancer stem cells for therapeutic opportunities of metastasis.

    PubMed

    Iqbal, Waqas; Alkarim, Saleh; AlHejin, Ahmed; Mukhtar, Hasan; Saini, Kulvinder S

    2016-11-15

    Tumor comprises of heterogeneous population of cells where not all the disseminated cancer cells have the prerogative and "in-build genetic cues" to form secondary tumors. Cells with stem like properties complemented by key signaling molecules clearly have shown to exhibit selective growth advantage to form tumors at distant metastatic sites. Thus, defining the role of cancer stem cells (CSC) in tumorigenesis and metastasis is emerging as a major thrust area for therapeutic intervention. Precise relationship and regulatory mechanisms operating in various signal transduction pathways during cancer dissemination, extravasation and angiogenesis still remain largely enigmatic. How the crosstalk amongst circulating tumor cells (CTC), epithelial mesenchymal transition (EMT) process and CSC is coordinated for initiating the metastasis at secondary tissues, and during cancer relapse could be of great therapeutic interest. The signal transduction mechanisms facilitating the dissemination, infiltration of CSC into blood stream, extravasations, progression of metastasis phenotype and angiogenesis, at distant organs, are the key pathologically important vulnerabilities being elucidated. Therefore, current new drug discovery focus has shifted towards finding "key driver genes" operating in parallel signaling pathways, during quiescence, survival and maintenance of stemness in CSC. Understanding these mechanisms could open new horizons for tackling the issue of cancer recurrence and metastasis-the cause of ~90% cancer associated mortality. To design futuristic & targeted therapies, we propose a multi-pronged strategy involving small molecules, RNA interference, vaccines, antibodies and other biotechnological modalities against CSC and the metastatic signal transduction cascade.

  9. Inhibition of intracellular bacterial replication in fibroblasts is dependent on the perforin-like protein (Perforin-2) encoded by macrophage expressed gene 1

    PubMed Central

    McCormack, Ryan; de Armas, Lesley R.; Shiratsuchi, Motoaki; Ramos, Jay; Podack, Eckhard R.

    2013-01-01

    Fibroblasts are known to eliminate intracellular bacteria, but the lethal hit of the bactericidal mechanism has not been defined. We show that primary embryonic and established fibroblasts can be induced by interferons or by intracellular bacterial infection to express a perforin-like mRNA previously described as macrophage expressed gene 1 (mpeg1). The presence and level of the perforin-like mRNA correlate with the ability of primary mouse embryonic fibroblasts (MEF) to eliminate intracellular bacteria. In addition, siRNA knock-down of the perforin-like molecule abolishes bactericidal activity and allows intracellular bacterial replication. Complementation of MEF in which the endogenous perforin-like molecule has been knocked down with an RFP-tagged version restores bactericidal activity. The perforin-like molecule has broad bactericidal specificity for pathogenic and non-pathogenic bacteria including Gram positive, Gram negative and acid fast bacteria. The perforin-like molecule renders previously lysozyme-resistant bacteria sensitive to lysis by lysozyme suggesting physical damage of the outer cell wall by the perforin-like protein. MEFs damage cell walls of intracellular bacteria by insertion, polymerization and pore-formation of the perforin-like protein, analogous to pore-formers of complement and Perforin-1 of cytolytic lymphocytes. We propose the name Perforin-2. PMID:23257510

  10. Tonsil Epithelial Factors May Influence Oropharyngeal Human Immunodeficiency Virus Transmission

    PubMed Central

    Moutsopoulos, Niki M.; Nares, Salvador; Nikitakis, Nikolaos; Rangel, Zoila; Wen, Jie; Munson, Peter; Sauk, John; Wahl, Sharon M.

    2007-01-01

    Tonsil epithelium has been implicated in human immunodeficiency virus (HIV) pathogenesis, but its role in oral transmission remains controversial. To study characteristics of this tissue, which may influence susceptibility or resistance to HIV, we performed microarray analysis of the tonsil epithelium. Our data revealed that genes related to immune functions such as antibody production and antigen processing were increasingly expressed in tonsil compared with the epithelium of another oropharyngeal site, the gingival epithelium. Importantly, tonsil epithelium highly expressed genes associated with HIV entrapment and/or transmission, including the HIV co-receptor CXCR4 and the potential HIV-binding molecules FcRγIII, complement receptor 2, and various complement components. Immunohistochemical staining confirmed the increased presence of CXCR4 in the tonsil epithelium compared with multiple oral epithelial sites, particularly in basal and parabasal layers. This increased expression of molecules involved in viral recognition, binding, and entry may favor virus-epithelium interactions in an environment with reduced innate antiviral mechanisms. Specifically, secretory leukocyte protease inhibitor, an innate molecule with anti-HIV activity, was minimal in the tonsil epithelium, in contrast to oral mucosa. Collectively, our data suggest that increased expression of molecules associated with HIV binding and entry coupled with decreased innate antiviral factors may render the tonsil a potential site for oral transmission. PMID:17620369

  11. SEDIMENT TOXICITY AS AN INDICATOR OF CONTAMINANT STRESS IN EMAP-ESTUARIES

    EPA Science Inventory

    Toxicity of sediments is widely used in EPA, ACOE, and NOAA monitoring and regulatory programs as a complement to measuring of chemical concentrations as it provides an indication of the bioavailability of sediment contaminants. Sediment toxicity was included as an abiotic condit...

  12. Identification of a Naegleria fowleri Membrane Protein Reactive with Anti-Human CD59 Antibody

    PubMed Central

    Fritzinger, Angela E.; Toney, Denise M.; MacLean, Rebecca C.; Marciano-Cabral, Francine

    2006-01-01

    Naegleria fowleri, the causative agent of primary amebic meningoencephalitis, is resistant to complement lysis. The presence of a complement regulatory protein on the surface of N. fowleri was investigated. Southern blot and Northern blot analyses demonstrated hybridization of a radiolabeled cDNA probe for CD59 to genomic DNA and RNA, respectively, from pathogenic N. fowleri. An 18-kDa immunoreactive protein was detected on the membrane of N. fowleri by Western immunoblot and immunofluorescence analyses with monoclonal antibodies for human CD59. Complement component C9 immunoprecipitated with the N. fowleri “CD59-like” protein from amebae incubated with normal human serum. In contrast, a gene or protein similar to CD59 was not detected in nonpathogenic, complement-sensitive N. gruberi amebae. Collectively, our studies suggest that a protein reactive with antibodies to human CD59 is present on the surface of N. fowleri amebae and may play a role in resistance to lysis by cytolytic proteins. PMID:16428768

  13. NF-κB and enhancer-binding CREB protein scaffolded by CREB-binding protein (CBP)/p300 proteins regulate CD59 protein expression to protect cells from complement attack.

    PubMed

    Du, Yiqun; Teng, Xiaoyan; Wang, Na; Zhang, Xin; Chen, Jianfeng; Ding, Peipei; Qiao, Qian; Wang, Qingkai; Zhang, Long; Yang, Chaoqun; Yang, Zhangmin; Chu, Yiwei; Du, Xiang; Zhou, Xuhui; Hu, Weiguo

    2014-01-31

    The complement system can be activated spontaneously for immune surveillance or induced to clear invading pathogens, in which the membrane attack complex (MAC, C5b-9) plays a critical role. CD59 is the sole membrane complement regulatory protein (mCRP) that restricts MAC assembly. CD59, therefore, protects innocent host cells from attacks by the complement system, and host cells require the constitutive and inducible expression of CD59 to protect themselves from deleterious destruction by complement. However, the mechanisms that underlie CD59 regulation remain largely unknown. In this study we demonstrate that the widely expressed transcription factor Sp1 may regulate the constitutive expression of CD59, whereas CREB-binding protein (CBP)/p300 bridge NF-κB and CREB, which surprisingly functions as an enhancer-binding protein to induce the up-regulation of CD59 during in lipopolysaccharide (LPS)-triggered complement activation, thus conferring host defense against further MAC-mediated destruction. Moreover, individual treatment with LPS, TNF-α, and the complement activation products (sublytic MAC (SC5b-9) and C5a) could increase the expression of CD59 mainly by activating NF-κB and CREB signaling pathways. Together, our findings identify a novel gene regulation mechanism involving CBP/p300, NF-κB, and CREB; this mechanism suggests potential drug targets for controlling various complement-related human diseases.

  14. Complement factor H protects mice from ischemic acute kidney injury but is not critical for controlling complement activation by glomerular IgM.

    PubMed

    Goetz, Lindsey; Laskowski, Jennifer; Renner, Brandon; Pickering, Matthew C; Kulik, Liudmila; Klawitter, Jelena; Stites, Erik; Christians, Uwe; van der Vlag, Johan; Ravichandran, Kameswaran; Holers, V Michael; Thurman, Joshua M

    2018-05-01

    Natural IgM binds to glomerular epitopes in several progressive kidney diseases. Previous work has shown that IgM also binds within the glomerulus after ischemia/reperfusion (I/R) but does not fully activate the complement system. Factor H is a circulating complement regulatory protein, and congenital or acquired deficiency of factor H is a strong risk factor for several types of kidney disease. We hypothesized that factor H controls complement activation by IgM in the kidney after I/R, and that heterozygous factor H deficiency would permit IgM-mediated complement activation and injury at this location. We found that mice with targeted heterozygous deletion of the gene for factor H developed more severe kidney injury after I/R than wild-type controls, as expected, but that complement activation within the glomeruli remained well controlled. Furthermore, mice that are unable to generate soluble IgM were not protected from renal I/R, even in the setting of heterozygous factor H deficiency. These results demonstrate that factor H is important for limiting injury in the kidney after I/R, but it is not critical for controlling complement activation by immunoglobulin within the glomerulus in this setting. IgM binds to glomerular epitopes after I/R, but it is not a significant source of injury. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A pore-forming protein implements VLR-activated complement cytotoxicity in lamprey.

    PubMed

    Wu, Fenfang; Feng, Bo; Ren, Yong; Wu, Di; Chen, Yue; Huang, Shengfeng; Chen, Shangwu; Xu, Anlong

    2017-01-01

    Lamprey is a basal vertebrate with a unique adaptive immune system, which uses variable lymphocyte receptors (VLRs) for antigen recognition. Our previous study has shown that lamprey possessed a distinctive complement pathway activated by VLR. In this study, we identified a natterin family member-lamprey pore-forming protein (LPFP) with a jacalin-like lectin domain and an aerolysin-like pore-forming domain. LPFP had a high affinity with mannan and could form oligomer in the presence of mannan. LPFP could deposit on the surface of target cells, form pore-like complex resembling a wheel with hub and spokes, and mediate powerful cytotoxicity on target cells. These pore-forming proteins along with VLRs and complement molecules were essential for the specific cytotoxicity against exogenous pathogens and tumor cells. This unique cytotoxicity implemented by LPFP might emerge before or in parallel with the IgG-based classical complement lytic pathway completed by polyC9.

  16. Anopheles Midgut Epithelium Evades Human Complement Activity by Capturing Factor H from the Blood Meal

    PubMed Central

    Khattab, Ayman; Barroso, Marta; Miettinen, Tiera; Meri, Seppo

    2015-01-01

    Hematophagous vectors strictly require ingesting blood from their hosts to complete their life cycles. Exposure of the alimentary canal of these vectors to the host immune effectors necessitates efficient counteractive measures by hematophagous vectors. The Anopheles mosquito transmitting the malaria parasite is an example of hematophagous vectors that within seconds can ingest human blood double its weight. The innate immune defense mechanisms, like the complement system, in the human blood should thereby immediately react against foreign cells in the mosquito midgut. A prerequisite for complement activation is that the target cells lack complement regulators on their surfaces. In this work, we analyzed whether human complement is active in the mosquito midgut, and how the mosquito midgut cells protect themselves against complement attack. We found that complement remained active for a considerable time and was able to kill microbes within the mosquito midgut. However, the Anopheles mosquito midgut cells were not injured. These cells were found to protect themselves by capturing factor H, the main soluble inhibitor of the alternative complement pathway. Factor H inhibited complement on the midgut cells by promoting inactivation of C3b to iC3b and preventing the activity of the alternative pathway amplification C3 convertase enzyme. An interference of the FH regulatory activity by monoclonal antibodies, carried to the midgut via blood, resulted in increased mosquito mortality and reduced fecundity. By using a ligand blotting assay, a putative mosquito midgut FH receptor could be detected. Thereby, we have identified a novel mechanism whereby mosquitoes can tolerate human blood. PMID:25679788

  17. New Milestones Ahead in Complement-Targeted Therapy

    PubMed Central

    Ricklin, Daniel; Lambris, John D.

    2017-01-01

    The complement system is a powerful effector arm of innate immunity that typically confers protection from microbial intruders and accumulating debris. In many clinical situations, however, the defensive functions of complement can turn against host cells and induce or exacerbate immune, inflammatory, and degenerative conditions. Although the value of inhibiting complement in a therapeutic context has long been recognized, bringing complement-targeted drugs into clinical use has proved challenging. This important milestone was finally reached a decade ago, yet the clinical availability of complement inhibitors has remained limited. Still, the positive long-term experience with complement drugs and their proven effectiveness in various diseases has reinvigorated interest and confidence in this approach. Indeed, a broad variety of clinical candidates that act at almost any level of the complement activation cascade are currently in clinical development, with several of them being evaluated in phase 2 and phase 3 trials. With antibody-related drugs dominating the panel of clinical candidates, the emergence of novel small-molecule, peptide, protein, and oligonucleotide-based inhibitors offers new options for drug targeting and administration. Whereas all the currently approved and many of the proposed indications for complement-targeted inhibitors belong to the rare disease spectrum, these drugs are increasingly being evaluated for more prevalent conditions. Fortunately, the growing experience from preclinical and clinical use of therapeutic complement inhibitors has enabled a more evidence-based assessment of suitable targets and rewarding indications as well as related technical and safety considerations. This review highlights recent concepts and developments in complement-targeted drug discovery, provides an overview of current and emerging treatment options, and discusses the new milestones ahead on the way to the next generation of clinically available complement therapeutics. PMID:27321574

  18. Surface receptors on neutrophils and monocytes from immunodeficient and normal horses.

    PubMed Central

    Banks, K L; McGuire, T C

    1975-01-01

    Surface receptors on peripheral blood neutrophils and monocytes from normal and immunodeficient horses have been studied. Sheep erythrocytes (SRBC) coated with IgG, IgM, and complement but not IgG(T), readily bound to normal equine monocytes and neutrophils. More than 4000 molecules of IgG were required to sensitize each SRBC for adherence to monocytes, and more than 12,000 molecules were required for adherence to neutrophils. Young horses with a severe combined immunodeficiency had an almost total absence of lymphocytes, but normal numbers of monocytes and neutrophils. The number of receptors for immunoglobulin, complement, and phytolectin on monocytes and neutrophils from immunodeficient animals were similar to those on the cells of normal horses. Although the precursor cells of lymphocytes of horses with combined immunodeficiency appear to be defective, no defect in the other cellular products of the bone marrow were apparent. PMID:1126740

  19. Quantifying Intrinsic Specificity: A Potential Complement to Affinity in Drug Screening

    NASA Astrophysics Data System (ADS)

    Wang, Jin; Zheng, Xiliang; Yang, Yongliang; Drueckhammer, Dale; Yang, Wei; Verkhivker, Gennardy; Wang, Erkang

    2007-11-01

    We report here the investigation of a novel description of specificity in protein-ligand binding based on energy landscape theory. We define a new term, intrinsic specificity ratio (ISR), which describes the level of discrimination in binding free energies of the native basin for a protein-ligand complex from the weaker binding states of the same ligand. We discuss the relationship between the intrinsic specificity we defined here and the conventional definition of specificity. In a docking study of molecules with the enzyme COX-2, we demonstrate a statistical correspondence between ISR value and geometrical shapes of the small molecules binding to COX-2. We further observe that the known selective (nonselective) inhibitors of COX-2 have higher (lower) ISR values. We suggest that intrinsic specificity ratio may be a useful new criterion and a complement to affinity in drug screening and in searching for potential drug lead compounds.

  20. Guilty as charged: all available evidence implicates complement's role in fetal demise.

    PubMed

    Girardi, Guillermina

    2008-03-01

    Appropriate complement inhibition is an absolute requirement for normal pregancy. Uncontrolled complement activation in the maternal-fetal interface leads to fetal death. Here we show that complement activation is a crucial and early mediator of pregnancy loss in two different mouse models of pregnancy loss. Using a mouse model of fetal loss and growth restriction (IUGR) induced by antiphospholipid antibodies (aPL), we examined the role of complement activation in fetal loss and IUGR. We found that C5a-C5aR interaction and neutrophils are key mediators of fetal injury. Treatment with heparin, the standard therapy for pregnant patients with aPL, prevents complement activation and protects mice from pregnancy complications induced by aPL, and anticoagulants that do not inhibit complement do not protect pregnancies. In an antibody-independent mouse model of spontaneous miscarriage and IUGR (CBA/JxDBA/2) we also identified C5a as an essential mediator. Complement activation caused dysregulation of the angiogenic factors required for normal placental development. In CBA/JxDBA/2 mice, we observed inflammatory infiltrates in placentas, functional deficiency of free vascular endothelial growth factor (VEGF), elevated levels of soluble VEGF receptor-1 (sVEGFR-1, also known as sFlt-1; a potent anti-angiogenic molecule), and defective placental development. Inhibition of complement activation blocked the increase in sVEGFR-1 and rescued pregnancies. Our studies in antibody-dependent and antibody-independent models of pregnancy complications identified complement activation as the key mediator of damage and will allow development of new interventions to prevent pregnancy loss and IUGR.

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Multichannel modeling and two-photon coherent transfer paths in NaK

    NASA Astrophysics Data System (ADS)

    Schulze, T. A.; Temelkov, I. I.; Gempel, M. W.; Hartmann, T.; Knöckel, H.; Ospelkaus, S.; Tiemann, E.

    2013-08-01

    We explore possible pathways for the creation of ultracold polar NaK molecules in their absolute electronic and rovibrational ground state starting from ultracold Feshbach molecules. In particular, we present a multichannel analysis of the electronic ground and K(4p)+Na(3s) excited-state manifold of NaK, analyze the spin character of both the Feshbach molecular state and the electronically excited intermediate states and discuss possible coherent two-photon transfer paths from Feshbach molecules to rovibronic ground-state molecules. The theoretical study is complemented by the demonstration of stimulated Raman adiabatic passage from the X1Σ+(v=0) state to the a3Σ+ manifold on a molecular beam experiment.

  3. 75 FR 54374 - BOEMRE Information Collection Activity: 1010-0112, Performance Measures Data, Revision of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-07

    ... industry as a complement to current regulatory efforts to protect people and the environment during OCS oil... ______ ENVIRONMENT G. No. of EPA NPDES Noncompliances _________ H. For Oil Spills ... oil, gas, and sulphur resources; make such resources available to meet the Nation's energy needs as...

  4. Specificity of EIA immunoassay for complement factor Bb testing.

    PubMed

    Pavlov, Igor Y; De Forest, Nikol; Delgado, Julio C

    2011-01-01

    During the alternative complement pathway activation, factor B is cleaved in two fragments, Ba and Bb. Concentration of those fragments is about 2 logs lower than of factor B present in the blood, which makes fragment detection challenging because of potential cross-reactivity. Lack of information on Bb assay cross-reactivity stimulated the authors to investigate this issue. We ran 109 healthy donor EDTA plasmas and 80 sera samples with both factor B immunodiffusion (The Binding Site) and Quidel Bb EIA assays. During the study it was shown that physiological concentrations of gently purified factor B demonstrated approximately 0.15% cross-reactivity in the Quidel Bb EIA assay. We also observed that Bb concentration in serum is higher than in plasma due to complement activation during clot formation which let us use sera as samples representing complement activated state. Our study demonstrated that despite the potential 0.15% cross-reactivity between endogenous factor B and cleaved Bb molecule, measuring plasma concentrations of factor Bb is adequate to evaluate the activation of the alternative complement pathway.

  5. The Group B Streptococcus–Secreted Protein CIP Interacts with C4, Preventing C3b Deposition via the Lectin and Classical Complement Pathways

    PubMed Central

    Pietrocola, Giampiero; Rindi, Simonetta; Rosini, Roberto; Buccato, Scilla

    2016-01-01

    The group B Streptococcus (GBS) is a leading cause of neonatal invasive disease. GBS bacteria are surrounded by a thick capsular polysaccharide that is a potent inhibitor of complement deposition via the alternative pathway. Several of its surface molecules can however activate the classical and lectin complement pathways, rendering this species still vulnerable to phagocytic killing. In this study we have identified a novel secreted protein named complement interfering protein (CIP) that downregulates complement activation via the classical and lectin pathways, but not the alternative pathway. The CIP protein showed high affinity toward C4b and inhibited its interaction with C2, presumably preventing the formation of the C4bC2a convertase. Addition of recombinant CIP to GBS cip-negative bacteria resulted in decreased deposition of C3b on their surface and in diminished phagocytic killing in a whole-blood assay. Our data reveal a novel strategy exploited by GBS to counteract innate immunity and could be valuable for the development of anti-infective agents against this important pathogen. PMID:26608922

  6. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    PubMed Central

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-01-01

    Disordered proteins are highly prevalent in biological systems, they control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule:disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of-principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A). PMID:26507530

  7. Discovery of Small Molecules that Inhibit the Disordered Protein, p27 Kip1

    DOE PAGES

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; ...

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27 Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groupsmore » of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  8. Molecular characterization of the rhesus rhadinovirus (RRV) ORF4 gene and the RRV complement control protein it encodes.

    PubMed

    Mark, Linda; Spiller, O Brad; Okroj, Marcin; Chanas, Simon; Aitken, Jim A; Wong, Scott W; Damania, Blossom; Blom, Anna M; Blackbourn, David J

    2007-04-01

    The diversity of viral strategies to modulate complement activation indicates that this component of the immune system has significant antiviral potential. One example is the Kaposi's sarcoma-associated herpesvirus (KSHV) complement control protein (KCP), which inhibits progression of the complement cascade. Rhesus rhadinovirus (RRV), like KSHV, is a member of the subfamily Gammaherpesvirinae and currently provides the only in vivo model of KSHV pathobiology in primates. In the present study, we characterized the KCP homologue encoded by RRV, RRV complement control protein (RCP). Two strains of RRV have been sequenced to date (H26-95 and 17577), and the RCPs they encode differ substantially in structure: RCP from strain H26-95 has four complement control protein (CCP) domains, whereas RCP from strain 17577 has eight CCP domains. Transcriptional analyses of the RCP gene (ORF4, referred to herein as RCP) in infected rhesus macaque fibroblasts mapped the ends of the transcripts of both strains. They revealed that H26-95 encodes a full-length, unspliced RCP transcript, while 17577 RCP generates a full-length unspliced mRNA and two alternatively spliced transcripts. Western blotting confirmed that infected cells express RCP, and immune electron microscopy disclosed this protein on the surface of RRV virions. Functional studies of RCP encoded by both RRV strains revealed their ability to suppress complement activation by the classical (antibody-mediated) pathway. These data provide the foundation for studies into the biological significance of gammaherpesvirus complement regulatory proteins in a tractable, non-human primate model.

  9. Molecular Characterization of the Rhesus Rhadinovirus (RRV) ORF4 Gene and the RRV Complement Control Protein It Encodes▿

    PubMed Central

    Mark, Linda; Spiller, O. Brad; Okroj, Marcin; Chanas, Simon; Aitken, Jim A.; Wong, Scott W.; Damania, Blossom; Blom, Anna M.; Blackbourn, David J.

    2007-01-01

    The diversity of viral strategies to modulate complement activation indicates that this component of the immune system has significant antiviral potential. One example is the Kaposi's sarcoma-associated herpesvirus (KSHV) complement control protein (KCP), which inhibits progression of the complement cascade. Rhesus rhadinovirus (RRV), like KSHV, is a member of the subfamily Gammaherpesvirinae and currently provides the only in vivo model of KSHV pathobiology in primates. In the present study, we characterized the KCP homologue encoded by RRV, RRV complement control protein (RCP). Two strains of RRV have been sequenced to date (H26-95 and 17577), and the RCPs they encode differ substantially in structure: RCP from strain H26-95 has four complement control protein (CCP) domains, whereas RCP from strain 17577 has eight CCP domains. Transcriptional analyses of the RCP gene (ORF4, referred to herein as RCP) in infected rhesus macaque fibroblasts mapped the ends of the transcripts of both strains. They revealed that H26-95 encodes a full-length, unspliced RCP transcript, while 17577 RCP generates a full-length unspliced mRNA and two alternatively spliced transcripts. Western blotting confirmed that infected cells express RCP, and immune electron microscopy disclosed this protein on the surface of RRV virions. Functional studies of RCP encoded by both RRV strains revealed their ability to suppress complement activation by the classical (antibody-mediated) pathway. These data provide the foundation for studies into the biological significance of gammaherpesvirus complement regulatory proteins in a tractable, non-human primate model. PMID:17287274

  10. On-Chip Cellomics: Constructive Understanding of Multicellular Network Using On-Chip Cellomics Technology

    NASA Astrophysics Data System (ADS)

    Yasuda, Kenji

    2012-08-01

    We have developed methods and systems of analyzing epigenetic information in cells to expand our understanding of how living systems are determined. Because cells are minimum units reflecting epigenetic information, which is considered to map the history of a parallel-processing recurrent network of biochemical reactions, their behaviors cannot be explained by considering only conventional deonucleotide (DNA) information-processing events. The role of epigenetic information on cells, which complements their genetic information, was inferred by comparing predictions from genetic information with cell behaviour observed under conditions chosen to reveal adaptation processes and community effects. A system of analyzing epigenetic information, on-chip cellomics technology, has been developed starting from the twin complementary viewpoints of cell regulation as an “algebraic” system (emphasis on temporal aspects) and as a “geometric” system (emphasis on spatial aspects) exploiting microfabrication technology and a reconstructive approach of cellular systems not only for single cell-based subjects such as Escherichia coli and macrophages but also for cellular networks like the community effect of cardiomyocytes and plasticity in neuronal networks. One of the most important contributions of this study was to be able to reconstruct the concept of a cell regulatory network from the “local” (molecules expressed at certain times and places) to the “global” (the cell as a viable, functioning system). Knowledge of epigenetic information, which we can control and change during cell lives, complements the genetic variety, and these two types of information are indispensable for living organisms. This new knowlege has the potential to be the basis of cell-based biological and medical fields such as those involving cell-based drug screening and the regeneration of organs from stem cells.

  11. Vasohibin-1 is identified as a master-regulator of endothelial cell apoptosis using gene network analysis

    PubMed Central

    2013-01-01

    Background Apoptosis is a critical process in endothelial cell (EC) biology and pathology, which has been extensively studied at protein level. Numerous gene expression studies of EC apoptosis have also been performed, however few attempts have been made to use gene expression data to identify the molecular relationships and master regulators that underlie EC apoptosis. Therefore, we sought to understand these relationships by generating a Bayesian gene regulatory network (GRN) model. Results ECs were induced to undergo apoptosis using serum withdrawal and followed over a time course in triplicate, using microarrays. When generating the GRN, this EC time course data was supplemented by a library of microarray data from EC treated with siRNAs targeting over 350 signalling molecules. The GRN model proposed Vasohibin-1 (VASH1) as one of the candidate master-regulators of EC apoptosis with numerous downstream mRNAs. To evaluate the role played by VASH1 in EC, we used siRNA to reduce the expression of VASH1. Of 10 mRNAs downstream of VASH1 in the GRN that were examined, 7 were significantly up- or down-regulated in the direction predicted by the GRN.Further supporting an important biological role of VASH1 in EC, targeted reduction of VASH1 mRNA abundance conferred resistance to serum withdrawal-induced EC death. Conclusion We have utilised Bayesian GRN modelling to identify a novel candidate master regulator of EC apoptosis. This study demonstrates how GRN technology can complement traditional methods to hypothesise the regulatory relationships that underlie important biological processes. PMID:23324451

  12. Pneumococcal polysaccharides complexed with C3d bind to human B lymphocytes via complement receptor type 2.

    PubMed Central

    Griffioen, A W; Rijkers, G T; Janssens-Korpela, P; Zegers, B J

    1991-01-01

    The immunoregulatory function of the complement system has been the focus of many investigations. In particular, fragments of complement factor C3 have been shown to play a role in B-lymphocyte activation and proliferation, lymphokine production, and the generation of in vitro antibody production. Purified pneumococcal polysaccharides (PS) can induce direct activation of C3 via the alternative pathway. Using sera of C1q-deficient patients and healthy subjects, we demonstrated that C3d, a split product of C3 that is generated after degradation of iC3b, can be bound to PS antigens. The binding of C3d to PS can occur in the absence of specific antibodies. Subsequently, we showed that PS complexed with C3d can be recognized by complement receptor type 2 that is expressed on B cells. Treatment of B cells with a monoclonal antibody recognizing the C3d-binding site of complement receptor type 2 reduces the binding of PS-C3d to the cells. In addition, we showed that PS4 complexed with C3d exerted an increased immunogenicity compared with free PS4. Our results show that the complement system plays a role in the activation of PS-specific B cells, carrying membrane receptors for C3d. Consequently, the complement system plays a regulatory role in the antibody response to T-cell-independent type 2 antigens such as PS. PMID:1826897

  13. Factor H: A Complement Regulator in Health and Disease, and a Mediator of Cellular Interactions

    PubMed Central

    Kopp, Anne; Hebecker, Mario; Svobodová, Eliška; Józsi, Mihály

    2012-01-01

    Complement is an essential part of innate immunity as it participates in host defense against infections, disposal of cellular debris and apoptotic cells, inflammatory processes and modulation of adaptive immune responses. Several soluble and membrane-bound regulators protect the host from the potentially deleterious effects of uncontrolled and misdirected complement activation. Factor H is a major soluble regulator of the alternative complement pathway, but it can also bind to host cells and tissues, protecting them from complement attack. Interactions of factor H with various endogenous ligands, such as pentraxins, extracellular matrix proteins and DNA are important in limiting local complement-mediated inflammation. Impaired regulatory as well as ligand and cell recognition functions of factor H, caused by mutations or autoantibodies, are associated with the kidney diseases: atypical hemolytic uremic syndrome and dense deposit disease and the eye disorder: age-related macular degeneration. In addition, factor H binds to receptors on host cells and is involved in adhesion, phagocytosis and modulation of cell activation. In this review we discuss current concepts on the physiological and pathophysiological roles of factor H in light of new data and recent developments in our understanding of the versatile roles of factor H as an inhibitor of complement activation and inflammation, as well as a mediator of cellular interactions. A detailed knowledge of the functions of factor H in health and disease is expected to unravel novel therapeutic intervention possibilities and to facilitate the development or improvement of therapies. PMID:24970127

  14. Overexpression of adhesion molecules and barrier molecules is associated with differential infiltration of immune cells in non-small cell lung cancer.

    PubMed

    Chae, Young Kwang; Choi, Wooyoung M; Bae, William H; Anker, Jonathan; Davis, Andrew A; Agte, Sarita; Iams, Wade T; Cruz, Marcelo; Matsangou, Maria; Giles, Francis J

    2018-01-18

    Immunotherapy is emerging as a promising option for lung cancer treatment. Various endothelial adhesion molecules, such as integrin and selectin, as well as various cellular barrier molecules such as desmosome and tight junctions, regulate T-cell infiltration in the tumor microenvironment. However, little is known regarding how these molecules affect immune cells in patients with lung cancer. We demonstrated for the first time that overexpression of endothelial adhesion molecules and cellular barrier molecule genes was linked to differential infiltration of particular immune cells in non-small cell lung cancer. Overexpression of endothelial adhesion molecule genes is associated with significantly lower infiltration of activated CD4 and CD8 T-cells, but higher infiltration of activated B-cells and regulatory T-cells. In contrast, overexpression of desmosome genes was correlated with significantly higher infiltration of activated CD4 and CD8 T-cells, but lower infiltration of activated B-cells and regulatory T-cells in lung adenocarcinoma. This inverse relation of immune cells aligns with previous studies of tumor-infiltrating B-cells inhibiting T-cell activation. Although overexpression of endothelial adhesion molecule or cellular barrier molecule genes alone was not predictive of overall survival in our sample, these genetic signatures may serve as biomarkers of immune exclusion, or resistance to T-cell mediated immunotherapy.

  15. Small Molecule-Induced Complement Factor D (Adipsin) Promotes Lipid Accumulation and Adipocyte Differentiation

    PubMed Central

    Jang, Byung-Hyun; Chang, Seo-Hyuk; Yun, Ui Jeong; Park, Ki-Moon; Waki, Hironori; Li, Dean Y.; Tontonoz, Peter; Park, Kye Won

    2016-01-01

    Adipocytes are differentiated by various transcriptional cascades integrated on the master regulator, Pparγ. To discover new genes involved in adipocyte differentiation, preadipocytes were treated with three newly identified pro-adipogenic small molecules and GW7845 (a Pparγ agonist) for 24 hours and transcriptional profiling was analyzed. Four genes, Peroxisome proliferator-activated receptor γ (Pparγ), human complement factor D homolog (Cfd), Chemokine (C-C motif) ligand 9 (Ccl9), and GIPC PDZ Domain Containing Family Member 2 (Gipc2) were induced by at least two different small molecules but not by GW7845. Cfd and Ccl9 expressions were specific to adipocytes and they were altered in obese mice. Small hairpin RNA (shRNA) mediated knockdown of Cfd in preadipocytes inhibited lipid accumulation and expression of adipocyte markers during adipocyte differentiation. Overexpression of Cfd promoted adipocyte differentiation, increased C3a production, and led to induction of C3a receptor (C3aR) target gene expression. Similarly, treatments with C3a or C3aR agonist (C4494) also promoted adipogenesis. C3aR knockdown suppressed adipogenesis and impaired the pro-adipogenic effects of Cfd, further suggesting the necessity for C3aR signaling in Cfd-mediated pro-adipogenic axis. Together, these data show the action of Cfd in adipogenesis and underscore the application of small molecules to identify genes in adipocytes. PMID:27611793

  16. Moonlighting of Helicobacter pylori catalase protects against complement-mediated killing by utilising the host molecule vitronectin

    PubMed Central

    Richter, Corinna; Mukherjee, Oindrilla; Ermert, David; Singh, Birendra; Su, Yu-Ching; Agarwal, Vaibhav; Blom, Anna M.; Riesbeck, Kristian

    2016-01-01

    Helicobacter pylori is an important human pathogen and a common cause of peptic ulcers and gastric cancer. Despite H. pylori provoking strong innate and adaptive immune responses, the bacterium is able to successfully establish long-term infections. Vitronectin (Vn), a component of both the extracellular matrix and plasma, is involved in many physiological processes, including regulation of the complement system. The aim of this study was to define a receptor in H. pylori that binds Vn and determine the significance of the interaction for virulence. Surprisingly, by using proteomics, we found that the hydrogen peroxide-neutralizing enzyme catalase KatA is a major Vn-binding protein. Deletion of the katA gene in three different strains resulted in impaired binding of Vn. Recombinant KatA was generated and shown to bind with high affinity to a region between heparin-binding domain 2 and 3 of Vn that differs from previously characterised bacterial binding sites on the molecule. In terms of function, KatA protected H. pylori from complement-mediated killing in a Vn-dependent manner. Taken together, the virulence factor KatA is a Vn-binding protein that moonlights on the surface of H. pylori to promote bacterial evasion of host innate immunity. PMID:27087644

  17. Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  18. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  19. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    DOEpatents

    Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

    2014-05-27

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  20. Regulation of WNT Signaling at the Neuromuscular Junction by the Immunoglobulin Superfamily Protein RIG-3 in Caenorhabditis elegans

    PubMed Central

    Pandey, Pratima; Bhardwaj, Ashwani; Babu, Kavita

    2017-01-01

    Perturbations in synaptic function could affect the normal behavior of an animal, making it important to understand the regulatory mechanisms of synaptic signaling. Previous work has shown that in Caenorhabditis elegans an immunoglobulin superfamily protein, RIG-3, functions in presynaptic neurons to maintain normal acetylcholine receptor levels at the neuromuscular junction (NMJ). In this study, we elucidate the molecular and functional mechanism of RIG-3. We demonstrate by genetic and BiFC (Bi-molecular Fluorescence Complementation) assays that presynaptic RIG-3 functions by directly interacting with the immunoglobulin domain of the nonconventional Wnt receptor, ROR receptor tyrosine kinase (RTK), CAM-1, which functions in postsynaptic body-wall muscles. This interaction in turn inhibits Wnt/LIN-44 signaling through the ROR/CAM-1 receptor, and allows for maintenance of normal acetylcholine receptor, AChR/ACR-16, levels at the neuromuscular synapse. Further, this work reveals that RIG-3 and ROR/CAM-1 function through the β-catenin/HMP-2 at the NMJ. Taken together, our results demonstrate that RIG-3 functions as an inhibitory molecule of the Wnt/LIN-44 signaling pathway through the RTK, CAM-1. PMID:28515212

  1. Medicinal leech therapy-an overall perspective.

    PubMed

    Sig, Ali K; Guney, Mustafa; Uskudar Guclu, Aylin; Ozmen, Erkan

    2017-12-01

    Complementary medicine methods have a long history, but modern medicine has just recently focused on their possible modes of action. Medicinal leech therapy (MLT) or hirudotherapy, an old technique, has been studied by many researchers for possible effects on various diseases such as inflammatory diseases, osteoarthritis, and after different surgeries. Hirudo medicinalis has widest therapeutic usage among the leeches, but worldwide, many different species were tested and studied. Leeches secrete more than 20 identified bioactive substances such as antistasin, eglins, guamerin, hirudin, saratin, bdellins, complement, and carboxypeptidase inhibitors. They have analgesic, anti-inflammatory, platelet inhibitory, anticoagulant, and thrombin regulatory functions, as well as extracellular matrix degradative and antimicrobial effects, but with further studies, the spectrum of effects may widen. The technique is cheap, effective, easy to apply, and its modes of action have been elucidated for certain diseases. In conclusion, for treatment of some diseases, MLT is not an alternative, but is a complementary and/or integrative choice. MLT is a part of multidisciplinary treatments, and secretes various bioactive substances. These substances vary among species and different species should be evaluated for both treatment capability and their particular secreted molecules. There is huge potential for novel substances and these could be future therapeutics.

  2. Evaluation of genotoxicity testing of FDA approved large molecule therapeutics.

    PubMed

    Sawant, Satin G; Fielden, Mark R; Black, Kurt A

    2014-10-01

    Large molecule therapeutics (MW>1000daltons) are not expected to enter the cell and thus have reduced potential to interact directly with DNA or related physiological processes. Genotoxicity studies are therefore not relevant and typically not required for large molecule therapeutic candidates. Regulatory guidance supports this approach; however there are examples of marketed large molecule therapeutics where sponsors have conducted genotoxicity studies. A retrospective analysis was performed on genotoxicity studies of United States FDA approved large molecule therapeutics since 1998 identified through the Drugs@FDA website. This information was used to provide a data-driven rationale for genotoxicity evaluations of large molecule therapeutics. Fifty-three of the 99 therapeutics identified were tested for genotoxic potential. None of the therapeutics tested showed a positive outcome in any study except the peptide glucagon (GlucaGen®) showing equivocal in vitro results, as stated in the product labeling. Scientific rationale and data from this review indicate that testing of a majority of large molecule modalities do not add value to risk assessment and support current regulatory guidance. Similarly, the data do not support testing of peptides containing only natural amino acids. Peptides containing non-natural amino acids and small molecules in conjugated products may need to be tested. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Bimolecular fluorescence complementation (BiFC) analysis as a probe of protein interactions in living cells.

    PubMed

    Kerppola, Tom K

    2008-01-01

    Protein interactions are a fundamental mechanism for the generation of biological regulatory specificity. The study of protein interactions in living cells is of particular significance because the interactions that occur in a particular cell depend on the full complement of proteins present in the cell and the external stimuli that influence the cell. Bimolecular fluorescence complementation (BiFC) analysis enables direct visualization of protein interactions in living cells. The BiFC assay is based on the association between two nonfluorescent fragments of a fluorescent protein when they are brought in proximity to each other by an interaction between proteins fused to the fragments. Numerous protein interactions have been visualized using the BiFC assay in many different cell types and organisms. The BiFC assay is technically straightforward and can be performed using standard molecular biology and cell culture reagents and a regular fluorescence microscope or flow cytometer.

  4. From orphan drugs to adopted therapies: Advancing C3-targeted intervention to the clinical stage

    PubMed Central

    Mastellos, Dimitrios C.; Reis, Edimara S.; Yancopoulou, Despina; Hajishengallis, George; Ricklin, Daniel; Lambris, John D.

    2016-01-01

    Complement dysregulation is increasingly recognized as an important pathogenic driver in a number of clinical disorders. Complement-triggered pathways intertwine with key inflammatory and tissue destructive processes that can either increase the risk of disease or exacerbate pathology in acute or chronic conditions. The launch of the first complement-targeted drugs in the clinic has undeniably stirred the field of complement therapeutic design, providing new insights into complement's contribution to disease pathogenesis and also helping to leverage a more personalized, comprehensive approach to patient management. In this regard, a rapidly expanding toolbox of complement therapeutics is being developed to address unmet clinical needs in several immune-mediated and inflammatory diseases. Elegant approaches employing both surface-directed and fluid-phase inhibitors have exploited diverse components of the complement cascade as putative points of therapeutic intervention. Targeting C3, the central hub of the system, has proven to be a promising strategy for developing biologics as well as small-molecule inhibitors with clinical potential. Complement modulation at the level of C3 has recently shown promise in preclinical primate models, opening up new avenues for therapeutic intervention in both acute and chronic indications fueled by uncontrolled C3 turnover. This review highlights recent developments in the field of complement therapeutics, focusing on C3-directed inhibitors and alternative pathway (AP) regulator-based approaches. Translational perspectives and considerations are discussed, particularly with regard to the structure-guided drug optimization and clinical advancement of a new generation of C3-targeted peptidic inhibitors. PMID:27353192

  5. When the model fits the frame: the impact of regulatory fit on efficacy appraisal and persuasion in health communication.

    PubMed

    Bosone, Lucia; Martinez, Frédéric; Kalampalikis, Nikos

    2015-04-01

    In health-promotional campaigns, positive and negative role models can be deployed to illustrate the benefits or costs of certain behaviors. The main purpose of this article is to investigate why, how, and when exposure to role models strengthens the persuasiveness of a message, according to regulatory fit theory. We argue that exposure to a positive versus a negative model activates individuals' goals toward promotion rather than prevention. By means of two experiments, we demonstrate that high levels of persuasion occur when a message advertising healthy dietary habits offers a regulatory fit between its framing and the described role model. Our data also establish that the effects of such internal regulatory fit by vicarious experience depend on individuals' perceptions of response-efficacy and self-efficacy. Our findings constitute a significant theoretical complement to previous research on regulatory fit and contain valuable practical implications for health-promotional campaigns. © 2015 by the Society for Personality and Social Psychology, Inc.

  6. Non-random distribution and co-localization of purine/pyrimidine-encoded information and transcriptional regulatory domains.

    PubMed

    Povinelli, C M

    1992-01-01

    In order to detect sequence-based information predictive for the location of eukaryotic transcriptional regulatory domains, the frequencies and distributions of the 36 possible purine/pyrimidine reverse complement hexamer pairs was determined for test sets of real and random sequences. The distribution of one of the hexamer pairs (RRYYRR/YYRRYY, referred to as M1) was further examined in a larger set of sequences (> 32 genes, 230 kb). Predominant clusters of M1 and the locations of eukaryotic transcriptional regulatory domains were found to be associated and non-randomly distributed along the DNA consistent with a periodicity of approximately 1.2 kb. In the context of higher ordered chromatin this would align promoters, enhancers and the predominant clusters of M1 longitudinally along one face of a 30 nm fiber. Using only information about the distribution of the M1 motif, 50-70% of a sequence could be eliminated as being unlikely to contain transcriptional regulatory domains with an 87% recovery of the regulatory domains present.

  7. The Molecule Pages database

    PubMed Central

    Saunders, Brian; Lyon, Stephen; Day, Matthew; Riley, Brenda; Chenette, Emily; Subramaniam, Shankar

    2008-01-01

    The UCSD-Nature Signaling Gateway Molecule Pages (http://www.signaling-gateway.org/molecule) provides essential information on more than 3800 mammalian proteins involved in cellular signaling. The Molecule Pages contain expert-authored and peer-reviewed information based on the published literature, complemented by regularly updated information derived from public data source references and sequence analysis. The expert-authored data includes both a full-text review about the molecule, with citations, and highly structured data for bioinformatics interrogation, including information on protein interactions and states, transitions between states and protein function. The expert-authored pages are anonymously peer reviewed by the Nature Publishing Group. The Molecule Pages data is present in an object-relational database format and is freely accessible to the authors, the reviewers and the public from a web browser that serves as a presentation layer. The Molecule Pages are supported by several applications that along with the database and the interfaces form a multi-tier architecture. The Molecule Pages and the Signaling Gateway are routinely accessed by a very large research community. PMID:17965093

  8. The Molecule Pages database.

    PubMed

    Saunders, Brian; Lyon, Stephen; Day, Matthew; Riley, Brenda; Chenette, Emily; Subramaniam, Shankar; Vadivelu, Ilango

    2008-01-01

    The UCSD-Nature Signaling Gateway Molecule Pages (http://www.signaling-gateway.org/molecule) provides essential information on more than 3800 mammalian proteins involved in cellular signaling. The Molecule Pages contain expert-authored and peer-reviewed information based on the published literature, complemented by regularly updated information derived from public data source references and sequence analysis. The expert-authored data includes both a full-text review about the molecule, with citations, and highly structured data for bioinformatics interrogation, including information on protein interactions and states, transitions between states and protein function. The expert-authored pages are anonymously peer reviewed by the Nature Publishing Group. The Molecule Pages data is present in an object-relational database format and is freely accessible to the authors, the reviewers and the public from a web browser that serves as a presentation layer. The Molecule Pages are supported by several applications that along with the database and the interfaces form a multi-tier architecture. The Molecule Pages and the Signaling Gateway are routinely accessed by a very large research community.

  9. A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons.

    PubMed

    Li, Shu-Jing; Vaughan, Alexander; Sturgill, James Fitzhugh; Kepecs, Adam

    2018-06-06

    Retrogradely transported neurotropic viruses enable genetic access to neurons based on their long-range projections and have become indispensable tools for linking neural connectivity with function. A major limitation of viral techniques is that they rely on cell-type-specific molecules for uptake and transport. Consequently, viruses fail to infect variable subsets of neurons depending on the complement of surface receptors expressed (viral tropism). We report a receptor complementation strategy to overcome this by potentiating neurons for the infection of the virus of interest-in this case, canine adenovirus type-2 (CAV-2). We designed AAV vectors for expressing the coxsackievirus and adenovirus receptor (CAR) throughout candidate projection neurons. CAR expression greatly increased retrograde-labeling rates, which we demonstrate for several long-range projections, including some resistant to other retrograde-labeling techniques. Our results demonstrate a receptor complementation strategy to abrogate endogenous viral tropism and thereby facilitate efficient retrograde targeting for functional analysis of neural circuits. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Molecular targets for small-molecule modulators of circadian clocks

    PubMed Central

    He, Baokun; Chen, Zheng

    2016-01-01

    Background Circadian clocks are endogenous timing systems that regulate various aspects of mammalian metabolism, physiology and behavior. Traditional chronotherapy refers to the administration of drugs in a defined circadian time window to achieve optimal pharmacokinetic and therapeutic efficacies. In recent years, substantial efforts have been dedicated to developing novel small-molecule modulators of circadian clocks. Methods Here, we review the recent progress in the identification of molecular targets of small-molecule clock modulators and their efficacies in clock-related disorders. Specifically, we examine the clock components and regulatory factors as possible molecular targets of small molecules, and we review several key clock-related disorders as promising venues for testing the preventive/therapeutic efficacies of these small molecules. Finally, we also discuss circadian regulation of drug metabolism. Results Small molecules can modulate the period, phase and/or amplitude of the circadian cycle. Core clock proteins, nuclear hormone receptors, and clock-related kinases and other epigenetic regulators are promising molecular targets for small molecules. Through these targets small molecules exert protective effects against clock-related disorders including the metabolic syndrome, immune disorders, sleep disorders and cancer. Small molecules can also modulate circadian drug metabolism and response to existing therapeutics. Conclusion Small-molecule clock modulators target clock components or diverse cellular pathways that functionally impinge upon the clock. Target identification of new small-molecule modulators will deepen our understanding of key regulatory nodes in the circadian network. Studies of clock modulators will facilitate their therapeutic applications, alone or in combination, for clock-related diseases. PMID:26750111

  11. Automatic reconstruction of a bacterial regulatory network using Natural Language Processing

    PubMed Central

    Rodríguez-Penagos, Carlos; Salgado, Heladia; Martínez-Flores, Irma; Collado-Vides, Julio

    2007-01-01

    Background Manual curation of biological databases, an expensive and labor-intensive process, is essential for high quality integrated data. In this paper we report the implementation of a state-of-the-art Natural Language Processing system that creates computer-readable networks of regulatory interactions directly from different collections of abstracts and full-text papers. Our major aim is to understand how automatic annotation using Text-Mining techniques can complement manual curation of biological databases. We implemented a rule-based system to generate networks from different sets of documents dealing with regulation in Escherichia coli K-12. Results Performance evaluation is based on the most comprehensive transcriptional regulation database for any organism, the manually-curated RegulonDB, 45% of which we were able to recreate automatically. From our automated analysis we were also able to find some new interactions from papers not already curated, or that were missed in the manual filtering and review of the literature. We also put forward a novel Regulatory Interaction Markup Language better suited than SBML for simultaneously representing data of interest for biologists and text miners. Conclusion Manual curation of the output of automatic processing of text is a good way to complement a more detailed review of the literature, either for validating the results of what has been already annotated, or for discovering facts and information that might have been overlooked at the triage or curation stages. PMID:17683642

  12. Solving the problems we face: the United States Environmental Protection Agency, sustainability, and the challenges of the twenty-first century

    EPA Science Inventory

    Addressing the problems of the twenty-first century will require new initiatives that complement traditional regulatory activities. Existing regulations, such as the Clean Air Act and Clean Water Act are important safety nets in the United States for protecting human health and t...

  13. A Model Formative Assessment Strategy to Promote Student-Centered Self-Regulated Learning in Higher Education

    ERIC Educational Resources Information Center

    Bose, Jayakumar; Rengel, Zed

    2009-01-01

    Adult learners are already involved in the process of self-regulation; hence, higher education institutions should focus on strengthening students' self-regulatory skills. Self-regulation can be facilitated through formative assessment. This paper proposes a model formative assessment strategy that would complement existing university teaching,…

  14. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

  15. DNA Sequence Variants in PPARGC1A, a Gene Encoding a Coactivator of the ω-3 LCPUFA Sensing PPAR-RXR Transcription Complex, Are Associated with NV AMD and AMD-Associated Loci in Genes of Complement and VEGF Signaling Pathways

    PubMed Central

    SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M.; Stahl, Andreas; Clemons, Traci E.; Chew, Emily Y.; Smith, Lois E. H.

    2013-01-01

    Background Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). Methods We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. Results A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (P<0.005) with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P≤0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P≤0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice – these animals also showed 70% reduction in retinal NV (P≤0.001). Conclusion Ligands and co-activators of the ω-3 LCPUFA sensing PPAR-RXR axis may influence retinal angiogenesis in NV AMD via the complement and VEGF signaling systems. We have linked the co-activator of a lipid-sensing transcription factor (PPARG co-activator 1 alpha, PPARGC1A) to age-related macular degeneration (AMD) and AMD-associated genes. PMID:23335958

  16. 2015 White Paper on recent issues in bioanalysis: focus on new technologies and biomarkers (Part 1 - small molecules by LCMS).

    PubMed

    Welink, Jan; Fluhler, Eric; Hughes, Nicola; Arnold, Mark; Garofolo, Fabio; Bustard, Mark; Coppola, Laura; Dhodda, Raj; Evans, Christopher; Gleason, Carol; Haidar, Sam; Hayes, Roger; Heinig, Katja; Katori, Noriko; Blaye, Olivier Le; Li, Wenkui; Liu, Guowen; Lima Santos, Gustavo Mendes; Meng, Min; Nicholson, Bob; Savoie, Natasha; Skelly, Michael; Sojo, Luis; Tampal, Nilufer; de Merbel, Nico van; Verhaeghe, Tom; Vinter, Stephen; Wickremsinhe, Enaksha; Whale, Emma; Wilson, Amanda; Witte, Bärbel; Woolf, Eric

    2015-01-01

    The 2015 9th Workshop on Recent Issues in Bioanalysis (9th WRIB) took place in Miami, Florida with participation of over 600 professionals from pharmaceutical and biopharmaceutical companies, biotechnology companies, contract research organizations and regulatory agencies worldwide. It is once again a 5-day week long event - a full immersion bioanalytical week - specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest in bioanalysis. The topics covered included both small and large molecules, and involved LCMS, hybrid LBA/LCMS, LBA approaches including the focus on biomarkers and immunogenicity. This 2015 White Paper encompasses recommendations that emerged from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to advance scientific excellence, improve quality and deliver better regulatory compliance. Due to its length, the 2015 edition of this comprehensive White Paper has been divided into three parts. Part 1 covers the recommendations for small molecule bioanalysis using LCMS. Part 2 (hybrid LBA/LCMS and regulatory agencies' inputs) and Part 3 (large molecule bioanalysis using LBA, biomarkers and immunogenicity) will also be published in volume 7 of Bioanalysis, issues 23 and 24, respectively.

  17. Audio visual summary: Implementing PURPA in Mid-America

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The audio-visual presentation, Implementing PURPA in Mid-America, is a slide presentation designed to complement deliverable W-101-2, a booklet entitled Implementing PURPA in Mid-America: A Guide to the Public Utility Regulatory Policies Act. The presentation lasts 10 to 12 min and explains the major sections of PURPA, the rules promulgated by the Federal Energy Regulatory Commission to implement PURPA, and the implications of PURPA and its rules. It delineates the rights and responsibilities of citizens who want to sell electricity to utilities, explains the certification process, and discusses the rights and responsibilities of the utilities.

  18. Novel fusion protein approach for efficient high-throughput screening of small molecule-mediating protein-protein interactions in cells and living animals.

    PubMed

    Paulmurugan, Ramasamy; Gambhir, Sanjiv S

    2005-08-15

    Networks of protein interactions execute many different intracellular pathways. Small molecules either synthesized within the cell or obtained from the external environment mediate many of these protein-protein interactions. The study of these small molecule-mediated protein-protein interactions is important in understanding abnormal signal transduction pathways in a variety of disorders, as well as in optimizing the process of drug development and validation. In this study, we evaluated the rapamycin-mediated interaction of the human proteins FK506-binding protein (FKBP12) rapamycin-binding domain (FRB) and FKBP12 by constructing a fusion of these proteins with a split-Renilla luciferase or a split enhanced green fluorescent protein (split-EGFP) such that complementation of the reporter fragments occurs in the presence of rapamycin. Different linker peptides in the fusion protein were evaluated for the efficient maintenance of complemented reporter activity. This system was studied in both cell culture and xenografts in living animals. We found that peptide linkers with two or four EAAAR repeat showed higher protein-protein interaction-mediated signal with lower background signal compared with having no linker or linkers with amino acid sequences GGGGSGGGGS, ACGSLSCGSF, and ACGSLSCGSFACGSLSCGSF. A 9 +/- 2-fold increase in signal intensity both in cell culture and in living mice was seen compared with a system that expresses both reporter fragments and the interacting proteins separately. In this fusion system, rapamycin induced heterodimerization of the FRB and FKBP12 moieties occurred rapidly even at very lower concentrations (0.00001 nmol/L) of rapamycin. For a similar fusion system employing split-EGFP, flow cytometry analysis showed significant level of rapamycin-induced complementation.

  19. Fusobacterium nucleatum binding to complement regulatory protein CD46 modulates the expression and secretion of cytokines and matrix metalloproteinases by oral epithelial cells.

    PubMed

    Mahtout, Hayette; Chandad, Fatiha; Rojo, Jose M; Grenier, Daniel

    2011-02-01

    Periodontitis is a chronic inflammatory disease that results in the destruction of the supporting tissues of the teeth. Gingival epithelial cells are an important mechanical barrier and participate in the host inflammatory response to periodontopathogens. The aim of the present study is to investigate the capacity of Fusobacterium nucleatum to bind to the complement regulatory protein CD46 expressed by oral epithelial cells and to determine the impact of the binding on the gene expression and protein secretion of interleukin (IL)-6, IL-8, and matrix metalloproteinase (MMP)-9 by oral epithelial cells. Binding of recombinant human CD46 to the surface of F. nucleatum was demonstrated by immunologic assays. After stimulation of oral epithelial cells with F. nucleatum, gene expression was determined by real-time polymerase chain reaction analysis while protein secretion was monitored by enzyme-linked immunosorbent assays. Heat and protease treatments of bacterial cells reduced CD46 binding. F. nucleatum-bound CD46 mediated the cleavage of C3b in the presence of factor I. Stimulating oral epithelial cells with F. nucleatum at a multiplicity of infection of 50 resulted in a significant upregulation of the gene expression and protein secretion of IL-6, IL-8, and MMP-9 by oral epithelial cells. However, pretreating the epithelial cells with an anti-CD46 polyclonal antibody attenuated the production of IL-6, IL-8, and MMP-9 in response to F. nucleatum. Such an inhibitory effect was not observed with non-specific antibodies. The present study demonstrates that F. nucleatum can bind the complement regulatory protein CD46. The interaction of F. nucleatum with epithelial cell surface CD46 may contribute to increasing the levels of proinflammatory mediators and MMPs in periodontal sites and consequently modulate tissue destruction.

