Petrenko, Y M
2015-01-01
Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.
NASA Technical Reports Server (NTRS)
Kanavarioti, Anastassia
1992-01-01
A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.
Yusupov, Marat; Yusupova, Gulnara
2014-01-01
The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524
The presence of codon-anticodon pairs in the acceptor stem of tRNAs.
Rodin, S; Rodin, A; Ohno, S
1996-01-01
A total of 1268 available (excluding mitochondrial) tRNA sequences was used to reconstruct the common consensus image of their acceptor domains. Its structure appeared as a 11-bp-long double-stranded palindrome with complementary triplets in the center, each flanked by the 3'-ACCD and NGGU-5' motifs on each strand (D, base determinator). The palindrome readily extends up to the modern tRNA-like cloverleaf passing through an intermediate hairpin having in the center the single-stranded triplet, in supplement to its double-stranded precursor. The latter might represent an original anticodon-codon pair mapped at 1-2-3 positions of the present-day tRNA acceptors. This conclusion is supported by the striking correlation: in pairs of consensus tRNAs with complementary anticodons, their bases at the 2nd position of the acceptor stem were also complementary. Accordingly, inverse complementarity was also evident at the 71st position of the acceptor stem. With a single exception (tRNA(Phe)-tRNA(Glu) pair), the parallelism is especially impressive for the pairs of tRNAs recognized by aminoacyl-tRNA synthetases (aaRS) from the opposite classes. The above complementarity still doubly presented at the key central position of real single-stranded anticodons and their hypothetical double-stranded precursors is consistent with our previous data pointing to the double-strand use of ancient RNAs in the origin of the main actors in translation- tRNAs with complementary anticodons and the two classes of aaRS. Images Fig. 3 Table 2 Fig. 4 PMID:8643439
Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.
Calvet, J P; Meyer, L M; Pederson, T
1982-07-30
Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.
Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D
1984-06-19
The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
ERIC Educational Resources Information Center
Ianneo, Brittany
2014-01-01
Accommodation~assimilation relations were theorized by Kelso and Engstrom (2006) as independent and dependent complementary pairs. This study defined relationships between organisms that experienced complementary interactions of accommodation~assimilation in diverse ecologies designed with universal design for learning environments (UDLE) compared…
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Westhof, E; Sundaralingam, M
1980-01-01
The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
Rail-to-rail differential input amplification stage with main and surrogate differential pairs
Britton, Jr., Charles Lanier; Smith, Stephen Fulton
2007-03-06
An operational amplifier input stage provides a symmetrical rail-to-rail input common-mode voltage without turning off either pair of complementary differential input transistors. Secondary, or surrogate, transistor pairs assume the function of the complementary differential transistors. The circuit also maintains essentially constant transconductance, constant slew rate, and constant signal-path supply current as it provides rail-to-rail operation.
Interfacial Shear Strength and Adhesive Behavior of Silk Ionomer Surfaces.
Kim, Sunghan; Geryak, Ren D; Zhang, Shuaidi; Ma, Ruilong; Calabrese, Rossella; Kaplan, David L; Tsukruk, Vladimir V
2017-09-11
The interfacial shear strength between different layers in multilayered structures of layer-by-layer (LbL) microcapsules is a crucial mechanical property to ensure their robustness. In this work, we investigated the interfacial shear strength of modified silk fibroin ionomers utilized in LbL shells, an ionic-cationic pair with complementary ionic pairing, (SF)-poly-l-glutamic acid (Glu) and SF-poly-l-lysine (Lys), and a complementary pair with partially screened Coulombic interactions due to the presence of poly(ethylene glycol) (PEG) segments and SF-Glu/SF-Lys[PEG] pair. Shearing and adhesive behavior between these silk ionomer surfaces in the swollen state were probed at different spatial scales and pressure ranges by using functionalized atomic force microscopy (AFM) tips as well as functionalized colloidal probes. The results show that both approaches were consistent in analyzing the interfacial shear strength of LbL silk ionomers at different spatial scales from a nanoscale to a fraction of a micron. Surprisingly, the interfacial shear strength between SF-Glu and SF-Lys[PEG] pair with partially screened ionic pairing was greater than the interfacial shear strength of the SF-Glu and SF-Lys pair with a high density of complementary ionic groups. The difference in interfacial shear strength and adhesive strength is suggested to be predominantly facilitated by the interlayer hydrogen bonding of complementary amino acids and overlap of highly swollen PEG segments.
NASA Technical Reports Server (NTRS)
Orgel, Leslie
2000-01-01
It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.
Hughes, J M
1996-06-21
The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.
Patel, D J; Canuel, L L
1977-07-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.
Patel, Dinshaw J.; Canuel, Lita L.
1977-01-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613
In situ hybridization in paracoccidioidomycosis.
De Brito, T; Sandhu, G S; Kline, B C; Aleff, R A; Sandoval, M P; Santos, R T; Brandão, A A; Lacaz, C S
1999-06-01
In situ hybridization (ISH) was performed using oral biopsies from patients with paracoccidioidomycosis and guinea pig testes inoculated with a culture of Paracoccidioides brasiliensis isolated from soil, employing both a 14 base-pair specific oligoprobe (ACT CCC CCG TGG TC) and its complementary sequence. When combining ISH with the Gridley stain which detects fungal cell walls, about 2-3% of the fungal cells present in the tissues were labelled. When the complementary probe was used, labelling was higher, reaching the 3% level.
Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel
2004-12-01
Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.
2005-01-01
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487
2013-01-01
Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545
Complexes of oligo(poly)nucleotides with structural anomalies
NASA Astrophysics Data System (ADS