  20. 2017 White Paper on recent issues in bioanalysis: aren't BMV guidance/guidelines 'Scientific'? (Part 1 - LCMS: small molecules, peptides and small molecule biomarkers).

    PubMed

    Welink, Jan; Yang, Eric; Hughes, Nicola; Rago, Brian; Woolf, Eric; Sydor, Jens; Coppola, Laura; Ackermann, Brad; Li, Wenkui; Alley, Stephen C; Arnold, Mark; Berger, Isabella; Briscoe, Chad; Buonarati, Michael; Bustard, Mark; Cancilla, Mark; Cho, Seongeun Julia; Duggan, Jeff; Fraier, Daniela; Garofolo, Fabio; Green, Rachel; Haidar, Sam; Hittle, Lucinda; Ishii-Watabe, Akiko; Islam, Rafiq; Jenkins, Rand; Jones, Barry; Kadavil, John; Kassim, Sean; Kavetska, Olga; Blaye, Olivier Le; Lee, Anita; Liu, Hanlan; Mehl, John; Lima Santos, Gustavo Mendes; Musuku, Adrien; Ramanathan, Ragu; Saito, Yoshiro; Savoie, Natasha; Summerfield, Scott; Surapaneni, Sekhar; Szapacs, Matthew; Tampal, Nilufer; Verhaeghe, Tom; Vinter, Stephen; Whale, Emma

    2017-11-01

    The 2017 11th Workshop on Recent Issues in Bioanalysis (11th WRIB) took place in Los Angeles/Universal City, California from 3 April 2017 to 7 April 2017 with participation of close to 750 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations and regulatory agencies worldwide. WRIB was once again a 5-day, weeklong event - A Full Immersion Week of Bioanalysis, Biomarkers and Immunogenicity. As usual, it was specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small and large molecule analysis involving LCMS, hybrid LBA/LCMS and ligand-binding assay (LBA) approaches. This 2017 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. Due to its length, the 2017 edition of this comprehensive White Paper has been divided into three parts for editorial reasons. This publication (Part 1) covers the recommendations for Small Molecules, Peptides and Small Molecule Biomarkers using LCMS. Part 2 (Biotherapeutics, Biomarkers and Immunogenicity Assays using Hybrid LBA/LCMS and Regulatory Agencies' Inputs) and Part 3 (LBA: Immunogenicity, Biomarkers and PK Assays) are published in volume 9 of Bioanalysis, issues 23 and 24 (2017), respectively.

  1. Spontaneous abortion is associated with elevated systemic C5a and reduced mRNA of complement inhibitory proteins in placenta

    PubMed Central

    Banadakoppa, M; Chauhan, M S; Havemann, D; Balakrishnan, M; Dominic, J S; Yallampalli, C

    2014-01-01

    Spontaneous abortion in early pregnancy due to unknown reasons is a common problem. The excess complement activation and consequent placental inflammation and anti-angiogenic milieu is emerging as an important associated factor in many pregnancy-related complications. In the present study we sought to examine the expression of complement inhibitory proteins at the feto–maternal interface and levels of complement split products in the circulation to understand their role in spontaneous abortion. Consenting pregnant women who either underwent elective abortion due to non-clinical reasons (n = 13) or suffered miscarriage (n = 14) were recruited for the study. Systemic levels of complement factors C3a and C5a were measured by enzyme-linked immunosorbent assay (ELISA). Plasma C5 and C3 protein levels were examined by Western blot. Expressions of complement regulatory proteins such as CD46 and CD55 in the decidua were investigated by quantitative polymerase chain reaction (PCR) and Western blot. The median of plasma C3a level was 82·83 ng/ml and 66·17 ng/ml in elective and spontaneous abortion patients, respectively. Medians of plasma C5a levels in elective and spontaneous abortion patients were 0·96 ng/ml and 1·14 ng/ml, respectively. Only plasma C5a levels but not C3a levels showed significant elevation in spontaneous abortion patients compared to elective abortion patients. Further, there was a threefold decrease in the mRNA expressions of complement inhibitory proteins CD46 and CD55 in the decidua obtained from spontaneous abortion patients compared to that of elective abortion patients. These data suggested that dysregulated complement cascade may be associated with spontaneous abortion. PMID:24802103

  2. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression.

    PubMed

    Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya

    2008-07-16

    Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.

  3. The Group B Streptococcus-Secreted Protein CIP Interacts with C4, Preventing C3b Deposition via the Lectin and Classical Complement Pathways.

    PubMed

    Pietrocola, Giampiero; Rindi, Simonetta; Rosini, Roberto; Buccato, Scilla; Speziale, Pietro; Margarit, Immaculada

    2016-01-01

    The group B Streptococcus (GBS) is a leading cause of neonatal invasive disease. GBS bacteria are surrounded by a thick capsular polysaccharide that is a potent inhibitor of complement deposition via the alternative pathway. Several of its surface molecules can however activate the classical and lectin complement pathways, rendering this species still vulnerable to phagocytic killing. In this study we have identified a novel secreted protein named complement interfering protein (CIP) that downregulates complement activation via the classical and lectin pathways, but not the alternative pathway. The CIP protein showed high affinity toward C4b and inhibited its interaction with C2, presumably preventing the formation of the C4bC2a convertase. Addition of recombinant CIP to GBS cip-negative bacteria resulted in decreased deposition of C3b on their surface and in diminished phagocytic killing in a whole-blood assay. Our data reveal a novel strategy exploited by GBS to counteract innate immunity and could be valuable for the development of anti-infective agents against this important pathogen. Copyright © 2015 by The American Association of Immunologists, Inc.

  4. Variola virus immune evasion design: expression of a highly efficient inhibitor of human complement.

    PubMed

    Rosengard, Ariella M; Liu, Yu; Nie, Zhiping; Jimenez, Robert

    2002-06-25

    Variola virus, the most virulent member of the genus Orthopoxvirus, specifically infects humans and has no other animal reservoir. Variola causes the contagious disease smallpox, which has a 30-40% mortality rate. Conversely, the prototype orthopoxvirus, vaccinia, causes no disease in immunocompetent humans and was used in the global eradication of smallpox, which ended in 1977. However, the threat of smallpox persists because clandestine stockpiles of variola still exist. Although variola and vaccinia share remarkable DNA homology, the strict human tropism of variola suggests that its proteins are better suited than those of vaccinia to overcome the human immune response. Here, we demonstrate the functional advantage of a variola complement regulatory protein over that of its vaccinia homologue. Because authentic variola proteins are not available for study, we molecularly engineered and characterized the smallpox inhibitor of complement enzymes (SPICE), a homologue of a vaccinia virulence factor, vaccinia virus complement control protein (VCP). SPICE is nearly 100-fold more potent than VCP at inactivating human C3b and 6-fold more potent at inactivating C4b. SPICE is also more human complement-specific than is VCP. By inactivating complement components, SPICE serves to inhibit the formation of the C3/C5 convertases necessary for complement-mediated viral clearance. SPICE provides the first evidence that variola proteins are particularly adept at overcoming human immunity, and the decreased function of VCP suggests one reason why the vaccinia virus vaccine was associated with relatively low mortality. Disabling SPICE may be therapeutically useful if smallpox reemerges.

  5. Variola virus immune evasion design: Expression of a highly efficient inhibitor of human complement

    PubMed Central

    Rosengard, Ariella M.; Liu, Yu; Nie, Zhiping; Jimenez, Robert

    2002-01-01

    Variola virus, the most virulent member of the genus Orthopoxvirus, specifically infects humans and has no other animal reservoir. Variola causes the contagious disease smallpox, which has a 30–40% mortality rate. Conversely, the prototype orthopoxvirus, vaccinia, causes no disease in immunocompetent humans and was used in the global eradication of smallpox, which ended in 1977. However, the threat of smallpox persists because clandestine stockpiles of variola still exist. Although variola and vaccinia share remarkable DNA homology, the strict human tropism of variola suggests that its proteins are better suited than those of vaccinia to overcome the human immune response. Here, we demonstrate the functional advantage of a variola complement regulatory protein over that of its vaccinia homologue. Because authentic variola proteins are not available for study, we molecularly engineered and characterized the smallpox inhibitor of complement enzymes (SPICE), a homologue of a vaccinia virulence factor, vaccinia virus complement control protein (VCP). SPICE is nearly 100-fold more potent than VCP at inactivating human C3b and 6-fold more potent at inactivating C4b. SPICE is also more human complement-specific than is VCP. By inactivating complement components, SPICE serves to inhibit the formation of the C3/C5 convertases necessary for complement-mediated viral clearance. SPICE provides the first evidence that variola proteins are particularly adept at overcoming human immunity, and the decreased function of VCP suggests one reason why the vaccinia virus vaccine was associated with relatively low mortality. Disabling SPICE may be therapeutically useful if smallpox reemerges. PMID:12034872

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27 Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groupsmore » of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  7. Comparative studies of gene expression and the evolution of gene regulation

    PubMed Central

    Romero, Irene Gallego; Ruvinsky, Ilya; Gilad, Yoav

    2014-01-01

    The hypothesis that differences in gene regulation play an important role in speciation and adaptation is more than 40 years old. With the advent of new sequencing technologies, we are able to characterize and study gene expression levels and associated regulatory mechanisms in a large number of individuals and species at unprecedented resolution and scale. We have thus gained new insights into the evolutionary pressures that shape gene expression levels, as well as developed an appreciation for the relative importance of evolutionary changes in different regulatory genetic and epigenetic mechanisms. The current challenge is to link gene regulatory changes to adaptive evolution of complex phenotypes. Here we mainly focus on comparative studies in primates, and how they are complemented by studies in model organisms. PMID:22705669

  8. Introduction: MicroRNAs in human reproduction: small molecules with crucial regulatory roles.

    PubMed

    Imbar, Tal; Galliano, Daniela; Pellicer, Antonio; Laufer, Neri

    2014-06-01

    MicroRNAs constitute a large family of approximately 21-nucleotide-long, noncoding RNAs. They emerged more than 20 years ago as key posttranscriptional regulators of gene expression. The regulatory role of these small RNA molecules has recently begun to be explored in the human reproductive system. In this issue's Views and Reviews, the authors present the current knowledge regarding the involvement of microRNAs in several aspects of human reproduction and discuss its future implications for clinical practice. Copyright © 2014 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  9. Sublytic complement protects prostate cancer cells from tumour necrosis factor-α-induced cell death.

    PubMed

    Liu, L; Li, W; Li, Z; Kirschfink, M

    2012-08-01

    Inflammation is a critical component of tumour progression. Although complement and tumour necrosis factor (TNF)-α potentially exert significant anti-tumour effects, both mediators may also promote tumour progression. It has been demonstrated that sublytic complement confers resistance on tumour cells not only against lytic complement, but also other danger molecules such as perforin. In low concentrations, TNF promotes survival of malignant cells rather than exerting cytotoxic activity. In this study, we tested if sublytic complement is able to interfere with TNF-mediated tumour cell killing. Our results demonstrate that either subcytotoxic concentrations of TNF or sublytic complement rescue prostate carcinoma cells (DU145) from TNF-α-mediated cell death. Upon pretreatment with low-dose TNF-α, but not upon pre-exposure to sublytic complement, TNF resistance was associated with the down-regulation of TNF receptor 1 (TNF-R1) expression. Complement-induced protection against TNF-mediated apoptosis accompanied the induction of anti-apoptotic proteins [B cell leukaemia/lymphoma (Bcl)-2 and Bcl-xL] at an early stage followed by inhibition of the TNF-induced decrease in the amount of Bcl-2 and Bcl-xL. Cell protection also accompanied the inhibition of caspase-8 activation, poly (ADP-ribose) polymerase (PARP)-1 cleavage and the activation of nuclear factor (NF)-κB. Our data extend our current view on the induction of tumour cell resistance against cytotoxic mediators supporting the role of the tumour microenvironment in mediating protection against the anti-cancer immune response. © 2012 The Authors. Clinical and Experimental Immunology © 2012 British Society for Immunology.

  10. Molecular imaging of drug-modulated protein-protein interactions in living subjects.

    PubMed

    Paulmurugan, Ramasamy; Massoud, Tarik F; Huang, Jing; Gambhir, Sanjiv S

    2004-03-15

    Networks of protein interactions mediate cellular responses to environmental stimuli and direct the execution of many different cellular functional pathways. Small molecules synthesized within cells or recruited from the external environment mediate many protein interactions. The study of small molecule-mediated interactions of proteins is important to understand abnormal signal transduction pathways in cancer and in drug development and validation. In this study, we used split synthetic renilla luciferase (hRLUC) protein fragment-assisted complementation to evaluate heterodimerization of the human proteins FRB and FKBP12 mediated by the small molecule rapamycin. The concentration of rapamycin required for efficient dimerization and that of its competitive binder ascomycin required for dimerization inhibition were studied in cell lines. The system was dually modulated in cell culture at the transcription level, by controlling nuclear factor kappaB promoter/enhancer elements using tumor necrosis factor alpha, and at the interaction level, by controlling the concentration of the dimerizer rapamycin. The rapamycin-mediated dimerization of FRB and FKBP12 also was studied in living mice by locating, quantifying, and timing the hRLUC complementation-based bioluminescence imaging signal using a cooled charged coupled device camera. This split reporter system can be used to efficiently screen small molecule drugs that modulate protein-protein interactions and also to assess drugs in living animals. Both are essential steps in the preclinical evaluation of candidate pharmaceutical agents targeting protein-protein interactions, including signaling pathways in cancer cells.

  11. Bench-to-bedside review: Future novel diagnostics for sepsis - a systems biology approach

    PubMed Central

    2013-01-01

    The early, accurate diagnosis and risk stratification of sepsis remains an important challenge in the critically ill. Since traditional biomarker strategies have not yielded a gold standard marker for sepsis, focus is shifting towards novel strategies that improve assessment capabilities. The combination of technological advancements and information generated through the human genome project positions systems biology at the forefront of biomarker discovery. While previously available, developments in the technologies focusing on DNA, gene expression, gene regulatory mechanisms, protein and metabolite discovery have made these tools more feasible to implement and less costly, and they have taken on an enhanced capacity such that they are ripe for utilization as tools to advance our knowledge and clinical research. Medicine is in a genome-level era that can leverage the assessment of thousands of molecular signals beyond simply measuring selected circulating proteins. Genomics is the study of the entire complement of genetic material of an individual. Epigenetics is the regulation of gene activity by reversible modifications of the DNA. Transcriptomics is the quantification of the relative levels of messenger RNA for a large number of genes in specific cells or tissues to measure differences in the expression levels of different genes, and the utilization of patterns of differential gene expression to characterize different biological states of a tissue. Proteomics is the large-scale study of proteins. Metabolomics is the study of the small molecule profiles that are the terminal downstream products of the genome and consists of the total complement of all low-molecular-weight molecules that cellular processes leave behind. Taken together, these individual fields of study may be linked during a systems biology approach. There remains a valuable opportunity to deploy these technologies further in human research. The techniques described in this paper not only have the potential to increase the spectrum of diagnostic and prognostic biomarkers in sepsis, but they may also enable the discovery of new disease pathways. This may in turn lead us to improved therapeutic targets. The objective of this paper is to provide an overview and basic framework for clinicians and clinical researchers to better understand the 'omics technologies' to enhance further use of these valuable tools. PMID:24093155

  12. Selective small-molecule inhibitors as chemical tools to define the roles of matrix metalloproteinases in disease.

    PubMed

    Meisel, Jayda E; Chang, Mayland

    2017-11-01

    The focus of this article is to highlight novel inhibitors and current examples where the use of selective small-molecule inhibitors has been critical in defining the roles of matrix metalloproteinases (MMPs) in disease. Selective small-molecule inhibitors are surgical chemical tools that can inhibit the targeted enzyme; they are the method of choice to ascertain the roles of MMPs and complement studies with knockout animals. This strategy can identify targets for therapeutic development as exemplified by the use of selective small-molecule MMP inhibitors in diabetic wound healing, spinal cord injury, stroke, traumatic brain injury, cancer metastasis, and viral infection. This article is part of a Special Issue entitled: Matrix Metalloproteinases edited by Rafael Fridman. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Dissecting non-coding RNA mechanisms in cellulo by single-molecule high-resolution localization and counting

    PubMed Central

    Pitchiaya, Sethuramasundaram; Krishnan, Vishalakshi; Custer, Thomas C.; Walter, Nils G.

    2013-01-01

    Non-coding RNAs (ncRNAs) recently were discovered to outnumber their protein-coding counterparts, yet their diverse functions are still poorly understood. Here we report on a method for the intracellular Single-molecule High Resolution Localization and Counting (iSHiRLoC) of microRNAs (miRNAs), a conserved, ubiquitous class of regulatory ncRNAs that controls the expression of over 60% of all mammalian protein coding genes post-transcriptionally, by a mechanism shrouded by seemingly contradictory observations. We present protocols to execute single particle tracking (SPT) and single-molecule counting of functional microinjected, fluorophore-labeled miRNAs and thereby extract diffusion coefficients and molecular stoichiometries of micro-ribonucleoprotein (miRNP) complexes from living and fixed cells, respectively. This probing of miRNAs at the single molecule level sheds new light on the intracellular assembly/disassembly of miRNPs, thus beginning to unravel the dynamic nature of this important gene regulatory pathway and facilitating the development of a parsimonious model for their obscured mechanism of action. PMID:23820309

  14. 2015 White Paper on recent issues in bioanalysis: focus on new technologies and biomarkers (Part 2 - hybrid LBA/LCMS and input from regulatory agencies).

    PubMed

    Ackermann, Brad; Neubert, Hendrik; Hughes, Nicola; Garofolo, Fabio; Abberley, Lee; Alley, Stephen C; Brown-Augsburger, Patricia; Bustard, Mark; Chen, Lin-Zhi; Heinrich, Julia; Katori, Noriko; Kaur, Surinder; Kirkovsky, Leo; Laterza, Omar F; Le Blaye, Olivier; Lévesque, Ann; Santos, Gustavo Mendes Lima; Olah, Timothy; Savoie, Natasha; Skelly, Michael; Spitz, Susan; Szapacs, Matthew; Tampal, Nilufer; Wang, Jian; Welink, Jan; Wieling, Jaap; Haidar, Sam; Vinter, Stephen; Whale, Emma; Witte, Bärbel

    2015-12-01

    The 2015 9th Workshop on Recent Issues in Bioanalysis (9th WRIB) took place in Miami, Florida with participation of over 600 professionals from pharmaceutical and biopharmaceutical companies, biotechnology companies, contract research organizations and regulatory agencies worldwide. It is once again a 5-day week long event - a full immersion bioanalytical week - specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest in bioanalysis. The topics covered included both small and large molecules, and involved LCMS, hybrid LBA/LCMS, LBA approaches including the focus on biomarkers and immunogenicity. This 2015 White Paper encompasses recommendations that emerged from the extensive discussions held during the workshop, and is aimed at providing the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to advance scientific excellence, improve quality and deliver better regulatory compliance. Due to its length, the 2015 edition of this comprehensive White Paper has been divided into three parts. Part 2 covers the recommendations for hybrid LBA/LCMS and regulatory agencies' inputs. Part 1 (small molecule bioanalysis using LCMS) and Part 3 (large molecule bioanalysis using LBA, biomarkers and immunogenicity) will be published in volume 7 of Bioanalysis, issues 22 and 24, respectively.

  15. 2016 White Paper on recent issues in bioanalysis: focus on biomarker assay validation (BAV): (Part 2 - Hybrid LBA/LCMS and input from regulatory agencies).

    PubMed

    Song, An; Lee, Anita; Garofolo, Fabio; Kaur, Surinder; Duggan, Jeff; Evans, Christopher; Palandra, Joe; Donato, Lorella Di; Xu, Keyang; Bauer, Ronald; Bustard, Mark; Chen, Linzhi; Cocea, Laurent; Croft, Stephanie; Galliccia, Fabrizio; Haidar, Sam; Hughes, Nicola; Ishii-Watabe, Akiko; Islam, Rafiqul; Jones, Barry; Kadavil, John; Krantz, Carsten; Lima Santos, Gustavo Mendes; Olah, Timothy; Pedras-Vasconcelos, João; Staelens, Ludovicus; Saito, Yoshiro; Savoie, Natasha; Scheibner, Kara; Spitz, Susan; Tampal, Nilufer; Thomas, Eric; Vinter, Stephen; Wakelin-Smith, Jason; Welink, Jan; Zeng, Jianing; Zhou, Shaolian

    2016-12-01

    The 2016 10th Workshop on Recent Issues in Bioanalysis (10 th WRIB) took place in Orlando, Florida with participation of close to 700 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations, and regulatory agencies worldwide. WRIB was once again a 5-day, weeklong event - A Full Immersion Week of Bioanalysis including Biomarkers and Immunogenicity. As usual, it is specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small and large molecules involving LCMS, hybrid LBA/LCMS, and LBA approaches, with the focus on biomarkers and immunogenicity. This 2016 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. This White Paper is published in 3 parts due to length. This part (Part 2) discusses the recommendations for Hybrid LBA/LCMS and regulatory inputs from major global health authorities. Parts 1 (small molecule bioanalysis using LCMS) and Part 3 (large molecule bioanalysis using LBA, biomarkers and immunogenicity) have been published in the Bioanalysis journal, issues 22 and 23, respectively.

  16. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum

    PubMed Central

    Castiblanco-Valencia, Mónica M.; Fraga, Tatiana R.; Breda, Leandro C.D.; Vasconcellos, Sílvio A.; Figueira, Cláudio P.; Picardeau, Mathieu; Wunder, Elsio; Ko, Albert I.; Barbosa, Angela S.; Isaac, Lourdes

    2017-01-01

    Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules present in pathogenic but not in saprophytic Leptospira species. We have previously shown that Lig proteins interact with the soluble complement regulators Factor H (FH), FH like-1 (FHL-1), FH related-1 (FHR-1) and C4b Binding Protein (C4BP). In this study, we used the saprophyte L. biflexa serovar Patoc as a surrogate host to address the specific role of LigA and LigB proteins in leptospiral complement evasion. L. biflexa expressing LigA or LigB was able to acquire FH and C4BP. Bound complement regulators retained their cofactor activities of FI in the proteolytic cleavage of C3b and C4b. Moreover, heterologous expression of ligA and ligB genes in the saprophyte L. biflexa enhanced bacterial survival in human serum. Complement deposition on lig-transformed L. biflexa was assessed by flow cytometry analysis. With regard to MAC deposition, L. biflexa expressing LigA or LigB presented an intermediate profile: MAC deposition levels were greater than those found in the pathogenic L. interrogans, but lower than those observed for L. biflexa wildtype. In conclusion, Lig proteins contribute to in vitro control of complement activation on the leptospiral surface, promoting an increased bacterial survival in human serum. PMID:26976804

  17. A teleost CD46 is involved in the regulation of complement activation and pathogen infection.

    PubMed

    Li, Mo-Fei; Sui, Zhi-Hai; Sun, Li

    2017-11-03

    In mammals, CD46 is involved in the inactivation of complement by factor I (FI). In teleost, study on the function of CD46 is very limited. In this study, we examined the immunological property of a CD46 molecule (CsCD46) from tongue sole, a teleost species with important economic value. We found that recombinant CsCD46 (rCsCD46) interacted with FI and inhibited complement activation in an FI-dependent manner. rCsCD46 also interacted with bacterial pathogens via a different mechanism to that responsible for the FI interaction, involving different rCsCD46 sites. Cellular study showed that CsCD46 was expressed on peripheral blood leukocytes (PBL) and protected the cells against the killing effect of complement. When the CsCD46 on PBL was blocked by antibody before incubation of the cells with bacterial pathogens, cellular infection was significantly reduced. Consistently, when tongue sole were infected with bacterial pathogens in the presence of rCsCD46, tissue dissemination and survival of the pathogens were significantly inhibited. These results provide the first evidence to indicate that CD46 in teleosts negatively regulates complement activation via FI and protects host cells from complement-induced damage, and that CD46 is required for optimal bacterial infection probably by serving as a receptor for the bacteria.

  18. Regulatory Dendritic Cells.

    PubMed

    Sato, Katsuaki; Uto, Tomofumi; Fukaya, Tomohiro; Takagi, Hideaki

    2017-01-01

    Dendritic cells (DCs) comprise heterogeneous subsets, functionally classified into conventional DCs (cDCs) and plasmacytoid DCs (pDCs). DCs are considered to be essential antigen (Ag)-presenting cells (APCs) that play crucial roles in activation and fine-tuning of innate and adaptive immunity under inflammatory conditions, as well as induction of immune tolerance to maintain immune homeostasis under steady-state conditions. Furthermore, DC functions can be modified and influenced by stimulation with various extrinsic factors, such as ligands for pattern-recognition receptors (PRRs) and cytokines. On the other hand, treatment of DCs with certain immunosuppressive drugs and molecules leads to the generation of tolerogenic DCs that show downregulation of both the major histocompatibility complex (MHC) and costimulatory molecules, and not only show defective T-cell activation, but also possess tolerogenic properties including the induction of anergic T-cells and regulatory T (T reg ) cells. To develop an effective strategy for Ag-specific intervention of T-cell-mediated immune disorders, we have previously established the modified DCs with moderately high levels of MHC molecules that are defective in the expression of costimulatory molecules that had a greater immunoregulatory property than classical tolerogenic DCs, which we therefore designated as regulatory DCs (DC reg ). Herein, we integrate the current understanding of the role of DCs in the control of immune responses, and further provide new information of the characteristics of tolerogenic DCs and DC reg , as well as their regulation of immune responses and disorders.

  19. The Xanthomonas oryzae pv. oryzae PhoPQ Two-Component System Is Required for AvrXA21 Activity, hrpG Expression, and Virulence▿ †

    PubMed Central

    Lee, Sang-Won; Jeong, Kyu-Sik; Han, Sang-Wook; Lee, Seung-Eun; Phee, Bong-Kwan; Hahn, Tae-Ryong; Ronald, Pamela

    2008-01-01

    The rice pathogen recognition receptor, XA21, confers resistance to Xanthomonas oryzae pv. oryzae strains producing the type one system-secreted molecule, AvrXA21. X. oryzae pv. oryzae requires a regulatory two-component system (TCS) called RaxRH to regulate expression of eight rax (required for AvrXA21 activity) genes and to sense population cell density. To identify other key components in this critical regulatory circuit, we assayed proteins expressed in a raxR gene knockout strain. This survey led to the identification of the phoP gene encoding a response regulator that is up-regulated in the raxR knockout strain. Next we generated a phoP knockout strain and found it to be impaired in X. oryzae pv. oryzae virulence and no longer able to activate the response regulator HrpG (hypersensitive reaction and pathogenicity G) in response to low levels of Ca2+. The impaired virulence of the phoP knockout strain can be partially complemented by constitutive expression of hrpG, indicating that PhoP controls a key aspect of X. oryzae pv. oryzae virulence through regulation of hrpG. A gene encoding the cognate putative histidine protein kinase, phoQ, was also isolated. Growth curve analysis revealed that AvrXA21 activity is impaired in a phoQ knockout strain as reflected by enhanced growth of this strain in rice lines carrying XA21. These results suggest that the X. oryzae pv. oryzae PhoPQ TCS functions in virulence and in the production of AvrXA21 in partnership with RaxRH. PMID:18203830

  20. Cytotoxic activity against human neuroblastoma and melanoma cells mediated by IgM antibodies derived from peripheral blood of healthy donors.

    PubMed

    Devarapu, Satish Kumar; Mamidi, Srinivas; Plöger, Frank; Dill, Othmar; Blixt, Ola; Kirschfink, Michael; Schwartz-Albiez, Reinhard

    2016-06-15

    A small percentage of healthy donors identified in the Western population carry antibodies in their peripheral blood which convey cytotoxic activity against certain human melanoma and neuroblastoma cell lines. We measured the cytotoxic activity of sera and plasmas from healthy donors on the human neuroblastoma cell line Kelly and various melanoma cell lines. Antibodies of IgM isotype, presumably belonging to the class of naturally occurring antibodies, exerted cytotoxic activity in a complement-dependent fashion. Apart from complement-dependent tumor cell lysis, we observed C3 opsonization in all tumor cell lines upon treatment with cytotoxic plasmas. Cell lines tested primarily expressed membrane complement regulatory proteins (mCRP) CD46, CD55 and CD59 to various extents. Blocking of mCRPs by monoclonal antibodies enhanced cell lysis and opsonization, though some melanoma cells remained resistant to complement attack. Epitopes recognized by cytotoxic antibodies were represented by gangliosides such as GD2 and GD3, as evidenced by cellular sialidase pretreatment and enhanced expression of distinct gangliosides. It remains to be clarified why only a small fraction of healthy persons carry these antitumor cytotoxic antibodies. © 2016 UICC.

  1. Interallelic Complementation at the Suppressor of Forked Locus of Drosophila Reveals Complementation between Suppressor of Forked Proteins Mutated in Different Regions

    PubMed Central

    Simonelig, M.; Elliott, K.; Mitchelson, A.; O'Hare, K.

    1996-01-01

    The Su(f) protein of Drosophila melanogaster shares extensive homologies with proteins from yeast (RNA14) and man (77 kD subunit of cleavage stimulation factor) that are required for 3' end processing of mRNA. These homologies suggest that su(f) is involved in mRNA 3' end formation and that some aspects of this process are conserved throughout eukaryotes. We have investigated the genetic and molecular complexity of the su(f) locus. The su(f) gene is transcribed to produce three RNAs and could encode two proteins. Using constructs that contain different parts of the locus, we show that only the larger predicted gene product of 84 kD is required for the wild-type function of su(f). Some lethal alleles of su(f) complement to produce viable combinations. The structures of complementing and noncomplementing su(f) alleles indicate that 84-kD Su(f) proteins mutated in different domains can act in combination for partial su(f) function. Our results suggest protein-protein interaction between or within wild-type Su(f) molecules. PMID:8846900

  2. Expression of recombinant CD59 with an N-terminal peptide epitope facilitates analysis of residues contributing to its complement-inhibitory function.

    PubMed

    Zhou, Q; Zhao, J; Hüsler, T; Sims, P J

    1996-10-01

    CD59 is a plasma membrane-anchored glycoprotein that serves to protect human cells from lysis by the C5b-9 complex of complement. The immunodominant epitopes of CD59 are known to be sensitive to disruption of native tertiary structure, complicating immunological measurement of expressed mutant constructs for structure function analysis. In order to quantify cell-surface expression of wild-type and mutant forms of this complement inhibitor, independent of CD59 antigen, an 11-residue peptide (TAG) recognized by monoclonal antibody (mAb) 9E10 was inserted before the N-terminal codon (L1) of mature CD59, in a pcDNA3 expression plasmid. SV-T2 cells were transfected with this plasmid, yielding cell lines expressing 0 to > 10(5) CD59/cell. The TAG-CD59 fusion protein was confirmed to be GPI-anchored, N-glycosylated and showed identical complement-inhibitory function to wild-type CD59, lacking the TAG peptide sequence. Using this construct, the contribution of each of four surface-localized aromatic residues (4Y, 47F, 61Y, and 62Y) to CD59's complement-inhibitory function was examined. These assays revealed normal surface expression with complete loss of complement-inhibitory function in the 4Y --> S, 47F --> G and 61Y --> S mutants. By contrast, 62Y --> S mutants retained approximately 40% of function of wild-type CD59. These studies confirmed the utility of the TAG-CD59 construct for quantifying CD59 surface expression and activity, and implicate surface aromatic residues 4Y, 47F, 61Y and 62Y as essential to maintenance of CD59's normal complement-regulatory function.

  3. Variants in Complement Factor H and Complement Factor H-Related Protein Genes, CFHR3 and CFHR1, Affect Complement Activation in IgA Nephropathy.

    PubMed

    Zhu, Li; Zhai, Ya-Ling; Wang, Feng-Mei; Hou, Ping; Lv, Ji-Cheng; Xu, Da-Min; Shi, Su-Fang; Liu, Li-Jun; Yu, Feng; Zhao, Ming-Hui; Novak, Jan; Gharavi, Ali G; Zhang, Hong

    2015-05-01

    Complement activation is common in patients with IgA nephropathy (IgAN) and associated with disease severity. Our recent genome-wide association study of IgAN identified susceptibility loci on 1q32 containing the complement regulatory protein-encoding genes CFH and CFHR1-5, with rs6677604 in CFH as the top single-nucleotide polymorphism and CFHR3-1 deletion (CFHR3-1∆) as the top signal for copy number variation. In this study, to explore the clinical effects of variation in CFH, CFHR3, and CFHR1 on IgAN susceptibility and progression, we enrolled two populations. Group 1 included 1178 subjects with IgAN and available genome-wide association study data. Group 2 included 365 subjects with IgAN and available clinical follow-up data. In group 1, rs6677604 was associated with mesangial C3 deposition by genotype-phenotype correlation analysis. In group 2, we detected a linkage between the rs6677604-A allele and CFHR3-1∆ and found that the rs6677604-A allele was associated with higher serum levels of CFH and lower levels of the complement activation split product C3a. Furthermore, CFH levels were positively associated with circulating C3 levels and negatively associated with mesangial C3 deposition. Moreover, serum levels of the pathogenic galactose-deficient glycoform of IgA1 were also associated with the degree of mesangial C3 deposition in patients with IgAN. Our findings suggest that genetic variants in CFH, CFHR3, and CFHR1 affect complement activation and thereby, predispose patients to develop IgAN. Copyright © 2015 by the American Society of Nephrology.

  4. Quorum-Sensing Signal-Response Systems in Gram-Negative Bacteria

    PubMed Central

    Papenfort, Kai; Bassler, Bonnie

    2016-01-01

    Abstract / Preface Bacteria use quorum sensing to orchestrate gene expression programmes that underlie collective behaviours. Quorum sensing relies on the production, release, detection and group-level response to extracellular signalling molecules, which are called autoinducers. Recent work has discovered new autoinducers in Gram-negative bacteria, shown how these molecules are recognized by cognate receptors, revealed new regulatory components that are embedded in canonical signalling circuits and identified novel regulatory network designs. In this Review we examine how, together, these features of quorum sensing signal–response systems combine to control collective behaviours in Gram-negative bacteria and we discuss the implications for host–microbial associations and antibacterial therapy. PMID:27510864

  5. The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

    USDA-ARS?s Scientific Manuscript database

    MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

  6. Design principles and operating principles: the yin and yang of optimal functioning.

    PubMed

    Voit, Eberhard O

    2003-03-01

    Metabolic engineering has as a goal the improvement of yield of desired products from microorganisms and cell lines. This goal has traditionally been approached with experimental biotechnological methods, but it is becoming increasingly popular to precede the experimental phase by a mathematical modeling step that allows objective pre-screening of possible improvement strategies. The models are either linear and represent the stoichiometry and flux distribution in pathways or they are non-linear and account for the full kinetic behavior of the pathway, which is often significantly effected by regulatory signals. Linear flux analysis is simpler and requires less input information than a full kinetic analysis, and the question arises whether the consideration of non-linearities is really necessary for devising optimal strategies for yield improvements. The article analyzes this question with a generic, representative pathway. It shows that flux split ratios, which are the key criterion for linear flux analysis, are essentially sufficient for unregulated, but not for regulated branch points. The interrelationships between regulatory design on one hand and optimal patterns of operation on the other suggest the investigation of operating principles that complement design principles, like a user's manual complements the hardwiring of electronic equipment.

  7. Gal knockout and beyond.

    PubMed

    Zhong, R

    2007-01-01

    Recently, Galalpha1-3Galbeta1-4GlcNAc (Gal) knockout (k/o) pigs have been developed using genetic cloning technologies. This remarkable achievement has generated great enthusiasm in xenotransplantation studies. This review summarizes the current status of nonhuman primate experiments using Gal k/o pig organs. Briefly, when Gal k/o pig organs are transplanted into primates, hyperacute rejection does not occur. Although graft survival has been prolonged up to a few months in some cases, the overall results were not better than those using Gal-positive pig organs with human complement regulatory protein transgenes. Gal k/o pig kidneys rapidly developed rejection which was associated with increased anti-non-Gal antibodies. Although the precise mechanisms of Gal k/o pig organ rejection are not clear, it could result from incomplete deletion of Gal, up-regulation of new antigen (non-Gal antigen) and/or production of non-Gal antibodies. Future work in xenotransplantation should place emphasis on further modification of donors, such as combining human complement regulatory genes with Gal k/o, deleting non-Gal antigens and adding protective/surviving genes or a gene that inhibits coagulation. Induction of donor-specific T- and B-cell tolerance and promotion of accommodation are also warranted.

  8. C1q-Mediated Complement Activation and C3 Opsonization Trigger Recognition of Stealth Poly(2-methyl-2-oxazoline)-Coated Silica Nanoparticles by Human Phagocytes.

    PubMed

    Tavano, Regina; Gabrielli, Luca; Lubian, Elisa; Fedeli, Chiara; Visentin, Silvia; Polverino De Laureto, Patrizia; Arrigoni, Giorgio; Geffner-Smith, Alessandra; Chen, Fangfang; Simberg, Dmitri; Morgese, Giulia; Benetti, Edmondo M; Wu, Linping; Moghimi, Seyed Moein; Mancin, Fabrizio; Papini, Emanuele

    2018-05-23

    Poly(2-methyl-2-oxazoline) (PMOXA) is an alternative promising polymer to poly(ethylene glycol) (PEG) for design and engineering of macrophage-evading nanoparticles (NPs). Although PMOXA-engineered NPs have shown comparable pharmacokinetics and in vivo performance to PEGylated stealth NPs in the murine model, its interaction with elements of the human innate immune system has not been studied. From a translational angle, we studied the interaction of fully characterized PMOXA-coated vinyltriethoxysilane-derived organically modified silica NPs (PMOXA-coated NPs) of approximately 100 nm in diameter with human complement system, blood leukocytes, and macrophages and compared their performance with PEGylated and uncoated NP counterparts. Through detailed immunological and proteomic profiling, we show that PMOXA-coated NPs extensively trigger complement activation in human sera exclusively through the classical pathway. Complement activation is initiated by the sensing molecule C1q, where C1q binds with high affinity ( K d = 11 ± 1 nM) to NP surfaces independent of immunoglobulin binding. C1q-mediated complement activation accelerates PMOXA opsonization with the third complement protein (C3) through the amplification loop of the alternative pathway. This promoted NP recognition by human blood leukocytes and monocyte-derived macrophages. The macrophage capture of PMOXA-coated NPs correlates with sera donor variability in complement activation and opsonization but not with other major corona proteins, including clusterin and a wide range of apolipoproteins. In contrast to these observations, PMOXA-coated NPs poorly activated the murine complement system and were marginally recognized by mouse macrophages. These studies provide important insights into compatibility of engineered NPs with elements of the human innate immune system for translational steps.

  9. Monocyte:T cell interaction regulates human T cell activation through a CD28/CD46 crosstalk

    PubMed Central

    Charron, Lauren; Doctrinal, Axelle; Choileain, Siobhan Ni; Astier, Anne L.

    2015-01-01

    T cell activation requires engagement of the T cell receptor and of at least one costimulatory molecule. The key role of CD28 in inducing T cell activation has been reported several decades ago and the molecular mechanisms involved well described. The complement regulator CD46 also acts as a costimulatory molecule for T cells but, in contrast to CD28, has the ability to drive T cell differentiation from producing some IFNγ to secreting some potent anti-inflammatory IL-10, acquiring a so-called Type I regulatory phenotype (Tr1). Proteolytic cleavage of CD46 occurs upon costimulation and is important for T cell activation and IL-10 production. The observation that CD46 cleavage was reduced when PBMC were costimulated compared to purified naive T cells led us to hypothesize that interactions between different cell types within the PBMC were able to modulate the CD46 pathway. We show that CD46 downregulation is also reduced when CD4+ T cells are co-cultured with autologous monocytes. Indeed, monocyte:T cell co-cultures impaired CD46–mediated T cell differentiation and coactivation, by reducing downregulation of surface CD46, lowering induction of the early activation marker CD69, as well as reducing the levels of IL-10 secretion. Blocking of CD86 could partly restore CD69 expression and cytokine secretion, demonstrating that the CD28-CD86 pathway regulates CD46 activation. Direct concomitant ligation of CD28 and CD46 on CD4+ T cells also modulated CD46 expression and regulated cytokine production. These data identify a crosstalk between two main costimulatory pathways and provide novel insights into the regulation of human T cell activation. PMID:25787182

  10. Threonine modulates immune response, antioxidant status and gene expressions of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream (Megalobrama amblycephala).

    PubMed

    Habte-Tsion, Habte-Michael; Ren, Mingchun; Liu, Bo; Ge, Xianping; Xie, Jun; Chen, Ruli

    2016-04-01

    A 9-week feeding trial was conducted to investigate the effects of graded dietary threonine (Thr) levels (0.58-2.58%) on the hematological parameters, immune response, antioxidant status and hepatopancreatic gene expression of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream. For this purpose, 3 tanks were randomly arranged and assigned to each experimental diet. Fish were fed with their respective diet to apparent satiation 4 times daily. The results indicated that white blood cell, red blood cell and haemoglobin significantly responded to graded dietary Thr levels, while hematocrit didn't. Complement components (C3 and C4), total iron-binding capacity (TIBC), immunoglobulin M (IgM), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) increased with increasing dietary Thr levels up to 1.58-2.08% and thereafter tended to decrease. Dietary Thr regulated the gene expressions of Cu/Zn-SOD, Mn-SOD and CAT, GPx1, glutathione S-transferase mu (GST), nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein-70 (Hsp70), tumor necrosis factor-alpha (TNF-α), apolipoprotein A-I (ApoA1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fructose-bisphosphate aldolase B (ALDOB); while the gene expression of peroxiredoxin II (PrxII) was not significantly modified by graded Thr levels. These genes are involved in different functions including antioxidant, immune, and defense responses, energy metabolism and protein synthesis. Therefore, this study could provide a new molecular tool for studies in fish immunonutrition and shed light on the regulatory mechanisms that dietary Thr improved the antioxidant and immune capacities of fish. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. The Gly-54-->Asp allelic form of human mannose-binding protein (MBP) fails to bind MBP-associated serine protease.

    PubMed Central

    Matsushita, M; Ezekowitz, R A; Fujita, T

    1995-01-01

    The human mannose-binding protein (MBP) is a pattern recognition molecule that appears to play a role in initial host defence. MBP activates the complement cascade and it may act as an opsonin both in the absence and in the presence of complement. A number of distinct MBP allelic forms exist in different population groups. An allele that occurs in 5-7% of Caucasians was identified by an inability to activate the complement system. A homozygous mutation at base pair 230 of the MBP gene results in a Gly-to-Asp substitution at the fifth collagen repeat. It appears that the resultant protein, MBPD, is able to form high-order multimers that bind bacteria but do not support complement activation. Recently a novel serine protease, the MBP-associated serine protease (MASP), has been described. MBP-MASP complexes circulate in serum and result in the direct activation of a novel complement pathway (lectin pathway) in the absence of the first complement components. In this study we demonstrate that MASP and its proenzyme proMASP are unable to bind to recombinant (r)MBPD. This lack of a MASP-rMBPD association corresponds to a failure of the Gly-54-->Asp form of MBP to activate complement. Our results provide a biochemical basis for the functional deficit in the Gly-54-->Asp allelic form of MBP and suggest that the proMASP/MASP binding site maps to the fifth collagen repeat of MBP. Images Figure 1 PMID:7487919

  12. Innate immune humoral factors, C1q and factor H, with differential pattern recognition properties, alter macrophage response to carbon nanotubes.

    PubMed

    Pondman, Kirsten M; Pednekar, Lina; Paudyal, Basudev; Tsolaki, Anthony G; Kouser, Lubna; Khan, Haseeb A; Shamji, Mohamed H; Ten Haken, Bennie; Stenbeck, Gudrun; Sim, Robert B; Kishore, Uday

    2015-11-01

    Interaction between the complement system and carbon nanotubes (CNTs) can modify their intended biomedical applications. Pristine and derivatised CNTs can activate complement primarily via the classical pathway which enhances uptake of CNTs and suppresses pro-inflammatory response by immune cells. Here, we report that the interaction of C1q, the classical pathway recognition molecule, with CNTs involves charge pattern and classical pathway activation that is partly inhibited by factor H, a complement regulator. C1q and its globular modules, but not factor H, enhanced uptake of CNTs by macrophages and modulated the pro-inflammatory immune response. Thus, soluble complement factors can interact differentially with CNTs and alter the immune response even without complement activation. Coating CNTs with recombinant C1q globular heads offers a novel way of controlling classical pathway activation in nanotherapeutics. Surprisingly, the globular heads also enhance clearance by phagocytes and down-regulate inflammation, suggesting unexpected complexity in receptor interaction. Carbon nanotubes (CNTs) maybe useful in the clinical setting as targeting drug carriers. However, it is also well known that they can interact and activate the complement system, which may have a negative impact on the applicability of CNTs. In this study, the authors functionalized multi-walled CNT (MWNT), and investigated the interaction with the complement pathway. These studies are important so as to gain further understanding of the underlying mechanism in preparation for future use of CNTs in the clinical setting. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  13. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator.

    PubMed

    Bahia El Idrissi, Nawal; Das, Pranab K; Fluiter, Kees; Rosa, Patricia S; Vreijling, Jeroen; Troost, Dirk; Morgan, B Paul; Baas, Frank; Ramaglia, Valeria

    2015-05-01

    Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is unclear. We previously identified the membrane attack complex (MAC) of the complement system as a key determinant of post-traumatic nerve damage and demonstrated that its inhibition is neuroprotective. Here, we determined the contribution of the MAC to nerve damage caused by Mycobacterium leprae and its components in mouse. Furthermore, we studied the association between MAC and the key M. leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients. Intraneural injections of M. leprae sonicate induced MAC deposition and pathological changes in the mouse nerve, whereas MAC inhibition preserved myelin and axons. Complement activation occurred mainly via the lectin pathway and the principal activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity was robust and significantly higher in multibacillary compared to paucibacillary donors (p = 0.01 and p = 0.001, respectively), with a highly significant association between LAM and MAC in the diseased samples (r = 0.9601, p = 0.0001). Further, MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in complement activation and nerve damage in leprosy. Our findings demonstrate that MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and its inhibition is neuroprotective. In addition, our data identified LAM as the key pathogen associated molecule that activates complement and causes nerve damage. Taken together our data imply an important role of complement in nerve damage in leprosy and may inform the development of novel therapeutics for patients.

  14. Mapping the Complement Factor H-Related Protein 1 (CFHR1):C3b/C3d Interactions

    PubMed Central

    Laskowski, Jennifer; Thurman, Joshua M.; Hageman, Gregory S.; Holers, V. Michael

    2016-01-01

    Complement factor H-related protein 1 (CFHR1) is a complement regulator which has been reported to regulate complement by blocking C5 convertase activity and interfering with C5b surface association. CFHR1 also competes with complement factor H (CFH) for binding to C3b, and may act as an antagonist of CFH-directed regulation on cell surfaces. We have employed site-directed mutagenesis in conjunction with ELISA-based and functional assays to isolate the binding interaction that CFHR1 undertakes with complement components C3b and C3d to a single shared interface. The C3b/C3d:CFHR1 interface is identical to that which occurs between the two C-terminal domains (SCR19-20) of CFH and C3b. Moreover, we have been able to corroborate that dimerization of CFHR1 is necessary for this molecule to bind effectively to C3b and C3d, or compete with CFH. Finally, we have established that CFHR1 competes with complement factor H-like protein 1 (CFHL-1) for binding to C3b. CFHL-1 is a CFH gene splice variant, which is almost identical to the N-terminal 7 domains of CFH (SCR1-7). CFHR1, therefore, not only competes with the C-terminus of CFH for binding to C3b, but also sterically blocks the interaction that the N-terminus of CFH undertakes with C3b, and which is required for CFH-regulation. PMID:27814381

  15. Indole-based novel small molecules for the modulation of bacterial signalling pathways.

    PubMed

    Biswas, Nripendra Nath; Kutty, Samuel K; Barraud, Nicolas; Iskander, George M; Griffith, Renate; Rice, Scott A; Willcox, Mark; Black, David StC; Kumar, Naresh

    2015-01-21

    Gram-negative bacteria such as Pseudomonas aeruginosa use N-acylated L-homoserine lactones (AHLs) as autoinducers (AIs) for quorum sensing (QS), a major regulatory and cell-to-cell communication system for social adaptation, virulence factor production, biofilm formation and antibiotic resistance. Some bacteria use indole moieties for intercellular signaling and as regulators of various bacterial phenotypes important for evading the innate host immune response and antimicrobial resistance. A range of natural and synthetic indole derivatives have been found to act as inhibitors of QS-dependent bacterial phenotypes, complementing the bactericidal ability of traditional antibiotics. In this work, various indole-based AHL mimics were designed and synthesized via the 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N,N'-dicyclohexylcarbodiimide (DCC) mediated coupling reactions of a variety of substituted or unsubstituted aminoindoles with different alkanoic acids. All synthesized compounds were tested for QS inhibition using a P. aeruginosa QS reporter strain by measuring the amount of green fluorescent protein (GFP) production. Docking studies were performed to examine their potential to bind and therefore inhibit the target QS receptor protein. The most potent compounds 11a, 11d and 16a showed 44 to 65% inhibition of QS activity at 250 μM concentration, and represent promising drug leads for the further development of anti-QS antimicrobial compounds.

  16. Pathogenesis of Group A Streptococcal Infections

    PubMed Central

    Cunningham, Madeleine W.

    2000-01-01

    Group A streptococci are model extracellular gram-positive pathogens responsible for pharyngitis, impetigo, rheumatic fever, and acute glomerulonephritis. A resurgence of invasive streptococcal diseases and rheumatic fever has appeared in outbreaks over the past 10 years, with a predominant M1 serotype as well as others identified with the outbreaks. emm (M protein) gene sequencing has changed serotyping, and new virulence genes and new virulence regulatory networks have been defined. The emm gene superfamily has expanded to include antiphagocytic molecules and immunoglobulin-binding proteins with common structural features. At least nine superantigens have been characterized, all of which may contribute to toxic streptococcal syndrome. An emerging theme is the dichotomy between skin and throat strains in their epidemiology and genetic makeup. Eleven adhesins have been reported, and surface plasmin-binding proteins have been defined. The strong resistance of the group A streptococcus to phagocytosis is related to factor H and fibrinogen binding by M protein and to disarming complement component C5a by the C5a peptidase. Molecular mimicry appears to play a role in autoimmune mechanisms involved in rheumatic fever, while nephritis strain-associated proteins may lead to immune-mediated acute glomerulonephritis. Vaccine strategies have focused on recombinant M protein and C5a peptidase vaccines, and mucosal vaccine delivery systems are under investigation. PMID:10885988

  17. 2017 White Paper: rise of hybrid LBA/LCMS immunogenicity assays (Part 2: hybrid LBA/LCMS biotherapeutics, biomarkers & immunogenicity assays and regulatory agencies' inputs).

    PubMed

    Neubert, Hendrik; Song, An; Lee, Anita; Wei, Cong; Duggan, Jeff; Xu, Keyang; Woolf, Eric; Evans, Chris; Palandra, Joe; Laterza, Omar; Amur, Shashi; Berger, Isabella; Bustard, Mark; Cancilla, Mark; Chen, Shang-Chiung; Cho, Seongeun Julia; Ciccimaro, Eugene; Cludts, Isabelle; Cocea, Laurent; D'Arienzo, Celia; Danan-Leon, Lieza; Donato, Lorella Di; Garofolo, Fabio; Haidar, Sam; Ishii-Watabe, Akiko; Jiang, Hao; Kadavil, John; Kassim, Sean; Kurki, Pekka; Blaye, Olivier Le; Liu, Kai; Mathews, Rod; Lima Santos, Gustavo Mendes; Niwa, Makoto; Pedras-Vasconcelos, João; Qian, Mark; Rago, Brian; Saad, Ola; Saito, Yoshiro; Savoie, Natasha; Su, Dian; Szapacs, Matthew; Tampal, Nilufer; Vinter, Stephen; Wang, Jian; Welink, Jan; Whale, Emma; Wilson, Amanda; Xue, Y-J

    2017-12-01

    The 2017 11th Workshop on Recent Issues in Bioanalysis (11th WRIB) took place in Los Angeles/Universal City, California on 3-7 April 2017 with participation of close to 750 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations and regulatory agencies worldwide. WRIB was once again a 5-day, weeklong event - a full immersion week of bioanalysis, biomarkers and immunogenicity. As usual, it was specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small and large molecule analysis involving LCMS, hybrid ligand binding assay (LBA)/LCMS and LBA approaches. This 2017 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. Due to its length, the 2017 edition of this comprehensive White Paper has been divided into three parts for editorial reasons. This publication (Part 2) covers the recommendations for biotherapeutics, biomarkers and immunogenicity assays using hybrid LBA/LCMS and regulatory agencies' inputs. Part 1 (LCMS for small molecules, peptides and small molecule biomarkers) and Part 3 (LBA: immunogenicity, biomarkers and pharmacokinetic assays) are published in Volume 9 of Bioanalysis, issues 22 and 24 (2017), respectively.

  18. Spontaneous abortion is associated with elevated systemic C5a and reduced mRNA of complement inhibitory proteins in placenta.

    PubMed

    Banadakoppa, M; Chauhan, M S; Havemann, D; Balakrishnan, M; Dominic, J S; Yallampalli, C

    2014-09-01

    Spontaneous abortion in early pregnancy due to unknown reasons is a common problem. The excess complement activation and consequent placental inflammation and anti-angiogenic milieu is emerging as an important associated factor in many pregnancy-related complications. In the present study we sought to examine the expression of complement inhibitory proteins at the feto-maternal interface and levels of complement split products in the circulation to understand their role in spontaneous abortion. Consenting pregnant women who either underwent elective abortion due to non-clinical reasons (n = 13) or suffered miscarriage (n = 14) were recruited for the study. Systemic levels of complement factors C3a and C5a were measured by enzyme-linked immunosorbent assay (ELISA). Plasma C5 and C3 protein levels were examined by Western blot. Expressions of complement regulatory proteins such as CD46 and CD55 in the decidua were investigated by quantitative polymerase chain reaction (PCR) and Western blot. The median of plasma C3a level was 82·83 ng/ml and 66·17 ng/ml in elective and spontaneous abortion patients, respectively. Medians of plasma C5a levels in elective and spontaneous abortion patients were 0·96 ng/ml and 1·14 ng/ml, respectively. Only plasma C5a levels but not C3a levels showed significant elevation in spontaneous abortion patients compared to elective abortion patients. Further, there was a threefold decrease in the mRNA expressions of complement inhibitory proteins CD46 and CD55 in the decidua obtained from spontaneous abortion patients compared to that of elective abortion patients. These data suggested that dysregulated complement cascade may be associated with spontaneous abortion. © 2014 British Society for Immunology.

  19. 2017 White Paper on recent issues in bioanalysis: a global perspective on immunogenicity guidelines & biomarker assay performance (Part 3 - LBA: immunogenicity, biomarkers and PK assays).

    PubMed

    Gupta, Shalini; Richards, Susan; Amaravadi, Lakshmi; Piccoli, Steven; Desilva, Binodh; Pillutla, Renuka; Stevenson, Lauren; Mehta, Devangi; Carrasco-Triguero, Montserrat; Neely, Robert; Partridge, Michael; Staack, Roland F; Zhao, Xuemei; Gorovits, Boris; Kolaitis, Gerry; Sumner, Giane; Stubenrauch, Kay-Gunnar; Zou, Linglong; Amur, Shashi; Beaver, Chris; Berger, Isabella; Berisha, Flora; Birnboeck, Herbert; Bower, Joe; Cho, Seongeun Julia; Cludts, Isabelle; Cocea, Laurent; Donato, Lorella Di; Fischer, Saloumeh; Fraser, Stephanie; Garofolo, Fabio; Haidar, Sam; Haulenbeek, Jonathan; Hottenstein, Charles; Hu, Jenny; Ishii-Watabe, Akiko; Islam, Rafiq; Jani, Darshana; Kadavil, John; Kamerud, John; Kramer, Daniel; Kurki, Pekka; MacMannis, Stephen; McNally, Jim; Mullan, Ashley; Papadimitriou, Apollon; Pedras-Vasconcelos, João; Ray, Soma; Safavi, Afshin; Saito, Yoshiro; Savoie, Natasha; Fjording, Marianne Scheel; Scheibner, Kara; Smeraglia, John; Song, An; Stouffer, Bruce; Tampal, Nilufer; der Strate, Barry van; Verch, Thorsten; Welink, Jan; Xu, Yuanxin; Yang, Tong-Yuan; Yengi, Lilian; Zeng, Jianing; Zhang, Yan; Zhang, Yanhua; Zoog, Stephen

    2017-12-01

    The 2017 11th Workshop on Recent Issues in Bioanalysis took place in Los Angeles/Universal City, California, on 3-7 April 2017 with participation of close to 750 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations and regulatory agencies worldwide. WRIB was once again a 5-day, week-long event - a full immersion week of bioanalysis, biomarkers and immunogenicity. As usual, it was specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small- and large-molecule analysis involving LC-MS, hybrid ligand-binding assay (LBA)/LC-MS and LBA approaches. This 2017 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. Due to its length, the 2017 edition of this comprehensive White Paper has been divided into three parts for editorial reasons. This publication (Part 3) covers the recommendations for large-molecule bioanalysis, biomarkers and immunogenicity using LBA. Part 1 (LC-MS for small molecules, peptides and small molecule biomarkers) and Part 2 (hybrid LBA/LC-MS for biotherapeutics and regulatory agencies' inputs) are published in volume 9 of Bioanalysis, issues 22 and 23 (2017), respectively.

  20. Complement component C5a mediates hemorrhage-induced intestinal damage

    PubMed Central

    Fleming, Sherry D.; Phillips, Lauren M.; Lambris, John D.; Tsokos, George C.

    2008-01-01

    Background Complement has been implicated in the pathogenesis of intestinal damage and inflammation in multiple animal models. Although the exact mechanism is unknown, inhibition of complement prevents hemodynamic alterations in hemorrhage. Materials/Methods C57Bl/6, complement 5 deficient (C5−/−) and sufficient (C5+/+) mice were subjected to 25% blood loss. In some cases, C57Bl/6 mice were treated with C5a receptor antagonist (C5aRa) post-hemorrhage. Intestinal injury, leukotriene B4, and myeloperoxidase production were assessed for each treatment group of mice. Results Mice subjected to significant blood loss without major trauma develop intestinal inflammation and tissue damage within two hours. We report here that complement 5 (C5) deficient mice are protected from intestinal tissue damage when subjected to hemorrhage (Injury score = 0.36 compared to wildtype hemorrhaged animal injury score = 2.89; p<0.05). We present evidence that C5a represents the effector molecule because C57Bl/6 mice treated with a C5a receptor antagonist displayed limited intestinal injury (Injury score = 0.88), leukotriene B4 (13.16 pg/mg tissue) and myeloperoxidase (115.6 pg/mg tissue) production compared to hemorrhaged C57Bl/6 mice (p<0.05). Conclusion Complement activation is important in the development of hemorrhage-induced tissue injury and C5a generation is critical for tissue inflammation and damage. Thus, therapeutics targeting C5a may be useful therapeutics for hemorrhage-associated injury. PMID:18639891

  1. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum.

    PubMed

    Castiblanco-Valencia, Mónica M; Fraga, Tatiana R; Breda, Leandro C D; Vasconcellos, Sílvio A; Figueira, Cláudio P; Picardeau, Mathieu; Wunder, Elsio; Ko, Albert I; Barbosa, Angela S; Isaac, Lourdes

    2016-05-01

    Leptospiral immunoglobulin-like (Lig) proteins are surface exposed molecules present in pathogenic but not in saprophytic Leptospira species. We have previously shown that Lig proteins interact with the soluble complement regulators Factor H (FH), FH like-1 (FHL-1), FH related-1 (FHR-1) and C4b Binding Protein (C4BP). In this study, we used the saprophyte L. biflexa serovar Patoc as a surrogate host to address the specific role of LigA and LigB proteins in leptospiral complement evasion. L. biflexa expressing LigA or LigB was able to acquire FH and C4BP. Bound complement regulators retained their cofactor activities of FI in the proteolytic cleavage of C3b and C4b. Moreover, heterologous expression of ligA and ligB genes in the saprophyte L. biflexa enhanced bacterial survival in human serum. Complement deposition on lig-transformed L. biflexa was assessed by flow cytometry analysis. With regard to MAC deposition, L. biflexa expressing LigA or LigB presented an intermediate profile: MAC deposition levels were greater than those found in the pathogenic L. interrogans, but lower than those observed for L. biflexa wildtype. In conclusion, Lig proteins contribute to in vitro control of complement activation on the leptospiral surface, promoting an increased bacterial survival in human serum. Copyright © 2016 European Federation of Immunological Societies. All rights reserved.

  2. Mannose-binding lectin binds to Ebola and Marburg envelope glycoproteins, resulting in blocking of virus interaction with DC-SIGN and complement-mediated virus neutralization.

    PubMed

    Ji, Xin; Olinger, Gene G; Aris, Sheena; Chen, Ying; Gewurz, Henry; Spear, Gregory T

    2005-09-01

    Mannose-binding lectin (MBL), a serum lectin that mediates innate immune functions including activation of the lectin complement pathway, binds to carbohydrates expressed on some viral glycoproteins. In this study, the ability of MBL to bind to virus particles pseudotyped with Ebola and Marburg envelope glycoproteins was evaluated. Virus particles bearing either Ebola (Zaire strain) or Marburg (Musoke strain) envelope glycoproteins bound at significantly higher levels to immobilized MBL compared with virus particles pseudotyped with vesicular stomatitis virus glycoprotein or with no virus glycoprotein. As observed in previous studies, Ebola-pseudotyped virus bound to cells expressing the lectin DC-SIGN (dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin). However, pre-incubation of virus with MBL blocked DC-SIGN-mediated binding to cells, suggesting that the two lectins bind at the same or overlapping sites on the Ebola glycoprotein. Neutralization experiments showed that virus pseudotyped with Ebola or Marburg (Musoke) glycoprotein was neutralized by complement, while the Marburg (Ravn strain) glycoprotein-pseudotyped virus was less sensitive to neutralization. Neutralization was partially mediated through the lectin complement pathway, since a complement source deficient in MBL was significantly less effective at neutralizing viruses pseudotyped with filovirus glycoproteins and addition of purified MBL to the MBL-deficient complement increased neutralization. These experiments demonstrated that MBL binds to filovirus envelope glycoproteins resulting in important biological effects and suggest that MBL can interact with filoviruses during infection in humans.

  3. System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells.

    PubMed

    Malina, Halina Z

    2011-01-19

    The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases.

  4. System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells

    PubMed Central

    2011-01-01

    Background The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Results Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. Conclusions The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases. PMID:21247434

  5. Markers of inflammation, oxidative stress, and endothelial dysfunction and the 20-year cumulative incidence of early age-related macular degeneration: the Beaver Dam Eye Study.

    PubMed

    Klein, Ronald; Myers, Chelsea E; Cruickshanks, Karen J; Gangnon, Ronald E; Danforth, Lorraine G; Sivakumaran, Theru A; Iyengar, Sudha K; Tsai, Michael Y; Klein, Barbara E K

    2014-04-01

    IMPORTANCE Modifying levels of factors associated with age-related macular degeneration (AMD) may decrease the risk for visual impairment in older persons. OBJECTIVE To examine the relationships of markers of inflammation, oxidative stress, and endothelial dysfunction to the 20-year cumulative incidence of early AMD. DESIGN, SETTING, AND PARTICIPANTS This longitudinal population-based cohort study involved a random sample of 975 persons in the Beaver Dam Eye Study without signs of AMD who participated in the baseline examination in 1988-1990 and up to 4 follow-up examinations in 1993-1995, 1998-2000, 2003-2005, and 2008-2010. EXPOSURES Serum markers of inflammation (high-sensitivity C-reactive protein, tumor necrosis factor-α receptor 2, interleukin-6, and white blood cell count), oxidative stress (8-isoprostane and total carbonyl content), and endothelial dysfunction (soluble vascular cell adhesion molecule-1 and soluble intercellular adhesion molecule-1) were measured. Interactions with complement factor H (rs1061170), age-related maculopathy susceptibility 2 (rs10490924), complement component 3 (rs2230199), and complement component 2/complement factor B (rs4151667) were examined using multiplicative models. Age-related macular degeneration was assessed from fundus photographs. MAIN OUTCOMES AND MEASURES Early AMD defined by the presence of any size drusen and the presence of pigmentary abnormalities or by the presence of large-sized drusen (≥125-μm diameter) in the absence of late AMD. RESULTS The 20-year cumulative incidence of early AMD was 23.0%. Adjusting for age, sex, and other risk factors, high-sensitivity C-reactive protein (odds ratio comparing fourth with first quartile, 2.18; P = .005), tumor necrosis factor-α receptor 2 (odds ratio, 1.78; P = .04), and interleukin-6 (odds ratio, 1.78; P = .03) were associated with the incidence of early AMD. Increased incidence of early AMD was associated with soluble vascular cell adhesion molecule-1 (odds ratio per SD on the logarithmic scale, 1.21; P = .04). CONCLUSIONS AND RELEVANCE We found modest evidence of relationships of serum high-sensitivity C-reactive protein, tumor necrosis factor-α receptor 2, interleukin-6, and soluble vascular cell adhesion molecule-1 to the 20-year cumulative incidence of early AMD independent of age, smoking status, and other factors. It is not known whether these associations represent a cause and effect relationship or whether other unknown confounders accounted for the findings. Even if inflammatory processes are a cause of early AMD, it is not known whether interventions that reduce systemic inflammatory processes will reduce the incidence of early AMD.

  6. THE BIOLOGICAL ACTIVITY OF SOLUBLE ANTIGEN-ANTIBODY COMPLEXES

    PubMed Central

    Ishizaka, Kimishige; Ishizaka, Teruko; Campbell, Dan H.

    1959-01-01

    Soluble BSA-anti-BSA complexes, formed in antigen excess, give immediate skin reactions in normal guinea pigs. The mechanism of the reaction is not that of passive or reversed passive anaphylaxis. The complex itself is toxic. Skin activity of the complex depends on its composition. It has become obvious that the complex composed of two antigen molecules and one antibody molecule, (Ag2Ab), does not have the activity, whereas, Ag3Ab2 and more complicated complexes do. The role of complement as well as speculation on the structural changes of antibody-antigen complexes is presented. PMID:13620844

  7. The electronic structure of VO in its ground and electronically excited states: A combined matrix isolation and quantum chemical (MRCI) study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hübner, Olaf; Hornung, Julius; Himmel, Hans-Jörg, E-mail: hans-jorg.himmel@aci.uni-heidelberg.de

    2015-07-14

    The electronic ground and excited states of the vanadium monoxide (VO) molecule were studied in detail. Electronic absorption spectra for the molecule isolated in Ne matrices complement the previous gas-phase spectra. A thorough quantum chemical (multi-reference configuration interaction) study essentially confirms the assignment and characterization of the electronic excitations observed for VO in the gas-phase and in Ne matrices and allows the clarification of open issues. It provides a complete overview over the electronically excited states up to about 3 eV of this archetypical compound.

  8. Complementation of a red-light-indifferent cyanobacterial mutant.

    PubMed Central

    Chiang, G G; Schaefer, M R; Grossman, A R

    1992-01-01

    Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

  9. Phenotypic characterization of ten methanol oxidation (Mox) mutant classes in methylobacterium AM1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nunn, D.N.; Lidstrom, M.E.

    Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium strain AM1 have been characterized by complementation analysis and assigned to ten complementation groups, Mox A1,A2,A3 and B-H. We have characterized each of the mutants belonging to the ten Mox complementation groups by PMS-DCPIP dye linked methanol dehydrogenase activity, by methanol-dependent whole cell oxygen consumption, by the presence or absence of methanol dehydrogenase protein by SDS-polyacrylamide gels and Western blotting, by the absorption spectra of purified mutant methanol dehydrogenase proteins and by the presence or absence of the soluble cytochrome c proteins of Methylobacterium AM1. We propose functions for each ofmore » the genes deficient in the mutants of the ten Mox complementation groups. These functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the PQQ prosthetic group with the methanol dehydrogenase apoprotein and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol. 24 refs., 5 figs., 2 tabs.« less

  10. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

  11. 2016 White Paper on recent issues in bioanalysis: focus on biomarker assay validation (BAV): (Part 3 - LBA, biomarkers and immunogenicity).

    PubMed

    Richards, Susan; Amaravadi, Lakshmi; Pillutla, Renuka; Birnboeck, Herbert; Torri, Albert; Cowan, Kyra J; Papadimitriou, Apollon; Garofolo, Fabio; Satterwhite, Christina; Piccoli, Steven; Wu, Bonnie; Krinos-Fiorotti, Corinna; Allinson, John; Berisha, Flora; Cocea, Laurent; Croft, Stephanie; Fraser, Stephanie; Galliccia, Fabrizio; Gorovits, Boris; Gupta, Swati; Gupta, Vinita; Haidar, Sam; Hottenstein, Charles; Ishii-Watabe, Akiko; Jani, Darshana; Kadavil, John; Kamerud, John; Kramer, Daniel; Litwin, Virginia; Lima Santos, Gustavo Mendes; Nelson, Robert; Ni, Yan; Pedras-Vasconcelos, João; Qiu, Yongchang; Rhyne, Paul; Safavi, Afshin; Saito, Yoshiro; Savoie, Natasha; Scheibner, Kara; Schick, Eginhard; Siguenza, Patricia Y; Smeraglia, John; Staack, Roland F; Subramanyam, Meena; Sumner, Giane; Thway, Theingi; Uhlinger, David; Ullmann, Martin; Vitaliti, Alessandra; Welink, Jan; Whiting, Chan C; Xue, Li; Zeng, Rong

    2016-12-01

    The 2016 10th Workshop on Recent Issues in Bioanalysis (10th WRIB) took place in Orlando, Florida with participation of close to 700 professionals from pharmaceutical/biopharmaceutical companies, biotechnology companies, contract research organizations, and regulatory agencies worldwide. WRIB was once again a weeklong event - A Full Immersion Week of Bioanalysis for PK, Biomarkers and Immunogenicity. As usual, it is specifically designed to facilitate sharing, reviewing, discussing and agreeing on approaches to address the most current issues of interest including both small and large molecules involving LCMS, hybrid LBA/LCMS, and LBA approaches, with the focus on PK, biomarkers and immunogenicity. This 2016 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop, and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. This White Paper is published in 3 parts due to length. This part (Part 3) discusses the recommendations for large molecule bioanalysis using LBA, biomarkers and immunogenicity. Parts 1 (small molecule bioanalysis using LCMS) and Part 2 (Hybrid LBA/LCMS and regulatory inputs from major global health authorities) have been published in the Bioanalysis journal, issues 22 and 23, respectively.

  12. Human IgG is produced in a pro-form that requires clipping of C-terminal lysines for maximal complement activation

    PubMed Central

    van den Bremer, Ewald TJ; Beurskens, Frank J; Voorhorst, Marleen; Engelberts, Patrick J; de Jong, Rob N; van der Boom, Burt G; Cook, Erika M; Lindorfer, Margaret A; Taylor, Ronald P; van Berkel, Patrick HC; Parren, Paul WHI

    2015-01-01

    Human IgG is produced with C-terminal lysines that are cleaved off in circulation. The function of this modification was unknown and generally thought not to affect antibody function. We recently reported that efficient C1q binding and complement-dependent cytotoxicity (CDC) requires IgG hexamerization at the cell surface. Here we demonstrate that C-terminal lysines may interfere with this process, leading to suboptimal C1q binding and CDC of cells opsonized with C-terminal lysine-containing IgG. After we removed these lysines with a carboxypeptidase, maximal complement activation was observed. Interestingly, IgG1 mutants containing either a negative C-terminal charge or multiple positive charges lost CDC almost completely; however, CDC was fully restored by mixing C-terminal mutants of opposite charge. Our data indicate a novel post-translational control mechanism of human IgG: human IgG molecules are produced in a pro-form in which charged C-termini interfere with IgG hexamer formation, C1q binding and CDC. To allow maximal complement activation, C-terminal lysine processing is required to release the antibody's full cytotoxic potential. PMID:26037225

  13. A novel factor H-Fc chimeric immunotherapeutic molecule against Neisseria gonorrhoeae

    PubMed Central

    Shaughnessy, Jutamas; Gulati, Sunita; Agarwal, Sarika; Unemo, Magnus; Ohnishi, Makoto; Su, Xia-Hong; Monks, Brian G.; Visintin, Alberto; Madico, Guillermo; Lewis, Lisa A.; Golenbock, Douglas T.; Reed, George W.; Rice, Peter A.; Ram, Sanjay

    2015-01-01

    Neisseria gonorrhoeae (Ng), the causative agent of the sexually transmitted infection gonorrhea, has developed resistance to almost every conventional antibiotic. There is an urgent need to develop novel therapies against gonorrhea. Many pathogens, including Ng, bind the complement inhibitor factor H (FH) to evade complement-dependent killing. Sialylation of gonococcal lipooligosaccharide, as occurs in vivo, augments binding of human FH through its domains 18-20 (FH18-20). We explored the utility of fusing FH18-20 with IgG Fc (FH18-20/Fc) to create a novel anti-infective immunotherapeutic. FH18-20 also binds to select host glycosaminoglycans to limit unwanted complement activation on host cells. To identify mutation(s) in FH18-20 that eliminated complement activation on host cells, yet maintained binding to Ng, we created four mutations in domains 19 or 20 described in atypical hemolytic uremic syndrome that prevented binding of mutated fH to human erythrocytes. One of the mutant proteins (D to G at position 1119 in domain 19; FHD1119G/Fc) facilitated complement-dependent killing of gonococci similar to unmodified FH18-20/Fc, but unlike FH18-20/Fc, did not lyse human erythrocytes. FHD1119G/Fc bound to all (100%) of 15 sialylated clinical Ng isolates tested (including three contemporary ceftriaxone-resistant strains), mediated complement-dependent killing of 10/15 (67%) strains and enhanced C3 deposition (≥10-fold above baseline levels) on each of the five isolates not directly killed by complement. FHD1119G/Fc facilitated opsonophagocytic killing of a serum-resistant strain by human polymorphonuclear neutrophils. FHD1119G/Fc administered intravaginally significantly reduced the duration and burden of gonococcal infection in the mouse vaginal colonization model. FHD1119G/Fc represents a novel immunotherapeutic against multidrug-resistant Ng. PMID:26773149

  14. Multi-functional mechanisms of immune evasion by the streptococcal complement inhibitor C5a peptidase

    PubMed Central

    Reglinski, Mark; Calay, Damien; Siggins, Matthew K.; Mason, Justin C.; Botto, Marina; Sriskandan, Shiranee

    2017-01-01

    The complement cascade is crucial for clearance and control of invading pathogens, and as such is a key target for pathogen mediated host modulation. C3 is the central molecule of the complement cascade, and plays a vital role in opsonization of bacteria and recruitment of neutrophils to the site of infection. Streptococcal species have evolved multiple mechanisms to disrupt complement-mediated innate immunity, among which ScpA (C5a peptidase), a C5a inactivating enzyme, is widely conserved. Here we demonstrate for the first time that pyogenic streptococcal species are capable of cleaving C3, and identify C3 and C3a as novel substrates for the streptococcal ScpA, which are functionally inactivated as a result of cleavage 7 amino acids upstream of the natural C3 convertase. Cleavage of C3a by ScpA resulted in disruption of human neutrophil activation, phagocytosis and chemotaxis, while cleavage of C3 generated abnormally-sized C3a and C3b moieties with impaired function, in particular reducing C3 deposition on the bacterial surface. Despite clear effects on human complement, expression of ScpA reduced clearance of group A streptococci in vivo in wildtype and C5 deficient mice, and promoted systemic bacterial dissemination in mice that lacked both C3 and C5, suggesting an additional complement-independent role for ScpA in streptococcal pathogenesis. ScpA was shown to mediate streptococcal adhesion to both human epithelial and endothelial cells, consistent with a role in promoting bacterial invasion within the host. Taken together, these data show that ScpA is a multi-functional virulence factor with both complement-dependent and independent roles in streptococcal pathogenesis. PMID:28806402

  15. IFN-α and CD46 stimulation are associated with active lupus and skew natural T regulatory cell differentiation to type 1 regulatory T (Tr1) cells

    PubMed Central

    Le Buanec, Hélène; Gougeon, Marie-Lise; Mathian, Alexis; Lebon, Pierre; Dupont, Jean-Michel; Peltre, Gabriel; Hemon, Patrice; Schmid, Michel; Bizzini, Bernard; Künding, Thomas; Burny, Arsène; Bensussan, Armand; Amoura, Zahir; Gallo, Robert C.; Zagury, Daniel

    2011-01-01

    Immune suppressive activities exerted by regulatory T-cell subsets have several specific functions, including self-tolerance and regulation of adaptive immune reactions, and their dysfunction can lead to autoimmune diseases and contribute to AIDS and cancer. Two functionally distinct regulatory T-cell subsets are currently identified in peripheral tissues: thymus-developed natural T regulatory cells (nTregs) controlling self-tolerance and antiinflammatory IL-10–secreting type 1 regulatory T cells (Tr1) derived from Ag-stimulated T cells, which regulate inflammation-dependent adaptive immunity and minimize immunopathology. We establish herein that cell contact-mediated nTreg regulatory function is inhibited by inflammation, especially in the presence of the complement C3b receptor (CD46). Instead, as with other T-cell subsets, the latter inflammatory conditions of stimulation skew nTreg differentiation to Tr1 cells secreting IL-10, an effect potentiated by IFN-α. The clinical relevance of these findings was verified in a study of 152 lupus patients, in which we showed that lupus nTreg dysfunction is not due to intrinsic defects but is rather induced by C3b stimulation of CD46 and IFN-α and that these immune components of inflammation are directly associated with active lupus. These results provide a rationale for using anti–IFN-α Ab immunotherapy in lupus patients. PMID:22065791

  16. Upregulation of CD59

    PubMed Central

    Griesemer, Adam D.; Okumi, Masayoshi; Shimizu, Akira; Moran, Shannon; Ishikawa, Yoshinori; Iorio, Justin; Arn, J. Scott; Yamada, Kazuhiko

    2009-01-01

    Background Survival of ABO-mismatched kidneys with stable renal function despite the persistence of anti-ABO antibodies is called accommodation. The mechanism of accommodation is unclear, but may involve complement regulatory proteins such as CD59. The development of alpha-1,3-Galactosyltransferase knock-out (GalT-KO) swine that produce anti-Gal antibodies provides a large animal model capable of determining the role of complement regulatory proteins in accommodation. Methods ELISA and antibody FACS were used to examine the rate of anti-Gal antibody expression as a function of age. MHC-matched kidneys were transplanted from Gal-positive MGH miniature swine to MGH GalT-KO swine with systemic immunosuppression. One recipient underwent adsorbtion of anti-Gal antibodies prior to transplantation. Graft survival, antibody and complement deposition patterns and CD59 expression were determined. Results Three animals rejected Gal-positive kidneys via humoral mechanisms. One animal with low titers of anti-Gal Ab displayed spontaneous accommodation and the animal that was treated with Ab adsorbtion also displayed accommodation. Rejected grafts had deposition of IgM, IgG, C3 and C5b-9 with low expression of CD59, while accommodated grafts had low deposition of C5b-9 and high expression of CD59. Re-transplantation of one accommodated graft to a naïve GalT-KO animal confirmed that changes in the graft were responsible for the lack of C5b-9 deposition. Conclusion GalT-KO miniature swine produce anti-Gal antibodies and titers increase with age. These anti-Gal antibodies can cause rejection of MHC matched kidneys unless accommodation occurs. CD59 upregulation appears to be involved in the mechanism of accommodation by preventing the formation of the MAC on the accommodated graft. PMID:19424030

  17. Novel Roles for Immune Molecules in Neural Development: Implications for Neurodevelopmental Disorders

    PubMed Central

    Garay, Paula A.; McAllister, A. Kimberley

    2010-01-01

    Although the brain has classically been considered “immune-privileged”, current research suggests an extensive communication between the immune and nervous systems in both health and disease. Recent studies demonstrate that immune molecules are present at the right place and time to modulate the development and function of the healthy and diseased central nervous system (CNS). Indeed, immune molecules play integral roles in the CNS throughout neural development, including affecting neurogenesis, neuronal migration, axon guidance, synapse formation, activity-dependent refinement of circuits, and synaptic plasticity. Moreover, the roles of individual immune molecules in the nervous system may change over development. This review focuses on the effects of immune molecules on neuronal connections in the mammalian central nervous system – specifically the roles for MHCI and its receptors, complement, and cytokines on the function, refinement, and plasticity of geniculate, cortical and hippocampal synapses, and their relationship to neurodevelopmental disorders. These functions for immune molecules during neural development suggest that they could also mediate pathological responses to chronic elevations of cytokines in neurodevelopmental disorders, including autism spectrum disorders (ASD) and schizophrenia. PMID:21423522

  18. Intelligent Therapeutics and Metabolic Programming Through Tailormade, Ligand-Controlled RNA Switches

    DTIC Science & Technology

    2007-02-05

    lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme

  19. Staphylococcus aureus SdrE captures complement factor H's C-terminus via a novel ‘close, dock, lock and latch' mechanism for complement evasion

    PubMed Central

    Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye

    2017-01-01

    Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine–aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE–CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH1206–1226), which binds SdrE N2 and N3 domains (SdrEN2N3) with high affinity, and determined the crystal structures of apo-SdrEN2N3 and the SdrEN2N3–CFH1206–1226 complex. Comparison of the structure of the CFH–SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrEN2N3 adopts a ‘close’ state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel ‘close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a ‘clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. PMID:28258151

  20. Staphylococcus aureus SdrE captures complement factor H's C-terminus via a novel 'close, dock, lock and latch' mechanism for complement evasion.

    PubMed

    Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye; Zhang, Min; Zhang, Xuan

    2017-05-04

    Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine-aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE-CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH 1206-1226 ), which binds SdrE N2 and N3 domains (SdrE N2N3 ) with high affinity, and determined the crystal structures of apo-SdrE N2N3 and the SdrE N2N3 -CFH 1206-1226 complex. Comparison of the structure of the CFH-SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrE N2N3 adopts a 'close' state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel 'close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a 'clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. © 2017 The Author(s).

  1. Clinical roundtable monograph: Paroxysmal nocturnal hemoglobinuria: a case-based discussion.

    PubMed

    Szer, Jeff; Hill, Anita; Weitz, Ilene Ceil

    2012-11-01

    Paroxysmal nocturnal hemoglobinuria (PNH) is a rare, acquired disorder characterized by chronic intravascular hemolysis as the primary clinical manifestation and morbidities that include anemia, thrombosis, renal impairment, pulmonary hypertension, and bone marrow failure. The prevalence of the PNH clone (from <1-100% PNH granulocytes) is approximately 16 per million, and careful monitoring is required. The average age of onset of the clinical disease is the early 30s, although it can present at all ages. PNH is caused by the acquisition of a somatic mutation of the gene phosphatidylinositol glycan anchor (PIG-A) in a multipotent hematopoietic stem cell (HSC), with clonal expansion of the mutated HSC. The mutation causes a deficiency in the synthesis of glycosylphosphatidylinositol (GPI). In cells derived from normal HSCs, the complement regulatory proteins CD55 and CD59 are anchored to the hematopoietic cell membrane surface via GPI, protecting the cells from complement-mediated lysis. However, in patients with PNH, these 2 proteins, along with numerous other GPI-linked proteins, are absent from the cell surface of red cells, granulocytes, monocytes, and platelets, resulting in complement-mediated intravascular hemolysis and other complications. Lysis of red blood cells is the most obvious manifestation, but as other cell lineages are also affected, this complement-mediated attack contributes to additional complications, such as thrombosis. Eculizumab, a humanized monoclonal antibody against the C5 complement protein, is the only effective drug therapy for PNH patients. The antibody prevents cleavage of the C5 protein by C5 convertase, in turn preventing generation of C5b-9 and release of C5a, thereby protecting from hemolysis of cells lacking the CD59 surface protein and other complications associated with complement activation. Drs. Ilene C. Weitz, Anita Hill, and Jeff Szer discuss 3 recent cases of patients with PNH.

  2. Nitrogen modulation of legume root architecture signaling pathways involves phytohormones and small regulatory molecules.

    PubMed

    Mohd-Radzman, Nadiatul A; Djordjevic, Michael A; Imin, Nijat

    2013-10-01

    Nitrogen, particularly nitrate is an important yield determinant for crops. However, current agricultural practice with excessive fertilizer usage has detrimental effects on the environment. Therefore, legumes have been suggested as a sustainable alternative for replenishing soil nitrogen. Legumes can uniquely form nitrogen-fixing nodules through symbiotic interaction with specialized soil bacteria. Legumes possess a highly plastic root system which modulates its architecture according to the nitrogen availability in the soil. Understanding how legumes regulate root development in response to nitrogen availability is an important step to improving root architecture. The nitrogen-mediated root development pathway starts with sensing soil nitrogen level followed by subsequent signal transduction pathways involving phytohormones, microRNAs and regulatory peptides that collectively modulate the growth and shape of the root system. This review focuses on the current understanding of nitrogen-mediated legume root architecture including local and systemic regulations by different N-sources and the modulations by phytohormones and small regulatory molecules.

  3. Ionic tethering contributes to the conformational stability and function of complement C3b.

    PubMed

    López-Perrote, Andrés; Harrison, Reed E S; Subías, Marta; Alcorlo, Martín; Rodríguez de Córdoba, Santiago; Morikis, Dimitrios; Llorca, Oscar

    2017-05-01

    C3b, the central component of the alternative pathway (AP) of the complement system, coexists as a mixture of conformations in solution. These conformational changes can affect interactions with other proteins and complement regulators. Here we combine a computational model for electrostatic interactions within C3b with molecular imaging to study the conformation of C3b. The computational analysis shows that the TED domain in C3b is tethered ionically to the macroglobulin (MG) ring. Monovalent counterion concentration affects the magnitude of electrostatic forces anchoring the TED domain to the rest of the C3b molecule in a thermodynamic model. This is confirmed by observing NaCl concentration dependent conformational changes using single molecule electron microscopy (EM). We show that the displacement of the TED domain is compatible with C3b binding to Factor B (FB), suggesting that the regulation of the C3bBb convertase could be affected by conditions that promote movement in the TED domain. Our molecular model also predicts mutations that could alter the positioning of the TED domain, including the common R102G polymorphism, a risk variant for developing age-related macular degeneration. The common C3b isoform, C3bS, and the risk isoform, C3bF, show distinct energetic barriers to displacement in the TED that are related to a network of electrostatic interactions at the interface of the TED and MG-ring domains of C3b. These computational predictions agree with experimental evidence that shows differences in conformation observed in C3b isoforms purified from homozygous donors. Altogether, we reveal an ionic, reversible attachment of the TED domain to the MG ring that may influence complement regulation in some mutations and polymorphisms of C3b. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Complement anaphylatoxin C3a is a potent inducer of embryonic chick retina regeneration

    PubMed Central

    Haynes, Tracy; Luz-Madrigal, Agustin; Reis, Edimara S.; Echeverri Ruiz, Nancy P.; Grajales-Esquivel, Erika; Tzekou, Apostolia; Tsonis, Panagiotis A.; Lambris, John D.; Del Rio-Tsonis, Katia

    2013-01-01

    Identifying the initiation signals for tissue regeneration in vertebrates is one of the major challenges in regenerative biology. Much of the research thus far has indicated that certain growth factors have key roles. Here we show that complement fragment C3a is sufficient to induce complete regeneration of the embryonic chick retina from stem/progenitor cells present in the eye, independent of fibroblast growth factor receptor signaling. Instead, C3a induces retina regeneration via STAT3 activation, which in turn activates the injury- and inflammation-responsive factors, IL-6, IL-8 and TNF-α. This activation sets forth regulation of Wnt2b, Six3 and Sox2, genes associated with retina stem and progenitor cells. Thus, our results establish a mechanism for retina regeneration based on injury and inflammation signals. Furthermore, our results indicate a unique function for complement anaphylatoxins that implicate these molecules in the induction and complete regeneration of the retina, opening new avenues of experimentation in the field. PMID:23942241

  5. Complement activation by ligand-driven juxtaposition of discrete pattern recognition complexes

    PubMed Central

    Degn, Søren E.; Kjaer, Troels R.; Kidmose, Rune T.; Jensen, Lisbeth; Hansen, Annette G.; Tekin, Mustafa; Jensenius, Jens C.; Andersen, Gregers R.; Thiel, Steffen

    2014-01-01

    Defining mechanisms governing translation of molecular binding events into immune activation is central to understanding immune function. In the lectin pathway of complement, the pattern recognition molecules (PRMs) mannan-binding lectin (MBL) and ficolins complexed with the MBL-associated serine proteases (MASP)-1 and MASP-2 cleave C4 and C2 to generate C3 convertase. MASP-1 was recently found to be the exclusive activator of MASP-2 under physiological conditions, yet the predominant oligomeric forms of MBL carry only a single MASP homodimer. This prompted us to investigate whether activation of MASP-2 by MASP-1 occurs through PRM-driven juxtaposition on ligand surfaces. We demonstrate that intercomplex activation occurs between discrete PRM/MASP complexes. PRM ligand binding does not directly escort the transition of MASP from zymogen to active enzyme in the PRM/MASP complex; rather, clustering of PRM/MASP complexes directly causes activation. Our results support a clustering-based mechanism of activation, fundamentally different from the conformational model suggested for the classical pathway of complement. PMID:25197071

  6. Heterologous expression of the Phycomyces blakesleeanus phytoene dehydrogenase gene (carB) in Mucor circinelloides.

    PubMed

    Ruiz-Hidalgo, M J; Eslava, A P; Alvarez, M I; Benito, E P

    1999-11-01

    A phytoene dehydrogenase-deficient mutant of Mucor circinelloides accumulating only phytoene was transformed with the gene encoding the corresponding enzyme (carB gene) of Phycomyces blakesleeanus. Carotenoids derived from phytoene were detected in the transformants showing that the P. blakesleeanus carB gene complements the M. circinelloides carB mutation. These newly formed carotenoids accumulated in low quantities, indicating that functional complementation was poor. carB mRNA molecules correctly transcribed were detected in the transformants, but they represented a small proportion of the total population of carB-derived mRNAs, mostly constituted by truncated transcripts and by transcripts longer than the transcript that is functional in Phycomyces. These results showed that the P. blakesleeanus carB gene was expressed in M. circinelloides and suggested that the poor complementation observed was owing, at least in part, to the lack of specificity in the recognition of the transcription initiation and termination signals of the P. blakesleeanus carB gene by the M. circinelloides transcriptional machinery.

  7. Deficiency in Mannose-Binding Lectin-Associated Serine Protease-2 Does Not Increase Susceptibility to Trypanosoma cruzi Infection

    PubMed Central

    Ribeiro, Carolina H.; Lynch, Nicholas J.; Stover, Cordula M.; Ali, Youssif M.; Valck, Carolina; Noya-Leal, Francisca; Schwaeble, Wilhelm J.; Ferreira, Arturo

    2015-01-01

    Trypanosoma cruzi is the causative agent of Chagas' disease, a chronic illness affecting 10 million people around the world. The complement system plays an important role in fighting microbial infections. The recognition molecules of the lectin pathway of complement activation, mannose-binding lectin (MBL), ficolins, and CL-11, bind to specific carbohydrates on pathogens, triggering complement activation through MBL-associated serine protease-2 (MASP-2). Previous in vitro work showed that human MBL and ficolins contribute to T. cruzi lysis. However, MBL-deficient mice are only moderately compromised in their defense against the parasite, as they may still activate the lectin pathway through ficolins and CL-11. Here, we assessed MASP-2-deficient mice, the only presently available mouse line with total lectin pathway deficiency, for a phenotype in T. cruzi infection. Total absence of lectin pathway functional activity did not confer higher susceptibility to T. cruzi infection, suggesting that it plays a minor role in the immune response against this parasite. PMID:25548381

  8. Disruption of the nitrogen regulatory gene AcareA in Acremonium chrysogenum leads to reduction of cephalosporin production and repression of nitrogen metabolism.

    PubMed

    Li, Jinyang; Pan, Yuanyuan; Liu, Gang

    2013-12-01

    AcareA, encoding a homologue of the fungal nitrogen regulatory GATA zinc-finger proteins, was cloned from Acremonium chrysogenum. Gene disruption and genetic complementation revealed that AcareA was required for nitrogen metabolism and cephalosporin production. Disruption of AcareA resulted in growth defect in the medium using nitrate, uric acid and low concentration of ammonium, glutamine or urea as sole nitrogen source. Transcriptional analysis showed that the transcription of niaD/niiA was increased drastically when induced with nitrate in the wild-type and AcareA complemented strains but not in AcareA disruption mutant. Consistent with the reduction of cephalosporin production, the transcription of pcbAB, cefD2, cefEF and cefG encoding the enzymes for cephalosporin production was reduced in AcareA disruption mutant. Band shift assays showed that AcAREA bound to the promoter regions of niaD, niiA and the bidirectional promoter region of pcbAB-pcbC. Sequence analysis showed that all the AcAREA binding sites contain the consensus GATA elements. These results indicated that AcAREA plays an important role both in the regulation of nitrogen metabolism and cephalosporin production in A. chrysogenum. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.

    PubMed

    Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner

    2007-01-24

    A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.

  10. Multi-scale genetic dynamic modelling I : an algorithm to compute generators.

    PubMed

    Kirkilionis, Markus; Janus, Ulrich; Sbano, Luca

    2011-09-01

    We present a new approach or framework to model dynamic regulatory genetic activity. The framework is using a multi-scale analysis based upon generic assumptions on the relative time scales attached to the different transitions of molecular states defining the genetic system. At micro-level such systems are regulated by the interaction of two kinds of molecular players: macro-molecules like DNA or polymerases, and smaller molecules acting as transcription factors. The proposed genetic model then represents the larger less abundant molecules with a finite discrete state space, for example describing different conformations of these molecules. This is in contrast to the representations of the transcription factors which are-like in classical reaction kinetics-represented by their particle number only. We illustrate the method by considering the genetic activity associated to certain configurations of interacting genes that are fundamental to modelling (synthetic) genetic clocks. A largely unknown question is how different molecular details incorporated via this more realistic modelling approach lead to different macroscopic regulatory genetic models which dynamical behaviour might-in general-be different for different model choices. The theory will be applied to a real synthetic clock in a second accompanying article (Kirkilioniset al., Theory Biosci, 2011).

  11. Design of an ectoine-responsive AraC mutant and its application in metabolic engineering of ectoine biosynthesis.

    PubMed

    Chen, Wei; Zhang, Shan; Jiang, Peixia; Yao, Jun; He, Yongzhi; Chen, Lincai; Gui, Xiwu; Dong, Zhiyang; Tang, Shuang-Yan

    2015-07-01

    Advanced high-throughput screening methods for small molecules may have important applications in the metabolic engineering of the biosynthetic pathways of these molecules. Ectoine is an excellent osmoprotectant that has been widely used in cosmetics. In this study, the Escherichia coli regulatory protein AraC was engineered to recognize ectoine as its non-natural effector and to activate transcription upon ectoine binding. As an endogenous reporter of ectoine, the mutated AraC protein was successfully incorporated into high-throughput screening of ectoine hyper-producing strains. The ectoine biosynthetic cluster from Halomonas elongata was cloned into E. coli. By engineering the rate-limiting enzyme L-2,4-diaminobutyric acid (DABA) aminotransferase (EctB), ectoine production and the specific activity of the EctB mutant were increased. Thus, these results demonstrated the effectiveness of engineering regulatory proteins into sensitive and rapid screening tools for small molecules and highlighted the importance and efficacy of directed evolution strategies applied to the engineering of genetic components for yield improvement in the biosynthesis of small molecules. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  12. Altered Functionality of Anti-Bacterial Antibodies in Patients with Chronic Hepatitis C Virus Infection

    PubMed Central

    Lamontagne, Anne; Long, Ronald E.; Comunale, Mary Ann; Hafner, Julie; Rodemich-Betesh, Lucy; Wang, Mengjun; Marrero, Jorge; Di Bisceglie, Adrian M.; Block, Timothy; Mehta, Anand

    2013-01-01

    Background Using comparative glycoproteomics, we have previously identified a glycoprotein that is altered in both amount and glycosylation as a function of liver cirrhosis. The altered glycoprotein is an agalactosylated (G0) immunoglobulin G molecule (IgG) that recognizes the heterophilic alpha-gal epitope. Since the alpha gal epitope is found on gut enterobacteria, it has been hypothesized that anti-gal antibodies are generated as a result of increased bacterial exposure in patients with liver disease. Methods The N-linked glycosylation of anti-gal IgG molecules from patients with fibrosis and cirrhosis was determined and the effector function of anti-bacterial antibodies from over 100 patients examined. In addition, markers of microbial exposure were determined. Results Surprisingly, the subset of agalactosylated anti-gal antibodies described here, was impaired in their ability to mediate complement mediated lysis and inhibited the complement-mediated destruction of common gut bacteria. In an analysis of serum from more than 100 patients with liver disease, we have shown that those with increased levels of this modified anti-gal antibody had increased levels of markers of bacterial exposure. Conclusions Anti-gal antibodies in patients with liver cirrhosis were reduced in their ability to mediate complement mediated lysis of target cells. As bacterial infection is a major complication in patients with cirrhosis and bacterial products such as LPS are thought to play a major role in the development and progression of liver fibrosis, this finding has many clinical implications in the etiology, prognosis and treatment of liver disease. PMID:23750224

  13. Development and validation of a high-content bimolecular fluorescence complementation assay for small-molecule inhibitors of HIV-1 Nef dimerization.

    PubMed

    Poe, Jerrod A; Vollmer, Laura; Vogt, Andreas; Smithgall, Thomas E

    2014-04-01

    Nef is a human immunodeficiency virus 1 (HIV-1) accessory factor essential for viral pathogenesis and AIDS progression. Many Nef functions require dimerization, and small molecules that block Nef dimerization may represent antiretroviral drug leads. Here we describe a cell-based assay for Nef dimerization inhibitors based on bimolecular fluorescence complementation (BiFC). Nef was fused to nonfluorescent, complementary fragments of yellow fluorescent protein (YFP) and coexpressed in the same cell population. Dimerization of Nef resulted in juxtaposition of the YFP fragments and reconstitution of the fluorophore. For automation, the Nef-YFP fusion proteins plus a monomeric red fluorescent protein (mRFP) reporter were expressed from a single vector, separated by picornavirus "2A" linker peptides to permit equivalent translation of all three proteins. Validation studies revealed a critical role for gating on the mRFP-positive subpopulation of transfected cells, as well as use of the mRFP signal to normalize the Nef-BiFC signal. Nef-BiFC/mRFP ratios resulting from cells expressing wild-type versus dimerization-defective Nef were very clearly separated, with Z factors consistently in the 0.6 to 0.7 range. A fully automated pilot screen of the National Cancer Institute Diversity Set III identified several hit compounds that reproducibly blocked Nef dimerization in the low micromolar range. This BiFC-based assay has the potential to identify cell-active small molecules that directly interfere with Nef dimerization and function.

  14. Development and Validation of a High-Content Bimolecular Fluorescence Complementation Assay for Small Molecule Inhibitors of HIV-1 Nef Dimerization

    PubMed Central

    Poe, Jerrod A.; Vollmer, Laura; Vogt, Andreas; Smithgall, Thomas E.

    2014-01-01

    Nef is an HIV-1 accessory factor essential for viral pathogenesis and AIDS progression. Many Nef functions require dimerization, and small molecules that block Nef dimerization may represent antiretroviral drug leads. Here we describe a cell-based assay for Nef dimerization inhibitors based on bimolecular fluorescence complementation (BiFC). Nef was fused to non-fluorescent, complementary fragments of YFP and co-expressed in the same cell population. Dimerization of Nef resulted in juxtaposition of the YFP fragments and reconstitution of the fluorophore. For automation, the Nef-YFP fusion proteins plus an mRFP reporter were expressed from a single vector, separated by picornavirus ‘2A’ linker peptides to permit equivalent translation of all three proteins. Validation studies revealed a critical role for gating on the mRFP-positive subpopulation of transfected cells, as well as use of the mRFP signal to normalize the Nef-BiFC signal. Nef-BiFC/mRFP ratios resulting from cells expressing wild-type vs. dimerization-defective Nef were very clearly separated, with Z-factors consistently in the 0.6–0.7 range. A fully automated pilot screen of the NIH Diversity Set III identified several hit compounds that reproducibly blocked Nef dimerization in the low micromolar range. This BiFC-based assay has the potential to identify cell-active small molecules that directly interfere with Nef dimerization and function. PMID:24282155

  15. Structural Model for Covalent Adhesion of the Streptococcus pyogenes Pilus through a Thioester Bond*

    PubMed Central

    Linke-Winnebeck, Christian; Paterson, Neil G.; Young, Paul G.; Middleditch, Martin J.; Greenwood, David R.; Witte, Gregor; Baker, Edward N.

    2014-01-01

    The human pathogen Streptococcus pyogenes produces pili that are essential for adhesion to host surface receptors. Cpa, the adhesin at the pilus tip, was recently shown to have a thioester-containing domain. The thioester bond is believed to be important in adhesion, implying a mechanism of covalent attachment analogous to that used by human complement factors. Here, we have characterized a second active thioester-containing domain on Cpa, the N-terminal domain of Cpa (CpaN). Expression of CpaN in Escherichia coli gave covalently linked dimers. These were shown by x-ray crystallography and mass spectrometry to comprise two CpaN molecules cross-linked by the polyamine spermidine following reaction with the thioester bonds. This cross-linked CpaN dimer provides a model for the covalent attachment of Cpa to target receptors and thus the streptococcal pilus to host cells. Similar thioester domains were identified in cell wall proteins of other Gram-positive pathogens, suggesting that thioester domains are more widely used and provide a mechanism of adhesion by covalent bonding to target molecules on host cells that mimics that used by the human complement system to eliminate pathogens. PMID:24220033

  16. Potential influences of complement factor H in autoimmune inflammatory and thrombotic disorders.

    PubMed

    Ferluga, Janez; Kouser, Lubna; Murugaiah, Valarmathy; Sim, Robert B; Kishore, Uday

    2017-04-01

    Complement system homeostasis is important for host self-protection and anti-microbial immune surveillance, and recent research indicates roles in tissue development and remodelling. Complement also appears to have several points of interaction with the blood coagulation system. Deficiency and altered function due to gene mutations and polymorphisms in complement effectors and regulators, including Factor H, have been associated with familial and sporadic autoimmune inflammatory - thrombotic disorders, in which autoantibodies play a part. These include systemic lupus erythematosus, rheumatoid arthritis, atypical haemolytic uremic syndrome, anti-phospholipid syndrome and age-related macular degeneration. Such diseases are generally complex - multigenic and heterogeneous in their symptoms and predisposition/susceptibility. They usually need to be triggered by vascular trauma, drugs or infection and non-complement genetic factors also play a part. Underlying events seem to include decline in peripheral regulatory T cells, dendritic cell, and B cell tolerance, associated with alterations in lymphoid organ microenvironment. Factor H is an abundant protein, synthesised in many cell types, and its reported binding to many different ligands, even if not of high affinity, may influence a large number of molecular interactions, together with the accepted role of Factor H within the complement system. Factor H is involved in mesenchymal stem cell mediated tolerance and also contributes to self-tolerance by augmenting iC3b production and opsonisation of apoptotic cells for their silent dendritic cell engulfment via complement receptor CR3, which mediates anti-inflammatory-tolerogenic effects in the apoptotic cell context. There may be co-operation with other phagocytic receptors, such as complement C1q receptors, and the Tim glycoprotein family, which specifically bind phosphatidylserine expressed on the apoptotic cell surface. Factor H is able to discriminate between self and nonself surfaces for self-protection and anti-microbe defence. Factor H, particularly as an abundant platelet protein, may also modulate blood coagulation, having an anti-thrombotic role. Here, we review a number of interaction pathways in coagulation and in immunity, together with associated diseases, and indicate where Factor H may be expected to exert an influence, based on reports of the diversity of ligands for Factor H. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Complement factor H is expressed in adipose tissue in association with insulin resistance.

    PubMed

    Moreno-Navarrete, José María; Martínez-Barricarte, Rubén; Catalán, Victoria; Sabater, Mònica; Gómez-Ambrosi, Javier; Ortega, Francisco José; Ricart, Wifredo; Blüher, Mathias; Frühbeck, Gema; Rodríguez de Cordoba, Santiago; Fernández-Real, José Manuel

    2010-01-01

    Activation of the alternative pathway of the complement system, in which factor H (fH; complement fH [CFH]) is a key regulatory component, has been suggested as a link between obesity and metabolic disorders. Our objective was to study the associations between circulating and adipose tissue gene expressions of CFH and complement factor B (fB; CFB) with obesity and insulin resistance. Circulating fH and fB were determined by enzyme-linked immunosorbent assay in 398 subjects. CFH and CFB gene expressions were evaluated in 76 adipose tissue samples, in isolated adipocytes, and in stromovascular cells (SVC) (n = 13). The effects of weight loss and rosiglitazone were investigated in independent cohorts. Both circulating fH and fB were associated positively with BMI, waist circumference, triglycerides, and inflammatory parameters and negatively with insulin sensitivity and HDL cholesterol. For the first time, CFH gene expression was detected in human adipose tissue (significantly increased in subcutaneous compared with omental fat). CFH gene expression in omental fat was significantly associated with insulin resistance. In contrast, CFB gene expression was significantly increased in omental fat but also in association with fasting glucose and triglycerides. The SVC fraction was responsible for these differences, although isolated adipocytes also expressed fB and fH at low levels. Both weight loss and rosiglitazone led to significantly decreased circulating fB and fH levels. Increased circulating fH and fB concentrations in subjects with altered glucose tolerance could reflect increased SVC-induced activation of the alternative pathway of complement in omental adipose tissue linked to insulin resistance and metabolic disturbances.

  18. The Scl1 protein of M6-type group A Streptococcus binds the human complement regulatory protein, factor H, and inhibits the alternative pathway of complement.

    PubMed

    Caswell, Clayton C; Han, Runlin; Hovis, Kelley M; Ciborowski, Pawel; Keene, Douglas R; Marconi, Richard T; Lukomski, Slawomir

    2008-02-01

    Non-specific activation of the complement system is regulated by the plasma glycoprotein factor H (FH). Bacteria can avoid complement-mediated opsonization and phagocytosis through acquiring FH to the cell surface. Here, we characterize an interaction between the streptococcal collagen-like protein Scl1.6 of M6-type group A Streptococcus (GAS) and FH. Using affinity chromatography with immobilized recombinant Scl1.6 protein, we co-eluted human plasma proteins with molecular weight of 155 kDa, 43 kDa and 38 kDa. Mass spectrometry identified the 155 kDa band as FH and two other bands as isoforms of the FH-related protein-1. The identities of all three bands were confirmed by Western immunoblotting with specific antibodies. Structure-function relation studies determined that the globular domain of the Scl1.6 variant specifically binds FH while fused to collagenous tails of various lengths. This binding is not restricted to Scl1.6 as the phylogenetically linked Scl1.55 variant also binds FH. Functional analyses demonstrated the cofactor activity of the rScl1.6-bound FH for factor I-mediated cleavage of C3b. Finally, purified FH bound to the Scl1.6 protein present in the cell wall material obtained from M6-type GAS. In conclusion, we have identified a functional interaction between Scl1 and plasma FH, which may contribute to GAS evasion of complement-mediated opsonization and phagocytosis.

  19. Novel Scabies Mite Serpins Inhibit the Three Pathways of the Human Complement System

    PubMed Central

    Mika, Angela; Reynolds, Simone L.; Mohlin, Frida C.; Willis, Charlene; Swe, Pearl M.; Pickering, Darren A.; Halilovic, Vanja; Wijeyewickrema, Lakshmi C.; Pike, Robert N.; Blom, Anna M.; Kemp, David J.; Fischer, Katja

    2012-01-01

    Scabies is a parasitic infestation of the skin by the mite Sarcoptes scabiei that causes significant morbidity worldwide, in particular within socially disadvantaged populations. In order to identify mechanisms that enable the scabies mite to evade human immune defenses, we have studied molecules associated with proteolytic systems in the mite, including two novel scabies mite serine protease inhibitors (SMSs) of the serpin superfamily. Immunohistochemical studies revealed that within mite-infected human skin SMSB4 (54 kDa) and SMSB3 (47 kDa) were both localized in the mite gut and feces. Recombinant purified SMSB3 and SMSB4 did not inhibit mite serine and cysteine proteases, but did inhibit mammalian serine proteases, such as chymotrypsin, albeit inefficiently. Detailed functional analysis revealed that both serpins interfered with all three pathways of the human complement system at different stages of their activation. SMSB4 inhibited mostly the initial and progressing steps of the cascades, while SMSB3 showed the strongest effects at the C9 level in the terminal pathway. Additive effects of both serpins were shown at the C9 level in the lectin pathway. Both SMSs were able to interfere with complement factors without protease function. A range of binding assays showed direct binding between SMSB4 and seven complement proteins (C1, properdin, MBL, C4, C3, C6 and C8), while significant binding of SMSB3 occurred exclusively to complement factors without protease function (C4, C3, C8). Direct binding was observed between SMSB4 and the complement proteases C1s and C1r. However no complex formation was observed between either mite serpin and the complement serine proteases C1r, C1s, MASP-1, MASP-2 and MASP-3. No catalytic inhibition by either serpin was observed for any of these enzymes. In summary, the SMSs were acting at several levels mediating overall inhibition of the complement system and thus we propose that they may protect scabies mites from complement-mediated gut damage. PMID:22792350

  20. Self-regulatory processes mediate the intention-behavior relation for adherence and exercise behaviors.

    PubMed

    de Bruin, Marijn; Sheeran, Paschal; Kok, Gerjo; Hiemstra, Anneke; Prins, Jan M; Hospers, Harm J; van Breukelen, Gerard J P

    2012-11-01

    Understanding the gap between people's intentions and actual health behavior is an important issue in health psychology. Our aim in this study was to investigate whether self-regulatory processes (monitoring goal progress and responding to discrepancies) mediate the intention-behavior relation in relation to HIV medication adherence (Study 1) and intensive exercise behavior (Study 2). In Study 1, questionnaire and electronically monitored adherence data were collected at baseline and 3 months later from patients in the control arm of an HIV-adherence intervention study. In Study 2, questionnaire data was collected at 3 time points 6-weeks apart in a cohort study of physical activity. Complete data at all time points were obtained from 51 HIV-infected patients and 499 intensive exercise participants. Intentions were good predictors of behavior and explained 25 to 30% of the variance. Self-regulatory processes explained an additional 11% (Study 1) and 6% (Study 2) of variance in behavior on top of intentions. Regression and bootstrap analyses revealed at least partial, and possibly full, mediation of the intention-behavior relation by self-regulatory processes. The present studies indicate that self-regulatory processes may explain how intentions drive behavior. Future tests, using different health behaviors and experimental designs, could firmly establish whether self-regulatory processes complement current health behavior theories and should become routine targets for intervention. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  1. Intercellular adhesion molecules (ICAMs) and spermatogenesis

    PubMed Central

    Xiao, Xiang; Mruk, Dolores D.; Cheng, C. Yan

    2013-01-01

    BACKGROUND During the seminiferous epithelial cycle, restructuring takes places at the Sertoli–Sertoli and Sertoli–germ cell interface to accommodate spermatogonia/spermatogonial stem cell renewal via mitosis, cell cycle progression and meiosis, spermiogenesis and spermiation since developing germ cells, in particular spermatids, move ‘up and down’ the seminiferous epithelium. Furthermore, preleptotene spermatocytes differentiated from type B spermatogonia residing at the basal compartment must traverse the blood–testis barrier (BTB) to enter the adluminal compartment to prepare for meiosis at Stage VIII of the epithelial cycle, a process also accompanied by the release of sperm at spermiation. These cellular events that take place at the opposite ends of the epithelium are co-ordinated by a functional axis designated the apical ectoplasmic specialization (ES)—BTB—basement membrane. However, the regulatory molecules that co-ordinate cellular events in this axis are not known. METHODS Literature was searched at http://www.pubmed.org and http://scholar.google.com to identify published findings regarding intercellular adhesion molecules (ICAMs) and the regulation of this axis. RESULTS Members of the ICAM family, namely ICAM-1 and ICAM-2, and the biologically active soluble ICAM-1 (sICAM-1) are the likely regulatory molecules that co-ordinate these events. sICAM-1 and ICAM-1 have antagonistic effects on the Sertoli cell tight junction-permeability barrier, involved in Sertoli cell BTB restructuring, whereas ICAM-2 is restricted to the apical ES, regulating spermatid adhesion during the epithelial cycle. Studies in other epithelia/endothelia on the role of the ICAM family in regulating cell movement are discussed and this information has been evaluated and integrated into studies of these proteins in the testis to create a hypothetical model, depicting how ICAMs regulate junction restructuring events during spermatogenesis. CONCLUSIONS ICAMs are crucial regulatory molecules of spermatogenesis. The proposed hypothetical model serves as a framework in designing functional experiments for future studies. PMID:23287428

  2. Regulation of the Synthesis of the Angucyclinone Antibiotic Alpomycin in Streptomyces ambofaciens by the Autoregulator Receptor AlpZ and Its Specific Ligand▿

    PubMed Central

    Bunet, Robert; Mendes, Marta V.; Rouhier, Nicolas; Pang, Xiuhua; Hotel, Laurence; Leblond, Pierre; Aigle, Bertrand

    2008-01-01

    Streptomyces ambofaciens produces an orange pigment and the antibiotic alpomycin, both of which are products of a type II polyketide synthase gene cluster identified in each of the terminal inverted repeats of the linear chromosome. Five regulatory genes encoding Streptomyces antibiotic regulatory proteins (alpV, previously shown to be an essential activator gene; alpT; and alpU) and TetR family receptors (alpZ and alpW) were detected in this cluster. Here, we demonstrate that AlpZ, which shows high similarity to γ-butyrolactone receptors, is at the top of a pathway-specific regulatory hierarchy that prevents synthesis of the alp polyketide products. Deletion of the two copies of alpZ resulted in the precocious production of both alpomycin and the orange pigment, suggesting a repressor role for AlpZ. Consistent with this, expression of the five alp-located regulatory genes and of two representative biosynthetic structural genes (alpA and alpR) was induced earlier in the alpZ deletion strain. Furthermore, recombinant AlpZ was shown to bind to specific DNA sequences within the promoter regions of alpZ, alpV, and alpXW, suggesting direct transcriptional control of these genes by AlpZ. Analysis of solvent extracts of S. ambofaciens cultures identified the existence of a factor which induces precocious production of alpomycin and pigment in the wild-type strain and which can disrupt the binding of AlpZ to its DNA targets. This activity is reminiscent of γ-butyrolactone-type molecules. However, the AlpZ-interacting molecule(s) was shown to be resistant to an alkali treatment capable of inactivating γ-butyrolactones, suggesting that the AlpZ ligand(s) does not possess a lactone functional group. PMID:18296523

  3. Peptides of a major histocompatibility complex class I (Kb) molecule cause prolongation of skin graft survival and induce specific down-regulatory T cells demonstrable in the mixed lymphocyte reaction.

    PubMed Central

    Brondz, B D; Kazansky, D B; Chernyshova, A D; Ivanov, V S

    1995-01-01

    Six individual peptides of the major histocompatibility complex (MHC) class I molecule H-2Kb were synthesized. Intravenous injection of peptide 6 into mice prolonged the survival of Kb (BL/6 or B10.MBR) skin grafts on allogeneic R101 and B10.AKM mice, respectively. This was specific, as control skin grafts from Kk (B10.BR) or Kd (DBA/2) donors, respectively, were rejected at the same time in both control and peptide-treated mice. The optimal doses for peptide 6, which is from the alpha 2 domain, were defined. The test system was the inhibition of proliferation in vitro of naive lymph node cells by syngeneic mitomycin c-treated spleen cells from R101 mice preimmunized with irradiated stimulator splenocytes of Kb (BL/6) origin. Down-regulation was specific, as proliferation in response to third-party allogeneic stimulator Kk (B10.BR) splenocytes was not inhibited. Of the six peptides of H-2Kb tested, potent down-regulatory cells were induced by peptides 2 (alpha 1 domain) and 5 and 6 (alpha 2 domain). The greatest down-regulatory activity was obtained by giving peptide 2 to mice that had already been immunized against H-2Kb by injecting EL4 cells. Under the same conditions, injecting peptide 2 did not induce any cytotoxic T cells. In contrast, specific cytotoxic lymphocytes (CTL) were induced when cells from primed mice were incubated for 4 days with heated stimulator cells from BL/6 mice. The data suggest that peptides from MHC class I molecules activate precursors of down-regulatory T cells, but not of CTL, and this may explain their ability to prolong skin allograft survival. PMID:7490121

  4. Role of Lymphocyte Activation Gene-3 (Lag-3) in Conventional and Regulatory T Cell Function in Allogeneic Transplantation

    PubMed Central

    Sega, Emanuela I.; Leveson-Gower, Dennis B.; Florek, Mareike; Schneidawind, Dominik; Luong, Richard H.; Negrin, Robert S.

    2014-01-01

    Lag-3 has emerged as an important molecule in T cell biology. We investigated the role of Lag-3 in conventional T cell (Tcon) and regulatory T cell (Treg) function in murine GVHD with the hypothesis that Lag-3 engagement diminishes alloreactive T cell responses after bone marrow transplantation. We demonstrate that Lag-3 deficient Tcon (Lag-3−/− Tcon) induce significantly more severe GVHD than wild type (WT) Tcon and that the absence of Lag-3 on CD4 but not CD8 T cells is responsible for exacerbating GVHD. Lag-3−/− Tcon exhibited increased activation and proliferation as indicated by CFSE and bioluminescence imaging analyses and higher levels of activation markers such as CD69, CD107a, granzyme B, and Ki-67 as well as production of IL-10 and IFN-g early after transplantation. Lag-3−/− Tcon were less responsive to suppression by WT Treg as compared to WT Tcon. The absence of Lag-3, however, did not impair Treg function as both Lag-3−/− and WT Treg equally suppress the proliferation of Tcon in vitro and in vivo and protect against GVHD. Further, we demonstrate that allogeneic Treg acquire recipient MHC class II molecules through a process termed trogocytosis. As MHC class II is a ligand for Lag-3, we propose a novel suppression mechanism employed by Treg involving the acquisition of host MHC-II followed by the engagement of Lag-3 on T cells. These studies demonstrate for the first time the biologic function of Lag-3 expression on conventional and regulatory T cells in GVHD and identify Lag-3 as an important regulatory molecule involved in alloreactive T cell proliferation and activation after bone marrow transplantation. PMID:24475140

  5. Regulation of the synthesis of the angucyclinone antibiotic alpomycin in Streptomyces ambofaciens by the autoregulator receptor AlpZ and its specific ligand.

    PubMed

    Bunet, Robert; Mendes, Marta V; Rouhier, Nicolas; Pang, Xiuhua; Hotel, Laurence; Leblond, Pierre; Aigle, Bertrand

    2008-05-01

    Streptomyces ambofaciens produces an orange pigment and the antibiotic alpomycin, both of which are products of a type II polyketide synthase gene cluster identified in each of the terminal inverted repeats of the linear chromosome. Five regulatory genes encoding Streptomyces antibiotic regulatory proteins (alpV, previously shown to be an essential activator gene; alpT; and alpU) and TetR family receptors (alpZ and alpW) were detected in this cluster. Here, we demonstrate that AlpZ, which shows high similarity to gamma-butyrolactone receptors, is at the top of a pathway-specific regulatory hierarchy that prevents synthesis of the alp polyketide products. Deletion of the two copies of alpZ resulted in the precocious production of both alpomycin and the orange pigment, suggesting a repressor role for AlpZ. Consistent with this, expression of the five alp-located regulatory genes and of two representative biosynthetic structural genes (alpA and alpR) was induced earlier in the alpZ deletion strain. Furthermore, recombinant AlpZ was shown to bind to specific DNA sequences within the promoter regions of alpZ, alpV, and alpXW, suggesting direct transcriptional control of these genes by AlpZ. Analysis of solvent extracts of S. ambofaciens cultures identified the existence of a factor which induces precocious production of alpomycin and pigment in the wild-type strain and which can disrupt the binding of AlpZ to its DNA targets. This activity is reminiscent of gamma-butyrolactone-type molecules. However, the AlpZ-interacting molecule(s) was shown to be resistant to an alkali treatment capable of inactivating gamma-butyrolactones, suggesting that the AlpZ ligand(s) does not possess a lactone functional group.

  6. Discovery of a general method of solving the Schrödinger and dirac equations that opens a way to accurately predictive quantum chemistry.

    PubMed

    Nakatsuji, Hiroshi

    2012-09-18

    Just as Newtonian law governs classical physics, the Schrödinger equation (SE) and the relativistic Dirac equation (DE) rule the world of chemistry. So, if we can solve these equations accurately, we can use computation to predict chemistry precisely. However, for approximately 80 years after the discovery of these equations, chemists believed that they could not solve SE and DE for atoms and molecules that included many electrons. This Account reviews ideas developed over the past decade to further the goal of predictive quantum chemistry. Between 2000 and 2005, I discovered a general method of solving the SE and DE accurately. As a first inspiration, I formulated the structure of the exact wave function of the SE in a compact mathematical form. The explicit inclusion of the exact wave function's structure within the variational space allows for the calculation of the exact wave function as a solution of the variational method. Although this process sounds almost impossible, it is indeed possible, and I have published several formulations and applied them to solve the full configuration interaction (CI) with a very small number of variables. However, when I examined analytical solutions for atoms and molecules, the Hamiltonian integrals in their secular equations diverged. This singularity problem occurred in all atoms and molecules because it originates from the singularity of the Coulomb potential in their Hamiltonians. To overcome this problem, I first introduced the inverse SE and then the scaled SE. The latter simpler idea led to immediate and surprisingly accurate solution for the SEs of the hydrogen atom, helium atom, and hydrogen molecule. The free complement (FC) method, also called the free iterative CI (free ICI) method, was efficient for solving the SEs. In the FC method, the basis functions that span the exact wave function are produced by the Hamiltonian of the system and the zeroth-order wave function. These basis functions are called complement functions because they are the elements of the complete functions for the system under consideration. We extended this idea to solve the relativistic DE and applied it to the hydrogen and helium atoms, without observing any problems such as variational collapse. Thereafter, we obtained very accurate solutions of the SE for the ground and excited states of the Born-Oppenheimer (BO) and non-BO states of very small systems like He, H(2)(+), H(2), and their analogues. For larger systems, however, the overlap and Hamiltonian integrals over the complement functions are not always known mathematically (integration difficulty); therefore we formulated the local SE (LSE) method as an integral-free method. Without any integration, the LSE method gave fairly accurate energies and wave functions for small atoms and molecules. We also calculated continuous potential curves of the ground and excited states of small diatomic molecules by introducing the transferable local sampling method. Although the FC-LSE method is simple, the achievement of chemical accuracy in the absolute energy of larger systems remains time-consuming. The development of more efficient methods for the calculations of ordinary molecules would allow researchers to make these calculations more easily.

  7. Enhanced Vibrational Spectroscopies as Tools for Small Molecule Biosensing

    PubMed Central

    Boujday, Souhir; Lamy de la Chapelle, Marc; Srajer, Johannes; Knoll, Wolfgang

    2015-01-01

    In this short summary we summarize some of the latest developments in vibrational spectroscopic tools applied for the sensing of (small) molecules and biomolecules in a label-free mode of operation. We first introduce various concepts for the enhancement of InfraRed spectroscopic techniques, including the principles of Attenuated Total Reflection InfraRed (ATR-IR), (phase-modulated) InfraRed Reflection Absorption Spectroscopy (IRRAS/PM-IRRAS), and Surface Enhanced Infrared Reflection Absorption Spectroscopy (SEIRAS). Particular attention is put on the use of novel nanostructured substrates that allow for the excitation of propagating and localized surface plasmon modes aimed at operating additional enhancement mechanisms. This is then be complemented by the description of the latest development in Surface- and Tip-Enhanced Raman Spectroscopies, again with an emphasis on the detection of small molecules or bioanalytes. PMID:26343666

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Blocking herpes simplex virus 2 glycoprotein E immune evasion as an approach to enhance efficacy of a trivalent subunit antigen vaccine for genital herpes.

    PubMed

    Awasthi, Sita; Huang, Jialing; Shaw, Carolyn; Friedman, Harvey M

    2014-08-01

    Herpes simplex virus 2 (HSV-2) subunit antigen vaccines targeting virus entry molecules have failed to prevent genital herpes in human trials. Our approach is to include a virus entry molecule and add antigens that block HSV-2 immune evasion. HSV-2 glycoprotein C (gC2) is an immune evasion molecule that inhibits complement. We previously reported that adding gC2 to gD2 improved vaccine efficacy compared to the efficacy of either antigen alone in mice and guinea pigs. Here we demonstrate that HSV-2 glycoprotein E (gE2) functions as an immune evasion molecule by binding the IgG Fc domain. HSV-2 gE2 is synergistic with gC2 in protecting the virus from antibody and complement neutralization. Antibodies produced by immunization with gE2 blocked gE2-mediated IgG Fc binding and cell-to-cell spread. Mice immunized with gE2 were only partially protected against HSV-2 vaginal challenge in mice; however, when gE2 was added to gC2/gD2 to form a trivalent vaccine, neutralizing antibody titers with and without complement were significantly higher than those produced by gD2 alone. Importantly, the trivalent vaccine protected the dorsal root ganglia (DRG) of 32/33 (97%) mice between days 2 and 7 postchallenge, compared with 27/33 (82%) in the gD2 group. The HSV-2 DNA copy number was significantly lower in mice immunized with the trivalent vaccine than in those immunized with gD2 alone. The extent of DRG protection using the trivalent vaccine was better than what we previously reported for gC2/gD2 immunization. Therefore, gE2 is a candidate antigen for inclusion in a multivalent subunit vaccine that attempts to block HSV-2 immune evasion. Herpes simplex virus is the most common cause of genital ulcer disease worldwide. Infection results in emotional distress for infected individuals and their partners, is life threatening for infants exposed to herpes during childbirth, and greatly increases the risk of individuals acquiring and transmitting HIV infection. A vaccine that prevents genital herpes infection will have major public health benefits. Our vaccine approach includes strategies to prevent the virus from evading immune attack. Mice were immunized with a trivalent vaccine containing an antigen that induces antibodies to block virus entry and two antigens that induce antibodies that block immune evasion from antibody and complement. Immunized mice demonstrated no genital disease, and 32/33 (97%) animals had no evidence of infection of dorsal root ganglia, suggesting that the vaccine may prevent the establishment of latency and recurrent infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Ligand solvation in molecular docking.

    PubMed

    Shoichet, B K; Leach, A R; Kuntz, I D

    1999-01-01

    Solvation plays an important role in ligand-protein association and has a strong impact on comparisons of binding energies for dissimilar molecules. When databases of such molecules are screened for complementarity to receptors of known structure, as often occurs in structure-based inhibitor discovery, failure to consider ligand solvation often leads to putative ligands that are too highly charged or too large. To correct for the different charge states and sizes of the ligands, we calculated electrostatic and non-polar solvation free energies for molecules in a widely used molecular database, the Available Chemicals Directory (ACD). A modified Born equation treatment was used to calculate the electrostatic component of ligand solvation. The non-polar component of ligand solvation was calculated based on the surface area of the ligand and parameters derived from the hydration energies of apolar ligands. These solvation energies were subtracted from the ligand-receptor interaction energies. We tested the usefulness of these corrections by screening the ACD for molecules that complemented three proteins of known structure, using a molecular docking program. Correcting for ligand solvation improved the rankings of known ligands and discriminated against molecules with inappropriate charge states and sizes.

  11. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  12. Electromagnetic torque tweezers: a versatile approach for measurement of single-molecule twist and torque.

    PubMed

    Janssen, Xander J A; Lipfert, Jan; Jager, Tessa; Daudey, Renier; Beekman, Jaap; Dekker, Nynke H

    2012-07-11

    The well-established single-molecule force-spectroscopy techniques have recently been complemented by methods that can measure torque and twist directly, notably magnetic torque tweezers and the optical torque wrench. A limitation of the current torque measurement schemes is the intrinsic coupling between the force and torque degrees of freedom. Here we present electromagnetic torque tweezers (eMTT) that combine permanent and electromagnets to enable independent control of the force and torsional trap stiffness for sensitive measurements of single molecule torque and twist. Using the eMTT, we demonstrate sensitive torque measurements on tethered DNA molecules from simple tracking of the beads' (x,y)-position, obviating the need for any angular tracking algorithms or markers. Employing the eMTT for high-resolution torque measurements, we experimentally confirm the theoretically predicted torque overshoot at the DNA buckling transition in high salt conditions. We envision that the flexibility and control afforded by the eMTT will enable a range of new torque and twist measurement schemes from single-molecules to living cells.

  13. CsMAP34, a teleost MAP with dual role: A promoter of MASP-assisted complement activation and a regulator of immune cell activity.

    PubMed

    Li, Mo-Fei; Li, Jun; Sun, Li

    2016-12-23

    In teleost fish, the immune functions of mannan-binding lectin (MBL) associated protein (MAP) and MBL associated serine protease (MASP) are scarcely investigated. In the present study, we examined the biological properties both MAP (CsMAP34) and MASP (CsMASP1) molecules from tongue sole (Cynoglossus semilaevis). We found that CsMAP34 and CsMASP1 expressions occurred in nine different tissues and were upregulated by bacterial challenge. CsMAP34 protein was detected in blood, especially during bacterial infection. Recombinant CsMAP34 (rCsMAP34) bound C. semilaevis MBL (rCsBML) when the latter was activated by bacteria, while recombinant CsMASP1 (rCsMASP1) bound activated rCsBML only in the presence of rCsMAP34. rCsMAP34 stimulated the hemolytic and bactericidal activities of serum complement, whereas anti-CsMAP34 antibody blocked complement activities. Knockdown of CsMASP1 in C. semilaevis resulted in significant inhibition of complement activities. Furthermore, rCsMAP34 interacted directly with peripheral blood leukocytes (PBL) and enhanced the respiratory burst, acid phosphatase activity, chemotactic activity, and gene expression of PBL. These results indicate for the first time that a teleost MAP acts one hand as a regulator that promotes the lectin pathway of complement activation via its ability to recruit MBL to MASP, and other hand as a modulator of immune cell activity.

  14. More Than a Repair Enzyme: Aspergillus nidulans Photolyase-like CryA Is a Regulator of Sexual Development

    PubMed Central

    Bayram, Özgür; Biesemann, Christoph; Krappmann, Sven; Galland, Paul

    2008-01-01

    Cryptochromes are blue-light receptors that have presumably evolved from the DNA photolyase protein family, and the genomes of many organisms contain genes for both types of molecules. Both protein structures resemble each other, which suggests that light control and light protection share a common ancient origin. In the genome of the filamentous fungus Aspergillus nidulans, however, only one cryptochrome/photolyase-encoding gene, termed cryA, was identified. Deletion of the cryA gene triggers sexual differentiation under inappropriate culture conditions and results in up-regulation of transcripts encoding regulators of fruiting body formation. CryA is a protein whose N- and C-terminal synthetic green fluorescent protein fusions localize to the nucleus. CryA represses sexual development under UVA350-370 nm light both on plates and in submerged culture. Strikingly, CryA exhibits photorepair activity as demonstrated by heterologous complementation of a DNA repair-deficient Escherichia coli strain as well as overexpression in an A. nidulans uvsBΔ genetic background. This is in contrast to the single deletion cryAΔ strain, which does not show increased sensitivity toward UV-induced damage. In A. nidulans, cryA encodes a novel type of cryptochrome/photolyase that exhibits a regulatory function during light-dependent development and DNA repair activity. This represents a paradigm for the evolutionary transition between photolyases and cryptochromes. PMID:18495868

  15. Protons, osmolytes, and fitness of internal milieu for protein function.

    PubMed

    Somero, G N

    1986-08-01

    The composition of the intracellular milieu shows striking similarities among widely different species. Only certain values of intracellular pH, values that generally reflect alphastat regulation, and only narrow ranges of inorganic ion concentrations are found in the cytoplasm of the cells of most animals, plants, and microorganisms. In water-stressed organisms only a few types of low-molecular-weight organic molecules (osmolytes) are accumulated. These highly conserved characteristics of the intracellular fluids reflect the need to maintain critical features of macromolecules within narrow ranges optimal for life. For proteins these features include maintaining adequate rates of catalysis, a high level of regulatory responsiveness, and a precise balance between stability and lability of structure (tertiary conformation, subunit assembly, and multiprotein complexes). The optimal values for these functional and structural features of proteins often lie near the midrange of possible values for these properties, and only under specific conditions of intracellular pH, ionic strength, and osmolyte composition are these optimal midrange values conserved. In dormant cells the departure of solution conditions from values that are optimal for protein function and structure may be instrumental in reducing or shutting down metabolic functions. Seen from a broad evolutionary perspective, the evolution of the intracellular milieu is an important complement to macromolecular evolution. In certain instances appropriate modifications of the internal milieu may reduce the need for adaptive amino acid replacements in proteins.

  16. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    PubMed

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

  17. Engineering of metabolic control

    DOEpatents

    Liao, James C.

    2006-10-17

    The invention features a method of producing heterologous molecules in cells under the regulatory control of a metabolite and metabolic flux. The method can enhance the synthesis of heterologous polypeptides and metabolites.

  18. Engineering of metabolic control

    DOEpatents

    Liao, James C.

    2004-03-16

    The invention features a method of producing heterologous molecules in cells under the regulatory control of a metabolite and metabolic flux. The method can enhance the synthesis of heterologous polypeptides and metabolites.

  19. The decline of venture capital investment in early-stage life sciences poses a challenge to continued innovation.

    PubMed

    Fleming, Jonathan J

    2015-02-01

    A key element required for translating new knowledge into effective therapies is early-stage venture capital that finances the work needed to identify a lead molecule or medical device prototype and to develop it to the proof-of-concept stage. This early investment is distinguished by great uncertainty over whether the molecule or prototype is safe and effective, the stability of the regulatory standards to which clinical trials are designed, and the likelihood that large follow-on investments for commercial development can be secured. Regulatory and reimbursement policies have a profound impact on the amount of capital and the types of life science projects that investors pursue. In this article I analyze several recent trends in early-stage venture capital funding, describe how these trends are influenced by regulatory and reimbursement policies, and discuss the role of policy makers in bringing new treatments to market. Policy makers can foster renewed private investment into critically needed early-stage products by increasing Small Business Innovation Research (SBIR) funding and public support for clinical trials in targeted areas of interest; creating regulatory pathways to enable early testing of experimental compounds in limited populations; and offering economic incentives for investors and developers in designated therapeutic areas. Project HOPE—The People-to-People Health Foundation, Inc.

  20. Mechanochemical Association Reaction of Interfacial Molecules Driven by Shear.

    PubMed

    Khajeh, Arash; He, Xin; Yeon, Jejoon; Kim, Seong H; Martini, Ashlie

    2018-05-29

    Shear-driven chemical reaction mechanisms are poorly understood because the relevant reactions are often hidden between two solid surfaces moving in relative motion. Here, this phenomenon is explored by characterizing shear-induced polymerization reactions that occur during vapor phase lubrication of α-pinene between sliding hydroxylated and dehydroxylated silica surfaces, complemented by reactive molecular dynamics simulations. The results suggest that oxidative chemisorption of the α-pinene molecules at reactive surface sites, which transfers oxygen atoms from the surface to the adsorbate molecule, is the critical activation step. Such activation takes place more readily on the dehydroxylated surface. During this activation, the most strained part of the α-pinene molecules undergoes a partial distortion from its equilibrium geometry, which appears to be related to the critical activation volume for mechanical activation. Once α-pinene molecules are activated, association reactions occur between the newly attached oxygen and one of the carbon atoms in another molecule, forming ether bonds. These findings have general implications for mechanochemistry because they reveal that shear-driven reactions may occur through reaction pathways very different from their thermally induced counterparts and specifically the critical role of molecular distortion in such reactions.

  1. Monitoring Single-Molecule Protein Dynamics with a Carbon Nanotube Transistor

    NASA Astrophysics Data System (ADS)

    Collins, Philip G.

    2014-03-01

    Nanoscale electronic devices like field-effect transistors have long promised to provide sensitive, label-free detection of biomolecules. Single-walled carbon nanotubes press this concept further by not just detecting molecules but also monitoring their dynamics in real time. Recent measurements have demonstrated this premise by monitoring the single-molecule processivity of three different enzymes: lysozyme, protein Kinase A, and the Klenow fragment of DNA polymerase I. With all three enzymes, single molecules tethered to nanotube transistors were electronically monitored for 10 or more minutes, allowing us to directly observe a range of activity including rare transitions to chemically inactive and hyperactive conformations. The high bandwidth of the nanotube transistors further allow every individual chemical event to be clearly resolved, providing excellent statistics from tens of thousands of turnovers by a single enzyme. Initial success with three different enzymes indicates the generality and attractiveness of the nanotube devices as a new tool to complement other single-molecule techniques. Research on transduction mechanisms provides the design rules necessary to further generalize this architecture and apply it to other proteins. The purposeful incorporation of just one amino acid is sufficient to fabricate effective, single molecule sensors from a wide range of enzymes or proteins.

  2. A transcription factor network coordinates attraction, repulsion, and adhesion combinatorially to control motor axon pathway selection.

    PubMed

    Zarin, Aref Arzan; Asadzadeh, Jamshid; Hokamp, Karsten; McCartney, Daniel; Yang, Long; Bashaw, Greg J; Labrador, Juan-Pablo

    2014-03-19

    Combinations of transcription factors (TFs) instruct precise wiring patterns in the developing nervous system; however, how these factors impinge on surface molecules that control guidance decisions is poorly understood. Using mRNA profiling, we identified the complement of membrane molecules regulated by the homeobox TF Even-skipped (Eve), the major determinant of dorsal motor neuron (dMN) identity in Drosophila. Combinatorial loss- and gain-of-function genetic analyses of Eve target genes indicate that the integrated actions of attractive, repulsive, and adhesive molecules direct eve-dependent dMN axon guidance. Furthermore, combined misexpression of Eve target genes is sufficient to partially restore CNS exit and can convert the guidance behavior of interneurons to that of dMNs. Finally, we show that a network of TFs, comprised of eve, zfh1, and grain, induces the expression of the Unc5 and Beaten-path guidance receptors and the Fasciclin 2 and Neuroglian adhesion molecules to guide individual dMN axons. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. A Transcription Factor Network Coordinates Attraction, Repulsion, and Adhesion Combinatorially to Control Motor Axon Pathway Selection

    PubMed Central

    Zarin, Aref Arzan; Asadzadeh, Jamshid; Hokamp, Karsten; McCartney, Daniel; Yang, Long; Bashaw, Greg J.; Labrador, Juan-Pablo

    2014-01-01

    SUMMARY Combinations of transcription factors (TFs) instruct precise wiring patterns in the developing nervous system; however, how these factors impinge on surface molecules that control guidance decisions is poorly understood. Using mRNA profiling, we identified the complement of membrane molecules regulated by the homeobox TF Even-skipped (Eve), the major determinant of dorsal motor neuron (dMN) identity in Drosophila. Combinatorial loss- and gain-of-function genetic analyses of Eve target genes indicate that the integrated actions of attractive, repulsive, and adhesive molecules direct eve-dependent dMN axon guidance. Furthermore, combined misexpression of Eve target genes is sufficient to partially restore CNS exit and can convert the guidance behavior of interneurons to that of dMNs. Finally, we show that a network of TFs, comprised of eve, zfh1, and grain, induces the expression of the Unc5 and Beaten-path guidance receptors and the Fasciclin 2 and Neuroglian adhesion molecules to guide individual dMN axons. PMID:24560702

  4. In Situ Detection of Organic Molecules on the Martian Surface With the Mars Organic Molecule Analyzer (MOMA) on Exomars 2018

    NASA Technical Reports Server (NTRS)

    Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.

    2015-01-01

    The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.

  5. A review of the immune molecules in the sea cucumber.

    PubMed

    Xue, Zhuang; Li, Hui; Wang, Xiuli; Li, Xia; Liu, Yang; Sun, Jing; Liu, Cenjie

    2015-05-01

    It is very important to identify and characterize the immune-related genes that respond to pathogens. Until recently, only some of the immune-related genes in sea cucumbers had been characterized. Their expression patterns after pathogen challenges have been analyzed via expressed sequence tag libraries, microarray studies and proteomic approaches. These genes include lectins, antimicrobial peptides, lysozyme, enzymes, clotting protein, pattern recognition proteins, Toll receptors, complement C3 and other humoral factors that might participate in the innate immune system of sea cucumbers. Although the participation of some of these immune molecules in the sea cucumber's innate immune defense against invading pathogens has been demonstrated, the functions of many of the molecules remain unclear. This review focuses on the discovery and functional characterization of the immune-related molecules from the sea cucumber for the first time and provides new insights into the immune mechanisms of the sea cucumber, which opens new possibilities for developing drugs for novel anti-bacterial and antiviral applications in fisheries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy.

    PubMed

    Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping

    2017-01-01

    As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin ( Ts -CRT), a Ca 2+ -binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts -CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts -CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts -CRT (r Ts -CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte-macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts -CRT on the surface of newborn larvae (NBL) of T. spiralis with anti- Ts -CRT antibody increased the C1q-mediated adherence of monocyte-macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis -expressed Ts -CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages.

  7. Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy

    PubMed Central

    Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping

    2017-01-01

    As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin (Ts-CRT), a Ca2+-binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts-CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts-CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts-CRT (rTs-CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte–macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts-CRT on the surface of newborn larvae (NBL) of T. spiralis with anti-Ts-CRT antibody increased the C1q-mediated adherence of monocyte–macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis-expressed Ts-CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages. PMID:28620388

  8. Functionalization of multilayer fullerenes (carbon nano-onions) using diazonium compounds and "click" chemistry.

    PubMed

    Flavin, Kevin; Chaur, Manuel N; Echegoyen, Luis; Giordani, Silvia

    2010-02-19

    A novel versatile approach for the functionalization of multilayer fullerenes (carbon nano-onions) has been developed, which involves the facile introduction of a variety of simple functionalities onto their surface by treatment with in situ generated diazonium compounds. This approach is complemented by use of "click" chemistry which was used for the covalent introduction of more complex porphyrin molecules.

  9. The Role of Complement in Cnidarian-Dinoflagellate Symbiosis and Immune Challenge in the Sea Anemone Aiptasia pallida

    PubMed Central

    Poole, Angela Z.; Kitchen, Sheila A.; Weis, Virginia M.

    2016-01-01

    The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1 and Ap_Bf-2b, and that Ap_Bf-1 and Ap_MASP may be functioning together in an ancestral hybrid of the lectin and alternative complement pathways. Overall, this study provides information on the role of the complement system in a basal metazoan and its role in host-microbe interactions. PMID:27148208

  10. The Role of Complement in Cnidarian-Dinoflagellate Symbiosis and Immune Challenge in the Sea Anemone Aiptasia pallida.

    PubMed

    Poole, Angela Z; Kitchen, Sheila A; Weis, Virginia M

    2016-01-01

    The complement system is an innate immune pathway that in vertebrates, is responsible for initial recognition and ultimately phagocytosis and destruction of microbes. Several complement molecules including C3, Factor B, and mannose binding lectin associated serine proteases (MASP) have been characterized in invertebrates and while most studies have focused on their conserved role in defense against pathogens, little is known about their role in managing beneficial microbes. The purpose of this study was to (1) characterize complement pathway genes in the symbiotic sea anemone Aiptasia pallida, (2) investigate the evolution of complement genes in invertebrates, and (3) examine the potential dual role of complement genes Factor B and MASP in the onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge using qPCR based studies. The results demonstrate that A. pallida has multiple Factor B genes (Ap_Bf-1, Ap_Bf-2a, and Ap_Bf-2b) and one MASP gene (Ap_MASP). Phylogenetic analysis indicates that the evolutionary history of complement genes is complex, and there have been many gene duplications or gene loss events, even within members of the same phylum. Gene expression analyses revealed a potential role for complement in both onset and maintenance of cnidarian-dinoflagellate symbiosis and immune challenge. Specifically, Ap_Bf-1 and Ap_MASP are significantly upregulated in the light at the onset of symbiosis and in response to challenge with the pathogen Serratia marcescens suggesting that they play a role in the initial recognition of both beneficial and harmful microbes. Ap_Bf-2b in contrast, was generally downregulated during the onset and maintenance of symbiosis and in response to challenge with S. marcescens. Therefore, the exact role of Ap_Bf-2b in response to microbes remains unclear, but the results suggest that the presence of microbes leads to repressed expression. Together, these results indicate functional divergence between Ap_Bf-1 and Ap_Bf-2b, and that Ap_Bf-1 and Ap_MASP may be functioning together in an ancestral hybrid of the lectin and alternative complement pathways. Overall, this study provides information on the role of the complement system in a basal metazoan and its role in host-microbe interactions.

  11. Gluconacetobacter diazotrophicus PAL5 possesses an active quorum sensing regulatory system.

    PubMed

    Bertini, Elisa V; Nieto Peñalver, Carlos G; Leguina, Ana C; Irazusta, Verónica P; de Figueroa, Lucía I C

    2014-09-01

    The endophytic bacterium Gluconacetobacter diazotrophicus colonizes a broad range of host plants. Its plant growth-promoting capability is related to the capacity to perform biological nitrogen fixation, the biosynthesis of siderophores, antimicrobial substances and the solubilization of mineral nutrients. Colonization of and survival in these endophytic niche requires a complex regulatory network. Among these, quorum sensing systems (QS) are signaling mechanisms involved in the control of several genes related to microbial interactions, host colonization and stress survival. G. diazotrophicus PAL5 possesses a QS composed of a luxR and a luxI homolog, and produces eight molecules from the AHL family as QS signals. In this report data are provided showing that glucose concentration modifies the relative levels of these signal molecules. The activity of G. diazotrophicus PAL5 QS is also altered in presence of other carbon sources and under saline stress conditions. Inactivation of the QS system of G. diazotrophicus PAL5 by means of a quorum quenching strategy allowed the identification of extracellular and intracellular proteins under the control of this regulatory mechanism.

  12. Regulatory polymorphisms modulate the expression of HLA class II molecules and promote autoimmunity

    PubMed Central

    Raj, Prithvi; Rai, Ekta; Song, Ran; Khan, Shaheen; Wakeland, Benjamin E; Viswanathan, Kasthuribai; Arana, Carlos; Liang, Chaoying; Zhang, Bo; Dozmorov, Igor; Carr-Johnson, Ferdicia; Mitrovic, Mitja; Wiley, Graham B; Kelly, Jennifer A; Lauwerys, Bernard R; Olsen, Nancy J; Cotsapas, Chris; Garcia, Christine K; Wise, Carol A; Harley, John B; Nath, Swapan K; James, Judith A; Jacob, Chaim O; Tsao, Betty P; Pasare, Chandrashekhar; Karp, David R; Li, Quan Zhen; Gaffney, Patrick M; Wakeland, Edward K

    2016-01-01

    Targeted sequencing of sixteen SLE risk loci among 1349 Caucasian cases and controls produced a comprehensive dataset of the variations causing susceptibility to systemic lupus erythematosus (SLE). Two independent disease association signals in the HLA-D region identified two regulatory regions containing 3562 polymorphisms that modified thirty-seven transcription factor binding sites. These extensive functional variations are a new and potent facet of HLA polymorphism. Variations modifying the consensus binding motifs of IRF4 and CTCF in the XL9 regulatory complex modified the transcription of HLA-DRB1, HLA-DQA1 and HLA-DQB1 in a chromosome-specific manner, resulting in a 2.5-fold increase in the surface expression of HLA-DR and DQ molecules on dendritic cells with SLE risk genotypes, which increases to over 4-fold after stimulation. Similar analyses of fifteen other SLE risk loci identified 1206 functional variants tightly linked with disease-associated SNPs and demonstrated that common disease alleles contain multiple causal variants modulating multiple immune system genes. DOI: http://dx.doi.org/10.7554/eLife.12089.001 PMID:26880555

  13. Combinatorics of feedback in cellular uptake and metabolism of small molecules.

    PubMed

    Krishna, Sandeep; Semsey, Szabolcs; Sneppen, Kim

    2007-12-26

    We analyze the connection between structure and function for regulatory motifs associated with cellular uptake and usage of small molecules. Based on the boolean logic of the feedback we suggest four classes: the socialist, consumer, fashion, and collector motifs. We find that the socialist motif is good for homeostasis of a useful but potentially poisonous molecule, whereas the consumer motif is optimal for nutrition molecules. Accordingly, examples of these motifs are found in, respectively, the iron homeostasis system in various organisms and in the uptake of sugar molecules in bacteria. The remaining two motifs have no obvious analogs in small molecule regulation, but we illustrate their behavior using analogies to fashion and obesity. These extreme motifs could inspire construction of synthetic systems that exhibit bistable, history-dependent states, and homeostasis of flux (rather than concentration).

  14. A Novel Method for Gene-Specific Enhancement of Protein Translation by Targeting 5’UTRs of Selected Tumor Suppressors

    PubMed Central

    Master, Adam; Wójcicka, Anna; Giżewska, Kamilla; Popławski, Piotr; Williams, Graham R.; Nauman, Alicja

    2016-01-01

    Background Translational control is a mechanism of protein synthesis regulation emerging as an important target for new therapeutics. Naturally occurring microRNAs and synthetic small inhibitory RNAs (siRNAs) are the most recognized regulatory molecules acting via RNA interference. Surprisingly, recent studies have shown that interfering RNAs may also activate gene transcription via the newly discovered phenomenon of small RNA-induced gene activation (RNAa). Thus far, the small activating RNAs (saRNAs) have only been demonstrated as promoter-specific transcriptional activators. Findings We demonstrate that oligonucleotide-based trans-acting factors can also specifically enhance gene expression at the level of protein translation by acting at sequence-specific targets within the messenger RNA 5’-untranslated region (5’UTR). We designed a set of short synthetic oligonucleotides (dGoligos), specifically targeting alternatively spliced 5’UTRs in transcripts expressed from the THRB and CDKN2A suppressor genes. The in vitro translation efficiency of reporter constructs containing alternative TRβ1 5’UTRs was increased by up to more than 55-fold following exposure to specific dGoligos. Moreover, we found that the most folded 5’UTR has higher translational regulatory potential when compared to the weakly folded TRβ1 variant. This suggests such a strategy may be especially applied to enhance translation from relatively inactive transcripts containing long 5’UTRs of complex structure. Significance This report represents the first method for gene-specific translation enhancement using selective trans-acting factors designed to target specific 5’UTR cis-acting elements. This simple strategy may be developed further to complement other available methods for gene expression regulation including gene silencing. The dGoligo-mediated translation-enhancing approach has the potential to be transferred to increase the translation efficiency of any suitable target gene and may have future application in gene therapy strategies to enhance expression of proteins including tumor suppressors. PMID:27171412

  15. The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma.

    PubMed

    Guillermet-Guibert, Julie; Bjorklof, Katja; Salpekar, Ashreena; Gonella, Cristiano; Ramadani, Faruk; Bilancio, Antonio; Meek, Stephen; Smith, Andrew J H; Okkenhaug, Klaus; Vanhaesebroeck, Bart

    2008-06-17

    The p110 isoforms of phosphoinositide 3-kinase (PI3K) are acutely regulated by extracellular stimuli. The class IA PI3K catalytic subunits (p110alpha, p110beta, and p110delta) occur in complex with a Src homology 2 (SH2) domain-containing p85 regulatory subunit, which has been shown to link p110alpha and p110delta to Tyr kinase signaling pathways. The p84/p101 regulatory subunits of the p110gamma class IB PI3K lack SH2 domains and instead couple p110gamma to G protein-coupled receptors (GPCRs). Here, we show, using small-molecule inhibitors with selectivity for p110beta and cells derived from a p110beta-deficient mouse line, that p110beta is not a major effector of Tyr kinase signaling but couples to GPCRs. In macrophages, both p110beta and p110gamma contributed to Akt activation induced by the GPCR agonist complement 5a, but not by the Tyr kinase ligand colony-stimulating factor-1. In fibroblasts, which express p110beta but not p110gamma, p110beta mediated Akt activation by the GPCR ligands stromal cell-derived factor, sphingosine-1-phosphate, and lysophosphatidic acid but not by the Tyr kinase ligands PDGF, insulin, and insulin-like growth factor 1. Introduction of p110gamma in these cells reduced the contribution of p110beta to GPCR signaling. Taken together, these data show that p110beta and p110gamma can couple redundantly to the same GPCR agonists. p110beta, which shows a much broader tissue distribution than the leukocyte-restricted p110gamma, could thus provide a conduit for GPCR-linked PI3K signaling in the many cell types where p110gamma expression is low or absent.

  16. The p110β isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110γ

    PubMed Central

    Guillermet-Guibert, Julie; Bjorklof, Katja; Salpekar, Ashreena; Gonella, Cristiano; Ramadani, Faruk; Bilancio, Antonio; Meek, Stephen; Smith, Andrew J. H.; Okkenhaug, Klaus; Vanhaesebroeck, Bart

    2008-01-01

    The p110 isoforms of phosphoinositide 3-kinase (PI3K) are acutely regulated by extracellular stimuli. The class IA PI3K catalytic subunits (p110α, p110β, and p110δ) occur in complex with a Src homology 2 (SH2) domain-containing p85 regulatory subunit, which has been shown to link p110α and p110δ to Tyr kinase signaling pathways. The p84/p101 regulatory subunits of the p110γ class IB PI3K lack SH2 domains and instead couple p110γ to G protein-coupled receptors (GPCRs). Here, we show, using small-molecule inhibitors with selectivity for p110β and cells derived from a p110β-deficient mouse line, that p110β is not a major effector of Tyr kinase signaling but couples to GPCRs. In macrophages, both p110β and p110γ contributed to Akt activation induced by the GPCR agonist complement 5a, but not by the Tyr kinase ligand colony-stimulating factor-1. In fibroblasts, which express p110β but not p110γ, p110β mediated Akt activation by the GPCR ligands stromal cell-derived factor, sphingosine-1-phosphate, and lysophosphatidic acid but not by the Tyr kinase ligands PDGF, insulin, and insulin-like growth factor 1. Introduction of p110γ in these cells reduced the contribution of p110β to GPCR signaling. Taken together, these data show that p110β and p110γ can couple redundantly to the same GPCR agonists. p110β, which shows a much broader tissue distribution than the leukocyte-restricted p110γ, could thus provide a conduit for GPCR-linked PI3K signaling in the many cell types where p110γ expression is low or absent. PMID:18544649

  17. Incorporating comparative genomics into the design-test-learn cycle of microbial strain engineering.

    PubMed

    Sardi, Maria; Gasch, Audrey P

    2017-08-01

    Engineering microbes with new properties is an important goal in industrial engineering, to establish biological factories for production of biofuels, commodity chemicals and pharmaceutics. But engineering microbes to produce new compounds with high yield remains a major challenge toward economically viable production. Incorporating several modern approaches, including synthetic and systems biology, metabolic modeling and regulatory rewiring, has proven to significantly advance industrial strain engineering. This review highlights how comparative genomics can also facilitate strain engineering, by identifying novel genes and pathways, regulatory mechanisms and genetic background effects for engineering. We discuss how incorporating comparative genomics into the design-test-learn cycle of strain engineering can provide novel information that complements other engineering strategies. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Arabidopsis PPP family of serine/threonine protein phosphatases: many targets but few engines.

    PubMed

    Uhrig, R Glen; Labandera, Anne-Marie; Moorhead, Greg B

    2013-09-01

    The major plant serine/threonine protein phosphatases belong to the phosphoprotein phosphatase (PPP) family. Over the past few years the complement of Arabidopsis thaliana PPP family of catalytic subunits has been cataloged and many regulatory subunits identified. Specific roles for PPPs have been characterized, including roles in auxin and brassinosteroid signaling, in phototropism, in regulating the target of rapamycin pathway, and in cell stress responses. In this review, we provide a framework for understanding the PPP family by exploring the fundamental role of the phosphatase regulatory subunits that drive catalytic engine specificity. Although there are fewer plant protein phosphatases compared with their protein kinase partners, their function is now recognized to be as dynamic and as regulated as that of protein kinases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Reconstructing the regulatory network controlling commitment and sporulation in Physarum polycephalum based on hierarchical Petri Net modelling and simulation.

    PubMed

    Marwan, Wolfgang; Sujatha, Arumugam; Starostzik, Christine

    2005-10-21

    We reconstruct the regulatory network controlling commitment and sporulation of Physarum polycephalum from experimental results using a hierarchical Petri Net-based modelling and simulation framework. The stochastic Petri Net consistently describes the structure and simulates the dynamics of the molecular network as analysed by genetic, biochemical and physiological experiments within a single coherent model. The Petri Net then is extended to simulate time-resolved somatic complementation experiments performed by mixing the cytoplasms of mutants altered in the sporulation response, to systematically explore the network structure and to probe its dynamics. This reverse engineering approach presumably can be employed to explore other molecular or genetic signalling systems where the activity of genes or their products can be experimentally controlled in a time-resolved manner.

  20. Scabies Mite Peritrophins Are Potential Targets of Human Host Innate Immunity

    PubMed Central

    Holt, Deborah C.; Kemp, Dave J.; Fischer, Katja

    2011-01-01

    Background Pruritic scabies lesions caused by Sarcoptes scabiei burrowing in the stratum corneum of human skin facilitate opportunistic bacterial infections. Emerging resistance to current therapeutics emphasizes the need to identify novel targets for protective intervention. We have characterized several protein families located in the mite gut as crucial factors for host-parasite interactions. Among these multiple proteins inhibit human complement, presumably to avoid complement-mediated damage of gut epithelial cells. Peritrophins are major components of the peritrophic matrix often found in the gut of arthropods. We hypothesized that a peritrophin, if abundant in the scabies mite gut, could be an activator of complement. Methodology/Principal Findings A novel full length scabies mite peritrophin (SsPTP1) was identified in a cDNA library from scabies mites. The amino acid sequence revealed four putative chitin binding domains (CBD). Recombinant expression of one CBD of the highly repetitive SsPTP1 sequence as TSP-hexaHis-fusion protein resulted in soluble protein, which demonstrated chitin binding activity in affinity chromatography assays. Antibodies against a recombinant SsPTP1 fragment were used to immunohistochemically localize native SsPTP1 in the mite gut and in fecal pellets within the upper epidermis, co-localizing with serum components such as host IgG and complement. Enzymatic deglycosylation confirmed strong N- and O-glycosylation of the native peritrophin. Serum incubation followed by immunoblotting with a monoclonal antibody against mannan binding lectin (MBL), the recognition molecule of the lectin pathway of human complement activation, indicated that MBL may specifically bind to glycosylated SsPTP1. Conclusions/Significance This study adds a new aspect to the accumulating evidence that complement plays a major role in scabies mite biology. It identifies a novel peritrophin localized in the mite gut as a potential target of the lectin pathway of the complement cascade. These initial findings indicate a novel role of scabies mite peritrophins in triggering a host innate immune response within the mite gut. PMID:21980545

  1. Reducing abrupt climate change risk using the Montreal Protocol and other regulatory actions to complement cuts in CO2 emissions.

    PubMed

    Molina, Mario; Zaelke, Durwood; Sarma, K Madhava; Andersen, Stephen O; Ramanathan, Veerabhadran; Kaniaru, Donald

    2009-12-08

    Current emissions of anthropogenic greenhouse gases (GHGs) have already committed the planet to an increase in average surface temperature by the end of the century that may be above the critical threshold for tipping elements of the climate system into abrupt change with potentially irreversible and unmanageable consequences. This would mean that the climate system is close to entering if not already within the zone of "dangerous anthropogenic interference" (DAI). Scientific and policy literature refers to the need for "early," "urgent," "rapid," and "fast-action" mitigation to help avoid DAI and abrupt climate changes. We define "fast-action" to include regulatory measures that can begin within 2-3 years, be substantially implemented in 5-10 years, and produce a climate response within decades. We discuss strategies for short-lived non-CO(2) GHGs and particles, where existing agreements can be used to accomplish mitigation objectives. Policy makers can amend the Montreal Protocol to phase down the production and consumption of hydrofluorocarbons (HFCs) with high global warming potential. Other fast-action strategies can reduce emissions of black carbon particles and precursor gases that lead to ozone formation in the lower atmosphere, and increase biosequestration, including through biochar. These and other fast-action strategies may reduce the risk of abrupt climate change in the next few decades by complementing cuts in CO(2) emissions.

  2. Genetic analysis of indefinite division in human cells: Evidence for a cell senescence-related gene(s) on human chromosome 4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi Ning; Ledbetter, D.H.; Smith, J.R.

    1991-07-01

    Earlier studies had demonstrated that fusion of normal with immortal human cells yielded hybrids having limited division potential. This indicated that the phenotype of limited proliferation (cellular senescence) is dominant and that immortal cells result from recessive changes in normal growth-regulatory genes. In additional studies, the authors exploited the fact that the immortal phenotype is recessive and, by fusing various immortal human cell lines with each other, identified four complementation groups for indefinite division. Assignment of cell lines to specific groups allowed us to take a focused approach to identify the chromosomes and genes involved in growth regulation that havemore » been modified in immortal cells. They report here that introduction of a normal human chromosome 4 into three immortal cell lines (HeLa, J82, T98G) assigned to complementation group B resulted in loss of proliferation and reversal of the immortal phenotype. No effect on the proliferation potential of cell lines representative of the other complementation groups was observed. This result suggests that a gene(s) involved in cellular senescence and normal growth regulation resides on chromosome 4.« less

  3. The Complement System in Flavivirus Infections

    PubMed Central

    Conde, Jonas N.; Silva, Emiliana M.; Barbosa, Angela S.; Mohana-Borges, Ronaldo

    2017-01-01

    The incidence of flavivirus infections has increased dramatically in recent decades in tropical and sub-tropical climates worldwide, affecting hundreds of millions of people each year. The Flaviviridae family includes dengue, West Nile, Zika, Japanese encephalitis, and yellow fever viruses that are typically transmitted by mosquitoes or ticks, and cause a wide range of symptoms, such as fever, shock, meningitis, paralysis, birth defects, and death. The flavivirus genome is composed of a single positive-sense RNA molecule encoding a single viral polyprotein. This polyprotein is further processed by viral and host proteases into three structural proteins (C, prM/M, E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) that are involved in viral replication and pathogenicity. The complement system has been described to play an important role in flavivirus infection either by protecting the host and/or by influencing disease pathogenesis. In this mini-review, we will explore the role of complement system inhibition and/or activation against infection by the Flavivirus genus, with an emphasis on dengue and West Nile viruses. PMID:28261172

  4. Role of collectins and complement protein C1q in pregnancy and parturition.

    PubMed

    Madhukaran, Shanmuga Priyaa; Alhamlan, Fatimah S; Kale, Kavita; Vatish, Manu; Madan, Taruna; Kishore, Uday

    2016-11-01

    Collectins such as surfactant proteins SP-A, SP-D, and mannan-binding lectin (MBL), as well as complement protein C1q are evolutionarily conserved innate immune molecules. They are known to opsonize a range of microbial pathogens (bacteria, fungi, virus, and parasites) and trigger effector clearance mechanisms involving phagocytosis and/or complement activation. Collectins and C1q have also attracted attention in studies involving pregnancy as they are expressed in the female reproductive tissues during pregnancy; a unique state of immune suppression with increased susceptibility to infectious diseases. Recent studies are beginning to unravel their functional significance in implantation, placentation, pregnancy maintenance and parturition in normal and adverse pregnancies. Collectins and C1q, expressed in gestational tissues during pregnancy, might alter the status of mother's immune response to the allogenic fetus and the microenvironment, thereby serving as important regulators of fetus-mother interaction. Here, we discuss the functional roles that have been assigned to SP-A, SP-D, MBL and C1q in pregnancy and parturition. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Antitumor action of 3-bromopyruvate implicates reorganized tumor growth regulatory components of tumor milieu, cell cycle arrest and induction of mitochondria-dependent tumor cell death.

    PubMed

    Yadav, Saveg; Kujur, Praveen Kumar; Pandey, Shrish Kumar; Goel, Yugal; Maurya, Babu Nandan; Verma, Ashish; Kumar, Ajay; Singh, Rana Pratap; Singh, Sukh Mahendra

    2018-01-15

    Evidences demonstrate that metabolic inhibitor 3-bromopyruvate (3-BP) exerts a potent antitumor action against a wide range of malignancies. However, the effect of 3-BP on progression of the tumors of thymic origin remains unexplored. Although, constituents of tumor microenvironment (TME) plays a pivotal role in regulation of tumor progression, it remains unclear if 3-BP can alter the composition of the crucial tumor growth regulatory components of the external surrounding of tumor cells. Thus, the present investigation attempts to understand the effect of 3-BP administration to a host bearing a progressively growing tumor of thymic origin on tumor growth regulatory soluble, cellular and biophysical components of tumor milieu vis-à-vis understanding its association with tumor progression, accompanying cell cycle events and mode of cell death. Further, the expression of cell survival regulatory molecules and hemodynamic characteristics of the tumor milieu were analysed to decipher mechanisms underlying the antitumor action of 3-BP. Administration of 3-BP to tumor-bearing hosts retarded tumor progression accompanied by induction of tumor cell death, cell cycle arrest, declined metabolism, inhibited mitochondrial membrane potential, elevated release of cytochrome c and altered hemodynamics. Moreover, 3-BP reconstituted the external milieu, in concurrence with deregulated glucose and pH homeostasis and increased tumor infiltration by NK cells, macrophages, and T lymphocytes. Further, 3-BP administration altered the expression of key regulatory molecules involved in glucose uptake, intracellular pH and tumor cell survival. The outcomes of this study will help in optimizing the therapeutic application of 3-BP by targeting crucial tumor growth regulatory components of tumor milieu. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Circular RNA: New Regulatory Molecules.

    PubMed

    Belousova, E A; Filipenko, M L; Kushlinskii, N E

    2018-04-01

    Circular RNA are a family of covalently closed circular RNA molecules, formed from pre-mRNA of coding genes by means of splicing (canonical and alternative noncanonical splicing). Maturation of circular RNA is regulated by cis- and trans-elements. Complete list of biological functions of these RNA is not yet compiled; however, their capacity to interact with specific microRNA and play a role of a depot attracts the greatest interest. This property makes circular RNA active regulatory transcription factors. Circular RNA have many advantages over their linear analogs: synthesis of these molecules is conservative, they are universal, characterized by clearly determined specificity, and are resistant to exonucleases. In addition, the level of their expression is often higher than that of their linear forms. It should be noted that expression of circular RNA is tissue-specific. Moreover, some correlations between changes in the repertoire and intensity of expression of circular RNA and the development of some pathologies have been detected. Circular RNA have certain advantages and can serve as new biomarkers for the diagnosis, prognosis, and evaluation of response to therapy.

  7. Listening to the Noise: Random Fluctuations Reveal Gene Network Parameters

    NASA Astrophysics Data System (ADS)

    Munsky, Brian; Trinh, Brooke; Khammash, Mustafa

    2010-03-01

    The cellular environment is abuzz with noise originating from the inherent random motion of reacting molecules in the living cell. In this noisy environment, clonal cell populations exhibit cell-to-cell variability that can manifest significant prototypical differences. Noise induced stochastic fluctuations in cellular constituents can be measured and their statistics quantified using flow cytometry, single molecule fluorescence in situ hybridization, time lapse fluorescence microscopy and other single cell and single molecule measurement techniques. We show that these random fluctuations carry within them valuable information about the underlying genetic network. Far from being a nuisance, the ever-present cellular noise acts as a rich source of excitation that, when processed through a gene network, carries its distinctive fingerprint that encodes a wealth of information about that network. We demonstrate that in some cases the analysis of these random fluctuations enables the full identification of network parameters, including those that may otherwise be difficult to measure. We use theoretical investigations to establish experimental guidelines for the identification of gene regulatory networks, and we apply these guideline to experimentally identify predictive models for different regulatory mechanisms in bacteria and yeast.

  8. Scientific and Regulatory Policy Committee Points-to-consider Paper*: Drug-induced Vascular Injury Associated with Nonsmall Molecule Therapeutics in Preclinical Development: Part 2. Antisense Oligonucleotides.

    PubMed

    Engelhardt, Jeffery A; Fant, Pierluigi; Guionaud, Silvia; Henry, Scott P; Leach, Michael W; Louden, Calvert; Scicchitano, Marshall S; Weaver, James L; Zabka, Tanja S; Frazier, Kendall S

    2015-10-01

    Drug-induced vascular injury (DIVI) is a recurrent challenge in the development of novel pharmaceutical agents. In recent years, DIVI has been occasionally observed in nonhuman primates given RNA-targeting therapeutics such as antisense oligonucleotide therapies (ASOs) during chronic toxicity studies. While DIVI in laboratory animal species has been well characterized for vasoactive small molecules, and immune-mediated responses against large molecule biotherapeutics have been well described, there is little published information regarding DIVI induced by ASOs to date. Preclinical DIVI findings in monkeys have caused considerable delays in development of promising new ASO therapies, because of the uncertainty about whether DIVI in preclinical studies is predictive of effects in humans, and the lack of robust biomarkers of DIVI. This review of DIVI discusses clinical and microscopic features of vasculitis in monkeys, their pathogenic mechanisms, and points to consider for the toxicologist and pathologist when confronted with ASO-related DIVI. Relevant examples of regulatory feedback are included to provide insight into risk assessment of ASO therapies. © 2015 by The Author(s).

  9. Computational and spectroscopic data correlation study of N,N'-bisarylmalonamides (Part II).

    PubMed

    Arsovski, Violeta M; Božić, Bojan Đ; Mirković, Jelena M; Vitnik, Vesna D; Vitnik, Željko J; Petrović, Slobodan D; Ušćumlić, Gordana S; Mijin, Dušan Ž

    2015-09-01

    To complement a previous UV study, we present a quantitative evaluation of substituent effects on spectroscopic data ((1)H and (13)C NMR chemical shifts as well as FT-IR absorption frequency) applied to N,N'-bisarylmalonamides, using simple and extended Hammett equations as well as the Swain-Lupton equation. Furthermore, the DFT CAM-B3LYP/6-311+G(d,p) method was applied to study the impact of different solvents on the geometry of the molecules and their spectral data. Additionally, experimental data are correlated with theoretical results; excellent linear dependence was obtained. The overall results presented in this paper show that N,N'-bisarylmalonamides are prominent candidates for model molecules.

  10. Decorin Core Protein (Decoron) Shape Complements Collagen Fibril Surface Structure and Mediates Its Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orgel, Joseph P.R.O.; Eid, Aya; Antipova, Olga

    Decorin is the archetypal small leucine rich repeat proteoglycan of the vertebrate extracellular matrix (ECM). With its glycosaminoglycuronan chain, it is responsible for stabilizing inter-fibrillar organization. Type I collagen is the predominant member of the fibrillar collagen family, fulfilling both organizational and structural roles in animal ECMs. In this study, interactions between decoron (the decorin core protein) and binding sites in the d and e1 bands of the type I collagen fibril were investigated through molecular modeling of their respective X-ray diffraction structures. Previously, it was proposed that a model-based, highly curved concave decoron interacts with a single collagen molecule,more » which would form extensive van der Waals contacts and give rise to strong non-specific binding. However, the large well-ordered aggregate that is the collagen fibril places significant restraints on modes of ligand binding and necessitates multi-collagen molecular contacts. We present here a relatively high-resolution model of the decoron-fibril collagen complex. We find that the respective crystal structures complement each other well, although it is the monomeric form of decoron that shows the most appropriate shape complementarity with the fibril surface and favorable calculated energies of interaction. One molecule of decoron interacts with four to six collagen molecules, and the binding specificity relies on a large number of hydrogen bonds and electrostatic interactions, primarily with the collagen motifs KXGDRGE and AKGDRGE (d and e{sub 1} bands). This work helps us to understand collagen-decorin interactions and the molecular architecture of the fibrillar ECM in health and disease.« less

  11. Decorin core protein (decoron) shape complements collagen fibril surface structure and mediates its binding.

    PubMed

    Orgel, Joseph P R O; Eid, Aya; Antipova, Olga; Bella, Jordi; Scott, John E

    2009-09-15

    Decorin is the archetypal small leucine rich repeat proteoglycan of the vertebrate extracellular matrix (ECM). With its glycosaminoglycuronan chain, it is responsible for stabilizing inter-fibrillar organization. Type I collagen is the predominant member of the fibrillar collagen family, fulfilling both organizational and structural roles in animal ECMs. In this study, interactions between decoron (the decorin core protein) and binding sites in the d and e(1) bands of the type I collagen fibril were investigated through molecular modeling of their respective X-ray diffraction structures. Previously, it was proposed that a model-based, highly curved concave decoron interacts with a single collagen molecule, which would form extensive van der Waals contacts and give rise to strong non-specific binding. However, the large well-ordered aggregate that is the collagen fibril places significant restraints on modes of ligand binding and necessitates multi-collagen molecular contacts. We present here a relatively high-resolution model of the decoron-fibril collagen complex. We find that the respective crystal structures complement each other well, although it is the monomeric form of decoron that shows the most appropriate shape complementarity with the fibril surface and favorable calculated energies of interaction. One molecule of decoron interacts with four to six collagen molecules, and the binding specificity relies on a large number of hydrogen bonds and electrostatic interactions, primarily with the collagen motifs KXGDRGE and AKGDRGE (d and e(1) bands). This work helps us to understand collagen-decorin interactions and the molecular architecture of the fibrillar ECM in health and disease.

  12. Complement Factor H Is Expressed in Adipose Tissue in Association With Insulin Resistance

    PubMed Central

    Moreno-Navarrete, José María; Martínez-Barricarte, Rubén; Catalán, Victoria; Sabater, Mònica; Gómez-Ambrosi, Javier; Ortega, Francisco José; Ricart, Wifredo; Blüher, Mathias; Frühbeck, Gema; Rodríguez de Cordoba, Santiago; Fernández-Real, José Manuel

    2010-01-01

    OBJECTIVE Activation of the alternative pathway of the complement system, in which factor H (fH; complement fH [CFH]) is a key regulatory component, has been suggested as a link between obesity and metabolic disorders. Our objective was to study the associations between circulating and adipose tissue gene expressions of CFH and complement factor B (fB; CFB) with obesity and insulin resistance. RESEARCH DESIGN AND METHODS Circulating fH and fB were determined by enzyme-linked immunosorbent assay in 398 subjects. CFH and CFB gene expressions were evaluated in 76 adipose tissue samples, in isolated adipocytes, and in stromovascular cells (SVC) (n = 13). The effects of weight loss and rosiglitazone were investigated in independent cohorts. RESULTS Both circulating fH and fB were associated positively with BMI, waist circumference, triglycerides, and inflammatory parameters and negatively with insulin sensitivity and HDL cholesterol. For the first time, CFH gene expression was detected in human adipose tissue (significantly increased in subcutaneous compared with omental fat). CFH gene expression in omental fat was significantly associated with insulin resistance. In contrast, CFB gene expression was significantly increased in omental fat but also in association with fasting glucose and triglycerides. The SVC fraction was responsible for these differences, although isolated adipocytes also expressed fB and fH at low levels. Both weight loss and rosiglitazone led to significantly decreased circulating fB and fH levels. CONCLUSIONS Increased circulating fH and fB concentrations in subjects with altered glucose tolerance could reflect increased SVC-induced activation of the alternative pathway of complement in omental adipose tissue linked to insulin resistance and metabolic disturbances. PMID:19833879

  13. Super-resolution imaging and tracking of protein-protein interactions in sub-diffraction cellular space

    NASA Astrophysics Data System (ADS)

    Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie

    2014-07-01

    Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein-protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB-EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB-EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB-EF-Tu interactions.

  14. Super-resolution imaging and tracking of protein–protein interactions in sub-diffraction cellular space

    PubMed Central

    Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie

    2014-01-01

    Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein–protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB–EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB–EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB–EF-Tu interactions. PMID:25030837

  15. FPGA acceleration of rigid-molecule docking codes

    PubMed Central

    Sukhwani, B.; Herbordt, M.C.

    2011-01-01

    Modelling the interactions of biological molecules, or docking, is critical both to understanding basic life processes and to designing new drugs. The field programmable gate array (FPGA) based acceleration of a recently developed, complex, production docking code is described. The authors found that it is necessary to extend their previous three-dimensional (3D) correlation structure in several ways, most significantly to support simultaneous computation of several correlation functions. The result for small-molecule docking is a 100-fold speed-up of a section of the code that represents over 95% of the original run-time. An additional 2% is accelerated through a previously described method, yielding a total acceleration of 36× over a single core and 10× over a quad-core. This approach is found to be an ideal complement to graphics processing unit (GPU) based docking, which excels in the protein–protein domain. PMID:21857870

  16. Lessons learned at the intersection of immunology and neuroscience.

    PubMed

    Steinman, Lawrence

    2012-04-01

    Neurobiologists and immunologists study concepts often signified with identical terminology. Scientists in both fields study a structure known as the synapse, and each group analyzes a subject called memory. Is this a quirk of human language, or are there real similarities between these two physiological systems? Not only are the linguistic concepts expressed in the words "synapse" and "memory" shared between the fields, but the actual molecules of physiologic importance in one system play parallel roles in the other: complement, the major histocompatibility molecules, and even "neuro"-transmitters all have major impacts on health and on disease in both the brain and the immune system. Not only are the same molecules found in diverse roles in each system, but we have learned that there is real "hard-wired" crosstalk between nerves and lymphoid organs. This issue of the JCI highlights some of the lessons learned from experts who are working at this scintillating intersection between immunology and neuroscience.

  17. Conditional sterility in plants

    DOEpatents

    Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung

    2010-02-23

    The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.

  18. Function of fusion regulatory proteins (FRPs) in immune cells and virus-infected cells.

    PubMed

    Tsurudome, M; Ito, Y

    2000-01-01

    Two molecules that regulate cell fusion have been identified and designated fusion regulatory protein-1 (FRP-1) and FRP-2. FRP-1 is a complex composed of a glycosylated heavy chain and a nonglycosylated light chain that are disulfide linked. FRP-1 heavy chain is identical to 4F2/CD98 heavy chain, whereas FRP-2 is identical to integrin alpha3 subunit. The FRP-1 heavy chain is a multifunctional molecule: that is, fusion regulator, amino acid transporter, integrin regulator, comitogenic factor, Na+-Ca2+ exchanger, oncogenic protein, and so on. Several aspects of the structure and function of the FRP-1 system are reviewed: fusion regulatory molecular mechanisms, cross-talk between the FRP-1 and integrin, the FRP-1 system as amino acid transporter, and FRP-1-mediated T-cell activation. The FRP-1 system is involved in virus-mediated cell fusion and multinucleated giant cell formation of blood monocytes. Monoclonal antibodies against human FRP-1 heavy chain induce polykaryocytes that have properties as osteoclasts. Multiple steps participate in molecular mechanisms regulating cell fusion. The FRP-1 heavy chain supports amino acid transport activity and the FRP-1 light chains have recently been cloned as amino acid transporters that require association with the heavy chain to exhibit their activity. Novel pathways for monocyte-dependent regulation of T-cell activation have recently been found that are mediated by the FRP-1 system. In conclusion, the FRP-1 molecules are essential factors for basic cellular functions.

  19. Release of complement regulatory proteins from ocular surface cells in infections.

    PubMed

    Cocuzzi, E; Guidubaldi, J; Bardenstein, D S; Chen, R; Jacobs, M R; Medof, E M

    2000-11-01

    The decay accelerating factor (DAF or CD55) and the membrane inhibitor of reactive lysis (MIRL or CD59), two complement regulatory proteins that protect self cells from autologous complement-mediated injury, are attached to corneal and cqonjunctival epithelial cells by glycosylphos-phatidylinositol (GPI) anchors. We sought to 1) determine the frequency with which bacteria recovered from patients with infections of the eye elaborate factors that can remove these surface proteins from ocular cells, 2) determine the spectrum of bacteria from other sites that have similar effects, and 3) establish the time interval required for reconstitution of the two regulators. Culture supernatants of 18 ocular isolates [P. aeruginosa (n = 3), S. marcescens (n = 1), S. epidermidis (n = 9), and S. aureus (n = 5)], and > 100 other clinical specimens isolated in the hospital's microbiology laboratory [P. mirabilis (n = 1), S. aureus (n = 65), S. epidermidis (n = 24), B. cereus (n = 12), H. influenzae (n = 15), and Enterobacter sp. (n = 21)] were incubated at 37 degrees C for various times with conjunctival epithelial cells, conjunctival fibroblasts or HeLa cells and the release of DAF and CD59 proteins from the surfaces of the cells analyzed by 2-site immunoradiometric assays and by Western blotting. The kinetics of recovery of DAF and CD59 expression on the cells was measured by flow cytometry. DAF and/or CD59 release from the cell monolayers varied from < 5% to > 99% at as much as a 1:81 dilution of the supernatant from some bacteria. On conjunctival epithelial cells, more than 8 hr was required for 44% recovery of DAF expression and for 50% recovery of CD59 expression. Bacteria produce phospholipases and/or other enzymes which can efficiently remove DAF and CD59 from ocular cell surfaces. This phenomenon may correlate with their in vivo pathogenicity.

  20. Hha Controls Escherichia coli O157:H7 Biofilm Formation by Differential Regulation of Global Transcriptional Regulators FlhDC and CsgD

    PubMed Central

    Bearson, Bradley L.

    2013-01-01

    Although molecular mechanisms promoting adherence of enterohemorrhagic Escherichia coli (EHEC) O157:H7 on epithelial cells are well characterized, regulatory mechanisms controlling biofilm formation are not fully understood. In this study, we demonstrate that biofilm formation in EHEC O157:H7 strain 86-24 is highly repressed compared to that in an isogenic hha mutant. The hha mutant produced large quantities of biofilm compared to the wild-type strain at 30°C and 37°C. Complementation of the hha mutant reduced the level of biofilm formation to that of the wild-type strain, indicating that Hha is a negative regulator of biofilm production. While swimming motility and expression of the flagellar gene fliC were significantly reduced, the expression of csgA (encoding curlin of curli fimbriae) and the ability to bind Congo red were significantly enhanced. The expression of both fliC and csgA and the phenotypes of motility and curli production affected by these two genes, respectively, were restored to wild-type levels in the complemented hha mutant. The csgA deletion abolished biofilm formation in the hha mutant and wild-type strain, and csgA complementation restored biofilm formation to these strains, indicating the importance of csgA and curli in biofilm formation. The regulatory effects of Hha on flagellar and curli gene expression appear to occur via the induction and repression of FlhDC and CsgD, as demonstrated by reduced flhD and increased csgD transcription in the hha mutant, respectively. In gel shift assays Hha interacted with flhDC and csgD promoters. In conclusion, Hha regulates biofilm formation in EHEC O157:H7 by differential regulation of FlhDC and CsgD, the global regulators of motility and curli production, respectively. PMID:23377937

  1. Hha controls Escherichia coli O157:H7 biofilm formation by differential regulation of global transcriptional regulators FlhDC and CsgD.

    PubMed

    Sharma, Vijay K; Bearson, Bradley L

    2013-04-01

    Although molecular mechanisms promoting adherence of enterohemorrhagic Escherichia coli (EHEC) O157:H7 on epithelial cells are well characterized, regulatory mechanisms controlling biofilm formation are not fully understood. In this study, we demonstrate that biofilm formation in EHEC O157:H7 strain 86-24 is highly repressed compared to that in an isogenic hha mutant. The hha mutant produced large quantities of biofilm compared to the wild-type strain at 30°C and 37°C. Complementation of the hha mutant reduced the level of biofilm formation to that of the wild-type strain, indicating that Hha is a negative regulator of biofilm production. While swimming motility and expression of the flagellar gene fliC were significantly reduced, the expression of csgA (encoding curlin of curli fimbriae) and the ability to bind Congo red were significantly enhanced. The expression of both fliC and csgA and the phenotypes of motility and curli production affected by these two genes, respectively, were restored to wild-type levels in the complemented hha mutant. The csgA deletion abolished biofilm formation in the hha mutant and wild-type strain, and csgA complementation restored biofilm formation to these strains, indicating the importance of csgA and curli in biofilm formation. The regulatory effects of Hha on flagellar and curli gene expression appear to occur via the induction and repression of FlhDC and CsgD, as demonstrated by reduced flhD and increased csgD transcription in the hha mutant, respectively. In gel shift assays Hha interacted with flhDC and csgD promoters. In conclusion, Hha regulates biofilm formation in EHEC O157:H7 by differential regulation of FlhDC and CsgD, the global regulators of motility and curli production, respectively.

  2. Dynamic Network-Based Epistasis Analysis: Boolean Examples

    PubMed Central

    Azpeitia, Eugenio; Benítez, Mariana; Padilla-Longoria, Pablo; Espinosa-Soto, Carlos; Alvarez-Buylla, Elena R.

    2011-01-01

    In this article we focus on how the hierarchical and single-path assumptions of epistasis analysis can bias the inference of gene regulatory networks. Here we emphasize the critical importance of dynamic analyses, and specifically illustrate the use of Boolean network models. Epistasis in a broad sense refers to gene interactions, however, as originally proposed by Bateson, epistasis is defined as the blocking of a particular allelic effect due to the effect of another allele at a different locus (herein, classical epistasis). Classical epistasis analysis has proven powerful and useful, allowing researchers to infer and assign directionality to gene interactions. As larger data sets are becoming available, the analysis of classical epistasis is being complemented with computer science tools and system biology approaches. We show that when the hierarchical and single-path assumptions are not met in classical epistasis analysis, the access to relevant information and the correct inference of gene interaction topologies is hindered, and it becomes necessary to consider the temporal dynamics of gene interactions. The use of dynamical networks can overcome these limitations. We particularly focus on the use of Boolean networks that, like classical epistasis analysis, relies on logical formalisms, and hence can complement classical epistasis analysis and relax its assumptions. We develop a couple of theoretical examples and analyze them from a dynamic Boolean network model perspective. Boolean networks could help to guide additional experiments and discern among alternative regulatory schemes that would be impossible or difficult to infer without the elimination of these assumption from the classical epistasis analysis. We also use examples from the literature to show how a Boolean network-based approach has resolved ambiguities and guided epistasis analysis. Our article complements previous accounts, not only by focusing on the implications of the hierarchical and single-path assumption, but also by demonstrating the importance of considering temporal dynamics, and specifically introducing the usefulness of Boolean network models and also reviewing some key properties of network approaches. PMID:22645556

  3. Functions and Mechanisms of Sleep in Flies and Mammals

    DTIC Science & Technology

    2007-02-01

    serotonin receptor likely to mediate the known interaction between the serotonergic Raphe nucleus and the LC (Htr1d). We have also confirmed the prior... Chemistry . His research focuses on mass spectrometry, a technique that will augment research on the mechanisms of sleep and complement microarray gene...labeling (ICAT, ITRAQ, etc); 8) MALDI and electrospray FTMS for the identification of small molecule structure ; 9) Gas phase reactions within the FTMS

  4. Role of Ficolin-A and Lectin Complement Pathway in the Innate Defense against Pathogenic Aspergillus Species

    PubMed Central

    Bidula, Stefan; Kenawy, Hany; Ali, Youssif M.; Sexton, Darren; Schwaeble, Wilhelm J.

    2013-01-01

    Aspergillus species are saprophytic molds causing life-threatening invasive fungal infections in the immunocompromised host. Innate immune recognition, in particular, the mechanisms of opsonization and complement activation, has been reported to be an integral part of the defense against fungi. We have shown that the complement component ficolin-A significantly binds to Aspergillus conidia and hyphae in a concentration-dependent manner and was inhibited by N-acetylglucosamine and N-acetylgalactosamine. Calcium-independent binding to Aspergillus fumigatus and A. terreus was observed, but binding to A. flavus and A. niger was calcium dependent. Ficolin-A binding to conidia was increased under low-pH conditions, and opsonization led to enhanced binding of conidia to A549 airway epithelial cells. In investigations of the lectin pathway of complement activation, ficolin-A-opsonized conidia did not lead to lectin pathway-specific C4 deposition. In contrast, the collectin mannose binding lectin C (MBL-C) but not MBL-A led to efficient lectin pathway activation on A. fumigatus in the absence of ficolin-A. In addition, ficolin-A opsonization led to a modulation of the proinflammatory cytokine interleukin-8. We conclude that ficolin-A may play an important role in the innate defense against Aspergillus by opsonizing conidia, immobilizing this fungus through enhanced adherence to epithelial cells and modulation of inflammation. However, it appears that other immune pattern recognition molecules, i.e., those of the collectin MBL-C, are involved in the Aspergillus-lectin complement pathway activation rather than ficolin-A. PMID:23478320

  5. Protection of Nonself Surfaces from Complement Attack by Factor H-Binding Peptides: Implications for Therapeutic Medicine

    PubMed Central

    Wu, You-Qiang; Qu, Hongchang; Sfyroera, Georgia; Tzekou, Apostolia; Kay, Brian K.; Nilsson, Bo; Ekdahl, Kristina Nilsson; Ricklin, Daniel; Lambris, John D.

    2011-01-01

    Exposure of nonself surfaces such as those of biomaterials or transplanted cells and organs to host blood frequently triggers innate immune responses, thereby affecting both their functionality and tolerability. Activation of the alternative pathway of complement plays a decisive role in this unfavorable reaction. Whereas previous studies demonstrated that immobilization of physiological regulators of complement activation (RCA) can attenuate this foreign body-induced activation, simple and efficient approaches for coating artificial surfaces with intact RCA are still missing. The conjugation of small molecular entities that capture RCA with high affinity is an intriguing alternative, as this creates a surface with autoregulatory activity upon exposure to blood. We therefore screened two variable cysteine-constrained phage-displayed peptide libraries for factor H-binding peptides. We discovered three peptide classes that differed with respect to their main target binding areas. Peptides binding to the broad middle region of factor H (domains 5–18) were of particular interest, as they do not interfere with either regulatory or binding activities. One peptide in this group (5C6) was further characterized and showed high factor H-capturing activity while retaining its functional integrity. Most importantly, when 5C6 was coated to a model polystyrene surface and exposed to human lepirudin-anticoagulated plasma, the bound peptide captured factor H and substantially inhibited complement activation by the alternative pathway. Our study therefore provides a promising and novel approach to produce therapeutic materials with enhanced biocompatibility. PMID:21339361

  6. Chimeras of human complement C9 reveal the site recognized by complement regulatory protein CD59.

    PubMed

    Hüsler, T; Lockert, D H; Kaufman, K M; Sodetz, J M; Sims, P J

    1995-02-24

    CD59 antigen is a membrane glycoprotein that inhibits the activity of the C9 component of the C5b-9 membrane attack complex, thereby protecting human cells from lysis by human complement. The complement-inhibitory activity of CD59 is species-selective and is most effective toward C9 derived from human or other primate plasma. By contrast, rabbit C9, which can substitute for human C9 in the membrane attack complex, mediates unrestricted lysis of human cells. To identify the peptide segment of human C9 that is recognized by CD59, rabbit C9 cDNA clones were isolated, characterized, and used to construct hybrid cDNAs for expression of full-length human/rabbit C9 chimeras in COS-7 cells. All resulting chimeras were hemolytically active, when tested against chicken erythrocytes bearing C5b-8 complexes. Assays performed in the presence or absence of CD59 revealed that this inhibitor reduced the hemolytic activity of those chimeras containing human C9 sequence between residues 334-415, irrespective of whether the remainder of the protein contained human or rabbit sequence. By contrast, when this segment of C9 contained rabbit sequence, lytic activity was unaffected by CD59. These data establish that human C9 residues 334-415 contain the site recognized by CD59, and they suggest that sequence variability within this segment of C9 is responsible for the observed species-selective inhibitory activity of CD59.

  7. Significant changes in ITIH4, AHSG, ORM1, and CD46 content in milk fat globule membrane proteins of ketotic dairy cows.

    PubMed

    Gao, Sansi; Yang, Wei; Yu, Hongjiang; Liu, Runqi; Dong, Zhihao; Zhang, Hongyou; Xia, Cheng; Xu, Chuang

    2017-11-01

    High concentrations of non-esterified fatty acid (NEFA) and β-hydroxybutyrate (BHBA) in cows' blood caused by ketosis are associated with inflammatory states. We hypothesised that ketosis in postparturient dairy cows would result in altered levels on inflammation-related proteins not only in plasma but also in the milk fat globule membranes (MFGM). Thirty cows were selected from a dairy farm in Heilongjiang, China. Inflammatory milk fat globule membrane proteins were detected using ELISA kits, and a fully automatic biochemical analyser was used to measure the concentrations of BHBA, NEFA, glucose (GLU) and triglyceride (TG) in plasma. MFGM protein from milk of ketotic cows contained significantly different concentrations of acute-phase response proteins (complement C3 (C3), prothrombin (F2), alpha-1-acid glycoprotein (ORM1), inter-alpha-trypsin inhibitor heavy chain H4 (ITIH4), alpha-2-HS-glycoprotein (AHSG), complement C9 (C9), complement regulatory protein variant 4 (CD46)) in comparison with milk from non-ketotic cows. Blood concentrations of C3, complement C9 (C9), tumour necrosis factor α (TNFα), MFGM C3, monocyte differentiation antigen CD14 (CD14) and ORM1 levels were correlated with energy balance. ITIH4 and CD46 increased, and AHSG and ORM1 decreased before the onset of ketosis. These biomarkers offer potential as predictors and monitors of ketosis in at-risk cows.

  8. Expression of Human Complement Factor H Prevents Age-Related Macular Degeneration–Like Retina Damage and Kidney Abnormalities in Aged Cfh Knockout Mice

    PubMed Central

    Ding, Jin-Dong; Kelly, Una; Landowski, Michael; Toomey, Christopher B.; Groelle, Marybeth; Miller, Chelsey; Smith, Stephanie G.; Klingeborn, Mikael; Singhapricha, Terry; Jiang, Haixiang; Frank, Michael M.; Bowes Rickman, Catherine

    2016-01-01

    Complement factor H (CFH) is an important regulatory protein in the alternative pathway of the complement system, and CFH polymorphisms increase the genetic risk of age-related macular degeneration dramatically. These same human CFH variants have also been associated with dense deposit disease. To mechanistically study the function of CFH in the pathogenesis of these diseases, we created transgenic mouse lines using human CFH bacterial artificial chromosomes expressing full-length human CFH variants and crossed these to Cfh knockout (Cfh−/−) mice. Human CFH protein inhibited cleavage of mouse complement component 3 and factor B in plasma and in retinal pigment epithelium/choroid/sclera, establishing that human CFH regulates activation of the mouse alternative pathway. One of the mouse lines, which express relatively higher levels of CFH, demonstrated functional and structural protection of the retina owing to the Cfh deletion. Impaired visual function, detected as a deficit in the scotopic electroretinographic response, was improved in this transgenic mouse line compared with Cfh−/− mice, and transgenics had a thicker outer nuclear layer and less sub–retinal pigment epithelium deposit accumulation. In addition, expression of human CFH also completely protected the mice from developing kidney abnormalities associated with loss of CFH. These humanized CFH mice present a valuable model for study of the molecular mechanisms of age-related macular degeneration and dense deposit disease and for testing therapeutic targets. PMID:25447048

  9. Phenotypic characterization of 10 methanol oxidation mutant classes in Methylobacterium sp. strain AM1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nunn, D.N.; Lidstrom, M.E.

    Twenty-five methanol oxidation mutants of the facultative methylotroph Methylobacterium sp. strain AM1 have been characterized by complementation analysis and assigned to 10 complementation groups, Mox A1, A2, A3, and B through H. In this study we have characterized each of the mutants belonging to the 10 Mox complementation groups for the following criteria: (i) phenazine methosulfate-dichlorophenolindophenol dye-linked methanol dehydrogenase activity; (ii) methanol-dependent whole-cell oxygen consumption; (iii) the presence or absence of methanol dehydrogenase protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting; (iv) the absorption spectra of purified mutant methanol dehydrogenase proteins; and (v) the presence or absence ofmore » the soluble cytochrome c proteins of Methylobacterium sp. strain AM1, as determined by reduced-oxidized difference spectra and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. With this information, we have proposed functions for each of the genes deficient in the mutants of the 10 Mox complementation groups. These proposed gene functions include two linked genes that encode the methanol dehydrogenase structural protein and the soluble cytochrome c/sub L/, a gene encoding a secretion function essential for the synthesis and export of methanol dehydrogenase and cytochrome c/sub L/, three gene functions responsible for the proper association of the pyrrolo-quinoline quinone prosthetic group with the methanol dehydrogenase apoprotein, and four positive regulatory gene functions controlling the expression of the ability to oxidize methanol.« less

  10. RNA-FISH to Study Regulatory RNA at the Site of Transcription.

    PubMed

    Soler, Marta; Boque-Sastre, Raquel; Guil, Sonia

    2017-01-01

    The increasing role of all types of regulatory RNAs in the orchestration of cellular programs has enhanced the development of a variety of techniques that allow its precise detection, quantification, and functional scrutiny. Recent advances in imaging and fluoresecent in situ hybridization (FISH) methods have enabled the utilization of user-friendly protocols that provide highly sensitive and accurate detection of ribonucleic acid molecules at both the single cell and subcellular levels. We herein describe the approach originally developed by Stellaris ® , in which the target RNA molecule is fluoresecently labeled with multiple tiled complementary probes each carrying a fluorophore, thus improving sensitivity and reducing the chance of false positives. We have applied this method to the detection of nascent RNAs that partake of special regulatory structures called R loops. Their growing role in active gene expression regulation (Aguilera and Garcia-Muse, Mol Cell 46:115-124, 2012; Ginno et al., Mol Cell 45:814-825, 2012; Sun et al., Science 340:619-621, 2013; Bhatia et al., Nature 511:362-365, 2014) imposes the use of a combination of in vivo and in vitro techniques for the detailed analysis of the transcripts involved. Therefore, their study is a good example to illustrate how RNA FISH, combined with transcriptional arrest and/or cell synchronization, permits localization and temporal characterization of potentially regulatory RNA sequences.

  11. Crystal structures of the CBS and DRTGG domains of the regulatory region of Clostridiumperfringens pyrophosphatase complexed with the inhibitor, AMP, and activator, diadenosine tetraphosphate.

    PubMed

    Tuominen, H; Salminen, A; Oksanen, E; Jämsen, J; Heikkilä, O; Lehtiö, L; Magretova, N N; Goldman, A; Baykov, A A; Lahti, R

    2010-05-07

    Nucleotide-binding cystathionine beta-synthase (CBS) domains serve as regulatory units in numerous proteins distributed in all kingdoms of life. However, the underlying regulatory mechanisms remain to be established. Recently, we described a subfamily of CBS domain-containing pyrophosphatases (PPases) within family II PPases. Here, we express a novel CBS-PPase from Clostridium perfringens (CPE2055) and show that the enzyme is inhibited by AMP and activated by a novel effector, diadenosine 5',5-P1,P4-tetraphosphate (AP(4)A). The structures of the AMP and AP(4)A complexes of the regulatory region of C. perfringens PPase (cpCBS), comprising a pair of CBS domains interlinked by a DRTGG domain, were determined at 2.3 A resolution using X-ray crystallography. The structures obtained are the first structures of a DRTGG domain as part of a larger protein structure. The AMP complex contains two AMP molecules per cpCBS dimer, each bound to a single monomer, whereas in the activator-bound complex, one AP(4)A molecule bridges two monomers. In the nucleotide-bound structures, activator binding induces significant opening of the CBS domain interface, compared with the inhibitor complex. These results provide structural insight into the mechanism of CBS-PPase regulation by nucleotides. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Stochastic Effects in Computational Biology of Space Radiation Cancer Risk

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Pluth, Janis; Harper, Jane; O'Neill, Peter

    2007-01-01

    Estimating risk from space radiation poses important questions on the radiobiology of protons and heavy ions. We are considering systems biology models to study radiation induced repair foci (RIRF) at low doses, in which less than one-track on average transverses the cell, and the subsequent DNA damage processing and signal transduction events. Computational approaches for describing protein regulatory networks coupled to DNA and oxidative damage sites include systems of differential equations, stochastic equations, and Monte-Carlo simulations. We review recent developments in the mathematical description of protein regulatory networks and possible approaches to radiation effects simulation. These include robustness, which states that regulatory networks maintain their functions against external and internal perturbations due to compensating properties of redundancy and molecular feedback controls, and modularity, which leads to general theorems for considering molecules that interact through a regulatory mechanism without exchange of matter leading to a block diagonal reduction of the connecting pathways. Identifying rate-limiting steps, robustness, and modularity in pathways perturbed by radiation damage are shown to be valid techniques for reducing large molecular systems to realistic computer simulations. Other techniques studied are the use of steady-state analysis, and the introduction of composite molecules or rate-constants to represent small collections of reactants. Applications of these techniques to describe spatial and temporal distributions of RIRF and cell populations following low dose irradiation are described.

  13. [Free from stress by autogenic therapy. Relaxation technique yielding peace of mind and self-insight].

    PubMed

    Broms, C

    1999-02-10

    The utilisation of self-regulatory capacity is one of the purposes of autogenic therapy, a method consisting of exercises focused on the limbs, lungs, heart, diaphragm and head. The physiological response is muscle relaxation, increased peripheral blood flow, lower heart rate and blood pressure, slower and deeper breathing, and reduced oxygen consumption. Autogenic training is applicable in most pathological conditions associated with stress, and can be used preventively or as a complement to conventional treatment.

  14. Analysis of correlated domain motions in IgG light chain reveals possible mechanisms of immunological signal transduction.

    PubMed

    Król, Marcin; Roterman, Irena; Piekarska, Barbara; Konieczny, Leszek; Rybarska, Janina; Stopa, Barbara; Spólnik, Paweł

    2005-05-15

    It was shown experimentally that binding of a micelle composed of Congo red molecules to immunological complexes leads to the enhanced stability of the latter, and simultaneously prevents binding of a complement molecule (C1q). The dye binds in a cavity created by the removal of N-terminal polypeptide chain, as observed experimentally in a model system-immunoglobulin G (IgG) light chain dimer. Molecular Dynamics (MD) simulations of three forms of IgG light chain dimer, with and without the dye, were performed to investigate the role of N-terminal fragment and self-assembled ligand in coupling between V and C domains. Root-mean-square distance (RMSD) time profiles show that removal of N-terminal fragment leads to destabilization of V domain. A micelle composed of four self-assembled dye molecules stabilizes and fixes the domain. Analysis of root-mean-square fluctuation (RMSF) values and dynamic cross-correlation matrices (DCCM) reveals that removal of N-terminal fragment results in complete decoupling between V and C domains. Binding of self-assembled Congo red molecules improves the coupling, albeit slightly. The disruption of a small beta-sheet composed of N- and C-terminal fragments of the domain (NC sheet) is the most likely reason for the decoupling. Self-assembled ligand, bound in the place originally occupied by N-terminal fragment, is not able to take over the function of the beta-sheet. Lack of correlation of motions between residues in V and C domains denotes that light chain-Congo red complexes have hampered ability to transmit conformational changes between domains. This is a likely explanation of the lack of complement binding by immunological complexes, which bind Congo red, and supports the idea that the NC sheet is the key structural fragment taking part in immunological signal transduction. Copyright 2005 Wiley-Liss, Inc.

  15. Studies of Dynamic Protein-Protein Interactions in Bacteria Using Renilla Luciferase Complementation Are Undermined by Nonspecific Enzyme Inhibition

    PubMed Central

    Hatzios, Stavroula K.; Ringgaard, Simon; Davis, Brigid M.; Waldor, Matthew K.

    2012-01-01

    The luciferase protein fragment complementation assay is a powerful tool for studying protein-protein interactions. Two inactive fragments of luciferase are genetically fused to interacting proteins, and when these two proteins interact, the luciferase fragments can reversibly associate and reconstitute enzyme activity. Though this technology has been used extensively in live eukaryotic cells, split luciferase complementation has not yet been applied to studies of dynamic protein-protein interactions in live bacteria. As proof of concept and to develop a new tool for studies of bacterial chemotaxis, fragments of Renilla luciferase (Rluc) were fused to the chemotaxis-associated response regulator CheY3 and its phosphatase CheZ in the enteric pathogen Vibrio cholerae. Luciferase activity was dependent on the presence of both CheY3 and CheZ fusion proteins, demonstrating the specificity of the assay. Furthermore, enzyme activity was markedly reduced in V. cholerae chemotaxis mutants, suggesting that this approach can measure defects in chemotactic signaling. However, attempts to measure changes in dynamic CheY3-CheZ interactions in response to various chemoeffectors were undermined by nonspecific inhibition of the full-length luciferase. These observations reveal an unexpected limitation of split Rluc complementation that may have implications for existing data and highlight the need for great caution when evaluating small molecule effects on dynamic protein-protein interactions using the split luciferase technology. PMID:22905225

  16. Studies of dynamic protein-protein interactions in bacteria using Renilla luciferase complementation are undermined by nonspecific enzyme inhibition.

    PubMed

    Hatzios, Stavroula K; Ringgaard, Simon; Davis, Brigid M; Waldor, Matthew K

    2012-01-01

    The luciferase protein fragment complementation assay is a powerful tool for studying protein-protein interactions. Two inactive fragments of luciferase are genetically fused to interacting proteins, and when these two proteins interact, the luciferase fragments can reversibly associate and reconstitute enzyme activity. Though this technology has been used extensively in live eukaryotic cells, split luciferase complementation has not yet been applied to studies of dynamic protein-protein interactions in live bacteria. As proof of concept and to develop a new tool for studies of bacterial chemotaxis, fragments of Renilla luciferase (Rluc) were fused to the chemotaxis-associated response regulator CheY3 and its phosphatase CheZ in the enteric pathogen Vibrio cholerae. Luciferase activity was dependent on the presence of both CheY3 and CheZ fusion proteins, demonstrating the specificity of the assay. Furthermore, enzyme activity was markedly reduced in V. cholerae chemotaxis mutants, suggesting that this approach can measure defects in chemotactic signaling. However, attempts to measure changes in dynamic CheY3-CheZ interactions in response to various chemoeffectors were undermined by nonspecific inhibition of the full-length luciferase. These observations reveal an unexpected limitation of split Rluc complementation that may have implications for existing data and highlight the need for great caution when evaluating small molecule effects on dynamic protein-protein interactions using the split luciferase technology.

  17. Complement Interaction with Trypanosomatid Promastigotes in Normal Human Serum

    PubMed Central

    Domínguez, Mercedes; Moreno, Inmaculada; López-Trascasa, Margarita; Toraño, Alfredo

    2002-01-01

    In normal human serum (NHS), axenic promastigotes of Crithidia, Phytomonas, and Leishmania trigger complement activation, and from 1.2 to 1.8 × 105 C3 molecules are deposited per promastigote within 2.5 min. In Leishmania, promastigote C3 binding capacity remains constant during in vitro metacyclogenesis. C3 deposition on promastigotes activated through the classical complement pathway reaches a 50% maximum after ∼50 s, and represents >85% of total C3 bound. In C1q- and C2-deficient human sera, promastigotes cannot activate the classical pathway (CP) unless purified C1q or C2 factors, respectively, are supplemented, demonstrating a requirement for CP factor in promastigote C3 opsonization. NHS depleted of natural anti-Leishmania antibodies cannot trigger promastigote CP activation, but IgM addition restores C3 binding. Furthermore, Leishmania binds natural antibodies in ethylenediaminetetracetic acid (EDTA)-treated NHS; after EDTA removal, promastigote-bound IgM triggers C3 deposition in natural antibody-depleted NHS. Serum collectins and pentraxins thus do not participate significantly in NHS promastigote C3 opsonization. Real-time kinetic analysis of promastigote CP-mediated lysis indicates that between 85–95% of parasites are killed within 2.5 min of serum contact. These data indicate that successful Leishmania infection in man must immediately follow promastigote transmission, and that Leishmania evasion strategies are shaped by the selective pressure exerted by complement. PMID:11854358

  18. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  19. Characterization of tumor-associated T-lymphocyte subsets and immune checkpoint molecules in head and neck squamous cell carcinoma

    PubMed Central

    Thelen, Martin; Reuter, Sabrina; Zentis, Peter; Shimabukuro-Vornhagen, Alexander; Theurich, Sebastian; Wennhold, Kerstin; Garcia-Marquez, Maria; Tharun, Lars; Quaas, Alexander; Schauss, Astrid; Isensee, Jörg; Hucho, Tim; Huebbers, Christian

    2017-01-01

    The composition of tumor-infiltrating lymphocytes (TIL) reflects biology and immunogenicity of cancer. Here, we characterize T-cell subsets and expression of immune checkpoint molecules in head and neck squamous cell carcinoma (HNSCC). We analyzed TIL subsets in primary tumors (n = 34), blood (peripheral blood mononuclear cells (PBMC); n = 34) and non-cancerous mucosa (n = 7) of 34 treatment-naïve HNSCC patients and PBMC of 15 healthy controls. Flow cytometry analyses revealed a highly variable T-cell infiltration mainly of an effector memory phenotype (CD45RA−/CCR7−). Naïve T cells (CD45RA+/CCR7+) were decreased in the microenvironment compared to PBMC of patients, while regulatory T cells (CD4+/CD25+/CD127low and CD4+/CD39+) were elevated. Furthermore, we performed digital image analyses of entire cross sections of HNSCC to define the ‘Immunoscore’ (CD3+ and CD8+ cell infiltration in tumor core and invasive margin) and quantified MHC class I expression on tumor cells by immunohistochemistry. Immune checkpoint molecules cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4), programmed cell death 1 (PD-1) and programmed cell death 1 ligand 1 (PD-L1) were increased in TILs compared to peripheral T cells in flow-cytometric analysis. Human papillomavirus (HPV) positive tumors showed higher numbers of TILs, but a similar composition of T-cell subsets and checkpoint molecule expression compared to HPV negative tumors. Taken together, the tumor microenvironment of HNSCC is characterized by a strong infiltration of regulatory T cells and high checkpoint molecule expression on T-cell subsets. In view of increasingly used immunotherapies, a detailed knowledge of TILs and checkpoint molecule expression on TILs is of high translational relevance. PMID:28574843

  20. Stratospheric Observatory for Infrared Astronomy (SOFIA)

    NASA Astrophysics Data System (ADS)

    Becklin, E. E.; Tielens, A. G. G. M.; Gehrz, R. D.; Callis, H. H. S.

    2007-09-01

    The joint U.S. and German SOFIA project to develop and operate a 2.5-meter infrared airborne telescope in a Boeing 747-SP is now in its final stages of development. Flying in the stratosphere, SOFIA allows observations throughout the infrared and submillimeter region with an average transmission of >= 80%. The SOFIA instrument complement includes broadband imagers, moderate resolution spectrographs capable of resolving broad features due to dust and large molecules, and high resolution spectrometers suitable for kinematic studies of molecular and atomic gas lines at km/s resolution. These instruments will enable SOFIA to make unique contributions to a broad array of science topics. First science flights will begin in 2009, and the observatory is expected to operate for more than 20 years. The sensitivity, characteristics, science instrument complement, and examples of first light science are discussed.

  1. Extending the dynamic range of transcription factor action by translational regulation

    NASA Astrophysics Data System (ADS)

    Sokolowski, Thomas R.; Walczak, Aleksandra M.; Bialek, William; Tkačik, Gašper

    2016-02-01

    A crucial step in the regulation of gene expression is binding of transcription factor (TF) proteins to regulatory sites along the DNA. But transcription factors act at nanomolar concentrations, and noise due to random arrival of these molecules at their binding sites can severely limit the precision of regulation. Recent work on the optimization of information flow through regulatory networks indicates that the lower end of the dynamic range of concentrations is simply inaccessible, overwhelmed by the impact of this noise. Motivated by the behavior of homeodomain proteins, such as the maternal morphogen Bicoid in the fruit fly embryo, we suggest a scheme in which transcription factors also act as indirect translational regulators, binding to the mRNA of other regulatory proteins. Intuitively, each mRNA molecule acts as an independent sensor of the input concentration, and averaging over these multiple sensors reduces the noise. We analyze information flow through this scheme and identify conditions under which it outperforms direct transcriptional regulation. Our results suggest that the dual role of homeodomain proteins is not just a historical accident, but a solution to a crucial physics problem in the regulation of gene expression.

  2. Loss of diacylglycerol kinase epsilon in mice causes endothelial distress and impairs glomerular Cox-2 and PGE2 production

    PubMed Central

    Zhu, Jili; Chaki, Moumita; Lu, Dongmei; Ren, Chongyu; Wang, Shan-Shan; Rauhauser, Alysha; Li, Binghua; Zimmerman, Susan; Jun, Bokkyoo; Du, Yong; Vadnagara, Komal; Wang, Hanquin; Elhadi, Sarah; Quigg, Richard J.; Topham, Matthew K.; Mohan, Chandra; Ozaltin, Fatih; Zhou, Xin J.; Marciano, Denise K.; Bazan, Nicolas G.

    2016-01-01

    Thrombotic microangiopathy (TMA) is a disorder characterized by microvascular occlusion that can lead to thrombocytopenia, hemolytic anemia, and glomerular damage. Complement activation is the central event in most cases of TMA. Primary forms of TMA are caused by mutations in genes encoding components of the complement or regulators of the complement cascade. Recently, we and others have described a genetic form of TMA caused by mutations in the gene diacylglycerol kinase-ε (DGKE) that encodes the lipid kinase DGKε (Lemaire M, Fremeaux-Bacchi V, Schaefer F, Choi MR, Tang WH, Le Quintrec M, Fakhouri F, Taque S, Nobili F, Martinez F, Ji WZ, Overton JD, Mane SM, Nurnberg G, Altmuller J, Thiele H, Morin D, Deschenes G, Baudouin V, Llanas B, Collard L, Majid MA, Simkova E, Nurnberg P, Rioux-Leclerc N, Moeckel GW, Gubler MC, Hwa J, Loirat C, Lifton RP. Nat Genet 45: 531–536, 2013; Ozaltin F, Li BH, Rauhauser A, An SW, Soylemezoglu O, Gonul II, Taskiran EZ, Ibsirlioglu T, Korkmaz E, Bilginer Y, Duzova A, Ozen S, Topaloglu R, Besbas N, Ashraf S, Du Y, Liang CY, Chen P, Lu DM, Vadnagara K, Arbuckle S, Lewis D, Wakeland B, Quigg RJ, Ransom RF, Wakeland EK, Topham MK, Bazan NG, Mohan C, Hildebrandt F, Bakkaloglu A, Huang CL, Attanasio M. J Am Soc Nephrol 24: 377–384, 2013). DGKε is unrelated to the complement pathway, which suggests that unidentified pathogenic mechanisms independent of complement dysregulation may result in TMA. Studying Dgke knockout mice may help to understand the pathogenesis of this disease, but no glomerular phenotype has been described in these animals so far. Here we report that Dgke null mice present subclinical microscopic anomalies of the glomerular endothelium and basal membrane that worsen with age and develop glomerular capillary occlusion when exposed to nephrotoxic serum. We found that induction of cyclooxygenase-2 and of the proangiogenic prostaglandin E2 are impaired in Dgke null kidneys and are associated with reduced expression of the antithrombotic cell adhesion molecule platelet endothelial cell adhesion molecule-1/CD31 in the glomerular endothelium. Notably, prostaglandin E2 supplementation was able to rescue motility defects of Dgke knockdown cells in vitro and to restore angiogenesis in a test in vivo. Our results unveil an unexpected role of Dgke in the induction of cyclooxygenase-2 and in the regulation of glomerular prostanoids synthesis under stress. PMID:26887830

  3. Loss of diacylglycerol kinase epsilon in mice causes endothelial distress and impairs glomerular Cox-2 and PGE2 production.

    PubMed

    Zhu, Jili; Chaki, Moumita; Lu, Dongmei; Ren, Chongyu; Wang, Shan-Shan; Rauhauser, Alysha; Li, Binghua; Zimmerman, Susan; Jun, Bokkyoo; Du, Yong; Vadnagara, Komal; Wang, Hanquin; Elhadi, Sarah; Quigg, Richard J; Topham, Matthew K; Mohan, Chandra; Ozaltin, Fatih; Zhou, Xin J; Marciano, Denise K; Bazan, Nicolas G; Attanasio, Massimo

    2016-05-01

    Thrombotic microangiopathy (TMA) is a disorder characterized by microvascular occlusion that can lead to thrombocytopenia, hemolytic anemia, and glomerular damage. Complement activation is the central event in most cases of TMA. Primary forms of TMA are caused by mutations in genes encoding components of the complement or regulators of the complement cascade. Recently, we and others have described a genetic form of TMA caused by mutations in the gene diacylglycerol kinase-ε (DGKE) that encodes the lipid kinase DGKε (Lemaire M, Fremeaux-Bacchi V, Schaefer F, Choi MR, Tang WH, Le Quintrec M, Fakhouri F, Taque S, Nobili F, Martinez F, Ji WZ, Overton JD, Mane SM, Nurnberg G, Altmuller J, Thiele H, Morin D, Deschenes G, Baudouin V, Llanas B, Collard L, Majid MA, Simkova E, Nurnberg P, Rioux-Leclerc N, Moeckel GW, Gubler MC, Hwa J, Loirat C, Lifton RP. Nat Genet 45: 531-536, 2013; Ozaltin F, Li BH, Rauhauser A, An SW, Soylemezoglu O, Gonul II, Taskiran EZ, Ibsirlioglu T, Korkmaz E, Bilginer Y, Duzova A, Ozen S, Topaloglu R, Besbas N, Ashraf S, Du Y, Liang CY, Chen P, Lu DM, Vadnagara K, Arbuckle S, Lewis D, Wakeland B, Quigg RJ, Ransom RF, Wakeland EK, Topham MK, Bazan NG, Mohan C, Hildebrandt F, Bakkaloglu A, Huang CL, Attanasio M. J Am Soc Nephrol 24: 377-384, 2013). DGKε is unrelated to the complement pathway, which suggests that unidentified pathogenic mechanisms independent of complement dysregulation may result in TMA. Studying Dgke knockout mice may help to understand the pathogenesis of this disease, but no glomerular phenotype has been described in these animals so far. Here we report that Dgke null mice present subclinical microscopic anomalies of the glomerular endothelium and basal membrane that worsen with age and develop glomerular capillary occlusion when exposed to nephrotoxic serum. We found that induction of cyclooxygenase-2 and of the proangiogenic prostaglandin E2 are impaired in Dgke null kidneys and are associated with reduced expression of the antithrombotic cell adhesion molecule platelet endothelial cell adhesion molecule-1/CD31 in the glomerular endothelium. Notably, prostaglandin E2 supplementation was able to rescue motility defects of Dgke knockdown cells in vitro and to restore angiogenesis in a test in vivo. Our results unveil an unexpected role of Dgke in the induction of cyclooxygenase-2 and in the regulation of glomerular prostanoids synthesis under stress. Copyright © 2016 the American Physiological Society.

  4. The hemodialysis membranes: a historical perspective, current state and future prospect.

    PubMed

    Cheung, A K; Leypoldt, J K

    1997-05-01

    Transport and biocompatibility characteristics are two important considerations when choosing hemodialysis membranes. Dialyzer performance depends on clearances of small solutes, middle molecules, and oncotically active proteins. Although complement and neutrophil activation have become the gold standards for biocompatibility testing of dialysis membranes, alterations of other cellular and noncellular blood elements as a result of blood-membrane interactions are also important. Because of concerns about middle molecule transport and biocompatibility, the original cellophane membrane has been gradually replaced by modified cellulosic membranes and synthetic membranes for clinical use. Recent studies suggest that the choice of dialysis membrane influences the clinical outcome of patients in several areas, including intradialytic acute anaphylactoid reactions, beta 2-microglobulin associated amyloidosis, recovery from acute renal failure, and mortality of chronic hemodialysis patients. However, the relative contributions of middle molecule transport, biocompatibility, and other factors in determining these differences in outcome are unclear. Future development of hemodialysis membranes should focus on improving biocompatibility and enhancing clearances of small solutes and middle molecules, while minimizing the loss of larger plasma proteins.

  5. Report on the sixth blind test of organic crystal structure prediction methods

    PubMed Central

    Reilly, Anthony M.; Cooper, Richard I.; Adjiman, Claire S.; Bhattacharya, Saswata; Boese, A. Daniel; Brandenburg, Jan Gerit; Bygrave, Peter J.; Bylsma, Rita; Campbell, Josh E.; Car, Roberto; Case, David H.; Chadha, Renu; Cole, Jason C.; Cosburn, Katherine; Cuppen, Herma M.; Curtis, Farren; Day, Graeme M.; DiStasio Jr, Robert A.; Dzyabchenko, Alexander; van Eijck, Bouke P.; Elking, Dennis M.; van den Ende, Joost A.; Facelli, Julio C.; Ferraro, Marta B.; Fusti-Molnar, Laszlo; Gatsiou, Christina-Anna; Gee, Thomas S.; de Gelder, René; Ghiringhelli, Luca M.; Goto, Hitoshi; Grimme, Stefan; Guo, Rui; Hofmann, Detlef W. M.; Hoja, Johannes; Hylton, Rebecca K.; Iuzzolino, Luca; Jankiewicz, Wojciech; de Jong, Daniël T.; Kendrick, John; de Klerk, Niek J. J.; Ko, Hsin-Yu; Kuleshova, Liudmila N.; Li, Xiayue; Lohani, Sanjaya; Leusen, Frank J. J.; Lund, Albert M.; Lv, Jian; Ma, Yanming; Marom, Noa; Masunov, Artëm E.; McCabe, Patrick; McMahon, David P.; Meekes, Hugo; Metz, Michael P.; Misquitta, Alston J.; Mohamed, Sharmarke; Monserrat, Bartomeu; Needs, Richard J.; Neumann, Marcus A.; Nyman, Jonas; Obata, Shigeaki; Oberhofer, Harald; Oganov, Artem R.; Orendt, Anita M.; Pagola, Gabriel I.; Pantelides, Constantinos C.; Pickard, Chris J.; Podeszwa, Rafal; Price, Louise S.; Price, Sarah L.; Pulido, Angeles; Read, Murray G.; Reuter, Karsten; Schneider, Elia; Schober, Christoph; Shields, Gregory P.; Singh, Pawanpreet; Sugden, Isaac J.; Szalewicz, Krzysztof; Taylor, Christopher R.; Tkatchenko, Alexandre; Tuckerman, Mark E.; Vacarro, Francesca; Vasileiadis, Manolis; Vazquez-Mayagoitia, Alvaro; Vogt, Leslie; Wang, Yanchao; Watson, Rona E.; de Wijs, Gilles A.; Yang, Jack; Zhu, Qiang; Groom, Colin R.

    2016-01-01

    The sixth blind test of organic crystal structure prediction (CSP) methods has been held, with five target systems: a small nearly rigid molecule, a polymorphic former drug candidate, a chloride salt hydrate, a co-crystal and a bulky flexible molecule. This blind test has seen substantial growth in the number of participants, with the broad range of prediction methods giving a unique insight into the state of the art in the field. Significant progress has been seen in treating flexible molecules, usage of hierarchical approaches to ranking structures, the application of density-functional approximations, and the establishment of new workflows and ‘best practices’ for performing CSP calculations. All of the targets, apart from a single potentially disordered Z′ = 2 polymorph of the drug candidate, were predicted by at least one submission. Despite many remaining challenges, it is clear that CSP methods are becoming more applicable to a wider range of real systems, including salts, hydrates and larger flexible molecules. The results also highlight the potential for CSP calculations to complement and augment experimental studies of organic solid forms. PMID:27484368

  6. Biosimilars: Considerations for Oncology Nurses
.

    PubMed

    Vizgirda, Vida; Jacobs, Ira

    2017-04-01

    Biosimilars are developed to be highly similar to and treat the same conditions as licensed biologics. As they are approved and their use becomes more widespread, oncology nurses should be aware of their development and unique considerations. This article reviews properties of biosimilars; their regulation and approval process; the ways in which their quality, safety, and efficacy are evaluated; their postmarketing safety monitoring; and their significance to oncology nurses and oncology nursing.
. A search of PubMed and regulatory agency websites was conducted for references related to the development and use of biosimilars in oncology. 
. Because biologics are large, structurally complex molecules, biosimilars cannot be considered generic equivalents to licensed biologic products. Consequently, regulatory approval for biosimilars is different from approval for small-molecule generics. Oncology nurses are in a unique position to educate themselves, other clinicians, and patients and their families about biosimilars to ensure accurate understanding, as well as optimal and safe use, of biosimilars.

  7. Evolutionary Insights into RNA trans-Splicing in Vertebrates

    PubMed Central

    Lei, Quan; Li, Cong; Zuo, Zhixiang; Huang, Chunhua; Cheng, Hanhua; Zhou, Rongjia

    2016-01-01

    Pre-RNA splicing is an essential step in generating mature mRNA. RNA trans-splicing combines two separate pre-mRNA molecules to form a chimeric non-co-linear RNA, which may exert a function distinct from its original molecules. Trans-spliced RNAs may encode novel proteins or serve as noncoding or regulatory RNAs. These novel RNAs not only increase the complexity of the proteome but also provide new regulatory mechanisms for gene expression. An increasing amount of evidence indicates that trans-splicing occurs frequently in both physiological and pathological processes. In addition, mRNA reprogramming based on trans-splicing has been successfully applied in RNA-based therapies for human genetic diseases. Nevertheless, clarifying the extent and evolution of trans-splicing in vertebrates and developing detection methods for trans-splicing remain challenging. In this review, we summarize previous research, highlight recent advances in trans-splicing, and discuss possible splicing mechanisms and functions from an evolutionary viewpoint. PMID:26966239

  8. A comparative evaluation of the regulation of GM crops or products containing dsRNA and suggested improvements to risk assessments.

    PubMed

    Heinemann, Jack A; Agapito-Tenfen, Sarah Zanon; Carman, Judy A

    2013-05-01

    Changing the nature, kind and quantity of particular regulatory-RNA molecules through genetic engineering can create biosafety risks. While some genetically modified organisms (GMOs) are intended to produce new regulatory-RNA molecules, these may also arise in other GMOs not intended to express them. To characterise, assess and then mitigate the potential adverse effects arising from changes to RNA requires changing current approaches to food or environmental risk assessments of GMOs. We document risk assessment advice offered to government regulators in Australia, New Zealand and Brazil during official risk evaluations of GM plants for use as human food or for release into the environment (whether for field trials or commercial release), how the regulator considered those risks, and what that experience teaches us about the GMO risk assessment framework. We also suggest improvements to the process. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Genetic noise mechanism for power-law switching in bacterial flagellar motors

    NASA Astrophysics Data System (ADS)

    Krivonosov, M. I.; Zaburdaev, V.; Denisov, S. V.; Ivanchenko, M. V.

    2018-06-01

    Switching of the direction of flagella rotations is the key control mechanism governing the chemotactic activity of E. coli and many other bacteria. Power-law distributions of switching times are most peculiar because their emergence cannot be deduced from simple thermodynamic arguments. Recently, it was suggested that by adding finite-time correlations into Gaussian fluctuations regulating the energy height of the barrier between the two rotation states, it is possible to generate switching statistics with an intermediate power-law asymptotics. By using a simple model of a regulatory pathway, we demonstrate that the required amount of correlated ‘noise’ can be produced by finite number fluctuations of reacting protein molecules, a condition common to the intracellular chemistry. The corresponding power-law exponent appears as a tunable characteristic controlled by parameters of the regulatory pathway network such as the equilibrium number of molecules, sensitivities, and the characteristic relaxation time.

  10. Hill functions for stochastic gene regulatory networks from master equations with split nodes and time-scale separation

    NASA Astrophysics Data System (ADS)

    Lipan, Ovidiu; Ferwerda, Cameron

    2018-02-01

    The deterministic Hill function depends only on the average values of molecule numbers. To account for the fluctuations in the molecule numbers, the argument of the Hill function needs to contain the means, the standard deviations, and the correlations. Here we present a method that allows for stochastic Hill functions to be constructed from the dynamical evolution of stochastic biocircuits with specific topologies. These stochastic Hill functions are presented in a closed analytical form so that they can be easily incorporated in models for large genetic regulatory networks. Using a repressive biocircuit as an example, we show by Monte Carlo simulations that the traditional deterministic Hill function inaccurately predicts time of repression by an order of two magnitudes. However, the stochastic Hill function was able to capture the fluctuations and thus accurately predicted the time of repression.

  11. Worms and the Treatment of Inflammatory Bowel Disease: Are Molecules the Answer?

    PubMed Central

    Ruyssers, Nathalie E.; De Winter, Benedicte Y.; De Man, Joris G.; Loukas, Alex; Herman, Arnold G.; Pelckmans, Paul A.; Moreels, Tom G.

    2008-01-01

    The lack of exposure to helminth infections, as a result of improved living standards and medical conditions, may have contributed to the increased incidence of IBD in the developed world. Epidemiological, experimental, and clinical data sustain the idea that helminths could provide protection against IBD. Studies investigating the underlying mechanisms by which helminths might induce such protection have revealed the importance of regulatory pathways, for example, regulatory T-cells. Further investigation on how helminths influence both innate and adaptive immune reactions will shed more light on the complex pathways used by helminths to regulate the hosts immune system. Although therapy with living helminths appears to be effective in several immunological diseases, the disadvantages of a treatment based on living parasites are explicit. Therefore, the identification and characterization of helminth-derived immunomodulatory molecules that contribute to the protective effect could lead to new therapeutic approaches in IBD and other immune diseases. PMID:18509490

  12. Engineering an allosteric transcription factor to respond to new ligands.

    PubMed

    Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan

    2016-02-01

    Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.

  13. Engineering an allosteric transcription factor to respond to new ligands

    PubMed Central

    Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan

    2016-01-01

    Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol or sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits. PMID:26689263

  14. Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

    PubMed Central

    Arenas-Mena, Cesar; Coffman, James A.

    2016-01-01

    Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

  15. Dynamics of alkali ions-neutral molecules reactions: Radio frequency-guided beam experimental cross-sections and direct quasiclassical trajectory studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aguilar, J.; Andres, J. de; Lucas, J. M.

    2012-11-27

    Different reactive processes taking place in collisions between alkali ions and neutral i-C{sub 3}H{sub 7}Cl molecules in the low (center of mass frame) energy range have been studied using an octopole radiofrequency guided-ion-beam apparatus developed in our laboratory. Cross-section energy dependences for all these reactions have been obtained in absolute units. Ab initio electronic structure calculations for those colliding systems evolving on the ground single potential surface have given relevant information on the main topological features of the surfaces. For some of the reactions a dynamic study by 'on the fly' trajectories has complemented the available experimental and electronic structuremore » information.« less

  16. Brucella abortus down-regulates MHC class II by the IL-6-dependent inhibition of CIITA through the downmodulation of IFN regulatory factor-1 (IRF-1).

    PubMed

    Velásquez, Lis N; Milillo, M Ayelén; Delpino, M Victoria; Trotta, Aldana; Fernández, Pablo; Pozner, Roberto G; Lang, Roland; Balboa, Luciana; Giambartolomei, Guillermo H; Barrionuevo, Paula

    2017-03-01

    Brucella abortus is an intracellular pathogen capable of surviving inside of macrophages. The success of B. abortus as a chronic pathogen relies on its ability to orchestrate different strategies to evade the adaptive CD4 + T cell responses that it elicits. Previously, we demonstrated that B. abortus inhibits the IFN-γ-induced surface expression of MHC class II (MHC-II) molecules on human monocytes, and this phenomenon correlated with a reduction in antigen presentation. However, the molecular mechanisms, whereby B. abortus is able to down-regulate the expression of MHC-II, remained to be elucidated. In this study, we demonstrated that B. abortus infection inhibits the IFN-γ-induced transcription of MHC-II, transactivator (CIITA) and MHC-II genes. Accordingly, we observed that the synthesis of MHC-II proteins was also diminished. B. abortus was not only able to reduce the expression of mature MHC-II, but it also inhibited the expression of invariant chain (Ii)-associated immature MHC-II molecules. Outer membrane protein 19 (Omp19), a prototypical B. abortus lipoprotein, diminished the expression of MHC-II and CIITA transcripts to the same extent as B. abortus infection. IL-6 contributes to these down-regulatory phenomena. In addition, B. abortus and its lipoproteins, through IL-6 secretion, induced the transcription of the negative regulators of IFN-γ signaling, suppressor of cytokine signaling (SOCS)-1 and -3, without interfering with STAT1 activation. Yet, B. abortus lipoproteins via IL-6 inhibit the expression of IFN regulatory factor 1 (IRF-1), a critical regulatory transcription factor for CIITA induction. Overall, these results indicate that B. abortus inhibits the expression of MHC-II molecules at very early points in their synthesis and in this way, may prevent recognition by T cells establishing a chronic infection. © Society for Leukocyte Biology.

  17. Adipose derived stem cells (ASCs) isolated from breast cancer tissue express IL-4, IL-10 and TGF-β1 and upregulate expression of regulatory molecules on T cells: do they protect breast cancer cells from the immune response?

    PubMed

    Razmkhah, Mahboobeh; Jaberipour, Mansooreh; Erfani, Nasrollah; Habibagahi, Mojtaba; Talei, Abdol-rasoul; Ghaderi, Abbas

    2011-01-01

    Immunomodulatory function of bone marrow derived mesenchymal stem cells in cancer has recently been investigated. But the resident mesenchymal stem cells as whole in cancer and in the breast cancer tissue have not been studied well. In the present work we isolated adipose derived stem cells (ASCs) from breast cancer and normal breast tissues to investigate the expressions of IL-4, IL-10 and transforming growth factor (TGF)-β1 in ASCs and to see if ASCs isolated from patients can modulate the regulatory molecules on peripheral blood lymphocytes. Our results showed that IL-10 and TGF-β1 have significantly higher mRNA expressions in ASCs isolated from breast cancer patients than those from normal individuals (P value <0.05). The culture supernatant of ASCs isolated from breast cancer patients with pathological stage III induced upregulation of the mRNA expression levels of IL-4, TGF-β1, IL-10, CCR4 and CD25 in PBLs. In addition, the percentage of CD4+CD25(high)Foxp3(+) T regulatory cells was increased in vitro. When the same culture supernatant was added to ASCs isolated from normal subjects augmentation of the mRNA expressions of IL-4, IL-10, IL-8, MMP2, VEGF and SDF-1 in normal ASCs was also observed. These data collectively conclude that resident ASCs in breast cancer tissue may have crucial roles in breast tumor growth and progression by inducing regulatory molecules and promoting anti-inflammatory reaction within the tumor microenvironment. Further investigation is required to see if the immune suppression induced by ASCs is an independent property from tumor cells or ASCs gain their immunosuppressive potential from malignant cells. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Extended orientational correlation study for molecular liquids containing distorted tetrahedral molecules: Application to methylene halides

    NASA Astrophysics Data System (ADS)

    Pothoczki, Szilvia; Temleitner, László; Pusztai, László

    2010-04-01

    The method of Rey [Rey, J. Chem. Phys. 126, 164506 (2007)] for describing how molecules orient toward each other in systems with perfect tetrahedral molecules is extended to the case of distorted tetrahedral molecules of c2v symmetry by means of introducing 28 subgroups. Additionally, the original analysis developed for perfect tetrahedral molecules, based on six groups, is adapted for molecules with imperfect tetrahedral shape. Deriving orientational correlation functions have been complemented with detailed analyses of dipole-dipole correlations. This way, (up to now) the most complete structure determination can be carried out for such molecular systems. In the present work, these calculations have been applied for particle configurations resulting from reverse Monte Carlo computer modeling. These particle arrangements are fully consistent with structure factors from neutron and x-ray diffraction measurements. Here we present a complex structural study for methylene halide (chloride, bromide, and iodide) molecular liquids, as possibly the best representative examples. It has been found that the most frequent orientations of molecules are of the 2:2 type over the entire distance range in these liquids. Focusing on the short range orientation, neighboring molecules turn toward each other with there "H,Y"-"H,Y" (Y: Cl, Br, I) edges, apart from CH2Cl2 where the H,H-H,Cl arrangement is the most frequent. In general, the structure of methylene chloride appears to be different from the structure of the other two liquids.

  19. Reducing abrupt climate change risk using the Montreal Protocol and other regulatory actions to complement cuts in CO2 emissions

    PubMed Central

    Molina, Mario; Zaelke, Durwood; Sarma, K. Madhava; Andersen, Stephen O.; Ramanathan, Veerabhadran; Kaniaru, Donald

    2009-01-01

    Current emissions of anthropogenic greenhouse gases (GHGs) have already committed the planet to an increase in average surface temperature by the end of the century that may be above the critical threshold for tipping elements of the climate system into abrupt change with potentially irreversible and unmanageable consequences. This would mean that the climate system is close to entering if not already within the zone of “dangerous anthropogenic interference” (DAI). Scientific and policy literature refers to the need for “early,” “urgent,” “rapid,” and “fast-action” mitigation to help avoid DAI and abrupt climate changes. We define “fast-action” to include regulatory measures that can begin within 2–3 years, be substantially implemented in 5–10 years, and produce a climate response within decades. We discuss strategies for short-lived non-CO2 GHGs and particles, where existing agreements can be used to accomplish mitigation objectives. Policy makers can amend the Montreal Protocol to phase down the production and consumption of hydrofluorocarbons (HFCs) with high global warming potential. Other fast-action strategies can reduce emissions of black carbon particles and precursor gases that lead to ozone formation in the lower atmosphere, and increase biosequestration, including through biochar. These and other fast-action strategies may reduce the risk of abrupt climate change in the next few decades by complementing cuts in CO2 emissions. PMID:19822751

  20. Reversible epigenetic down-regulation of MHC molecules by devil facial tumour disease illustrates immune escape by a contagious cancer

    PubMed Central

    Siddle, Hannah V.; Kreiss, Alexandre; Tovar, Cesar; Yuen, Chun Kit; Cheng, Yuanyuan; Belov, Katherine; Swift, Kate; Pearse, Anne-Maree; Hamede, Rodrigo; Jones, Menna E.; Skjødt, Karsten; Woods, Gregory M.; Kaufman, Jim

    2013-01-01

    Contagious cancers that pass between individuals as an infectious cell line are highly unusual pathogens. Devil facial tumor disease (DFTD) is one such contagious cancer that emerged 16 y ago and is driving the Tasmanian devil to extinction. As both a pathogen and an allograft, DFTD cells should be rejected by the host–immune response, yet DFTD causes 100% mortality among infected devils with no apparent rejection of tumor cells. Why DFTD cells are not rejected has been a question of considerable confusion. Here, we show that DFTD cells do not express cell surface MHC molecules in vitro or in vivo, due to down-regulation of genes essential to the antigen-processing pathway, such as β2-microglobulin and transporters associated with antigen processing. Loss of gene expression is not due to structural mutations, but to regulatory changes including epigenetic deacetylation of histones. Consequently, MHC class I molecules can be restored to the surface of DFTD cells in vitro by using recombinant devil IFN-γ, which is associated with up-regulation of the MHC class II transactivator, a key transcription factor with deacetylase activity. Further, expression of MHC class I molecules by DFTD cells can occur in vivo during lymphocyte infiltration. These results explain why T cells do not target DFTD cells. We propose that MHC-positive or epigenetically modified DFTD cells may provide a vaccine to DFTD. In addition, we suggest that down-regulation of MHC molecules using regulatory mechanisms allows evolvability of transmissible cancers and could affect the evolutionary trajectory of DFTD. PMID:23479617

  1. Changes in regulatory molecules for lymphangiogenesis in intestinal lymphangiectasia with enteric protein loss.

    PubMed

    Hokari, Ryota; Kitagawa, Noritake; Watanabe, Chikako; Komoto, Shunsuke; Kurihara, Chie; Okada, Yoshikiyo; Kawaguchi, Atsushi; Nagao, Shigeaki; Hibi, Toshifumi; Miura, Soichiro

    2008-07-01

    Vascular endothelial growth factor receptor 3 (VEGFR3) and LYVE-1 are specifically expressed in the endothelium of the lymphatic systems. VEGF-C, D, FOXC2, Prox 1, and SOX18 are known to play central roles in lymphatic development. We investigated the expression of regulatory molecules for lymphangiogenesis in the duodenal mucosa of idiopathic intestinal lymphangiectasia. Biopsy samples were obtained from duodenal biopsies in patients with intestinal lymphangiectasia complicated with protein-losing from white spot lesions in which lymphangiectasia was histologically confirmed. Immunohistochemical analysis for VEGFR3 and LYVE-1 was performed. mRNA expression of VEGF-C, VEGF-D, VEGFR3, and transcription factors was determined by the quantitative reverse transcription-polymerase chain reaction method. In the control mucosa, VEGFR3 was weakly expressed on the central lymphatic vessels in the lamina propria and LYVE-1 was expressed mainly on the lymphatic vessels in the submucosa. In intestinal lymphangiectasia, VEGFR3 and LYVE-1 expression levels were increased on the mucosal surface corresponding to widely dilated lymphatic vessels, while they were decreased in the deeper mucosa. mRNA expression study showed a significant increase in the expression level of VEGFR3 in lymphangiectasia, but the expression of VEGF-C and -D mRNA was significantly suppressed compared with that in controls despite the presence of lymphangiectasia. The mRNA expression levels of FOXC2 and SOX18 were also decreased, whereas Prox 1 was not altered. There is an altered expression of regulatory molecules for lymphangiogenesis in the duodenal mucosa in these patients.

  2. Vascular cell adhesion molecule-1 (VCAM-1) gene transcription and expression are regulated through an antioxidant-sensitive mechanism in human vascular endothelial cells.

    PubMed Central

    Marui, N; Offermann, M K; Swerlick, R; Kunsch, C; Rosen, C A; Ahmad, M; Alexander, R W; Medford, R M

    1993-01-01

    Oxidative stress and expression of the vascular cell adhesion molecule-1 (VCAM-1) on vascular endothelial cells are early features in the pathogenesis of atherosclerosis and other inflammatory diseases. Regulation of VCAM-1 gene expression may be coupled to oxidative stress through specific reduction-oxidation (redox) sensitive transcriptional or posttranscriptional regulatory factors. In cultured human umbilical vein endothelial (HUVE) cells, the cytokine interleukin 1 beta (IL-1 beta) activated VCAM-1 gene expression through a mechanism that was repressed approximately 90% by the antioxidants pyrrolidine dithiocarbamate (PDTC) and N-acetylcysteine (NAC). Furthermore, PDTC selectively inhibited the induction of VCAM-1, but not intercellular adhesion molecule-1 (ICAM-1), mRNA and protein accumulation by the cytokine tumor necrosis factor-alpha (TNF alpha) as well as the noncytokines bacterial endotoxin lipopolysaccharide (LPS) and double-stranded RNA, poly(I:C) (PIC). PDTC also markedly attenuated TNF alpha induction of VCAM-1-mediated cellular adhesion. In a distinct pattern, PDTC partially inhibited E-selectin gene expression in response to TNF alpha but not to LPS, IL-1 beta, or PIC. TNF alpha and LPS-mediated transcriptional activation of the human VCAM-1 promoter through NF-kappa B-like DNA enhancer elements and associated NF-kappa B-like DNA binding proteins was inhibited by PDTC. These studies suggest a molecular linkage between an antioxidant sensitive transcriptional regulatory mechanism and VCAM-1 gene expression that expands on the notion of oxidative stress as an important regulatory signal in the pathogenesis of atherosclerosis. Images PMID:7691889

  3. Symmetry of initial cell divisions among primitive hematopoietic progenitors is independent of ontogenic age and regulatory molecules.

    PubMed

    Huang, S; Law, P; Francis, K; Palsson, B O; Ho, A D

    1999-10-15

    We have developed a time-lapse camera system to follow the replication history and the fate of hematopoietic stem cells (HSC) at a single-cell level. Combined with single-cell culture, we correlated the early replication behavior with colony development after 14 days. The membrane dye PKH26 was used to monitor cell division. In addition to multiple, synchronous, and symmetric divisions, single-sorted CD34(+)/CD38(-) cells derived from fetal liver (FLV) also gave rise to a daughter cell that remained quiescent for up to 8 days, whereas the other daughter cell proliferated exponentially. Upon separation and replating as single cells onto medium containing a cytokine cocktail, 60.6% +/- 9.8% of the initially quiescent cells (PKH26 bright) gave rise again to colonies and 15.8% +/- 7.8% to blast colonies that could be replated. We have then determined the effects of various regulatory molecules on symmetry of initial cell divisions. After single-cell sorting, the CD34(+)/CD38(-) cells derived from FLV were exposed to flt3-ligand, thrombopoietin, stem cell factor (SCF), or medium containing a cytokine cocktail (with SCF, interleukin-3, interleukin-6, granulocyte-macrophage colony-stimulating factor, and erythropoietin). Whereas mitotic rate, colony efficiency, and asymmetric divisions could be altered using various regulatory molecules, the asymmetric division index, defined as the number of asymmetric divisions versus the number of dividing cells, was not altered significantly. This observation suggests that, although lineage commitment and cell proliferation can be skewed by extrinsic signaling, symmetry of early divisions is probably under the control of intrinsic factors.

  4. Helminth-induced regulatory T cells and suppression of allergic responses.

    PubMed

    Logan, Jayden; Navarro, Severine; Loukas, Alex; Giacomin, Paul

    2018-05-28

    Infection with helminths has been associated with lower rates of asthma and other allergic diseases. This has been attributed, in part, to the ability of helminths to induce regulatory T cells that suppress inappropriate immune responses to allergens. Recent compelling evidence suggests that helminths may promote regulatory T cell expansion or effector functions through either direct (secretion of excretory/secretory molecules) or indirect mechanisms (regulation of the microbiome). This review will discuss key findings from human immunoepidemiological observations, studies using animal models of disease, and clinical trials with live worm infections, discussing the therapeutic potential for worms and their secreted products for treating allergic inflammation. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

  5. Continuous in vivo infusion of interferon-gamma (IFN-γ) enhances engraftment of syngeneic wild-type cells in Fanca–/– and Fancg–/– mice

    PubMed Central

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J.; Critser, John; Arwert, Fre; Haneline, Laura S.; Clapp, D. Wade

    2006-01-01

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc–/– cells to interferon-gamma (IFN-γ), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc–/– mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca–/– and Fancg–/– mice are hypersensitive to IFN-γ and that in vivo infusion of IFN-γ at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-γ conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients. PMID:16946306

  6. Continuous in vivo infusion of interferon-gamma (IFN-gamma) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice.

    PubMed

    Si, Yue; Ciccone, Samantha; Yang, Feng-Chun; Yuan, Jin; Zeng, Daisy; Chen, Shi; van de Vrugt, Henri J; Critser, John; Arwert, Fre; Haneline, Laura S; Clapp, D Wade

    2006-12-15

    Fanconi anemia (FA) is a heterogeneous genetic disorder characterized by bone marrow (BM) failure and cancer susceptibility. Identification of the cDNAs of FA complementation types allows the potential of using gene transfer technology to introduce functional cDNAs as transgenes into autologous stem cells and provide a cure for the BM failure in FA patients. However, strategies to enhance the mobilization, transduction, and engraftment of exogenous stem cells are required to optimize efficacy prior to widespread clinical use. Hypersensitivity of Fancc-/- cells to interferon-gamma (IFN-gamma), a nongenotoxic immune-regulatory cytokine, enhances engraftment of syngeneic wild-type (WT) cells in Fancc-/- mice. However, whether this phenotype is of broad relevance in other FA complementation groups is unresolved. Here we show that primitive and mature myeloid progenitors in Fanca-/- and Fancg-/- mice are hypersensitive to IFN-gamma and that in vivo infusion of IFN-gamma at clinically relevant concentrations was sufficient to allow consistent long-term engraftment of isogenic WT repopulating stem cells. Given that FANCA, FANCC, and FANCG complementation groups account for more than 90% of all FA patients, these data provide evidence that IFN-gamma conditioning may be a useful nongenotoxic strategy for myelopreparation in FA patients.

  7. Oligosaccharins.

    ERIC Educational Resources Information Center

    Albersheim, Peter; Darvill, Alan G.

    1985-01-01

    Related history and laboratory work which lead to isolation of oligosaccharins, a new class of regulatory molecules found in plant cell walls. These substances function in growth, development, reproduction, and defense. Mixtures of oligosaccharins and other hormones can stimulate growth of an undifferentiated callus, roots, vegetative…

  8. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    PubMed

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by far the most variable segment. Further analyses involving the binding of transcription factors and non-coding RNAs, as well as the HLA-E expression in different tissues, are necessary to evaluate whether these variable sites at regulatory segments (or even at the coding sequence) may influence the gene expression profile. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Antimicrobial Peptides and Complement in Neonatal Hypoxia-Ischemia Induced Brain Damage

    PubMed Central

    Rocha-Ferreira, Eridan; Hristova, Mariya

    2015-01-01

    Hypoxic-ischemic encephalopathy (HIE) is a clinical condition in the neonate, resulting from oxygen deprivation around the time of birth. HIE affects 1–5/1000 live births worldwide and is associated with the development of neurological deficits, including cerebral palsy, epilepsy, and cognitive disabilities. Even though the brain is considered as an immune-privileged site, it has innate and adaptive immune response and can produce complement (C) components and antimicrobial peptides (AMPs). Dysregulation of cerebral expression of AMPs and C can exacerbate or ameliorate the inflammatory response within the brain. Brain ischemia triggers a prolonged inflammatory response affecting the progression of injury and secondary energy failure and involves both innate and adaptive immune systems, including immune-competent and non-competent cells. Following injury to the central nervous system (CNS), including neonatal hypoxia-ischemia (HI), resident microglia, and astroglia are the main cells providing immune defense to the brain in a stimulus-dependent manner. They can express and secrete pro-inflammatory cytokines and therefore trigger prolonged inflammation, resulting in neurodegeneration. Microglial cells express and release a wide range of inflammation-associated molecules including several components of the complement system. Complement activation following neonatal HI injury has been reported to contribute to neurodegeneration. Astrocytes can significantly affect the immune response of the CNS under pathological conditions through production and release of pro-inflammatory cytokines and immunomodulatory AMPs. Astrocytes express β-defensins, which can chemoattract and promote maturation of dendritic cells (DC), and can also limit inflammation by controlling the viability of these same DC. This review will focus on the balance of complement components and AMPs within the CNS following neonatal HI injury and the effect of that balance on the subsequent brain damage. PMID:25729383

  10. Human Single-Chain Fv Immunoconjugates Targeted to a Melanoma-Associated Chondroitin Sulfate Proteoglycan Mediate Specific Lysis of Human Melanoma Cells by Natural Killer Cells and Complement

    NASA Astrophysics Data System (ADS)

    Wang, Baiyang; Chen, Yi-Bin; Ayalon, Oran; Bender, Jeffrey; Garen, Alan

    1999-02-01

    Two antimelanoma immunoconjugates containing a human single-chain Fv (scFv) targeting domain conjugated to the Fc effector domain of human IgG1 were synthesized as secreted two-chain molecules in Chinese hamster ovary and Drosophila S2 cells, and purified by affinity chromatography on protein A. The scFv targeting domains originally were isolated as melanoma-specific clones from a scFv fusion-phage library, derived from the antibody repertoire of a vaccinated melanoma patient. The purified immunoconjugates showed similar binding specificity as did the fusion-phage clones. Binding occurred to human melanoma cells but not to human melanocytes or to several other types of normal cells and tumor cells. A 250-kDa melanoma protein was immunoprecipitated by the immunoconjugates and analyzed by mass spectrometry, using two independent procedures. A screen of protein sequence databases showed an exact match of several peptide masses between the immunoprecipitated protein and the core protein of a chondroitin sulfate proteoglycan, which is expressed on the surface of most human melanoma cells. The Fc effector domain of the immunoconjugates binds natural killer (NK) cells and also the C1q protein that initiates the complement cascade; both NK cells and complement can activate powerful cytolytic responses against the targeted tumor cells. An in vitro cytolysis assay was used to test for an immunoconjugate-dependent specific cytolytic response against cultured human melanoma cells by NK cells and complement. The melanoma cells, but not the human fibroblast cells used as the control, were efficiently lysed by both NK cells and complement in the presence of the immunoconjugates. The in vitro results suggest that the immunoconjugates also could activate a specific cytolytic immune response against melanoma tumors in vivo.

  11. Spectroscopic Studies of the Super Relaxed State of Skeletal Muscle

    PubMed Central

    Naber, Nariman; Pate, Edward; Canton, Marcella; Reggiani, Carlo; Cooke, Roger

    2016-01-01

    In the super-relaxed state of myosin, ATPase activity is strongly inhibited by binding of the myosin heads to the core of the thick filament in a structure known as the interacting-heads motif. In the disordered relaxed state myosin heads are not bound to the core of the thick filament and have an ATPase rate that is 10 fold greater. In the interacting-heads motif the two regulatory light chains appear to bind to each other. We have made single cysteine mutants of the regulatory light chain, placed both paramagnetic and fluorescent probes on them, and exchanged them into skinned skeletal muscle fibers. Many of the labeled light chains tended to disrupt the stability of the super-relaxed state, and showed spectral changes in the transition from the disordered relaxed state to the super-relaxed state. These data support the putative interface between the two regulatory light chains identified by cryo electron microscopy and show that both the divalent cation bound to the regulatory light chain and the N-terminus of the regulatory light chain play a role in the stability of the super-relaxed state. One probe showed a shift to shorter wavelengths in the super-relaxed state such that a ratio of intensities at 440nm to that at 520nm provided a measure of the population of the super-relaxed state amenable for high throughput screens for finding potential pharmaceuticals. The results provide a proof of concept that small molecules that bind to this region can destabilize the super-relaxed state and provide a method to search for small molecules that do so leading to a potentially effective treatment for Type 2 diabetes and obesity. PMID:27479128

  12. SPLINTS: small-molecule protein ligand interface stabilizers.

    PubMed

    Fischer, Eric S; Park, Eunyoung; Eck, Michael J; Thomä, Nicolas H

    2016-04-01

    Regulatory protein-protein interactions are ubiquitous in biology, and small molecule protein-protein interaction inhibitors are an important focus in drug discovery. Remarkably little attention has been given to the opposite strategy-stabilization of protein-protein interactions, despite the fact that several well-known therapeutics act through this mechanism. From a structural perspective, we consider representative examples of small molecules that induce or stabilize the association of protein domains to inhibit, or alter, signaling for nuclear hormone, GTPase, kinase, phosphatase, and ubiquitin ligase pathways. These SPLINTS (small-molecule protein ligand interface stabilizers) drive interactions that are in some cases physiologically relevant, and in others entirely adventitious. The diverse structural mechanisms employed suggest approaches for a broader and systematic search for such compounds in drug discovery. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Establishment and validation of new complementing cells for production of E1-deleted adenovirus vectors in serum-free suspension culture.

    PubMed

    Gilbert, Rénald; Guilbault, Claire; Gagnon, David; Bernier, Alice; Bourget, Lucie; Elahi, Seyyed Mehdy; Kamen, Amine; Massie, Bernard

    2014-11-01

    E1-deleted adenovirus vectors (AdV) are important gene transfer vehicles for gene therapy and vaccination. Amplification of AdV must take place in cells that express the adenovirus E1A and E1B genes. Sequence homology between AdV and the E1 genes integrated within the complementing cells should be minimal to reduce the odds of generating replication-competent adenovirus (RCA). The present study describes the establishment of AdV complementing cells constructed by stable transfection of the minimal E1A and E1B genes into human lung carcinoma (A549). Because some transgene products can be cytotoxic, the cells were engineered to stably express the repressor of the cumate-switch (CymR) to silence transgene transcription during vector growth. For regulatory compliance and to facilitate the scale-up, the resulting complementing cells (SF-BMAdR) were adapted to serum-free suspension culture. The best clone of SF-BMAdR produced AdV carrying an innocuous transgene to the same level as 293 cells, but titers were better for AdV carrying transgene for a cytotoxic product. Elevated titers were maintained for at least two months in suspension culture in the absence of selective agent and the cells did not produce RCA. Because of their advantageous properties, SF-BMAdR cells should become an important tool for developing large-scale production processes of AdV for research and clinical applications. Copyright © 2014. Published by Elsevier B.V.

  14. Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.

    PubMed

    da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes

    2016-05-01

    Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.

  15. Nanoparticles and direct immunosuppression

    PubMed Central

    Ngobili, Terrika A

    2016-01-01

    Targeting the immune system with nanomaterials is an intensely active area of research. Specifically, the capability to induce immunosuppression is a promising complement for drug delivery and regenerative medicine therapies. Many novel strategies for immunosuppression rely on nanoparticles as delivery vehicles for small-molecule immunosuppressive compounds. As a consequence, efforts in understanding the mechanisms in which nanoparticles directly interact with the immune system have been overshadowed. The immunological activity of nanoparticles is dependent on the physiochemical properties of the nanoparticles and its subsequent cellular internalization. As the underlying factors for these reactions are elucidated, more nanoparticles may be engineered and evaluated for inducing immunosuppression and complementing immunosuppressive drugs. This review will briefly summarize the state-of-the-art and developments in understanding how nanoparticles induce immunosuppressive responses, compare the inherent properties of nanomaterials which induce these immunological reactions, and comment on the potential for using nanomaterials to modulate and control the immune system. PMID:27229901

  16. Spectroscopic observations with the Stratospheric Observatory for Infrared Astronomy (SOFIA)

    NASA Astrophysics Data System (ADS)

    Becklin, E. E.; Tielens, A. G. G. M.; Callis, H. H. S.

    The joint US and German SOFIA project to develop and operate a 2.5-meter infrared airborne telescope in a Boeing 747-SP is now in its final stages of development. Flying in the stratosphere, SOFIA allows observations through the infrared and submillimeter region, with an average transmission of greater than 80%. SOFIA is characterized by a wide instrument complement ranging from broadband imagers, through moderate resolution spectrographs capable of resolving broad features due to dust and large molecules, to high-resolution spectrometers suitable for kinematic studies of molecular and atomic gas lines at km/s resolution. This broad range in instruments will enable SOFIA to make unique contributions to a broad array of science topics. First science flights will begin in 2009 and the observatory is expected to operate for over 20 years. The sensitivity, characteristics, science instrument complement, and examples of first light spectroscopic science are discussed.

  17. Stratospheric Observatory for Infrared Astronomy (sofia)

    NASA Astrophysics Data System (ADS)

    Becklin, E. E.; Tielens, A. G. G. M.; Callis, H. H. S.

    The joint U.S. and German SOFIA project to develop and operate a 2.5-meter infrared airborne telescope in a Boeing 747-SP is now in its final stages of development. Flying in the stratosphere, SOFIA allows observations through the infrared and submillimeter region, with an average transmission of ≳ 80%. SOFIA is characterized by a wide instrument complement ranging from broadband imagers, through moderate resolution spectrographs capable of resolving broad features due to dust and large molecules, to high resolution spectrometers suitable for kinematic studies of molecular and atomic gas lines at km/s resolution. This broad range in instruments will enable SOFIA to make unique contributions to a broad array of science topics. First science flights will begin in 2009 and the observatory is expected to operate for over 20 years. The sensitivity, characteristics, science instrument complement, and examples of first light science are discussed.

  18. Stratospheric Observatory for Infrared Astronomy (SOFIA)

    NASA Astrophysics Data System (ADS)

    Becklin, E. E.; Gehrz, R. D.

    2009-08-01

    The joint U.S. and German SOFIA project to develop and operate a 2.5-meter infrared airborne telescope in a Boeing 747-SP is in its final stages of development. Flying in the stratosphere, SOFIA allows observations throughout the infrared and submillimeter region, with an average transmission of greater than 80%. SOFIA's first generation instrument complement includes high-speed photometers, broadband imagers, moderate resolution spectrographs capable of resolving broad features due to dust and large molecules, and high resolution spectrometers suitable for kinematic studies of molecular and atomic gas lines at km/s resolution. These instruments will enable SOFIA to make unique contributions to a broad array of science topics. First science flights will begin in 2010, and the observatory is expected to operate for more than 20 years. The sensitivity, characteristics, science instrument complement, future instrument opportunities and examples of first light science will be discussed.

  19. Genome of the opportunistic pathogen Streptococcus sanguinis.

    PubMed

    Xu, Ping; Alves, Joao M; Kitten, Todd; Brown, Arunsri; Chen, Zhenming; Ozaki, Luiz S; Manque, Patricio; Ge, Xiuchun; Serrano, Myrna G; Puiu, Daniela; Hendricks, Stephanie; Wang, Yingping; Chaplin, Michael D; Akan, Doruk; Paik, Sehmi; Peterson, Darrell L; Macrina, Francis L; Buck, Gregory A

    2007-04-01

    The genome of Streptococcus sanguinis is a circular DNA molecule consisting of 2,388,435 bp and is 177 to 590 kb larger than the other 21 streptococcal genomes that have been sequenced. The G+C content of the S. sanguinis genome is 43.4%, which is considerably higher than the G+C contents of other streptococci. The genome encodes 2,274 predicted proteins, 61 tRNAs, and four rRNA operons. A 70-kb region encoding pathways for vitamin B(12) biosynthesis and degradation of ethanolamine and propanediol was apparently acquired by horizontal gene transfer. The gene complement suggests new hypotheses for the pathogenesis and virulence of S. sanguinis and differs from the gene complements of other pathogenic and nonpathogenic streptococci. In particular, S. sanguinis possesses a remarkable abundance of putative surface proteins, which may permit it to be a primary colonizer of the oral cavity and agent of streptococcal endocarditis and infection in neutropenic patients.

  20. The role of anti-inflammatory agents in age-related macular degeneration (AMD) treatment

    PubMed Central

    Wang, Y; Wang, V M; Chan, C-C

    2011-01-01

    Although age-related macular degeneration (AMD) is not a classic inflammatory disease like uveitis, inflammation has been found to have an important role in disease pathogenesis and progression. Innate immunity and autoimmune components, such as complement factors, chemokines, cytokines, macrophages, and ocular microglia, are believed to be heavily involved in AMD development. Targeting these specific inflammatory molecules has recently been explored in an attempt to better understand and treat AMD. Although antivascular endothelial growth factor therapy is the first line of defence against neovascular AMD, anti-inflammatory agents such as corticosteroids, nonsteroidal anti-inflammatory drugs (NSAIDs), immunosuppressive agents (eg, methotrexate and rapamycin), and biologics (eg, infliximab, daclizumab, and complement inhibitors) may provide an adjunct or alternative mechanism to suppress the inflammatory processes driving AMD progression. Further investigation is required to evaluate the long-term safety and efficacy of these drugs for both neovascular and non-neovascular AMD. PMID:21183941

  1. Staphylococcus aureus Manipulates Innate Immunity through Own and Host-Expressed Proteases.

    PubMed

    Pietrocola, Giampiero; Nobile, Giulia; Rindi, Simonetta; Speziale, Pietro

    2017-01-01

    Neutrophils, complement system and skin collectively represent the main elements of the innate immune system, the first line of defense of the host against many common microorganisms. Bacterial pathogens have evolved strategies to counteract all these defense activities. Specifically, Staphylococcus aureus , a major human pathogen, secretes a variety of immune evasion molecules including proteases, which cleave components of the innate immune system or disrupt the integrity of extracellular matrix and intercellular connections of tissues. Additionally, S. aureus secretes proteins that can activate host zymogens which, in turn, target specific defense components. Secreted proteins can also inhibit the anti-bacterial function of neutrophils or complement system proteases, potentiating S. aureus chances of survival. Here, we review the current understanding of these proteases and modulators of host proteases in the functioning of innate immunity and describe the importance of these mechanisms in the pathology of staphylococcal diseases.

  2. Staphylococcus aureus Manipulates Innate Immunity through Own and Host-Expressed Proteases

    PubMed Central

    Pietrocola, Giampiero; Nobile, Giulia; Rindi, Simonetta; Speziale, Pietro

    2017-01-01

    Neutrophils, complement system and skin collectively represent the main elements of the innate immune system, the first line of defense of the host against many common microorganisms. Bacterial pathogens have evolved strategies to counteract all these defense activities. Specifically, Staphylococcus aureus, a major human pathogen, secretes a variety of immune evasion molecules including proteases, which cleave components of the innate immune system or disrupt the integrity of extracellular matrix and intercellular connections of tissues. Additionally, S. aureus secretes proteins that can activate host zymogens which, in turn, target specific defense components. Secreted proteins can also inhibit the anti-bacterial function of neutrophils or complement system proteases, potentiating S. aureus chances of survival. Here, we review the current understanding of these proteases and modulators of host proteases in the functioning of innate immunity and describe the importance of these mechanisms in the pathology of staphylococcal diseases. PMID:28529927

  3. Hepatic carcinoma-associated fibroblasts induce IDO-producing regulatory dendritic cells through IL-6-mediated STAT3 activation

    PubMed Central

    Cheng, J-t; Deng, Y-n; Yi, H-m; Wang, G-y; Fu, B-s; Chen, W-j; Liu, W; Tai, Y; Peng, Y-w; Zhang, Q

    2016-01-01

    Although carcinoma-associated fibroblasts (CAFs) in tumor microenvironments have a critical role in immune cell modulation, their effects on the generation of regulatory dendritic cells (DCs) are still unclear. In this study, we initially show that CAFs derived from hepatocellular carcinoma (HCC) tumors facilitate the generation of regulatory DCs, which are characterized by low expression of costimulatory molecules, high suppressive cytokines production and enhanced regulation of immune responses, including T-cell proliferation impairment and promotion of regulatory T-cell (Treg) expansion via indoleamine 2,3-dioxygenase (IDO) upregulation. Our findings also indicate that STAT3 activation in DCs, as mediated by CAF-derived interleukin (IL)-6, is essential to IDO production. Moreover, IDO inhibitor, STAT3 and IL-6 blocking antibodies can reverse this hepatic CAF-DC regulatory function. Therefore, our results provide new insights into the mechanisms by which CAFs induce tumor immune escape as well as a novel cancer immunotherapeutic approach (for example, targeting CAFs, IDO or IL-6). PMID:26900950

  4. Exploiting a novel conformational switch to control innate immunity mediated by complement protein C3a.

    PubMed

    Lohman, Rink-Jan; Hamidon, Johan K; Reid, Robert C; Rowley, Jessica A; Yau, Mei-Kwan; Halili, Maria A; Nielsen, Daniel S; Lim, Junxian; Wu, Kai-Chen; Loh, Zhixuan; Do, Anh; Suen, Jacky Y; Iyer, Abishek; Fairlie, David P

    2017-08-24

    Complement C3a is an important protein in innate and adaptive immunity, but its specific roles in vivo remain uncertain because C3a degrades rapidly to form the C3a-desArg protein, which does not bind to the C3a receptor and is indistinguishable from C3a using antibodies. Here we develop the most potent, stable and highly selective small molecule modulators of C3a receptor, using a heterocyclic hinge to switch between agonist and antagonist ligand conformations. This enables characterization of C3 areceptor-selective pro- vs. anti-inflammatory actions in human mast cells and macrophages, and in rats. A C3a receptor-selective agonist induces acute rat paw inflammation by first degranulating mast cells before activating macrophages and neutrophils. An orally administered C3a receptor-selective antagonist inhibits mast cell degranulation, thereby blocking recruitment and activation of macrophages and neutrophils, expression of inflammatory mediators and inflammation in a rat paw edema model. These novel tools reveal the mechanism of C3a-induced inflammation and provide new insights to complement-based medicines.Complement C3a is an important protein in innate and adaptive immunity, but its roles in vivo are unclear. Here the authors develop novel chemical agonists and antagonists for the C3a receptor, and show that they modulate mast cell degranulation and inflammation in a rat paw edema model.

  5. Neural Correlates of the False Consensus Effect: Evidence for Motivated Projection and Regulatory Restraint.

    PubMed

    Welborn, B Locke; Gunter, Benjamin C; Vezich, I Stephanie; Lieberman, Matthew D

    2017-04-01

    The false consensus effect (FCE), the tendency to project our attitudes and opinions on to others, is a pervasive bias in social reasoning with a range of ramifications for individuals and society. Research in social psychology has suggested that numerous factors (anchoring and adjustment, accessibility, motivated projection, etc.) may contribute to the FCE. In this study, we examine the neural correlates of the FCE and provide evidence that motivated projection plays a significant role. Activity in reward regions (ventromedial pFC and bilateral nucleus accumbens) during consensus estimation was positively associated with bias, whereas activity in right ventrolateral pFC (implicated in emotion regulation) was inversely associated with bias. Activity in reward and regulatory regions accounted for half of the total variation in consensus bias across participants (R 2 = .503). This research complements models of the FCE in social psychology, providing a glimpse into the neural mechanisms underlying this important phenomenon.

  6. An Arabidopsis Gene Regulatory Network for Secondary Cell Wall Synthesis

    PubMed Central

    Taylor-Teeples, M; Lin, L; de Lucas, M; Turco, G; Toal, TW; Gaudinier, A; Young, NF; Trabucco, GM; Veling, MT; Lamothe, R; Handakumbura, PP; Xiong, G; Wang, C; Corwin, J; Tsoukalas, A; Zhang, L; Ware, D; Pauly, M; Kliebenstein, DJ; Dehesh, K; Tagkopoulos, I; Breton, G; Pruneda-Paz, JL; Ahnert, SE; Kay, SA; Hazen, SP; Brady, SM

    2014-01-01

    Summary The plant cell wall is an important factor for determining cell shape, function and response to the environment. Secondary cell walls, such as those found in xylem, are composed of cellulose, hemicelluloses and lignin and account for the bulk of plant biomass. The coordination between transcriptional regulation of synthesis for each polymer is complex and vital to cell function. A regulatory hierarchy of developmental switches has been proposed, although the full complement of regulators remains unknown. Here, we present a protein-DNA network between Arabidopsis transcription factors and secondary cell wall metabolic genes with gene expression regulated by a series of feed-forward loops. This model allowed us to develop and validate new hypotheses about secondary wall gene regulation under abiotic stress. Distinct stresses are able to perturb targeted genes to potentially promote functional adaptation. These interactions will serve as a foundation for understanding the regulation of a complex, integral plant component. PMID:25533953

  7. Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

    PubMed

    Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

    1987-01-01

    The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

  8. Hybrid Storage Market Assessment: A JISEA White Paper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ericson, Sean J.; Rose, Eric; Jayaswal, Harshit

    This white paper evaluates which markets are best suited for battery storage and storage hybrids and reviews regulations and incentives that support or impede the implementation of standalone storage and battery hybrids. The costs of battery storage technologies have dropped in recent years, resulting in a seven-fold increase in installed capacity over the last decade (1). These technologies offer an attractive rate of return in some locations; however, cost and regulatory barriers still limit the market for storage. Hybridizing a battery (combining the battery with a generator) can in some instances reduce total system costs and increase value compared tomore » separate installations. The fast ramping and dispatchability of a battery can complement the generator to provide services that neither battery nor generator could provide alone. Battery hybrids also benefit from some policy incentives and may be better able to meet market and regulatory requirements.« less

  9. Roles of Trypanosoma cruzi calreticulin in parasite-host interactions and in tumor growth.

    PubMed

    Ramírez, Galia; Valck, Carolina; Aguilar, Lorena; Kemmerling, Ulrike; López-Muñoz, Rodrigo; Cabrera, Gonzalo; Morello, Antonio; Ferreira, Jorge; Maya, Juan Diego; Galanti, Norbel; Ferreira, Arturo

    2012-10-01

    In Latin America, there are about 10-12 million people infected with Trypanosoma cruzi, the agent of Chagas' disease, one of the most important neglected tropical parasitism. Identification of molecular targets, specific for the aggressor or host cells or both, may be useful in the development of pharmacological and/or immunological therapeutic tools. Classic efforts in Chagas' disease explore those strategies. Although the immune system frequently controls parasite aggressions, sterile immunity is seldom achieved and chronic interactions are thus established. However, laboratory-modified immunologic probes aimed at selected parasite targets, may be more effective than their unmodified counterparts. Calreticulin (CRT) from vertebrates is a calcium binding protein, present mainly in the endoplasmic reticulum (ER), where it directs the conformation of proteins and controls calcium levels. We have isolated, gene-cloned, expressed and characterized T. cruzi calreticulin (TcCRT). Upon infection, the parasite can translocate this molecule from the ER to the surface, where it inhibits both the classical and lectin complement pathways. Moreover, by virtue of its capacity to bind and inactivate first complement component C1, it promotes parasite infectivity. These two related properties reside in the central domain of this molecule. A different domain, amino terminal, binds to endothelial cells, thus inhibiting their angiogenic capacity. Since tumor growth depends, to a large extent on angiogenesis, their growth is also inhibited. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Possibilities of the free-complement methodology for solving the Schrödinger equation of atoms and molecules

    NASA Astrophysics Data System (ADS)

    Nakatsuji, Hiroshi

    Chemistry is a science of complex subjects that occupy this universe and biological world and that are composed of atoms and molecules. Its essence is diversity. However, surprisingly, whole of this science is governed by simple quantum principles like the Schrödinger and the Dirac equations. Therefore, if we can find a useful general method of solving these quantum principles under the fermionic and/or bosonic constraints accurately in a reasonable speed, we can replace somewhat empirical methodologies of this science with purely quantum theoretical and computational logics. This is the purpose of our series of studies - called ``exact theory'' in our laboratory. Some of our documents are cited below. The key idea was expressed as the free complement (FC) theory (originally called ICI theory) that was introduced to solve the Schrödinger and Dirac equations analytically. For extending this methodology to larger systems, order N methodologies are essential, but actually the antisymmetry constraints for electronic wave functions become big constraints. Recently, we have shown that the antisymmetry rule or `dogma' can be very much relaxed when our subjects are large molecular systems. In this talk, I want to present our recent progress in our FC methodology. The purpose is to construct ``predictive quantum chemistry'' that is useful in chemical and physical researches and developments in institutes and industries

  11. Bile Acid Sodium Symporter BASS6 Can Transport Glycolate and Is Involved in Photorespiratory Metabolism in Arabidopsis thaliana[OPEN

    PubMed Central

    Badger, Murray

    2017-01-01

    Photorespiration is an energy-intensive process that recycles 2-phosphoglycolate, a toxic product of the Rubisco oxygenation reaction. The photorespiratory pathway is highly compartmentalized, involving the chloroplast, peroxisome, cytosol, and mitochondria. Though the soluble enzymes involved in photorespiration are well characterized, very few membrane transporters involved in photorespiration have been identified to date. In this work, Arabidopsis thaliana plants containing a T-DNA disruption of the bile acid sodium symporter BASS6 show decreased photosynthesis and slower growth under ambient, but not elevated CO2. Exogenous expression of BASS6 complemented this photorespiration mutant phenotype. In addition, metabolite analysis and genetic complementation of glycolate transport in yeast showed that BASS6 was capable of glycolate transport. This is consistent with its involvement in the photorespiratory export of glycolate from Arabidopsis chloroplasts. An Arabidopsis double knockout line of both BASS6 and the glycolate/glycerate transporter PLGG1 (bass6, plgg1) showed an additive growth defect, an increase in glycolate accumulation, and reductions in photosynthetic rates compared with either single mutant. Our data indicate that BASS6 and PLGG1 partner in glycolate export from the chloroplast, whereas PLGG1 alone accounts for the import of glycerate. BASS6 and PLGG1 therefore balance the export of two glycolate molecules with the import of one glycerate molecule during photorespiration. PMID:28351992

  12. Towards understanding the pathology of erythema nodosum leprosum.

    PubMed

    Kahawita, I P; Lockwood, D N J

    2008-04-01

    Erythema nodosum leprosum (ENL) is an immune-mediated complication of leprosy presenting with inflammatory skin nodules and involvement of multiple organ systems, often running a protracted course. Immune complex production and deposition as well as complement activation have long been regarded as the principal aetiology of ENL. However, new data show that cell-mediated immunity is also important. We have performed a critical analysis of studies on the pathology of ENL. Our main findings are as follows. ENL is characterised by an inflammatory infiltrate of neutrophils with vasculitis and/or panniculitis. There is deposition of immune complexes and complement together with Mycobacterium leprae antigens in the skin. Changes in serum levels of Igs indicate a transient, localised immune response. The major T-cell subtype in ENL is the CD4 cell, in contrast to lepromatous leprosy where CD8 cells predominate. The cytokines TNFalpha and IL-6 are consistently found whilst IL-4 is low or absent in ENL lesions, indicating a T(H)1 type response. Keratinocyte 1a and intercellular adhesion molecule-1 (ICAM-1) have been shown to be present in the epidermis in ENL, which is evidence of a cell-mediated immune response. Co-stimulatory molecules such as B7-1 have also been studied but further work is needed to draw strong conclusions. We also highlight potential areas for future research.

  13. Genome-wide network of regulatory genes for construction of a chordate embryo.

    PubMed

    Shoguchi, Eiichi; Hamaguchi, Makoto; Satoh, Nori

    2008-04-15

    Animal development is controlled by gene regulation networks that are composed of sequence-specific transcription factors (TF) and cell signaling molecules (ST). Although housekeeping genes have been reported to show clustering in the animal genomes, whether the genes comprising a given regulatory network are physically clustered on a chromosome is uncertain. We examined this question in the present study. Ascidians are the closest living relatives of vertebrates, and their tadpole-type larva represents the basic body plan of chordates. The Ciona intestinalis genome contains 390 core TF genes and 119 major ST genes. Previous gene disruption assays led to the formulation of a basic chordate embryonic blueprint, based on over 3000 genetic interactions among 79 zygotic regulatory genes. Here, we mapped the regulatory genes, including all 79 regulatory genes, on the 14 pairs of Ciona chromosomes by fluorescent in situ hybridization (FISH). Chromosomal localization of upstream and downstream regulatory genes demonstrates that the components of coherent developmental gene networks are evenly distributed over the 14 chromosomes. Thus, this study provides the first comprehensive evidence that the physical clustering of regulatory genes, or their target genes, is not relevant for the genome-wide control of gene expression during development.

  14. Single-cell metabolomics: analytical and biological perspectives.

    PubMed

    Zenobi, R

    2013-12-06

    There is currently much interest in broad molecular profiling of single cells; a cell's metabolome-its full complement of small-molecule metabolites-is a direct indicator of phenotypic diversity of single cells and a nearly immediate readout of how cells react to environmental influences. However, the metabolome is very difficult to measure at the single-cell level because of rapid metabolic dynamics, the structural diversity of the molecules, and the inability to amplify or tag small-molecule metabolites. Measurement techniques including mass spectrometry, capillary electrophoresis, and, to a lesser extent, optical spectroscopy and fluorescence detection have led to impressive advances in single-cell metabolomics. Even though none of these methodologies can currently measure the metabolome of a single cell completely, rapidly, and nondestructively, progress has been sufficient such that the field is witnessing a shift from feasibility studies to investigations that yield new biological insight. Particularly interesting fields of application are cancer biology, stem cell research, and monitoring of xenobiotics and drugs in tissue sections at the single-cell level.

  15. Intracellular Action of a Secreted Peptide Required for Fungal Virulence.

    PubMed

    Homer, Christina M; Summers, Diana K; Goranov, Alexi I; Clarke, Starlynn C; Wiesner, Darin L; Diedrich, Jolene K; Moresco, James J; Toffaletti, Dena; Upadhya, Rajendra; Caradonna, Ippolito; Petnic, Sarah; Pessino, Veronica; Cuomo, Christina A; Lodge, Jennifer K; Perfect, John; Yates, John R; Nielsen, Kirsten; Craik, Charles S; Madhani, Hiten D

    2016-06-08

    Quorum sensing (QS) is a bacterial communication mechanism in which secreted signaling molecules impact population function and gene expression. QS-like phenomena have been reported in eukaryotes with largely unknown contributing molecules, functions, and mechanisms. We identify Qsp1, a secreted peptide, as a central signaling molecule that regulates virulence in the fungal pathogen Cryptococcus neoformans. QSP1 is a direct target of three transcription factors required for virulence, and qsp1Δ mutants exhibit attenuated infection, slowed tissue accumulation, and greater control by primary macrophages. Qsp1 mediates autoregulatory signaling that modulates secreted protease activity and promotes cell wall function at high cell densities. Peptide production requires release from a secreted precursor, proQsp1, by a cell-associated protease, Pqp1. Qsp1 sensing requires an oligopeptide transporter, Opt1, and remarkably, cytoplasmic expression of mature Qsp1 complements multiple phenotypes of qsp1Δ. Thus, C. neoformans produces an autoregulatory peptide that matures extracellularly but functions intracellularly to regulate virulence. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Mechanical design of proteins studied by single-molecule force spectroscopy and protein engineering.

    PubMed

    Carrion-Vazquez, M; Oberhauser, A F; Fisher, T E; Marszalek, P E; Li, H; Fernandez, J M

    2000-01-01

    Mechanical unfolding and refolding may regulate the molecular elasticity of modular proteins with mechanical functions. The development of the atomic force microscopy (AFM) has recently enabled the dynamic measurement of these processes at the single-molecule level. Protein engineering techniques allow the construction of homomeric polyproteins for the precise analysis of the mechanical unfolding of single domains. alpha-Helical domains are mechanically compliant, whereas beta-sandwich domains, particularly those that resist unfolding with backbone hydrogen bonds between strands perpendicular to the applied force, are more stable and appear frequently in proteins subject to mechanical forces. The mechanical stability of a domain seems to be determined by its hydrogen bonding pattern and is correlated with its kinetic stability rather than its thermodynamic stability. Force spectroscopy using AFM promises to elucidate the dynamic mechanical properties of a wide variety of proteins at the single molecule level and provide an important complement to other structural and dynamic techniques (e.g., X-ray crystallography, NMR spectroscopy, patch-clamp).

  17. Lessons learned at the intersection of immunology and neuroscience

    PubMed Central

    Steinman, Lawrence

    2012-01-01

    Neurobiologists and immunologists study concepts often signified with identical terminology. Scientists in both fields study a structure known as the synapse, and each group analyzes a subject called memory. Is this a quirk of human language, or are there real similarities between these two physiological systems? Not only are the linguistic concepts expressed in the words “synapse” and “memory” shared between the fields, but the actual molecules of physiologic importance in one system play parallel roles in the other: complement, the major histocompatibility molecules, and even “neuro”-transmitters all have major impacts on health and on disease in both the brain and the immune system. Not only are the same molecules found in diverse roles in each system, but we have learned that there is real “hard-wired” crosstalk between nerves and lymphoid organs. This issue of the JCI highlights some of the lessons learned from experts who are working at this scintillating intersection between immunology and neuroscience. PMID:22466655

  18. Analysis of the interaction between respiratory syncytial virus and lipid-rafts in Hep2 cells during infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, Gaie; Jeffree, Chris E.; McDonald, Terence

    2004-10-01

    The assembly of respiratory syncytial virus (RSV) in lipid-rafts was examined in Hep2 cells. Confocal and electron microscopy showed that during RSV assembly, the cellular distribution of the complement regulatory proteins, decay accelerating factor (CD55) and CD59, changes and high levels of these cellular proteins are incorporated into mature virus filaments. The detergent-solubility properties of CD55, CD59, and the RSV fusion (F) protein were found to be consistent with each protein being located predominantly within lipid-raft structures. The levels of these proteins in cell-released virus were examined by immunoelectronmicroscopy and found to account for between 5% and 15% of themore » virus attachment (G) glycoprotein levels. Collectively, our findings suggest that an intimate association exists between RSV and lipid-raft membranes and that significant levels of these host-derived raft proteins, such as those regulating complement activation, are subsequently incorporated into the envelope of mature virus particles.« less

  19. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

    PubMed

    Chen, Y M; Zhu, Y; Lin, E C

    1987-12-01

    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

  20. The chromosomes of the Didelphidae (Marsupialia) and their evolutionary significance

    USGS Publications Warehouse

    Reig, O.; Gardner, A.L.; Bianchi, N.O.; Patton, J.L.

    1977-01-01

    One hundred and seventy-seven specimens of American didelphids, representing 9 genera and 22 species have been studied for their chromosomal constitution. Didelphids are very conservative in chromosomal complements. All of the studied species can be sorted into one of three kinds of karyotypes: 2n= 14 (three species of Didelphis, one of Lutreolina, two of Philander, and one of Chironectes), 2n = 14 (eight species of Marmosa, one of Metachirus, three of Caluromys, and one of Dromiciops), and 2n= 18 (three species of Monodelphis). These karyotypes are stable, showing only minor variations within each basic pattern. It is concluded that chromosomals evolution in the Didelphidae proceededs from low numbers to higher numbers by a process of centromeric fissioning complemented by some pericentric inversions and/or translocations. The pattern of karyotypic stability is consistent with bradytely at the organismic level of evolution. This is explained by a low rate of regulatory genetic evolution promoted by epistatic selection favouring the retention of chromosomal arrangements highly advantageous for overall adaptation.

  1. [Medical science and the human image--on the theory of medical tasks].

    PubMed

    Jenny, S

    1993-06-22

    Our science-determined medicine interprets the non-individual partial aspects of disease that are approachable by causal analytical thought; therefore, it becomes only then an art of healing when it is complemented by medical craftsmanship and philosophic reflection. Naturopathy perceives the individual as an open self-regulatory system whose innumerable mechanisms and strategies for maintenance of integrity have to be supported. In medical practise both concepts have always to be available concomitantly and and in equal rights, not only for repair of lesions but also for real healing.

  2. Regulatory and clinical considerations for biosimilar oncology drugs

    PubMed Central

    Bennett, Charles L; Chen, Brian; Hermanson, Terhi; Wyatt, Michael D; Schulz, Richard M; Georgantopoulos, Peter; Kessler, Samuel; Raisch, Dennis W; Qureshi, Zaina P; Lu, Z Kevin; Love, Bryan L; Noxon, Virginia; Bobolts, Laura; Armitage, Melissa; Bian, John; Ray, Paul; Ablin, Richard J; Hrushesky, William J; Macdougall, Iain C; Sartor, Oliver; Armitage, James O

    2015-01-01

    Biological oncology products are integral to cancer treatment, but their high costs pose challenges to patients, families, providers, and insurers. The introduction of biosimilar agents—molecules that are similar in structure, function, activity, immunogenicity, and safety to the original biological drugs—provide opportunities both to improve healthcare access and outcomes, and to reduce costs. Several international regulatory pathways have been developed to expedite entry of biosimilars into global marketplaces. The first wave of oncology biosimilar use was in Europe and India in 2007. Oncology biosimilars are now widely marketed in several countries in Europe, and in Australia, Japan, China, Russia, India, and South Korea. Their use is emerging worldwide, with the notable exception of the USA, where several regulatory and cost barriers to biosimilar approval exist. In this Review, we discuss oncology biosimilars and summarise their regulatory frameworks, clinical experiences, and safety concerns. PMID:25456378

  3. Development of atmospheric pressure large area plasma jet for sterilisation and investigation of molecule and plasma interaction

    NASA Astrophysics Data System (ADS)

    Zerbe, Kristina; Iberler, Marcus; Jacoby, Joachim; Wagner, Christopher

    2016-09-01

    The intention of the project is the development and improvement of an atmospheric plasma jet based on various discharge forms (e.g. DBD, RF, micro-array) for sterilisation of biomedical equipment and investigation of biomolecules under the influence of plasma stress. The major objective is to design a plasma jet with a large area and an extended length. Due to the success on small scale plasma sterilisation the request of large area plasma has increased. Many applications of chemical disinfection in environmental and medical cleaning could thereby be complemented. Subsequently, the interaction between plasma and biomolecules should be investigated to improve plasma strerilisation. Special interest will be on non equilibrium plasma electrons affecting the chemical bindings of organic molecules.

  4. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    PubMed

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its cellular functions.

  5. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

    PubMed Central

    Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

    2018-01-01

    Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

  6. SOLEIL shining on the solution-state structure of biomacromolecules by synchrotron X-ray footprinting at the Metrology beamline.

    PubMed

    Baud, A; Aymé, L; Gonnet, F; Salard, I; Gohon, Y; Jolivet, P; Brodolin, K; Da Silva, P; Giuliani, A; Sclavi, B; Chardot, T; Mercère, P; Roblin, P; Daniel, R

    2017-05-01

    Synchrotron X-ray footprinting complements the techniques commonly used to define the structure of molecules such as crystallography, small-angle X-ray scattering and nuclear magnetic resonance. It is remarkably useful in probing the structure and interactions of proteins with lipids, nucleic acids or with other proteins in solution, often better reflecting the in vivo state dynamics. To date, most X-ray footprinting studies have been carried out at the National Synchrotron Light Source, USA, and at the European Synchrotron Radiation Facility in Grenoble, France. This work presents X-ray footprinting of biomolecules performed for the first time at the X-ray Metrology beamline at the SOLEIL synchrotron radiation source. The installation at this beamline of a stopped-flow apparatus for sample delivery, an irradiation capillary and an automatic sample collector enabled the X-ray footprinting study of the structure of the soluble protein factor H (FH) from the human complement system as well as of the lipid-associated hydrophobic protein S3 oleosin from plant seed. Mass spectrometry analysis showed that the structural integrity of both proteins was not affected by the short exposition to the oxygen radicals produced during the irradiation. Irradiated molecules were subsequently analysed using high-resolution mass spectrometry to identify and locate oxidized amino acids. Moreover, the analyses of FH in its free state and in complex with complement C3b protein have allowed us to create a map of reactive solvent-exposed residues on the surface of FH and to observe the changes in oxidation of FH residues upon C3b binding. Studies of the solvent accessibility of the S3 oleosin show that X-ray footprinting offers also a unique approach to studying the structure of proteins embedded within membranes or lipid bodies. All the biomolecular applications reported herein demonstrate that the Metrology beamline at SOLEIL can be successfully used for synchrotron X-ray footprinting of biomolecules.

  7. Strategies to identify microRNA targets: New advances

    USDA-ARS?s Scientific Manuscript database

    MicroRNAs (miRNAs) are small regulatory RNA molecules functioning to modulate gene expression at the post-transcriptional level, and playing an important role in many developmental and physiological processes. Ten thousand miRNAs have been discovered in various organisms. Although considerable progr...

  8. A new model for the surface arrangement of myosin molecules in tarantula thick filaments.

    PubMed

    Offer, G; Knight, P J; Burgess, S A; Alamo, L; Padrón, R

    2000-04-28

    Three-dimensional reconstructions of the negatively stained thick filaments of tarantula muscle with a resolution of 50 A have previously suggested that the helical tracks of myosin heads are zigzagged, short diagonal ridges being connected by nearly axial links. However, surface views of lower contour levels reveal an additional J-shaped feature approximately the size and shape of a myosin head. We have modelled the surface array of myosin heads on the filaments using as a building block a model of a two-headed regulated myosin molecule in which the regulatory light chains of the two heads together form a compact head-tail junction. Four parameters defining the radius, orientation and rotation of each myosin molecule were varied. In addition, the heads were allowed independently to bend in a plane perpendicular to the coiled-coil tail at three sites, and to tilt with respect to the tail and to twist at one of these sites. After low-pass filtering, models were aligned with the reconstruction, scored by cross-correlation and refined by simulated annealing. Comparison of the geometry of the reconstruction and the distance between domains in the myosin molecule narrowed the choice of models to two main classes. A good match to the reconstruction was obtained with a model in which each ridge is formed from the motor domain of a head pointing to the bare zone together with the head-tail junction of a neighbouring molecule. The heads pointing to the Z-disc intermittently occupy the J-position. Each motor domain interacts with the essential and regulatory light chains of the neighbouring heads. A near-radial spoke in the reconstruction connecting the backbone to one end of the ridge can be identified as the start of the coiled-coil tail. Copyright 2000 Academic Press.

  9. How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

    PubMed

    Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

    2016-01-01

    Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

  10. Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

    PubMed

    Poller, W; Fechner, H

    2010-01-01

    Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

  11. Interplay of the modified nucleotide phosphoadenosine 5'-phosphosulfate (PAPS) with global regulatory proteins in Escherichia coli: modulation of cyclic AMP (cAMP)-dependent gene expression and interaction with the HupA regulatory protein.

    PubMed

    Longo, Francesca; Motta, Sara; Mauri, Pierluigi; Landini, Paolo; Rossi, Elio

    2016-11-25

    In the bacterium Escherichia coli, some intermediates of the sulfate assimilation and cysteine biosynthesis pathway can act as signal molecules and modulate gene expression. In addition to sensing and utilization of sulphur sources, these signaling mechanisms also impact more global cell processes, such as resistance to antimicrobial agents and biofilm formation. In a recent work, we have shown that inactivation of the cysH gene, encoding phosphoadenosine-phosphosulfate (PAPS) reductase, and the consequent increase in intracellular PAPS concentration, strongly affect production of several cell surface-associated structures, enhancing surface adhesion and cell aggregation. In order to identify the molecular mechanism relaying intracellular PAPS concentration to regulation of cell surface-associated structures, we looked for mutations able to suppress the effects of cysH inactivation. We found that mutations in the adenylate cyclase-encoding cyaA gene abolished the effects of PAPS accumulation; consistent with this result, cyclic AMP (cAMP)-dependent gene expression appears to be increased in the cysH mutant. Experiments aimed at the direct identification of proteins interacting with either CysC or CysH, i.e. the PAPS-related proteins APS kinase and PAPS reductase, allowed us to identify several regulators, namely, CspC, CspE, HNS and HupA. Protein-protein interaction between HupA and CysH was confirmed by a bacterial two hybrid system, and inactivation of the hupA gene enhanced the effects of the cysH mutation in terms of production of cell surface-associated factors. Our results indicate that PAPS can modulate different regulatory systems, providing evidence that this molecule acts as a global signal molecule in E. coli. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Interleukin-1 family cytokines and their regulatory proteins in normal pregnancy and pre-eclampsia

    PubMed Central

    Southcombe, J H; Redman, C W G; Sargent, I L; Granne, I

    2015-01-01

    Maternal systemic inflammation is a feature of pre-eclampsia, a condition in pregnancy characterized by hypertension and proteinuria. Pre-eclampsia is caused by the placenta; many placental factors contribute to the syndrome's progression, and proinflammatory cytokines have been identified previously as one such mediator. The interleukin (IL)-1 family of cytokines are key regulators of the inflammatory network, and two naturally occurring regulatory molecules for IL-1 family cytokines, IL-1RA and sST2, have been found previously to be elevated in maternal blood from women with pre-eclampsia. Here we investigate more recently identified IL-1 family cytokines and regulatory molecules, IL-1RAcP, IL-37, IL-18BP, IL-36α/β/γ/Ra and IL-38 in pre-eclampsia. Pregnant women have more circulating IL-18BP and IL-36Ra than non-pregnant women, and sIL-1RAcP is elevated from women with pre-eclampsia compared to normal pregnancies. The placenta expresses all the molecules, and IL-37 and IL-18BP are up-regulated significantly in pre-eclampsia placentas compared to those from normal pregnancies. Together, these changes contribute to the required inhibition of maternal systemic cytotoxic immunity in normal pregnancy; however, in pre-eclampsia the same profile is not seen. Interestingly, the increased circulating levels of sIL-1RAcP and increased placental IL-18BP and IL-37, the latter of which we show to be induced by hypoxic damage to the placenta, are all factors which are anti-inflammatory. While the placenta is often held responsible for the damage and clinical symptoms of pre-eclampsia by the research community, here we show that the pre-eclampsia placenta is also trying to prevent inflammatory damage to the mother. PMID:25693732

  13. Heterocyclic Anions of Astrobiological Interest

    NASA Astrophysics Data System (ADS)

    Cole, Callie A.; Demarais, Nicholas J.; Yang, Zhibo; Snow, Theodore P.; Bierbaum, Veronica M.

    2013-12-01

    As more complex organic molecules are detected in the interstellar medium, the importance of heterocyclic molecules to astrobiology and the origin of life has become evident. 2-Aminothiazole and 2-aminooxazole have recently been suggested as important nucleotide precursors, highlighting azoles as potential prebiotic molecules. This study explores the gas-phase chemistry of three deprotonated azoles: oxazole, thiazole, and isothiazole. For the first time, their gas-phase acidities are experimentally determined with bracketing and H/D exchange techniques, and their reactivity is characterized with several detected interstellar neutral molecules (N2O, O2, CO, OCS, CO2, and SO2) and other reactive species (CS2, CH3Cl, (CH3)3CCl, and (CH3)3CBr). Rate constants and branching fractions for these reactions are experimentally measured using a modified commercial ion trap mass spectrometer whose kinetic data are in good accord with those of a flowing afterglow apparatus reported here. Last, we have examined the fragmentation patterns of these deprotonated azoles to elucidate their destruction mechanisms in high-energy environments. All experimental data are supported and complemented by electronic structure calculations at the B3LYP/6-311++G(d,p) and MP2(full)/aug-cc-pVDZ levels of theory.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osiry, H.; Cano, A.; Lemus-Santana, A.A.

    This contribution discusses the intercalation of imidazole and its 2-ethyl derivative, and pyridine in 2D copper nitroprusside. In the interlayer region, neighboring molecules remain interacting throu gh their dipole and quadrupole moments, which supports the solid 3D crystal structure. The crystal structure of this series of intercalation compounds was solved and refined from powder X-ray diffraction patterns complemented with spectroscopic information. The intermolecular interactions were studied from the refined crystal structures and low temperature magnetic measurements. Due to strong attractive forces between neighboring molecules, the resulting π–π cloud overlapping enables the ferromagnetic coupling between metal centers on neighboring layers, which wasmore » actually observed for the solids containing imidazole and pyridine as intercalated molecules. For these two solids, the magnetic data were properly described with a model of six neighbors. For the solid containing 2-ethylimidazole and for 2D copper nitroprusside, a model of four neighbors in a plane is sufficient to obtain a reliable data fitting. - Highlights: • Intercalation of organic molecules in 2D copper (II) nitroprusside. • Molecular properties of intercalation compounds of 2D copper (II) nitroprusside. • Magnetic properties of hybrid inorganic–organic solids. • Hybrid inorganic–organic 3D framework.« less

  15. Organic molecule-based photothermal agents: an expanding photothermal therapy universe.

    PubMed

    Jung, Hyo Sung; Verwilst, Peter; Sharma, Amit; Shin, Jinwoo; Sessler, Jonathan L; Kim, Jong Seung

    2018-04-03

    Over the last decade, organic photothermal therapy (PTT) agents have attracted increasing attention as a potential complement for, or alternative to, classical drugs and sensitizers involving inorganic nanomaterials. In this tutorial review, we provide a structured description of the main classes of organic photothermal agents and their characteristics. Representative agents that have been studied in the context of photothermal therapy since 2000 are summarized and recent advances in using PTT agents to address various cancers indications are highlighted.

  16. Development of a homogeneous immunoassay system using protein A fusion fragmented Renilla luciferase.

    PubMed

    Mie, Masayasu; Thuy, Ngo Phan Bich; Kobatake, Eiry

    2012-03-07

    A homogeneous immunoassay system was developed using fragmented Renilla luciferase (Rluc). The B domain of protein A was fused to two Rluc fragments. When complexes between an antibody and fragmented Rluc fusion proteins bind to target molecules, the Rluc fragments come into close proximity and the luminescence activity of fragmented Rluc is restored by complementation. As proof-of-principle, this fragmented Rluc system was used to detect E. coli homogeneously using an anti-E. coli antibody.

  17. Trust-based environmental regulation.

    PubMed

    Lange, Bettina; Gouldson, Andy

    2010-10-15

    Within this paper, we examine the contribution that trust-based relationships can make to achieving better-and particularly more effective, efficient and equitable-environmental regulation. While levels of trust in regulators, regulatory processes and outcomes are often discussed, the influence of trust on different actors and on different measures of regulatory performance is poorly understood. Within this paper, we define trust-based environmental regulation as a specific regulatory style that involves openness and cooperation in interaction between regulated, regulators and third-party stakeholders in order to achieve environmental protection objectives. We then discuss the pros and cons of trust relationships between regulators, regulated businesses and citizens for achieving behavioural change towards greater environmental protection. To illustrate the significance of these issues, we then examine three forms of contractual regulatory style where trust relationships are critically important: responsive regulation, self-regulation and environmental agreements. Based on this analysis, we highlight the importance of trust-based relationships, and we argue that one of the greatest contributions of trust-based environmental regulation is to challenge how we think about regulation. Trust is often understood as enabling existing regulatory relationships or in the case of self-regulation as a complement to regulation. However, we argue that the real potential of trust is to open up new ways for participants in regulatory regimes to engage in collective action, to go beyond a perception of regulation as driven by the competing interests of individual actors, and thus, to open up new channels of influence for behavioural change towards greater environmental protection. Our analysis therefore has great relevance for future research and for on-going debates on the future of regulation. Copyright © 2010. Published by Elsevier B.V.

  18. Alarmins and Their Receptors as Modulators and Indicators of Alloimmune Responses.

    PubMed

    Matta, B M; Reichenbach, D K; Blazar, B R; Turnquist, H R

    2017-02-01

    Cell damage and death releases alarmins, self-derived immunomodulatory molecules that recruit and activate the immune system. Unfortunately, numerous processes critical to the transplantation of allogeneic materials result in the destruction of donor and recipient cells and may trigger alarmin release. Alarmins, often described as damage-associated molecular patterns, together with exogenous pathogen-associated molecular patterns, are potent orchestrators of immune responses; however, the precise role that alarmins play in alloimmune responses remains relatively undefined. We examined evolving concepts regarding how alarmins affect solid organ and allogeneic hematopoietic cell transplantation outcomes and the mechanisms by which self molecules are released. We describe how, once released, alarmins may act alone or in conjunction with nonself materials to contribute to cytokine networks controlling alloimmune responses and their intensity. It is becoming recognized that this class of molecules has pleotropic functions, and certain alarmins can promote both inflammatory and regulatory responses in transplant models. Emerging evidence indicates that alarmins and their receptors may be promising transplantation biomarkers. Developing the therapeutic ability to support alarmin regulatory mechanisms and the predictive value of alarmin pathway biomarkers for early intervention may provide opportunities to benefit graft recipients. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  19. Intronic sequences are required for AINTEGUMENTA-LIKE6 expression in Arabidopsis flowers.

    PubMed

    Krizek, Beth A

    2015-10-12

    The AINTEGUMENTA-LIKE6/PLETHORA3 (AIL6/PLT3) gene of Arabidopsis thaliana is a key regulator of growth and patterning in both shoots and roots. AIL6 encodes an AINTEGUMENTA-LIKE/PLETHORA (AIL/PLT) transcription factor that is expressed in the root stem cell niche, the peripheral region of the shoot apical meristem and young lateral organ primordia. In flowers, AIL6 acts redundantly with AINTEGUMENTA (ANT) to regulate floral organ positioning, growth, identity and patterning. Experiments were undertaken to define the genomic regions required for AIL6 function and expression in flowers. Transgenic plants expressing a copy of the coding region of AIL6 in the context of 7.7 kb of 5' sequence and 919 bp of 3' sequence (AIL6:cAIL6-3') fail to fully complement AIL6 function when assayed in the ant-4 ail6-2 double mutant background. In contrast, a genomic copy of AIL6 with the same amount of 5' and 3' sequence (AIL6:gAIL6-3') can fully complement ant-4 ail6-2. In addition, a genomic copy of AIL6 with 590 bp of 5' sequence and 919 bp of 3' sequence (AIL6m:gAIL6-3') complements ant-4 ail6-2 and contains all regulatory elements needed to confer normal AIL6 expression in inflorescences. Efforts to map cis-regulatory elements reveal that the third intron of AIL6 contains enhancer elements that confer expression in young flowers but in a broader pattern than that of AIL6 mRNA in wild-type flowers. Some AIL6:gAIL6-3' and AIL6m:gAIL6-3' lines confer an over-rescue phenotype in the ant-4 ail6-2 background that is correlated with higher levels of AIL6 mRNA accumulation. The results presented here indicate that AIL6 intronic sequences serve as transcriptional enhancer elements. In addition, the results show that increased expression of AIL6 can partially compensate for loss of ANT function in flowers.

  20. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    NASA Astrophysics Data System (ADS)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.

  1. Fas/CD95 regulatory protein Faim2 is neuroprotective after transient brain ischemia.

    PubMed

    Reich, Arno; Spering, Christopher; Gertz, Karen; Harms, Christoph; Gerhardt, Ellen; Kronenberg, Golo; Nave, Klaus A; Schwab, Markus; Tauber, Simone C; Drinkut, Anja; Harms, Kristian; Beier, Chrstioph P; Voigt, Aaron; Göbbels, Sandra; Endres, Matthias; Schulz, Jörg B

    2011-01-05

    Death receptor (DR) signaling has a major impact on the outcome of numerous neurological diseases, including ischemic stroke. DRs mediate not only cell death signals, but also proinflammatory responses and cell proliferation. Identification of regulatory proteins that control the switch between apoptotic and alternative DR signaling opens new therapeutic opportunities. Fas apoptotic inhibitory molecule 2 (Faim2) is an evolutionary conserved, neuron-specific inhibitor of Fas/CD95-mediated apoptosis. To investigate its role during development and in disease models, we generated Faim2-deficient mice. The ubiquitous null mutation displayed a viable and fertile phenotype without overt deficiencies. However, lack of Faim2 caused an increase in susceptibility to combined oxygen-glucose deprivation in primary neurons in vitro as well as in caspase-associated cell death, stroke volume, and neurological impairment after cerebral ischemia in vivo. These processes were rescued by lentiviral Faim2 gene transfer. In summary, we provide evidence that Faim2 is a novel neuroprotective molecule in the context of cerebral ischemia.

  2. Synthetic biology to access and expand nature’s chemical diversity

    PubMed Central

    Smanski, Michael J.; Zhou, Hui; Claesen, Jan; Shen, Ben; Fischbach, Michael; Voigt, Christopher A.

    2016-01-01

    Bacterial genomes encode the biosynthetic potential to produce hundreds of thousands of complex molecules with diverse applications, from medicine to agriculture and materials. Economically accessing the potential encoded within sequenced genomes promises to reinvigorate waning drug discovery pipelines and provide novel routes to intricate chemicals. This is a tremendous undertaking, as the pathways often comprise dozens of genes spanning as much as 100+ kiliobases of DNA, are controlled by complex regulatory networks, and the most interesting molecules are made by non-model organisms. Advances in synthetic biology address these issues, including DNA construction technologies, genetic parts for precision expression control, synthetic regulatory circuits, computer aided design, and multiplexed genome engineering. Collectively, these technologies are moving towards an era when chemicals can be accessed en mass based on sequence information alone. This will enable the harnessing of metagenomic data and massive strain banks for high-throughput molecular discovery and, ultimately, the ability to forward design pathways to complex chemicals not found in nature. PMID:26876034

  3. Engineering an allosteric transcription factor to respond to new ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco

    Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less

  4. TGF-β of lung cancer microenvironment upregulates B7H1 and GITRL expression in dendritic cells and is associated with regulatory T cell generation.

    PubMed

    Ni, Xiao Yan; Sui, Hua Xiu; Liu, Yao; Ke, Shi Zhong; Wang, Yi Nan; Gao, Feng Guang

    2012-08-01

    The effects of TGF-β on dendritic cells (DCs) on the tumor microenvironment are not well understood. We report, here, the establishment of an in vitro lung cancer microenvironment by co-incubation of seminaphtharhodafluor (SNARF) labeled Lewis lung cancer (LLC) cells, carboxyfluorescein succinimidyl ester (CFSE) labeled fibroblasts and 4-chloromethyl-7-hydroxycoumarin (CMHC) labeled DCs. Raw 264.7, EL4 and NCI-H446 cells were able to synthesize TGF-β which was determined by flow cyto-metry and western blotting, respectively. Furthermore, TGF-β efficiently increased regulatory T-cell (Treg) expansion and upregulated DC B7H1 and GITRL expression. TGF-β and the co-incubation of LLC cells, fibroblasts with DCs could augment the expression of B7H1 and GITRL molecules of DCs. The data presented here indicate that the B7H1 and GITRL molecules may play an important role in TGF-β-induced Treg expansion of lung cancer microenvironment.

  5. Engineering an allosteric transcription factor to respond to new ligands

    DOE PAGES

    Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco; ...

    2015-12-21

    Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less

  6. Mechanistic Explanations for Restricted Evolutionary Paths That Emerge from Gene Regulatory Networks

    PubMed Central

    Cotterell, James; Sharpe, James

    2013-01-01

    The extent and the nature of the constraints to evolutionary trajectories are central issues in biology. Constraints can be the result of systems dynamics causing a non-linear mapping between genotype and phenotype. How prevalent are these developmental constraints and what is their mechanistic basis? Although this has been extensively explored at the level of epistatic interactions between nucleotides within a gene, or amino acids within a protein, selection acts at the level of the whole organism, and therefore epistasis between disparate genes in the genome is expected due to their functional interactions within gene regulatory networks (GRNs) which are responsible for many aspects of organismal phenotype. Here we explore epistasis within GRNs capable of performing a common developmental function – converting a continuous morphogen input into discrete spatial domains. By exploring the full complement of GRN wiring designs that are able to perform this function, we analyzed all possible mutational routes between functional GRNs. Through this study we demonstrate that mechanistic constraints are common for GRNs that perform even a simple function. We demonstrate a common mechanistic cause for such a constraint involving complementation between counter-balanced gene-gene interactions. Furthermore we show how such constraints can be bypassed by means of “permissive” mutations that buffer changes in a direct route between two GRN topologies that would normally be unviable. We show that such bypasses are common and thus we suggest that unlike what was observed in protein sequence-function relationships, the “tape of life” is less reproducible when one considers higher levels of biological organization. PMID:23613807

  7. Physico-chemical properties of manufactured nanomaterials - Characterisation and relevant methods. An outlook based on the OECD Testing Programme.

    PubMed

    Rasmussen, Kirsten; Rauscher, Hubert; Mech, Agnieszka; Riego Sintes, Juan; Gilliland, Douglas; González, Mar; Kearns, Peter; Moss, Kenneth; Visser, Maaike; Groenewold, Monique; Bleeker, Eric A J

    2018-02-01

    Identifying and characterising nanomaterials require additional information on physico-chemical properties and test methods, compared to chemicals in general. Furthermore, regulatory decisions for chemicals are usually based upon certain toxicological properties, and these effects may not be equivalent to those for nanomaterials. However, regulatory agencies lack an authoritative decision framework for nanomaterials that links the relevance of certain physico-chemical endpoints to toxicological effects. This paper investigates various physico-chemical endpoints and available test methods that could be used to produce such a decision framework for nanomaterials. It presents an overview of regulatory relevance and methods used for testing fifteen proposed physico-chemical properties of eleven nanomaterials in the OECD Working Party on Manufactured Nanomaterials' Testing Programme, complemented with methods from literature, and assesses the methods' adequacy and applications limits. Most endpoints are of regulatory relevance, though the specific parameters depend on the nanomaterial and type of assessment. Size (distribution) is the common characteristic of all nanomaterials and is decisive information for classifying a material as a nanomaterial. Shape is an important particle descriptor. The octanol-water partitioning coefficient is undefined for particulate nanomaterials. Methods, including sample preparation, need to be further standardised, and some new methods are needed. The current work of OECD's Test Guidelines Programme regarding physico-chemical properties is highlighted. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. A regulatory gene (ECO-orf4) required for ECO-0501 biosynthesis in Amycolatopsis orientalis.

    PubMed

    Shen, Yang; Huang, He; Zhu, Li; Luo, Minyu; Chen, Daijie

    2014-02-01

    ECO-0501 is a novel linear polyene antibiotic, which was discovered from Amycolatopsis orientalis. Recent study of ECO-0501 biosynthesis pathway revealed the presence of regulatory gene: ECO-orf4. The A. orientalis ECO-orf4 gene from the ECO-0501 biosynthesis cluster was analyzed, and its deduced protein (ECO-orf4) was found to have amino acid sequence homology with large ATP-binding regulators of the LuxR (LAL) family regulators. Database comparison revealed two hypothetical domains, a LuxR-type helix-turn-helix (HTH) DNA binding motif near the C-terminal and an N-terminal nucleotide triphosphate (NTP) binding motif included. Deletion of the corresponding gene (ECO-orf4) resulted in complete loss of ECO-0501 production. Complementation by one copy of intact ECO-orf4 restored the polyene biosynthesis demonstrating that ECO-orf4 is required for ECO-0501 biosynthesis. The results of overexpression ECO-orf4 on ECO-0501 production indicated that it is a positive regulatory gene. Gene expression analysis by reverse transcription PCR of the ECO-0501 gene cluster showed that the transcription of ECO-orf4 correlates with that of genes involved in polyketide biosynthesis. These results demonstrated that ECO-orf4 is a pathway-specific positive regulatory gene that is essential for ECO-0501 biosynthesis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

    PubMed

    Schwank, S; Hoffmann, B; Sch-uller, H J

    1997-06-01

    Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

  10. Applying differential dynamic logic to reconfigurable biological networks.

    PubMed

    Figueiredo, Daniel; Martins, Manuel A; Chaves, Madalena

    2017-09-01

    Qualitative and quantitative modeling frameworks are widely used for analysis of biological regulatory networks, the former giving a preliminary overview of the system's global dynamics and the latter providing more detailed solutions. Another approach is to model biological regulatory networks as hybrid systems, i.e., systems which can display both continuous and discrete dynamic behaviors. Actually, the development of synthetic biology has shown that this is a suitable way to think about biological systems, which can often be constructed as networks with discrete controllers, and present hybrid behaviors. In this paper we discuss this approach as a special case of the reconfigurability paradigm, well studied in Computer Science (CS). In CS there are well developed computational tools to reason about hybrid systems. We argue that it is worth applying such tools in a biological context. One interesting tool is differential dynamic logic (dL), which has recently been developed by Platzer and applied to many case-studies. In this paper we discuss some simple examples of biological regulatory networks to illustrate how dL can be used as an alternative, or also as a complement to methods already used. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling.

    PubMed

    Wang, Honglin; Sun, Yue; Chang, Jianhong; Zheng, Fangfang; Pei, Haixia; Yi, Yanjun; Chang, Caren; Dong, Chun-Hai

    2016-07-01

    Ethylene as a gaseous plant hormone is directly involved in various processes during plant growth and development. Much is known regarding the ethylene receptors and regulatory factors in the ethylene signal transduction pathway. In Arabidopsis thaliana, REVERSION-TO-ETHYLENE SENSITIVITY1 (RTE1) can interact with and positively regulates the ethylene receptor ETHYLENE RESPONSE1 (ETR1). In this study we report the identification and characterization of an RTE1-interacting protein, a putative Arabidopsis lipid transfer protein 1 (LTP1) of unknown function. Through bimolecular fluorescence complementation, a direct molecular interaction between LTP1 and RTE1 was verified in planta. Analysis of an LTP1-GFP fusion in transgenic plants and plasmolysis experiments revealed that LTP1 is localized to the cytoplasm. Analysis of ethylene responses showed that the ltp1 knockout is hypersensitive to 1-aminocyclopropanecarboxylic acid (ACC), while LTP1 overexpression confers insensitivity. Analysis of double mutants etr1-2 ltp1 and rte1-3 ltp1 demonstrates a regulatory function of LTP1 in ethylene receptor signaling through the molecular association with RTE1. This study uncovers a novel function of Arabidopsis LTP1 in the regulation of ethylene response and signaling.

  12. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  13. Complement activation as a bioequivalence issue relevant to the development of generic liposomes and other nanoparticulate drugs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szebeni, Janos, E-mail: jszebeni2@gmail.com; Storm, Gert

    Liposomes are known to activate the complement (C) system, which can lead in vivo to a hypersensitivity syndrome called C activation-related pseudoallergy (CARPA). CARPA has been getting increasing attention as a safety risk of i.v. therapy with liposomes, whose testing is now recommended in bioequivalence evaluations of generic liposomal drug candidates. This review highlights the adverse consequences of C activation, the unique symptoms of CARPA triggered by essentially all i.v. administered liposomal drugs, and the various features of vesicles influencing this adverse immune effect. For the case of Doxil, we also address the mechanism of C activation and the opsonization vs.more » long circulation (stealth) paradox. In reviewing the methods of assessing C activation and CARPA, we delineate the most sensitive porcine model and an algorithm for stepwise evaluation of the CARPA risk of i.v. liposomes, which are proposed for standardization for preclinical toxicology evaluation of liposomal and other nanoparticulate drug candidates. - Highlights: • Outlining of difficulties in generic development of liposomal drugs. • New regulatory requirements to evaluate CARPA in preclinical studies. • Review of complement activation by liposomes and its adverse consequences (CARPA). • Assays of C activation in vitro and CARPA in vivo, with the porcine test in focus. • Decision tree how to handle the risk of CARPA assessed by a battery of tests.« less

  14. Oligomeric domain structure of human complement factor H by X-ray and neutron solution scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perkins, S.J.; Nealis, A.S.; Sim, R.B.

    1991-03-19

    Factor H is a regulatory component of the complement system. It has a monomer M{sub r} of 150,000. Primary structure analysis shows that the polypeptide is divided into 20 homologous regions, each 60 amino acid residues long. These are independently folding domains and are termed short consensus repeats (SCRs) or complement control protein (CCP) repeats. High-flux synchrotron x-ray and neutron scatteriing studies were performed in order to define its solution structure in conditions close to physiological. The M{sub r} of factor H was determined as 250,000-320,000 to show that factor H is dimeric. The radius of gyration R{sub G} ofmore » native factor H by X-rays or by neutrons in 0% or 100% {sup 2}H{sub 2}O buffers is not measurable but is greater than 12.5 nm. Two cross-sectional radii of gyration R{sub XS-1} and R{sub XS-2} were determined as 3.0-3.1 and 1.8 nm, respectively. Analyses of the cross-sectional intensities show that factor H is composed of two distinct subunits. This model corresponds to an actual R{sub G} fo 21-23 nm. The separation between each SCR/CCP in factor H is close to 4 nm. In the solution structure of factor H, the SCR/CCP domains are in a highly extended conformation.« less

  15. From molecule to market access: drug regulatory science as an upcoming discipline.

    PubMed

    Gispen-de Wied, Christine C; Leufkens, Hubertus G M

    2013-11-05

    Regulatory science as a discipline has evolved over the past years with the object to boost and promote scientific rationale behind benefit/risk and decision making by regulatory authorities. The European Medicines Agency, EMA, the Food and Drug Administration, FDA, and the Japanese Pharmaceutical and Medical Devices Agency, PMDA, highlighted in their distinct ways the importance of regulatory science as a basis of good quality assessment in their strategic plans. The Medicines Evaluation Board, MEB, states: 'regulatory science is the science of developing and validating new standards and tools to evaluate and assess the benefit/risk of medicinal products, facilitating sound and transparent regulatory decision making'. Through analysis of regulatory frameworks itself and their effectiveness, however, regulatory science can also advance knowledge of these systems in general. The comprehensive guidance that is issued to complete an application dossier for regulatory product approval has seldomly been scrutinized for its efficiency. Since it is the task of regulatory authorities to protect and promote public health, it is understood that they take a cautious approach in regulating drugs prior to market access. In general, the authorities are among the first to be blamed if dangerous or useless drugs were allowed to the market. Yet, building a regulatory framework that is not challenged continuously in terms of deliverables for public health and cost-effectiveness, might be counterproductive in the end. Regulatory science and research can help understand how and why regulatory decisions are made, and where renewed discussions may be warranted. The MEB supports regulatory science as an R&D activity to fuel primary regulatory processes on product evaluation and vigilance, but also invests in a 'looking into the mirror' approach. Along the line of the drug life-cycle, publicly available data are reviewed and their regulatory impact highlighted. If made explicit, regulatory research can open the door to evidence based regulatory practice and serve the regulator's contribution to innovative drug licensing today. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. C1 inhibitor-mediated myocardial protection from chronic intermittent hypoxia-induced injury

    PubMed Central

    Fu, Jinrong; Guo, Furong; Chen, Cheng; Yu, Xiaoman; Hu, Ke; Li, Mingjiang

    2016-01-01

    The optimal treatment for chronic intermittent hypoxia (CIH)-induced cardiovascular injuries has yet to be determined. The aim of the current study was to explore the potential protective effect and mechanism of a C1 inhibitor in CIH in the myocardium. The present study used a rat model of CIH in which complement regulatory protein, known as C1 inhibitor (C1INH), was administered to the rats in the intervention groups. Cardiomyocyte apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling. The expression of proteins associated with the apoptotic pathway, such as B-cell lymphoma 2 (Bcl-2), Bax and caspase-3 were detected by western blot analysis. The expression of complement C3 protein and RNA were also analyzed. C1INH was observed to improve the cardiac function in rats with CIH. Myocardial myeloperoxidase activity, a marker of neutrophil infiltration, was significantly decreased in the C1INH intervention group compared with the CIH control group, and cardiomyocyte apoptosis was significantly attenuated (P<0.05). Western blotting and reverse transcription-polymerase chain reaction analysis indicated that the protein expression levels of Bcl-2 were decreased and those of Bax were increased in the CIH group compared with the normal control group, but the protein expression levels of Bcl-2 were increased and those of Bax were decreased in the C1INH intervention group, as compared with the CIH group. Furthermore, the CIH-induced expression and synthesis of complement C3 in the myocardium were also reduced in the C1INH intervention group. C1INH, in addition to inhibiting complement activation and inflammation, preserved cardiac function in CIH-mediated myocardial cell injury through an anti-apoptotic mechanism. PMID:27698713

  17. Early Components of the Complement Classical Activation Pathway in Human Systemic Autoimmune Diseases

    PubMed Central

    Lintner, Katherine E.; Wu, Yee Ling; Yang, Yan; Spencer, Charles H.; Hauptmann, Georges; Hebert, Lee A.; Atkinson, John P.; Yu, C. Yung

    2016-01-01

    The complement system consists of effector proteins, regulators, and receptors that participate in host defense against pathogens. Activation of the complement system, via the classical pathway (CP), has long been recognized in immune complex-mediated tissue injury, most notably systemic lupus erythematosus (SLE). Paradoxically, a complete deficiency of an early component of the CP, as evidenced by homozygous genetic deficiencies reported in human, are strongly associated with the risk of developing SLE or a lupus-like disease. Similarly, isotype deficiency attributable to a gene copy-number (GCN) variation and/or the presence of autoantibodies directed against a CP component or a regulatory protein that result in an acquired deficiency are relatively common in SLE patients. Applying accurate assay methodologies with rigorous data validations, low GCNs of total C4, and heterozygous and homozygous deficiencies of C4A have been shown as medium to large effect size risk factors, while high copy numbers of total C4 or C4A as prevalent protective factors, of European and East-Asian SLE. Here, we summarize the current knowledge related to genetic deficiency and insufficiency, and acquired protein deficiencies for C1q, C1r, C1s, C4A/C4B, and C2 in disease pathogenesis and prognosis of SLE, and, briefly, for other systemic autoimmune diseases. As the complement system is increasingly found to be associated with autoimmune diseases and immune-mediated diseases, it has become an attractive therapeutic target. We highlight the recent developments and offer a balanced perspective concerning future investigations and therapeutic applications with a focus on early components of the CP in human systemic autoimmune diseases. PMID:26913032

  18. Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

    PubMed

    Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath

    2013-08-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of expression of bioY and bio operons that separately function in biotin transport and the biosynthesis pathway.

  19. Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism

    PubMed Central

    Xu, Jie; Zhang, Huimin; Srinivas, Swaminath

    2013-01-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of expression of bioY and bio operons that separately function in biotin transport and the biosynthesis pathway. PMID:23729648

  20. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila.

    PubMed

    Tiaden, André; Spirig, Thomas; Sahr, Tobias; Wälti, Martin A; Boucke, Karin; Buchrieser, Carmen; Hilbi, Hubert

    2010-05-01

    The amoebae-resistant opportunistic pathogen Legionella pneumophila employs a biphasic life cycle to replicate in host cells and spread to new niches. Upon entering the stationary growth phase, the bacteria switch to a transmissive (virulent) state, which involves a complex regulatory network including the lqs gene cluster (lqsA-lqsR-hdeD-lqsS). LqsR is a putative response regulator that promotes host-pathogen interactions and represses replication. The autoinducer synthase LqsA catalyses the production of the diffusible signalling molecule 3-hydroxypentadecan-4-one (LAI-1) that is presumably recognized by the sensor kinase LqsS. Here, we analysed L. pneumophila strains lacking lqsA or lqsS. Compared with wild-type L. pneumophila, the DeltalqsS strain was more salt-resistant and impaired for the Icm/Dot type IV secretion system-dependent uptake by phagocytes. Legionella pneumophila strains lacking lqsS, lqsR or the alternative sigma factor rpoS sedimented more slowly and produced extracellular filaments. Deletion of lqsA moderately reduced the uptake of L. pneumophila by phagocytes, and the defect was complemented by expressing lqsA in trans. Unexpectedly, the overexpression of lqsA also restored the virulence defect and reduced filament production of L. pneumophila mutant strains lacking lqsS or lqsR, but not the phenotypes of strains lacking rpoS or icmT. These results suggest that LqsA products also signal through sensors not encoded by the lqs gene cluster. A transcriptome analysis of the DeltalqsA and DeltalqsS mutant strains revealed that under the conditions tested, lqsA regulated only few genes, whereas lqsS upregulated the expression of 93 genes at least twofold. These include 52 genes clustered in a 133 kb high plasticity genomic island, which is flanked by putative DNA-mobilizing genes and encodes multiple metal ion efflux pumps. Upon overexpression of lqsA, a cluster of 19 genes in the genomic island was also upregulated, suggesting that LqsA and LqsS participate in the same regulatory circuit.

  1. Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

    PubMed

    El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

    2017-03-01

    Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

  2. Challenges for modeling global gene regulatory networks during development: insights from Drosophila.

    PubMed

    Wilczynski, Bartek; Furlong, Eileen E M

    2010-04-15

    Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  3. A regulatory perspective of clinical trial applications for biological products with particular emphasis on Advanced Therapy Medicinal Products (ATMPs)

    PubMed Central

    Jones, David R; McBlane, James W; McNaughton, Graham; Rajakumaraswamy, Nishanthan; Wydenbach, Kirsty

    2013-01-01

    The safety of trial subjects is the tenet that guides the regulatory assessment of a Clinical Trial Authorization application and applies equally to trials involving small molecules and those with biological/biotechnological products, including Advanced Therapy Medicinal Products. The objective of a regulator is to ensure that the potential risk faced by a trial subject is outweighed by the potential benefit to them from taking part in the trial. The focus of the application review is to assess whether risks have been identified and appropriate steps taken to alleviate these as much as possible. Other factors are also taken into account during a review, such as regulatory requirements, and emerging non-clinical and clinical data from other trials on the same or similar products. This paper examines the regulatory review process of a Clinical Trial Authorization application from the perspectives of Quality, Non-Clinical and Clinical Regulatory Assessors at the Medicines and Healthcare products Regulatory Agency. It should be noted that each perspective has highlighted specific issues from their individual competence and that these can be different between the disciplines. PMID:23216470

  4. 76 FR 41266 - Critical Path Manufacturing Sector Research Initiative (U01)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... under the ``Regulatory Information'' section. The title of the page is ``Research Acquisitions... the Critical Path. Research into methods for laboratory synthesis of molecules that have been designed... accelerated by better design of the facilities where this research is conducted. Creating and making these...

  5. Atomic resolution model of the antibody Fc interaction with the complement C1q component.

    PubMed

    Schneider, Sebastian; Zacharias, Martin

    2012-05-01

    The globular C1q heterotrimer is a subunit of the C1 complement factor. Binding of the C1q subunit to the constant (Fc) part of antibody molecules is a first step and key event of complement activation. Although three-dimensional structures of C1q and antibody Fc subunits have been determined experimentally no atomic resolution structure of the C1q-Fc complex is known so far. Based on systematic protein-protein docking searches and Molecular Dynamics simulations a structural model of the C1q-IgG1-Fc-binding geometry has been obtained. The structural model is compatible with available experimental data on the interaction between the two partner proteins. It predicts a binding geometry that involves mainly the B-subunit of the C1q-trimer and both subunits of the IgG1-Fc-dimer with small conformational adjustments with respect to the unbound partners to achieve high surface complementarity. In addition to several charge-charge and polar contacts in the rim region of the interface it also involves nonpolar contacts between the two proteins and is compatible with the carbohydrate moiety of the Fc subunit. The model for the complex structure provides a working model for rationalizing available biochemical data on this important interaction and can form the basis for the design of Fc variants with a greater capacity to activate the complement system for example on binding to cancer cells or other target structures. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Identification of C1q as a Binding Protein for Advanced Glycation End Products.

    PubMed

    Chikazawa, Miho; Shibata, Takahiro; Hatasa, Yukinori; Hirose, Sayumi; Otaki, Natsuki; Nakashima, Fumie; Ito, Mika; Machida, Sachiko; Maruyama, Shoichi; Uchida, Koji

    2016-01-26

    Advanced glycation end products (AGEs) make up a heterogeneous group of molecules formed from the nonenzymatic reaction of reducing sugars with the free amino groups of proteins. The abundance of AGEs in a variety of age-related diseases, including diabetic complications and atherosclerosis, and their pathophysiological effects suggest the existence of innate defense mechanisms. Here we examined the presence of serum proteins that are capable of binding glycated bovine serum albumin (AGEs-BSA), prepared upon incubation of BSA with dehydroascorbate, and identified complement component C1q subcomponent subunit A as a novel AGE-binding protein in human serum. A molecular interaction analysis showed the specific binding of C1q to the AGEs-BSA. In addition, we identified DNA-binding regions of C1q, including a collagen-like domain, as the AGE-binding site and established that the amount of positive charge on the binding site was the determining factor. C1q indeed recognized several other modified proteins, including acylated proteins, suggesting that the binding specificity of C1q might be ascribed, at least in part, to the electronegative potential of the ligand proteins. We also observed that C1q was involved in the AGEs-BSA-activated deposition of complement proteins, C3b and C4b. In addition, the AGEs-BSA mediated the proteolytic cleavage of complement protein 5 to release C5a. These findings provide the first evidence of AGEs as a new ligand recognized by C1q, stimulating the C1q-dependent classical complement pathway.

  7. Engrailed negatively regulates the expression of cell adhesion molecules connectin and neuroglian in embryonic Drosophila nervous system.

    PubMed

    Siegler, M V; Jia, X X

    1999-02-01

    Engrailed is expressed in subsets of interneurons that do not express Connectin or appreciable Neuroglian, whereas other neurons that are Engrailed negative strongly express these adhesion molecules. Connectin and Neuroglian expression are virtually eliminated in interneurons when engrailed expression is driven ubiquitously in neurons, and greatly increased when engrailed genes are lacking in mutant embryos. The data suggest that Engrailed is normally a negative regulator of Connectin and neuroglian. These are the first two "effector" genes identified in the nervous system of Drosophila as regulatory targets for Engrailed. We argue that differential Engrailed expression is crucial in determining the pattern of expression of cell adhesion molecules and thus constitutes an important determinant of neuronal shape and perhaps connectivity.

  8. MicroRNAs in the intracellular space, regulation of organelle specific pathways in health and disease.

    PubMed

    Nguyen, Thao T; Brenu, Ekua W; Staines, Don R; Marshall-Gradisnik, Sonya M

    2014-01-01

    MicroRNAs (miRNA) are small (~22 nucleotide] non-coding RNA molecules originally characterised as nonsense or junk DNA. Emerging research suggests that these molecules have diverse regulatory roles in an array of molecular, cellular and physiological processes. MiRNAs are versatile and highly stable molecules, therefore, they are able to exist as intracellular or extracellular miRNAs. The purpose of this paper is to review the function and role of miRNAs in the intracellular space with specific focus on the interactions between miRNAs and organelles such as the mitochondria and the rough endoplasmic reticulum. Understanding the role of miRNAs in the intracellular space may be vital in understanding the mechanism of certain diseases.

  9. Can formulation and drug delivery reduce attrition during drug discovery and development—review of feasibility, benefits and challenges

    PubMed Central

    Basavaraj, S; Betageri, Guru V.

    2014-01-01

    Drug discovery and development has become longer and costlier process. The fear of failure and stringent regulatory review process is driving pharmaceutical companies towards “me too” drugs and improved generics (505(b) (2)) fillings. The discontinuance of molecules at late stage clinical trials is common these years. The molecules are withdrawn at various stages of discovery and development process for reasons such as poor ADME properties, lack of efficacy and safety reasons. Hence this review focuses on possible applications of formulation and drug delivery to salvage molecules and improve the drugability. The formulation and drug delivery technologies are suitable for addressing various issues contributing to attrition are discussed in detail. PMID:26579359

  10. Nanomanipulation of Single RNA Molecules by Optical Tweezers

    PubMed Central

    Stephenson, William; Wan, Gorby; Tenenbaum, Scott A.; Li, Pan T. X.

    2014-01-01

    A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed. PMID:25177917

  11. Analytical tools for characterizing biopharmaceuticals and the implications for biosimilars

    PubMed Central

    Berkowitz, Steven A.; Engen, John R.; Mazzeo, Jeffrey R.; Jones, Graham B.

    2013-01-01

    Biologics such as monoclonal antibodies are much more complex than small-molecule drugs, which raises challenging questions for the development and regulatory evaluation of follow-on versions of such biopharmaceutical products (also known as biosimilars) and their clinical use once patent protection for the pioneering biologic has expired. With the recent introduction of regulatory pathways for follow-on versions of complex biologics, the role of analytical technologies in comparing biosimilars with the corresponding reference product is attracting substantial interest in establishing the development requirements for biosimilars. Here, we discuss the current state of the art in analytical technologies to assess three characteristics of protein biopharmaceuticals that regulatory authorities have identified as being important in development strategies for biosimilars: post-translational modifications, three-dimensional structures and protein aggregation. PMID:22743980

  12. Immune Tolerance to Apoptotic Self Is Mediated Primarily by Regulatory B1a Cells.

    PubMed

    Miles, Katherine; Simpson, Joanne; Brown, Sheila; Cowan, Graeme; Gray, David; Gray, Mohini

    2017-01-01

    The chronic autoimmune inflammatory diseases, systemic lupus erythematosus and Sjogren's syndrome, develop when tolerance to apoptotic cells (ACs) is lost. We have previously reported that this tolerance is maintained by innate-like, IL-10 secreting regulatory B cells. Two questions remained. First, do these regulatory B cells belong predominantly to a single subset of steady-state B cells and second, what is their specificity? We report here that innate-like B cells with markers characteristic for B1a cells (CD43 +ve CD19 hi CD5 +ve IgM hi IgD lo ) constitute 80% of splenic and 96% of peritoneal B cells that respond to ACs by secreting IL-10. AC responsive B1a cells secrete self-reactive natural antibodies (NAbs) and IL-10, which is augmented by toll-like receptor (TLR) 7 or TLR9 stimulation. In so doing, they both accelerate the clearance of dying cells by macrophages and inhibit their potential to mount proinflammatory immune responses. While B1a cells make prolonged contact with ACs, they do not require TIM1 or complement to mediate their regulatory function. In an animal model of neural inflammation (experimental autoimmune encephalomyelitis), just 10 5 activated B1a B cells was sufficient to restrain inflammation. Activated B1a B cells also induced antigen-specific T cells to secrete IL-10. Hence, regulatory B1a cells specifically recognize and augment tolerance to apoptotic self via IL-10 and NAbs; but once activated, can also prevent autoimmune mediated inflammation.

  13. Solving the Schrödinger equation of molecules by relaxing the antisymmetry rule: Inter-exchange theory.

    PubMed

    Nakatsuji, Hiroshi; Nakashima, Hiroyuki

    2015-05-21

    The Schrödinger equation (SE) and the antisymmetry principle constitute the governing principle of chemistry. A general method of solving the SE was presented before as the free complement (FC) theory, which gave highly accurate solutions for small atoms and molecules. We assume here to use the FC theory starting from the local valence bond wave function. When this theory is applied to larger molecules, antisymmetrizations of electronic wave functions become time-consuming and therefore, an additional breakthrough is necessary concerning the antisymmetry principle. Usually, in molecular calculations, we first construct the wave function to satisfy the antisymmetry rule, "electronic wave functions must be prescribed to be antisymmetric for all exchanges of electrons, otherwise bosonic interference may disturb the basis of the science." Starting from determinantal wave functions is typical. Here, we give an antisymmetrization theory, called inter-exchange (iExg) theory, by dividing molecular antisymmetrizations to those within atoms and between atoms. For the electrons belonging to distant atoms in a molecule, only partial antisymmetrizations or even no antisymmetrizations are necessary, depending on the distance between the atoms. So, the above antisymmetry rule is not necessarily followed strictly to get the results of a desired accuracy. For this and other reasons, the necessary parts of the antisymmetrization operations become very small as molecules become larger, leading finally to the operation counts of lower orders of N, the number of electrons. This theory creates a natural antisymmetrization method that is useful for large molecules.

  14. Lipid Interaction Sites on Channels, Transporters and Receptors: Recent Insights from Molecular Dynamics Simulations

    PubMed Central

    Hedger, George; Sansom, Mark S. P.

    2017-01-01

    Lipid molecules are able to selectively interact with specific sites on integral membrane proteins, and modulate their structure and function. Identification and characterisation of these sites is of importance for our understanding of the molecular basis of membrane protein function and stability, and may facilitate the design of lipid-like drug molecules. Molecular dynamics simulations provide a powerful tool for the identification of these sites, complementing advances in membrane protein structural biology and biophysics. We describe recent notable biomolecular simulation studies which have identified lipid interaction sites on a range of different membrane proteins. The sites identified in these simulation studies agree well with those identified by complementary experimental techniques. This demonstrates the power of the molecular dynamics approach in the prediction and characterization of lipid interaction sites on integral membrane proteins. PMID:26946244

  15. Aggregation and folding phase transitions of RNA molecules

    NASA Astrophysics Data System (ADS)

    Bundschuh, Ralf

    2007-03-01

    RNA is a biomolecule that is involved in nearly all aspects of cellular functions. In order to perform many of these functions, RNA molecules have to fold into specific secondary structures. This folding is driven by the tendency of the bases to form Watson-Crick base pairs. Beyond the biological importance of RNA, the relatively simple rules for structure formation of RNA make it a very interesting system from the statistical physics point of view. We will present examples of phase transitions in RNA secondary structure formation that are amenable to analytical descriptions. A special focus will be on aggregation between several RNA molecules which is important for some regulatory circuits based on RNA structure, triplet repeat diseases like Huntington's, and as a model for prion diseases. We show that depending on the relative strength of the intramolecular and the intermolecular base pairing, RNA molecules undergo a transition into an aggregated phase and quantitatively characterize this transition.

  16. DG-AMMOS: a new tool to generate 3d conformation of small molecules using distance geometry and automated molecular mechanics optimization for in silico screening.

    PubMed

    Lagorce, David; Pencheva, Tania; Villoutreix, Bruno O; Miteva, Maria A

    2009-11-13

    Discovery of new bioactive molecules that could enter drug discovery programs or that could serve as chemical probes is a very complex and costly endeavor. Structure-based and ligand-based in silico screening approaches are nowadays extensively used to complement experimental screening approaches in order to increase the effectiveness of the process and facilitating the screening of thousands or millions of small molecules against a biomolecular target. Both in silico screening methods require as input a suitable chemical compound collection and most often the 3D structure of the small molecules has to be generated since compounds are usually delivered in 1D SMILES, CANSMILES or in 2D SDF formats. Here, we describe the new open source program DG-AMMOS which allows the generation of the 3D conformation of small molecules using Distance Geometry and their energy minimization via Automated Molecular Mechanics Optimization. The program is validated on the Astex dataset, the ChemBridge Diversity database and on a number of small molecules with known crystal structures extracted from the Cambridge Structural Database. A comparison with the free program Balloon and the well-known commercial program Omega generating the 3D of small molecules is carried out. The results show that the new free program DG-AMMOS is a very efficient 3D structure generator engine. DG-AMMOS provides fast, automated and reliable access to the generation of 3D conformation of small molecules and facilitates the preparation of a compound collection prior to high-throughput virtual screening computations. The validation of DG-AMMOS on several different datasets proves that generated structures are generally of equal quality or sometimes better than structures obtained by other tested methods.

  17. p38 MAPK inhibition suppresses the TLR-hypersensitive phenotype in FANCC- and FANCA-deficient mononuclear phagocytes

    PubMed Central

    Anur, Praveen; Yates, Jane; Garbati, Michael R.; Vanderwerf, Scott; Keeble, Winifred; Rathbun, Keaney; Hays, Laura E.; Tyner, Jeffrey W.; Svahn, Johanna; Cappelli, Enrico; Dufour, Carlo

    2012-01-01

    Fanconi anemia, complementation group C (FANCC)–deficient hematopoietic stem and progenitor cells are hypersensitive to a variety of inhibitory cytokines, one of which, TNFα, can induce BM failure and clonal evolution in Fancc-deficient mice. FANCC-deficient macrophages are also hypersensitive to TLR activation and produce TNFα in an unrestrained fashion. Reasoning that suppression of inhibitory cytokine production might enhance hematopoiesis, we screened small molecules using TLR agonist–stimulated FANCC- and Fanconi anemia, complementation group A (FANCA)–deficient macrophages containing an NF-κB/AP-1–responsive reporter gene (SEAP). Of the 75 small molecules screened, the p38 MAPK inhibitor BIRB 796 and dasatinib potently suppressed TLR8-dependent expression of the reporter gene. Fanconi anemia (FA) macrophages were hypersensitive to the TLR7/8 activator R848, overproducing SEAP and TNFα in response to all doses of the agonist. Low doses (50nM) of both agents inhibited p38 MAPK–dependent activation of MAPKAPK2 (MK2) and suppressed MK2-dependent TNFα production without substantially influencing TNFα gene transcription. Overproduction of TNFα by primary FA cells was likewise suppressed by these agents and involved inhibition of MK2 activation. Because MK2 is also known to influence production and/or sensitivity to 2 other suppressive factors (MIP-1α and IFNγ) to which FA hematopoietic progenitor cells are uniquely vulnerable, targeting of p38 MAPK in FA hematopoietic cells is a rational objective for preclinical evaluation. PMID:22234699

  18. p38 MAPK inhibition suppresses the TLR-hypersensitive phenotype in FANCC- and FANCA-deficient mononuclear phagocytes.

    PubMed

    Anur, Praveen; Yates, Jane; Garbati, Michael R; Vanderwerf, Scott; Keeble, Winifred; Rathbun, Keaney; Hays, Laura E; Tyner, Jeffrey W; Svahn, Johanna; Cappelli, Enrico; Dufour, Carlo; Bagby, Grover C

    2012-03-01

    Fanconi anemia, complementation group C (FANCC)-deficient hematopoietic stem and progenitor cells are hypersensitive to a variety of inhibitory cytokines, one of which, TNFα, can induce BM failure and clonal evolution in Fancc-deficient mice. FANCC-deficient macrophages are also hypersensitive to TLR activation and produce TNFα in an unrestrained fashion. Reasoning that suppression of inhibitory cytokine production might enhance hematopoiesis, we screened small molecules using TLR agonist-stimulated FANCC- and Fanconi anemia, complementation group A (FANCA)-deficient macrophages containing an NF-κB/AP-1-responsive reporter gene (SEAP). Of the 75 small molecules screened, the p38 MAPK inhibitor BIRB 796 and dasatinib potently suppressed TLR8-dependent expression of the reporter gene. Fanconi anemia (FA) macrophages were hypersensitive to the TLR7/8 activator R848, overproducing SEAP and TNFα in response to all doses of the agonist. Low doses (50nM) of both agents inhibited p38 MAPK-dependent activation of MAPKAPK2 (MK2) and suppressed MK2-dependent TNFα production without substantially influencing TNFα gene transcription. Overproduction of TNFα by primary FA cells was likewise suppressed by these agents and involved inhibition of MK2 activation. Because MK2 is also known to influence production and/or sensitivity to 2 other suppressive factors (MIP-1α and IFNγ) to which FA hematopoietic progenitor cells are uniquely vulnerable, targeting of p38 MAPK in FA hematopoietic cells is a rational objective for preclinical evaluation.

  19. [Invitation to the immunoglobulin world].

    PubMed

    Mafune, Naoki

    2010-04-01

    One of the most basic characteristics of the organism is to recognize self and non-self. Immune system is a typical system that fulfills this characteristic, and the immunoglobulins play important roles in it. The immunoglobulins circulating in internal or secreting to external space of the body, are basically characterized as a soluble form of cell surface receptors. The immunoglobulin has two kinds of domains. One is the variable domain that binds the antigen and the other is the constant domain that has the effecter functions. The immunoglobulin molecule can be obviously identified in vertebrates. In mammals, five immunoglobulin classes, IgG, IgA, IgM, IgD and IgE are classified. It is important to recognize that our immune system assign immunological roles among classes especially between IgG and IgA after class switch from IgM. IgG, the major immunoglobulin in plasma or extra vascular spaces, has the most versatile function of immunoglobulin molecules; such as placenta transfer, complement fixation and cell binding. On the other hand, IgA, the major immunoglobulin in secretions, does not show any complement fixation unless denatured. These facts implicate an aggressive characteristic of IgG in systemic immune response inside of the body, and a defensive characteristic of IgA in mucosal immune response on the surface of the body. Further, they allot the immunological roles to fetus or baby, in other words, IgG transferred from placenta protects fetus and newborn, and then IgA secreted in milk protects baby from mucosal invasion of pathogenic organisms.

  20. Yersinia infection tools-characterization of structure and function of adhesins.

    PubMed

    Mikula, Kornelia M; Kolodziejczyk, Robert; Goldman, Adrian

    2012-01-01

    Among the seventeen species of the Gram-negative genus Yersinia, three have been shown to be virulent and pathogenic to humans and animals-Y. enterocolitica, Y. pseudotuberculosis, and Y. pestis. In order to be so, they are armoured with various factors that help them adhere to tissues and organelles, cross the cellular barrier and escape the immune system during host invasion. The group of proteins that mediate pathogen-host interactions constitute adhesins. Invasin, Ail, YadA, YadB, YadC, Pla, and pH 6 antigen belong to the most prominent and best-known Yersinia adhesins. They act at different times and stages of infection complementing each other by their ability to bind a variety of host molecules such as collagen, fibronectin, laminin, β1 integrins, and complement regulators. All the proteins are anchored in the bacterial outer membrane (OM), often forming rod-like or fimbrial-like structures that protrude to the extracellular milieu. Structural studies have shown that the anchor region forms a β-barrel composed of 8, 10, or 12 antiparallel β-strands. Depending on the protein, the extracellular part can be composed of several domains belonging to the immunoglobulin fold superfamily, or form a coiled-coil structure with globular head domain at the end, or just constitute several loops connecting individual β-strands in the β-barrel. Those extracellular regions define the activity of each adhesin. This review focuses on the structure and function of these important molecules, and their role in pathogenesis.

  1. Yersinia infection tools—characterization of structure and function of adhesins

    PubMed Central

    Mikula, Kornelia M.; Kolodziejczyk, Robert; Goldman, Adrian

    2013-01-01

    Among the seventeen species of the Gram-negative genus Yersinia, three have been shown to be virulent and pathogenic to humans and animals—Y. enterocolitica, Y. pseudotuberculosis, and Y. pestis. In order to be so, they are armoured with various factors that help them adhere to tissues and organelles, cross the cellular barrier and escape the immune system during host invasion. The group of proteins that mediate pathogen–host interactions constitute adhesins. Invasin, Ail, YadA, YadB, YadC, Pla, and pH 6 antigen belong to the most prominent and best-known Yersinia adhesins. They act at different times and stages of infection complementing each other by their ability to bind a variety of host molecules such as collagen, fibronectin, laminin, β1 integrins, and complement regulators. All the proteins are anchored in the bacterial outer membrane (OM), often forming rod-like or fimbrial-like structures that protrude to the extracellular milieu. Structural studies have shown that the anchor region forms a β-barrel composed of 8, 10, or 12 antiparallel β-strands. Depending on the protein, the extracellular part can be composed of several domains belonging to the immunoglobulin fold superfamily, or form a coiled-coil structure with globular head domain at the end, or just constitute several loops connecting individual β-strands in the β-barrel. Those extracellular regions define the activity of each adhesin. This review focuses on the structure and function of these important molecules, and their role in pathogenesis. PMID:23316485

  2. Human-Specific Bacterial Pore-Forming Toxins Induce Programmed Necrosis in Erythrocytes

    PubMed Central

    LaRocca, Timothy J.; Stivison, Elizabeth A.; Hod, Eldad A.; Spitalnik, Steven L.; Cowan, Peter J.; Randis, Tara M.

    2014-01-01

    ABSTRACT A subgroup of the cholesterol-dependent cytolysin (CDC) family of pore-forming toxins (PFTs) has an unusually narrow host range due to a requirement for binding to human CD59 (hCD59), a glycosylphosphatidylinositol (GPI)-linked complement regulatory molecule. hCD59-specific CDCs are produced by several organisms that inhabit human mucosal surfaces and can act as pathogens, including Gardnerella vaginalis and Streptococcus intermedius. The consequences and potential selective advantages of such PFT host limitation have remained unknown. Here, we demonstrate that, in addition to species restriction, PFT ligation of hCD59 triggers a previously unrecognized pathway for programmed necrosis in primary erythrocytes (red blood cells [RBCs]) from humans and transgenic mice expressing hCD59. Because they lack nuclei and mitochondria, RBCs have typically been thought to possess limited capacity to undergo programmed cell death. RBC programmed necrosis shares key molecular factors with nucleated cell necroptosis, including dependence on Fas/FasL signaling and RIP1 phosphorylation, necrosome assembly, and restriction by caspase-8. Death due to programmed necrosis in RBCs is executed by acid sphingomyelinase-dependent ceramide formation, NADPH oxidase- and iron-dependent reactive oxygen species formation, and glycolytic formation of advanced glycation end products. Bacterial PFTs that are hCD59 independent do not induce RBC programmed necrosis. RBC programmed necrosis is biochemically distinct from eryptosis, the only other known programmed cell death pathway in mature RBCs. Importantly, RBC programmed necrosis enhances the growth of PFT-producing pathogens during exposure to primary RBCs, consistent with a role for such signaling in microbial growth and pathogenesis. PMID:25161188

  3. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva.

    PubMed

    Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P

    2016-10-01

    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.

  4. Biochemical characterization of rice trehalose-6-phosphate phosphatases supports distinctive functions of these plant enzymes.

    PubMed

    Shima, Shuhei; Matsui, Hirokazu; Tahara, Satoshi; Imai, Ryozo

    2007-03-01

    Substantial levels of trehalose accumulate in bacteria, fungi, and invertebrates, where it serves as a storage carbohydrate or as a protectant against environmental stresses. In higher plants, trehalose is detected at fairly low levels; therefore, a regulatory or signaling function has been proposed for this molecule. In many organisms, trehalose-6-phosphate phosphatase is the enzyme governing the final step of trehalose biosynthesis. Here we report that OsTPP1 and OsTPP2 are the two major trehalose-6-phosphate phosphatase genes expressed in vegetative tissues of rice. Similar to results obtained from our previous OsTPP1 study, complementation analysis of a yeast trehalose-6-phosphate phosphatase mutant and activity measurement of the recombinant protein demonstrated that OsTPP2 encodes a functional trehalose-6-phosphate phosphatase enzyme. OsTPP2 expression is transiently induced in response to chilling and other abiotic stresses. Enzymatic characterization of recombinant OsTPP1 and OsTPP2 revealed stringent substrate specificity for trehalose 6-phosphate and about 10 times lower K(m) values for trehalose 6-phosphate as compared with trehalose-6-phosphate phosphatase enzymes from microorganisms. OsTPP1 and OsTPP2 also clearly contrasted with microbial enzymes, in that they are generally unstable, almost completely losing activity when subjected to heat treatment at 50 degrees C for 4 min. These characteristics of rice trehalose-6-phosphate phosphatase enzymes are consistent with very low cellular substrate concentration and tightly regulated gene expression. These data also support a plant-specific function of trehalose biosynthesis in response to environmental stresses.

  5. Difference in Ulex europaeus agglutinin I-binding activity of decay-accelerating factor detected in the stools of patients with colorectal cancer and ulcerative colitis.

    PubMed

    Okazaki, Hiroaki; Mizuno, Motowo; Nasu, Junichirou; Makidono, Chiho; Hiraoka, Sakiko; Yamamoto, Kazuhide; Okada, Hiroyuki; Fujita, Teizo; Tsuji, Takao; Shiratori, Yasushi

    2004-03-01

    Expression of decay-accelerating factor (DAF, CD55), a complement-regulatory glycoprotein, is enhanced in colorectal-cancer (CC) cells and colonic epithelium in ulcerative colitis (UC), and stools from these patients contain increased amounts of DAF. Carbohydrate chains of glycoproteins are often altered during malignant transformation or inflammation. In this study, we investigated whether DAF molecules in patients with CC and those with UC differ with respect to oligosaccharide side chains. We analyzed DAF in stools and homogenates of colonic-tissue specimens obtained from patients with CC or UC using solid-phase enzyme-linked assay and Western blotting for reactivity with the lectins Ulex europaeus agglutinin I (UEA-I), wheat-germ agglutinin, peanut agglutinin, and concanavalin A. UEA-I bound to DAF in stools from patients with UC but not in that from the stools of CC patients, as demonstrated on the solid-phase enzyme-linked assay (P <.05, Mann-Whitney U test) and Western blotting. Binding of UEA-I was specifically inhibited by the addition of fucose. The difference in UEA-I reactivity with DAF was observed also in colonic-tissue homogenates from patients with UC and those with CC. DAF expressed in the mucosa and excreted into the stools of UC patients is different from that expressed in CC with regard to UEA-I reactivity. Future studies should be directed toward determining whether a qualitatively unique isoform of DAF is present, of which sugar chains are specific to CC in UC patients.

  6. PARS: a web server for the prediction of Protein Allosteric and Regulatory Sites.

    PubMed

    Panjkovich, Alejandro; Daura, Xavier

    2014-05-01

    The regulation of protein activity is a key aspect of life at the molecular level. Unveiling its details is thus crucial to understanding signalling and metabolic pathways. The most common and powerful mechanism of protein-function regulation is allostery, which has been increasingly calling the attention of medicinal chemists due to its potential for the discovery of novel therapeutics. In this context, PARS is a simple and fast method that queries protein dynamics and structural conservation to identify pockets on a protein structure that may exert a regulatory effect on the binding of a small-molecule ligand.

  7. Growth and stress response mechanisms underlying post-feeding regenerative organ growth in the Burmese python.

    PubMed

    Andrew, Audra L; Perry, Blair W; Card, Daren C; Schield, Drew R; Ruggiero, Robert P; McGaugh, Suzanne E; Choudhary, Amit; Secor, Stephen M; Castoe, Todd A

    2017-05-02

    Previous studies examining post-feeding organ regeneration in the Burmese python (Python molurus bivittatus) have identified thousands of genes that are significantly differentially regulated during this process. However, substantial gaps remain in our understanding of coherent mechanisms and specific growth pathways that underlie these rapid and extensive shifts in organ form and function. Here we addressed these gaps by comparing gene expression in the Burmese python heart, liver, kidney, and small intestine across pre- and post-feeding time points (fasted, one day post-feeding, and four days post-feeding), and by conducting detailed analyses of molecular pathways and predictions of upstream regulatory molecules across these organ systems. Identified enriched canonical pathways and upstream regulators indicate that while downstream transcriptional responses are fairly tissue specific, a suite of core pathways and upstream regulator molecules are shared among responsive tissues. Pathways such as mTOR signaling, PPAR/LXR/RXR signaling, and NRF2-mediated oxidative stress response are significantly differentially regulated in multiple tissues, indicative of cell growth and proliferation along with coordinated cell-protective stress responses. Upstream regulatory molecule analyses identify multiple growth factors, kinase receptors, and transmembrane receptors, both within individual organs and across separate tissues. Downstream transcription factors MYC and SREBF are induced in all tissues. These results suggest that largely divergent patterns of post-feeding gene regulation across tissues are mediated by a core set of higher-level signaling molecules. Consistent enrichment of the NRF2-mediated oxidative stress response indicates this pathway may be particularly important in mediating cellular stress during such extreme regenerative growth.

  8. [Down-regulatory effect of Nucleostemin expression on signal molecule of PI3K/AKT/mTOR pathway in HL-60 cells].

    PubMed

    Jia, Yu; Wei, Yuan-Yu; Zhang, Fan; Li, Zhao-Bo; Liu, Shuai; Yue, Bao-Hong

    2014-02-01

    This study was purpose to explore the down-regulatory effect of nucleostemin (NS) expression on signal molecules of PI3K/AKT/mTOR pathway belonged to candidate ways of p53-independent signal pathway in the leukemia cells. The expression of NS was interfered by using recombinant lentivirus expression vector NS-RNAi-GV248 to transfect HL-60 cells of p53 deficiency. The expression of NS and signal molecules of PI3K/AKT/mTOR pathway were detected by using Real-time PCR. The results of showed that the HL-60 cells were transfected by recombinant lentivirus vector NS-RNAi-GV248 successfully and with transfection rate up to 80%. According to results of Real-time PCR detection, the inhibition rate of NS gene was 56.5% in HL-60 cells. And the expression levels of PI3K,AKT and GβL mRNA (0.491 ± 0.084,0.398 ± 0.164, 0.472 ± 0.097 respectively) were obviously down-regulated by silencing NS, and showed statistical difference (P < 0.05) in comparison with control (1.002 ± 0.171, 1.000 ± 0.411, 1.001 ± 0.206 respectively) . It is concluded that the changes of signal molecules of PI3K/AKT/mTOR pathway positively correlate with NS down-regulation, which provides evidence for confirming PI3K/AKT/mTOR signal pathway possible as a type of NS p53-independent pathway.

  9. Cytokine networking of innate immunity cells: a potential target of therapy.

    PubMed

    Striz, Ilja; Brabcova, Eva; Kolesar, Libor; Sekerkova, Alena

    2014-05-01

    Innate immune cells, particularly macrophages and epithelial cells, play a key role in multiple layers of immune responses. Alarmins and pro-inflammatory cytokines from the IL (interleukin)-1 and TNF (tumour necrosis factor) families initiate the cascade of events by inducing chemokine release from bystander cells and by the up-regulation of adhesion molecules required for transendothelial trafficking of immune cells. Furthermore, innate cytokines produced by dendritic cells, macrophages, epithelial cells and innate lymphoid cells seem to play a critical role in polarization of helper T-cell cytokine profiles into specific subsets of Th1/Th2/Th17 effector cells or regulatory T-cells. Lastly, the innate immune system down-regulates effector mechanisms and restores homoeostasis in injured tissue via cytokines from the IL-10 and TGF (transforming growth factor) families mainly released from macrophages, preferentially the M2 subset, which have a capacity to induce regulatory T-cells, inhibit the production of pro-inflammatory cytokines and induce healing of the tissue by regulating extracellular matrix protein deposition and angiogenesis. Cytokines produced by innate immune cells represent an attractive target for therapeutic intervention, and multiple molecules are currently being tested clinically in patients with inflammatory bowel disease, rheumatoid arthritis, systemic diseases, autoinflammatory syndromes, fibrosing processes or malignancies. In addition to the already widely used blockers of TNFα and the tested inhibitors of IL-1 and IL-6, multiple therapeutic molecules are currently in clinical trials targeting TNF-related molecules [APRIL (a proliferation-inducing ligand) and BAFF (B-cell-activating factor belonging to the TNF family)], chemokine receptors, IL-17, TGFβ and other cytokines.

  10. Studies of metal ion binding by apo-metallothioneins attached onto preformed self-assembled monolayers using a highly sensitive surface plasmon resonance spectrometer

    PubMed Central

    Zhang, Yintang; Xu, Maotian; Wang, Yanju; Toledo, Freddy; Zhou, Feimeng

    2007-01-01

    The use of a flow-injection surface plasmon resonance (FI-SPR) spectrometer equipped with a bicell detector or a position-sensitive device for determining coordination of heavy metal ions (Cd2+ and Hg2+) by surface-confined apo-metallothionein (apo-MT) molecules is described. To facilitate the formation of a compact MT adsorbate layer with a uniform surface orientation, MT molecules were attached onto a preformed alkanethiol self-assembled monolayer. The method resorts to the generation of apo-MT at the surface by treating the MT-covered sensor chip with glycine–HCl and the measurement of the apo-MT conformation changes upon metal ion incorporation. Domain-specific metal ion binding processes by the apo-MT molecules were observed. Competitive replacement of one metal ion by another can be monitored in real time by FI-SPR. The tandem use of an immobilization scheme for forming a sub-monolayer of MT molecules at the sensor surface and the highly sensitive FI-SPR instrument affords a low concentration detection level. The detection level for Cd2+ (0.1 μM or 15 ppb) compares favorably with similar studies and the methodology complements to other well-established sensitive analytical techniques. The extent of metal incorporation by apo-MT molecules was also determined. PMID:18493298

  11. Dimeric MHC-peptides inserted into an immunoglobulin scaffold as new immunotherapeutic agents

    PubMed Central

    Goldberg, Burt; Bona, Constantin

    2011-01-01

    Abstract The interactions of the T cell receptor (TCR) with cognate MHC-peptide and co-stimulatory molecules expressed at surface of antigen presenting cells (APC) leads to activation or tolerance of T cells. The development of molecular biological tools allowed for the preparation of soluble MHC-peptide molecules as surrogate for the APC. A decade ago a monomeric class II MHC molecule in which the peptide was covalently linked to β-chain of class II molecule was generated. This type of molecule had a low-binding affinity and did not cause the multimerization of TCR. The requirement of multimerization of TCR led to development of a new class of reagents, chimeric peptides covalently linked to MHC that was dimerized via Fc fragment of an immunoglobulin and linked to 3′ end of the β-chain of MHC class II molecule. These soluble dimerized MHC-peptide chimeric molecules display high affinity for the TCR and caused multimerization of TCR without processing by an APC. Because dimeric molecules are devoid of co-stimulatory molecules interacting with CD28, a second signal, they induce anergy rather the activation of T cells. In this review, we compare the human and murine dimerized MHC class II-peptides and their effect on CD4+ T cells, particularly the generation of T regulatory cells, which make these chimeric molecules an appealing approach for the treatment of autoimmune diseases. PMID:21435177

  12. Evolution of context dependent regulation by expansion of feast/famine regulatory proteins

    DOE PAGES

    Plaisier, Christopher L.; Lo, Fang -Yin; Ashworth, Justin; ...

    2014-11-14

    Expansion of transcription factors is believed to have played a crucial role in evolution of all organisms by enabling them to deal with dynamic environments and colonize new environments. We investigated how the expansion of the Feast/Famine Regulatory Protein (FFRP) or Lrp-like proteins into an eight-member family in Halobacterium salinarum NRC-1 has aided in niche-adaptation of this archaeon to a complex and dynamically changing hypersaline environment. We mapped genome-wide binding locations for all eight FFRPs, investigated their preference for binding different effector molecules, and identified the contexts in which they act by analyzing transcriptional responses across 35 growth conditions thatmore » mimic different environmental and nutritional conditions this organism is likely to encounter in the wild. Integrative analysis of these data constructed an FFRP regulatory network with conditionally active states that reveal how interrelated variations in DNA-binding domains, effector-molecule preferences, and binding sites in target gene promoters have tuned the functions of each FFRP to the environments in which they act. We demonstrate how conditional regulation of similar genes by two FFRPs, AsnC (an activator) and VNG1237C (a repressor), have striking environment-specific fitness consequences for oxidative stress management and growth, respectively. This study provides a systems perspective into the evolutionary process by which gene duplication within a transcription factor family contributes to environment-specific adaptation of an organism.« less

  13. Evolution of context dependent regulation by expansion of feast/famine regulatory proteins.

    PubMed

    Plaisier, Christopher L; Lo, Fang-Yin; Ashworth, Justin; Brooks, Aaron N; Beer, Karlyn D; Kaur, Amardeep; Pan, Min; Reiss, David J; Facciotti, Marc T; Baliga, Nitin S

    2014-11-14

    Expansion of transcription factors is believed to have played a crucial role in evolution of all organisms by enabling them to deal with dynamic environments and colonize new environments. We investigated how the expansion of the Feast/Famine Regulatory Protein (FFRP) or Lrp-like proteins into an eight-member family in Halobacterium salinarum NRC-1 has aided in niche-adaptation of this archaeon to a complex and dynamically changing hypersaline environment. We mapped genome-wide binding locations for all eight FFRPs, investigated their preference for binding different effector molecules, and identified the contexts in which they act by analyzing transcriptional responses across 35 growth conditions that mimic different environmental and nutritional conditions this organism is likely to encounter in the wild. Integrative analysis of these data constructed an FFRP regulatory network with conditionally active states that reveal how interrelated variations in DNA-binding domains, effector-molecule preferences, and binding sites in target gene promoters have tuned the functions of each FFRP to the environments in which they act. We demonstrate how conditional regulation of similar genes by two FFRPs, AsnC (an activator) and VNG1237C (a repressor), have striking environment-specific fitness consequences for oxidative stress management and growth, respectively. This study provides a systems perspective into the evolutionary process by which gene duplication within a transcription factor family contributes to environment-specific adaptation of an organism.

  14. Relationship of Circulating C5a and Complement Factor H Levels With Disease Control in Pregnant Women With Asthma.

    PubMed

    Bohács, Anikó; Bikov, András; Ivancsó, István; Czaller, Ibolya; Böcskei, Renáta; Müller, Veronika; Rigó, János; Losonczy, György; Tamási, Lilla

    2016-04-01

    Asthma often complicates pregnancy and represents a risk of serious pregnancy complications. The complement system contributes to asthma pathogenesis and is up-regulated in healthy gestation as well. The anaphylatoxin C5a has a major pro-inflammatory role, and the complement factor H is a main soluble regulator protein both in asthma and during pregnancy; however, peripheral levels of these complement factors and their relationship to disease control have not yet been evaluated in pregnant subjects with asthma. The present study aimed to investigate circulating C5a and complement factor H levels in asthma (non-pregnant subjects with asthma; n = 19) and in pregnancy with asthma (pregnant subjects with asthma; n = 22), compared with healthy non-pregnant (n = 21) and healthy pregnant women (n = 13) and to test their relationship to clinical parameters of asthma (lung function, airway inflammation, and symptoms). Circulating C5a levels were higher in the pregnant asthma subject group compared with the healthy non-pregnant, healthy pregnant, and non-pregnant asthma groups: median 2.629 (interquartile range [IQR] 2.257-3.052) ng/mL versus 1.84 (IQR 1.576-2.563), 1.783 (IQR 0.6064-2.786), and 2.024 (IQR 1.232-2.615) ng/mL, respectively (P = .02 in all cases). C5a correlated negatively with FEV1 (r = -0.44, P = .039) and FVC values (r = -0.64, P = .001) in the pregnant asthma group and positively with fraction of exhaled nitric oxide levels in the non-pregnant asthma group (n = 12, r = 0.78, P = .004). Complement factor H levels were elevated in both the healthy pregnant and pregnant asthma subject groups compared with the healthy non-pregnant group (median 1,082 [IQR 734.9-1,224] and 910.7 [IQR 614.5-1076] μg/mL vs. 559.7 [IQR 388.7-783.1] μg/mL, P = .002 and P = .004, respectively) but not in the pregnant asthma group compared with the non-pregnant asthma group (median 687.4 [IQR 441.6-947.6] μg/mL, P = .10). Asthma during pregnancy increases the circulating level of pro-inflammatory C5a, which is accompanied by impaired lung function and partly counteracted by the gestation-specific elevation of regulatory complement factor H level (detected in pregnancy both in healthy and subjects with asthma). Copyright © 2016 by Daedalus Enterprises.

  15. Perspectives on Regulatory T Cell Therapies

    PubMed Central

    Probst-Kepper, Michael; Kröger, Andrea; Garritsen, Henk S.P.; Buer, Jan

    2009-01-01

    Summary Adoptive transfer in animal models clearly indicate an essential role of CD4+ CD25+ FOXP3+ regulatory T (Treg) cells in prevention and treatment of autoimmune and graft-versus-host disease. Thus, Treg cell therapies and development of drugs that specifically enhance Treg cell function and development represent promising tools to establish dominant tolerance. So far, lack of specific markers to differentiate human Treg cells from activated CD4+ CD25+ effector T cells, which also express FOXP3 at different levels, hampered such an approach. Recent identification of the orphan receptor glycoprotein-A repetitions predominant (GARP or LRRC32) as Treg cell-specific key molecule that dominantly controls FOXP3 via a positive feedback loop opens up new perspectives for molecular and cellular therapies. This brief review focuses on the role of GARP as a safeguard of a complex regulatory network of human Treg cells and its implications for regulatory T cell therapies in autoimmunity and graft-versus-host disease. PMID:21076548

  16. Perspectives on Regulatory T Cell Therapies.

    PubMed

    Probst-Kepper, Michael; Kröger, Andrea; Garritsen, Henk S P; Buer, Jan

    2009-01-01

    Adoptive transfer in animal models clearly indicate an essential role of CD4+ CD25+ FOXP3+ regulatory T (T(reg)) cells in prevention and treatment of autoimmune and graft-versus-host disease. Thus, T(reg) cell therapies and development of drugs that specifically enhance T(reg) cell function and development represent promising tools to establish dominant tolerance. So far, lack of specific markers to differentiate human T(reg) cells from activated CD4+ CD25+ effector T cells, which also express FOXP3 at different levels, hampered such an approach. Recent identification of the orphan receptor glycoprotein-A repetitions predominant (GARP or LRRC32) as T(reg) cell-specific key molecule that dominantly controls FOXP3 via a positive feedback loop opens up new perspectives for molecular and cellular therapies. This brief review focuses on the role of GARP as a safeguard of a complex regulatory network of human T(reg) cells and its implications for regulatory T cell therapies in autoimmunity and graft-versus-host disease.

  17. RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria

    PubMed Central

    Yanofsky, Charles

    2007-01-01

    We are now aware that RNA-based regulatory mechanisms are commonly used to control gene expression in many organisms. These mechanisms offer the opportunity to exploit relatively short, unique RNA sequences, in altering transcription, translation, and/or mRNA stability, in response to the presence of a small or large signal molecule. The ability of an RNA segment to fold and form alternative hairpin secondary structures—each dedicated to a different regulatory function—permits selection of specific sequences that can affect transcription and/or translation. In the present paper I will focus on our current understanding of the RNA-based regulatory mechanisms used by Escherichia coli and Bacillus subtilis in controlling expression of the tryptophan biosynthetic operon. The regulatory mechanisms they use for this purpose differ, suggesting that these organisms, or their ancestors, adopted different strategies during their evolution. I will also describe the RNA-based mechanism used by E. coli in regulating expression of its operon responsible for tryptophan degradation, the tryptophanase operon. PMID:17601995

  18. MicroRNAs play critical roles during plant development and in response to abiotic stresses.

    PubMed

    de Lima, Júlio César; Loss-Morais, Guilherme; Margis, Rogerio

    2012-12-01

    MicroRNAs (miRNAs) have been identified as key molecules in regulatory networks. The fine-tuning role of miRNAs in addition to the regulatory role of transcription factors has shown that molecular events during development are tightly regulated. In addition, several miRNAs play crucial roles in the response to abiotic stress induced by drought, salinity, low temperatures, and metals such as aluminium. Interestingly, several miRNAs have overlapping roles with regard to development, stress responses, and nutrient homeostasis. Moreover, in response to the same abiotic stresses, different expression patterns for some conserved miRNA families among different plant species revealed different metabolic adjustments. The use of deep sequencing technologies for the characterisation of miRNA frequency and the identification of new miRNAs adds complexity to regulatory networks in plants. In this review, we consider the regulatory role of miRNAs in plant development and abiotic stresses, as well as the impact of deep sequencing technologies on the generation of miRNA data.

  19. In Situ Formation of an Azo Bridge on Proteins Controllable by Visible Light.

    PubMed

    Hoppmann, Christian; Maslennikov, Innokentiy; Choe, Senyon; Wang, Lei

    2015-09-09

    Optical modulation of proteins provides superior spatiotemporal resolution for understanding biological processes, and photoswitches built on light-sensitive proteins have been significantly advancing neuronal and cellular studies. Small molecule photoswitches could complement protein-based switches by mitigating potential interference and affording high specificity for modulation sites. However, genetic encodability and responsiveness to nonultraviolet light, two desired properties possessed by protein photoswitches, are challenging to be engineered into small molecule photoswitches. Here we developed a small molecule photoswitch that can be genetically installed onto proteins in situ and controlled by visible light. A pentafluoro azobenzene-based photoswitchable click amino acid (F-PSCaa) was designed to isomerize in response to visible light. After genetic incorporation into proteins via the expansion of the genetic code, F-PSCaa reacts with a nearby cysteine within the protein generating an azo bridge in situ. The resultant bridge is switchable by visible light and allows conformation and binding of CaM to be regulated by such light. This photoswitch should prove valuable in optobiology for its minimal interference, site flexibility, genetic encodability, and response to the more biocompatible visible light.

  20. General method of solving the Schroedinger equation of atoms and molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakatsuji, Hiroshi

    2005-12-15

    We propose a general method of solving the Schroedinger equation of atoms and molecules. We first construct the wave function having the exact structure, using the ICI (iterative configuration or complement interaction) method and then optimize the variables involved by the variational principle. Based on the scaled Schroedinger equation and related principles, we can avoid the singularity problem of atoms and molecules and formulate a general method of calculating the exact wave functions in an analytical expansion form. We choose initial function {psi}{sub 0} and scaling g function, and then the ICI method automatically generates the wave function that hasmore » the exact structure by using the Hamiltonian of the system. The Hamiltonian contains all the information of the system. The free ICI method provides a flexible and variationally favorable procedure of constructing the exact wave function. We explain the computational procedure of the analytical ICI method routinely performed in our laboratory. Simple examples are given using hydrogen atom for the nuclear singularity case, the Hooke's atom for the electron singularity case, and the helium atom for both cases.« less

  1. Microwave spectroscopy of 2-(trifluoromethyl)pyridine⋯water complex: Molecular structure and hydrogen bond

    NASA Astrophysics Data System (ADS)

    Li, Xiaolong; Zheng, Yang; Gou, Qian; Feng, Gang; Xia, Zhining

    2018-01-01

    In order to explore the -CF3 substitution effect on the complexation of pyridine, we investigated the 2-(trifluoromethyl)pyridine⋯water complex by using pulsed jet Fourier transform microwave spectroscopy complemented with quantum chemical calculations. Experimental assignment and ab initio calculations confirmed that the observed complex is stabilized through N⋯H-O and O⋯H-C hydrogen bonds forming a five-membered ring structure. The bonding distance in N⋯H-O is determined to be 2.027(2) Å, whilst that in O⋯H-C interaction is 2.728(2) Å. The quantum theory of atoms in molecules analysis indicates that the interaction energy of N⋯H-O hydrogen bond is ˜22 kJ mol-1 and that for O⋯H-C hydrogen bond is ˜5 kJ mol-1. The water molecule lies almost in the plane of the aromatic ring in the complex. The -CF3 substitution to pyridine quenches the tunneling splitting path of the internal motion of water molecule.

  2. ON THE FORMATION OF AMIDE POLYMERS VIA CARBONYL–AMINO GROUP LINKAGES IN ENERGETICALLY PROCESSED ICES OF ASTROPHYSICAL RELEVANCE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Förstel, Marko; Maksyutenko, Pavlo; Jones, Brant M.

    2016-04-01

    We report on the formation of organic amide polymers via carbonyl–amino group linkages in carbon monoxide and ammonia bearing energetically processed ices of astrophysical relevance. The first group comprises molecules with one carboxyl group and an increasing number of amine moieties starting with formamide (45 u), urea (60 u), and hydrazine carboxamide (75 u). The second group consists of species with two carboxyl (58 u) and up to three amine groups (73 u, 88 u, and 103 u). The formation and polymerization of these linkages from simple inorganic molecules via formamide und urea toward amide polymers is discussed in anmore » astrophysical and astrobiological context. Our results show that long chain molecules, which are closely related to polypeptides, easily form by energetically processing simple, inorganic ices at very low temperatures and can be released into the gas phase by sublimation of the ices in star-forming regions. Our experimental results were obtained by employing reflectron time-of-flight mass spectroscopy, coupled with soft, single photon vacuum ultraviolet photoionization; they are complemented by theoretical calculations.« less

  3. Integrating computational and chemical biology tools in the discovery of antiangiogenic small molecule ligands of FGF2 derived from endogenous inhibitors

    PubMed Central

    Foglieni, Chiara; Pagano, Katiuscia; Lessi, Marco; Bugatti, Antonella; Moroni, Elisabetta; Pinessi, Denise; Resovi, Andrea; Ribatti, Domenico; Bertini, Sabrina; Ragona, Laura; Bellina, Fabio; Rusnati, Marco; Colombo, Giorgio; Taraboletti, Giulia

    2016-01-01

    The FGFs/FGFRs system is a recognized actionable target for therapeutic approaches aimed at inhibiting tumor growth, angiogenesis, metastasis, and resistance to therapy. We previously identified a non-peptidic compound (SM27) that retains the structural and functional properties of the FGF2-binding sequence of thrombospondin-1 (TSP-1), a major endogenous inhibitor of angiogenesis. Here we identified new small molecule inhibitors of FGF2 based on the initial lead. A similarity-based screening of small molecule libraries, followed by docking calculations and experimental studies, allowed selecting 7 bi-naphthalenic compounds that bound FGF2 inhibiting its binding to both heparan sulfate proteoglycans and FGFR-1. The compounds inhibit FGF2 activity in in vitro and ex vivo models of angiogenesis, with improved potency over SM27. Comparative analysis of the selected hits, complemented by NMR and biochemical analysis of 4 newly synthesized functionalized phenylamino-substituted naphthalenes, allowed identifying the minimal stereochemical requirements to improve the design of naphthalene sulfonates as FGF2 inhibitors. PMID:27000667

  4. Simulation of FRET dyes allows quantitative comparison against experimental data

    NASA Astrophysics Data System (ADS)

    Reinartz, Ines; Sinner, Claude; Nettels, Daniel; Stucki-Buchli, Brigitte; Stockmar, Florian; Panek, Pawel T.; Jacob, Christoph R.; Nienhaus, Gerd Ulrich; Schuler, Benjamin; Schug, Alexander

    2018-03-01

    Fully understanding biomolecular function requires detailed insight into the systems' structural dynamics. Powerful experimental techniques such as single molecule Förster Resonance Energy Transfer (FRET) provide access to such dynamic information yet have to be carefully interpreted. Molecular simulations can complement these experiments but typically face limits in accessing slow time scales and large or unstructured systems. Here, we introduce a coarse-grained simulation technique that tackles these challenges. While requiring only few parameters, we maintain full protein flexibility and include all heavy atoms of proteins, linkers, and dyes. We are able to sufficiently reduce computational demands to simulate large or heterogeneous structural dynamics and ensembles on slow time scales found in, e.g., protein folding. The simulations allow for calculating FRET efficiencies which quantitatively agree with experimentally determined values. By providing atomically resolved trajectories, this work supports the planning and microscopic interpretation of experiments. Overall, these results highlight how simulations and experiments can complement each other leading to new insights into biomolecular dynamics and function.

  5. Cancer diagnostics: The journey from histomorphology to molecular profiling.

    PubMed

    Ahmed, Atif A; Abedalthagafi, Malak

    2016-09-06

    Although histomorphology has made significant advances into the understanding of cancer etiology, classification and pathogenesis, it is sometimes complicated by morphologic ambiguities, and other shortcomings that necessitate the development of ancillary tests to complement its diagnostic value. A new approach to cancer patient management consists of targeting specific molecules or gene mutations in the cancer genome by inhibitory therapy. Molecular diagnostic tests and genomic profiling methods are increasingly being developed to identify tumor targeted molecular profile that is the basis of targeted therapy. Novel targeted therapy has revolutionized the treatment of gastrointestinal stromal tumor, renal cell carcinoma and other cancers that were previously difficult to treat with standard chemotherapy. In this review, we discuss the role of histomorphology in cancer diagnosis and management and the rising role of molecular profiling in targeted therapy. Molecular profiling in certain diagnostic and therapeutic difficulties may provide a practical and useful complement to histomorphology and opens new avenues for targeted therapy and alternative methods of cancer patient management.

  6. The Role of APEX as a Pathfinder for AtLAST

    NASA Astrophysics Data System (ADS)

    Wyrowski, Friedrich

    2018-01-01

    Now more than 12 years in operation, the Atacama Pathfinder Experiment (APEX) 12 m submillimeter telescope has significantly contributed to a wide variety of submillimeter astronomy science areas, ranging from the discoveries of new molecules to large and deep imaging of the submillimeter sky. While ALMA operation is in full swing, APEX is strengthening its role not only as pathfinder for studying large source samples and spatial scales to prepare detailed high angular resolution ALMA follow ups, but also as fast response instruments to complement new results from ALMA. Furthermore, APEX ensures southern hemisphere access for submillimeter projects complementing archival Herschel research as well as new SOFIA science. With new broadband and multipixel receivers as well as large cameras for wide-field continuum imaging, APEX will pave the way towards the science envisioned with ATLAST. In this contribution, the current status and ongoing upgrades of APEX will be discussed, with an emphasis on the importance of continuous cutting edge science and state-of-the-art instrumentation that will bridge the gap towards ATLAST.

  7. Crystallographic and kinetic study of riboflavin synthase from Brucella abortus, a chemotherapeutic target with an enhanced intrinsic flexibility

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Serer, María I.; Bonomi, Hernán R.; Guimarães, Beatriz G.

    This work reports crystal structures of trimeric riboflavin synthase from the pathogen B. abortus both as the apo protein and in complex with several ligands of interest. It is shown that ligand binding drives the assembly of the unique active site of the trimer, and these findings are complemented by a detailed kinetic study on this enzyme, in which marked inhibition by substrate and product was observed. Riboflavin synthase (RS) catalyzes the last step of riboflavin biosynthesis in microorganisms and plants, which corresponds to the dismutation of two molecules of 6,7-dimethyl-8-ribityllumazine to yield one molecule of riboflavin and one moleculemore » of 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione. Owing to the absence of this enzyme in animals and the fact that most pathogenic bacteria show a strict dependence on riboflavin biosynthesis, RS has been proposed as a potential target for antimicrobial drug development. Eubacterial, fungal and plant RSs assemble as homotrimers lacking C{sub 3} symmetry. Each monomer can bind two substrate molecules, yet there is only one active site for the whole enzyme, which is located at the interface between two neighbouring chains. This work reports the crystallographic structure of RS from the pathogenic bacterium Brucella abortus (the aetiological agent of the disease brucellosis) in its apo form, in complex with riboflavin and in complex with two different product analogues, being the first time that the structure of an intact RS trimer with bound ligands has been solved. These crystal models support the hypothesis of enhanced flexibility in the particle and also highlight the role of the ligands in assembling the unique active site. Kinetic and binding studies were also performed to complement these findings. The structural and biochemical information generated may be useful for the rational design of novel RS inhibitors with antimicrobial activity.« less

  8. Identification and functional characterisation of an allene oxide synthase from grapevine (Vitis vinifera L. Sauvignon blanc).

    PubMed

    Dumin, Walftor; Rostas, Michael; Winefield, Christopher

    2018-06-01

    Jasmonic acid (JA) is known to be an important phytohormone that orchestrates plant defence mechanisms against a range of herbivores and pathogens. Studies have suggested allene oxide synthase (AOS; E.C 4.2.1.92), the first committed step in JA biosynthesis, is essential for JA biosynthesis, yet clear evidence of its role as a biosynthetic regulatory point is lacking, in the main due to conflicting results derived from transgenic studies. However other studies lend support to a biosynthetic regulatory role for AOS. These studies have suggested that certain amino acid substitutions can increase the biosynthetic capacity of the enzyme and consequently improve pathogen tolerance in plants. To explore the role of AOS in Grapevine we isolated and functionally characterised this enzyme for the first time from Vitis vinifera L. Sauvignon blanc. The cloned AOS consisted of a single 1563 bp open reading frame. Comparative sequence analysis showed that the cloned gene (VvAOS) was highly conserved compared to those from other species. Complementation of an Arabidopsis AOS null mutant (aos) with VvAOS recovered the male sterile mutant phenotype and confirmed its function. Transcript analysis showed that VvAOS was wound responsive in leaves and was detectable in most tissues, with the highest levels of transcript in the mesocarp (pulp) of mature berries. Sub-cellular localisation of the VvAOS protein indicated that VvAOS is associated with the chloroplast membrane. Unexpectedly high levels of VvAOS transcript in complemented aos lines did not lead to predicted increases in JA. We have functionally characterised the sole AOS from Grapevine. Patterns of transcript accumulation in grapevine suggest roles in growth, development as well as an important role for JA in fruit ripening. Expression of VvAOS in Arabidopsis suggest complex epigenetic interactions between transgenic and endogenous AOS alleles, providing a possible explanation for why transgenic studies of AOS have delivered conflicting data pointing to a questionable role of AOS as a key regulatory point in JA biosynthesis.

  9. Natural Mutations in Streptococcus agalactiae Resulting in Abrogation of β Antigen Production

    PubMed Central

    Vasilyeva, Anastasia; Santos Sanches, Ilda; Florindo, Carlos; Dmitriev, Alexander

    2015-01-01

    Streptococcus agalactiae genome encodes 21 two-component systems (TCS) and a variety of regulatory proteins in order to control gene expression. One of the TCS, BgrRS, comprising the BgrR DNA-binding regulatory protein and BgrS sensor histidine kinase, was discovered within a putative virulence island. BgrRS influences cell metabolism and positively control the expression of bac gene, coding for β antigen at transcriptional level. Inactivation of bgrR abrogated bac gene expression and increased virulence properties of S. agalactiae. In this study, a total of 140 strains were screened for the presence of bac gene, and the TCS bgrR and bgrS genes. A total of 53 strains carried the bac, bgrR and bgrS genes. Most of them (48 strains) expressed β antigen, while five strains did not express β antigen. Three strains, in which bac gene sequence was intact, while bgrR and/or bgrS genes had mutations, and expression of β antigen was absent, were complemented with a constructed plasmid pBgrRS(P) encoding functionally active bgrR and bgrS gene alleles. This procedure restored expression of β antigen indicating the crucial regulatory role of TCS BgrRS. The complemented strain A49V/BgrRS demonstrated attenuated virulence in intraperitoneal mice model of S. agalactiae infection compared to parental strain A49V. In conclusion we showed that disruption of β antigen expression is associated with: i) insertion of ISSa4 upstream the bac gene just after the ribosomal binding site; ii) point mutation G342A resulting a stop codon TGA within the bac gene and a truncated form of β antigen; iii) single deletion (G) in position 439 of the bgrR gene resulting in a frameshift and the loss of DNA-binding domain of the BgrR protein, and iv) single base substitutions in bgrR and bgrS genes causing single amino acid substitutions in BgrR (Arg187Lys) and BgrS (Arg252Gln). The fact that BgrRS negatively controls virulent properties of S. agalactiae gives a novel clue for understanding of S. agalactiae adaptation to the human. PMID:26047354

  10. Natural Mutations in Streptococcus agalactiae Resulting in Abrogation of β Antigen Production.

    PubMed

    Vasilyeva, Anastasia; Santos Sanches, Ilda; Florindo, Carlos; Dmitriev, Alexander

    2015-01-01

    Streptococcus agalactiae genome encodes 21 two-component systems (TCS) and a variety of regulatory proteins in order to control gene expression. One of the TCS, BgrRS, comprising the BgrR DNA-binding regulatory protein and BgrS sensor histidine kinase, was discovered within a putative virulence island. BgrRS influences cell metabolism and positively control the expression of bac gene, coding for β antigen at transcriptional level. Inactivation of bgrR abrogated bac gene expression and increased virulence properties of S. agalactiae. In this study, a total of 140 strains were screened for the presence of bac gene, and the TCS bgrR and bgrS genes. A total of 53 strains carried the bac, bgrR and bgrS genes. Most of them (48 strains) expressed β antigen, while five strains did not express β antigen. Three strains, in which bac gene sequence was intact, while bgrR and/or bgrS genes had mutations, and expression of β antigen was absent, were complemented with a constructed plasmid pBgrRS(P) encoding functionally active bgrR and bgrS gene alleles. This procedure restored expression of β antigen indicating the crucial regulatory role of TCS BgrRS. The complemented strain A49V/BgrRS demonstrated attenuated virulence in intraperitoneal mice model of S. agalactiae infection compared to parental strain A49V. In conclusion we showed that disruption of β antigen expression is associated with: i) insertion of ISSa4 upstream the bac gene just after the ribosomal binding site; ii) point mutation G342A resulting a stop codon TGA within the bac gene and a truncated form of β antigen; iii) single deletion (G) in position 439 of the bgrR gene resulting in a frameshift and the loss of DNA-binding domain of the BgrR protein, and iv) single base substitutions in bgrR and bgrS genes causing single amino acid substitutions in BgrR (Arg187Lys) and BgrS (Arg252Gln). The fact that BgrRS negatively controls virulent properties of S. agalactiae gives a novel clue for understanding of S. agalactiae adaptation to the human.

  11. Novel Two-Component System of Streptococcus sanguinis Affecting Functions Associated with Viability in Saliva and Biofilm Formation.

    PubMed

    Camargo, Tarsila M; Stipp, Rafael N; Alves, Lívia A; Harth-Chu, Erika N; Höfling, José F; Mattos-Graner, Renata O

    2018-04-01

    Streptococcus sanguinis is a pioneer species of teeth and a common opportunistic pathogen of infective endocarditis. In this study, we identified a two-component system, S. sanguinis SptRS (SptRS Ss ), affecting S. sanguinis survival in saliva and biofilm formation. Isogenic mutants of sptR Ss (SKsptR) and sptS Ss (SKsptS) showed reduced cell counts in ex vivo assays of viability in saliva compared to those of parent strain SK36 and complemented mutants. Reduced counts of the mutants in saliva were associated with reduced growth rates in nutrient-poor medium (RPMI) and increased susceptibility to the deposition of C3b and the membrane attach complex (MAC) of the complement system, a defense component of saliva and serum. Conversely, sptR Ss and sptS Ss mutants showed increased biofilm formation associated with higher levels of production of H 2 O 2 and extracellular DNA. Reverse transcription-quantitative PCR (RT-qPCR) comparisons of strains indicated a global role of SptRS Ss in repressing genes for H 2 O 2 production (2.5- to 15-fold upregulation of spxB , spxR , vicR , tpk , and ackA in sptR Ss and sptS Ss mutants), biofilm formation, and/or evasion of host immunity (2.1- to 11.4-fold upregulation of srtA , pcsB , cwdP , iga , and nt5e ). Compatible with the homology of SptR Ss with AraC-type regulators, duplicate to multiple conserved repeats were identified in 1,000-bp regulatory regions of downstream genes, suggesting that SptR Ss regulates transcription by DNA looping. Significant transcriptional changes in the regulatory genes vicR , spxR , comE , comX , and mecA in the sptR Ss and sptS Ss mutants further indicated that SptRS Ss is part of a regulatory network that coordinates cell wall homeostasis, H 2 O 2 production, and competence. This study reveals that SptRS Ss is involved in the regulation of crucial functions for S. sanguinis persistence in the oral cavity. Copyright © 2018 American Society for Microbiology.

  12. RNAi-Dependent and Independent Control of LINE1 Accumulation and Mobility in Mouse Embryonic Stem Cells

    PubMed Central

    Ciaudo, Constance; Jay, Florence; Okamoto, Ikuhiro; Chen, Chong-Jian; Sarazin, Alexis; Servant, Nicolas; Barillot, Emmanuel; Heard, Edith; Voinnet, Olivier

    2013-01-01

    In most mouse tissues, long-interspersed elements-1 (L1s) are silenced via methylation of their 5′-untranslated regions (5′-UTR). A gradual loss-of-methylation in pre-implantation embryos coincides with L1 retrotransposition in blastocysts, generating potentially harmful mutations. Here, we show that Dicer- and Ago2-dependent RNAi restricts L1 accumulation and retrotransposition in undifferentiated mouse embryonic stem cells (mESCs), derived from blastocysts. RNAi correlates with production of Dicer-dependent 22-nt small RNAs mapping to overlapping sense/antisense transcripts produced from the L1 5′-UTR. However, RNA-surveillance pathways simultaneously degrade these transcripts and, consequently, confound the anti-L1 RNAi response. In Dicer−/− mESC complementation experiments involving ectopic Dicer expression, L1 silencing was rescued in cells in which microRNAs remained strongly depleted. Furthermore, these cells proliferated and differentiated normally, unlike their non-complemented counterparts. These results shed new light on L1 biology, uncover defensive, in addition to regulatory roles for RNAi, and raise questions on the differentiation defects of Dicer−/− mESCs. PMID:24244175

  13. Porcine Knock-in Fibroblasts Expressing hDAF on α-1,3-Galactosyltransferase (GGTA1) Gene Locus.

    PubMed

    Kim, Ji Woo; Kim, Hye-Min; Lee, Sang Mi; Kang, Man-Jong

    2012-10-01

    The Galactose-α1,3-galactose (α1,3Gal) epitope is responsible for hyperacute rejection in pig-to-human xenotransplantation. Human decay-accelerating factor (hDAF) is a cell surface regulatory protein that serves as a complement inhibitor to protect self cells from complement attack. The generation of α1,3-galactosyltransferase (GGTA1) knock-out pigs expressing DAF is a necessary step for their use as organ donors for humans. In this study, we established GGTA1 knock-out cell lines expressing DAF from pig ear fibroblasts for somatic cell nuclear transfer. hDAF expression was detected in hDAF knock-in heterozygous cells, but not in normal pig cells. Expression of the GGTA1 gene was lower in the knock-in heterozygous cell line compared to the normal pig cell. Knock-in heterozygous cells afforded more effective protection against cytotoxicity with human serum than with GGTA1 knock-out heterozygous and control cells. These cell lines may be used in the production of GGTA1 knock-out and DAF expression pigs for xenotransplantation.

  14. Visualization of protein interactions in living Drosophila embryos by the bimolecular fluorescence complementation assay.

    PubMed

    Hudry, Bruno; Viala, Séverine; Graba, Yacine; Merabet, Samir

    2011-01-28

    Protein interactions control the regulatory networks underlying developmental processes. The understanding of developmental complexity will, therefore, require the characterization of protein interactions within their proper environment. The bimolecular fluorescence complementation (BiFC) technology offers this possibility as it enables the direct visualization of protein interactions in living cells. However, its potential has rarely been applied in embryos of animal model organisms and was only performed under transient protein expression levels. Using a Hox protein partnership as a test case, we investigated the suitability of BiFC for the study of protein interactions in the living Drosophila embryo. Importantly, all BiFC parameters were established with constructs that were stably expressed under the control of endogenous promoters. Under these physiological conditions, we showed that BiFC is specific and sensitive enough to analyse dynamic protein interactions. We next used BiFC in a candidate interaction screen, which led to the identification of several Hox protein partners. Our results establish the general suitability of BiFC for revealing and studying protein interactions in their physiological context during the rapid course of Drosophila embryonic development.

  15. [Regulatory T cells].

    PubMed

    Marinić, Igor; Gagro, Alenka; Rabatić, Sabina

    2006-12-01

    Regulatory T-cells are a subset of T cells that have beene extensively studied in modern immunology. They are important for the maintenance of peripheral tolerance, and have an important role in various clinical conditions such as allergy, autoimmune disorders, tumors, infections, and in transplant medicine. Basically, this population has a suppressive effect on the neighboring immune cells, thus contributing to the local modulation and control of immune response. There are two main populations of regulatory T cells - natural regulatory T cells, which form a distinct cellular lineage, develop in thymus and perform their modulatory action through direct intercellular contact, along with the secreted cytokines; and inducible regulatory T cells, which develop in the periphery after contact with the antigen that is presented on the antigen presenting cell, and their primary mode of action is through the interleukin 10 (IL-10) and transforming growth factor beta (TGF-alpha) cytokines. Natural regulatory T cells are activated through T cell receptor after contact with specific antigen and inhibit proliferation of other T cells in an antigen independent manner. One of the major difficulties in the research of regulatory T cells is the lack of specific molecular markers that would identify these cells. Natural regulatory T cells constitutively express surface molecule CD25, but many other surface and intracellular molecules (HLA-DR, CD122, CD45RO, CD62, CTLA-4, GITR, PD-1, Notch, FOXP3, etc.) are being investigated for further phenotypic characterization of these cells. Because regulatory T cells have an important role in establishing peripheral tolerance, their importance is manifested in a number of clinical conditions. In the IPEX syndrome (immunodysregulation, polyendocrinopathy and enteropathy, X-linked), which is caused by mutation in Foxp3 gene that influences the development and function of regulatory T cells, patients develop severe autoimmune reactions that involve autoimmune endocrine disorders (type 1 diabetes, thyroiditis), respiratory and nutritive allergy, eczema and severe infections. In different types of allergy (pollen allergy, dust mite, nutritive allergens, contact hypersensitivity, etc.) and autoimmune diseases (such as rheumatoid arthritis, multiple sclerosis and type 1 diabetes) a lower number or decreased functional capability of regulatory T cells have been described. In inflammatory conditions and infections, this cell population has an important task in restricting immune response and protecting the host from excessive damage. This ability of regulatory T cells can be used by some pathogens (Epstein Barr virus, Mycobacterium tuberculosis, Leishmania major, etc.) and tumor cells to avoid host response and therefore contribute to the development of some pathological conditions. The knowledge gained on the phenotype and function of regulatory T cells could be useful in many medical conditions. In allergy, autoimmune diseases and in transplant procedures in medicine it would be desirable to increase their function, thus to partially suppress the immune system activity. On the other hand, in some infections and tumors, it would be preferable to decrease the activity of regulatory T cells and boost the function of effector T cells. Regulatory T cells comprise a very active field of immunology, therefore monitoring and modulating of their activity is of great potential significance in a broad spectrum of clinical conditions. By developing and standardizing methods for their monitoring, it would be possible to follow additional parameters of certain clinical conditions and possibly utilize them in therapy.

  16. A UK medical devices regulator's perspective on registries.

    PubMed

    Wilkinson, John; Crosbie, Andy

    2016-04-01

    Registries are powerful tools to support manufacturers in the fulfilment of their obligations to perform post-market surveillance and post-market clinical follow-up of implantable medical devices. They are also a valuable resource for regulators in support of regulatory action as well as in providing information around the safety of new and innovative technologies. Registries can provide valuable information on the relative performance of both generic types and manufacturer's individual products and they complement other sources of information about device performance such as post-market clinical studies and adverse incident reporting. This paper describes the experience of the UK medical device regulator - the Medicines and Healthcare Products Regulatory Agency (MHRA) - of working with registries to monitor the safety and performance of medical devices. Based upon this experience, the authors identify a number of attributes for a registry which they consider to be key if the registry is to contribute effectively to the work of regulators on patient safety monitoring and medical device regulation.

  17. A cellular and regulatory map of the GABAergic nervous system of C. elegans

    PubMed Central

    Gendrel, Marie; Atlas, Emily G; Hobert, Oliver

    2016-01-01

    Neurotransmitter maps are important complements to anatomical maps and represent an invaluable resource to understand nervous system function and development. We report here a comprehensive map of neurons in the C. elegans nervous system that contain the neurotransmitter GABA, revealing twice as many GABA-positive neuron classes as previously reported. We define previously unknown glia-like cells that take up GABA, as well as 'GABA uptake neurons' which do not synthesize GABA but take it up from the extracellular environment, and we map the expression of previously uncharacterized ionotropic GABA receptors. We use the map of GABA-positive neurons for a comprehensive analysis of transcriptional regulators that define the GABA phenotype. We synthesize our findings of specification of GABAergic neurons with previous reports on the specification of glutamatergic and cholinergic neurons into a nervous system-wide regulatory map which defines neurotransmitter specification mechanisms for more than half of all neuron classes in C. elegans. DOI: http://dx.doi.org/10.7554/eLife.17686.001 PMID:27740909

  18. The identification of transcription factors expressed in the notochord of Ciona intestinalis adds new potential players to the Brachyury gene regulatory network

    PubMed Central

    José-Edwards, Diana S.; Kerner, Pierre; Kugler, Jamie E.; Deng, Wei; Jiang, Di; Di Gregorio, Anna

    2013-01-01

    The notochord is the distinctive characteristic of chordates; however, the knowledge of the complement of transcription factors governing the development of this structure is still incomplete. Here we present the expression patterns of seven transcription factor genes detected in the notochord of the ascidian Ciona intestinalis at various stages of embryonic development. Four of these transcription factors, Fos-a, NFAT5, AFF and Klf15, have not been directly associated with the notochord in previous studies, while the others, including Spalt-like-a, Lmx-like and STAT5/6-b, display evolutionarily conserved expression in this structure as well as in other domains. We examined the hierarchical relationships between these genes and the transcription factor Brachyury, which is necessary for notochord development in all chordates. We found that Ciona Brachyury regulates the expression of most, although not all, of these genes. These results shed light on the genetic regulatory program underlying notochord formation in Ciona and possibly other chordates. PMID:21594950

  19. WHO Expert Committee on Specifications for Pharmaceutical Preparations.

    PubMed

    2003-01-01

    This report presents the recommendations of an international group of experts convened by the World Health Organization to consider matters concerning the quality assurance of pharmaceuticals and specifications for drug substances and dosage forms. Of particular relevance to drug regulatory authorities and pharmaceutical manufacturers, the report discusses activities related to the development of The International Pharmacopoeia and basic tests for pharmaceutical substances and dosage forms, as well as quality control of reference materials, good manufacturing practices (GMP), stability studies, inspection, hazard analysis, procurement, storage and other aspects of quality assurance of pharmaceuticals, and regulatory issues. The report is complemented by a number of annexes, including recommendations on the risk of transmitting animal spongiform encephalopathy agents via medicinal products, guidelines on GMP for pharmaceutical products, a model certificate for GMP and guidance on a GMP inspection report. The final annexes provide guidance on the application of Hazard Analysis and Critical Control Point (HACCP) method to pharmaceuticals, good storage practices and a procedure for assessing acceptability of pharmaceutical products for purchase by United Nations agencies.

  20. Pull-down Assay to Characterize Ca2+/Calmodulin Binding to Plant Receptor Kinases.

    PubMed

    Kaufmann, Christine; Sauter, Margret

    2017-01-01

    Plant receptor-like kinases (RLKs) are regulated by posttranscriptional modification and by interaction with regulatory proteins. A common modification of RLKs is (auto)phosphorylation, and a common regulatory protein is the calcium sensor calmodulin (CaM). We have developed protocols to detect the interaction of an RLK with CaM. The interaction with CaM was shown by bimolecular fluorescence complementation (BiFC) (see Chapter 14) and pull-down assay (this chapter). Both methods offer unique advantages. BiFC is useful in showing interaction of soluble as well as of membrane-bound proteins in planta. Pull-down assays are restricted to soluble proteins and provide in vitro data. The pull-down assay provides the advantage that proteins can be modified prior to binding and that experimental conditions such as the concentration of Ca 2+ or other divalent cations can be controlled. This chapter provides a pull-down protocol to study RLK-CaM interaction with optional steps to investigate the impact of RLK phosphorylation or of Ca 2+ .

Top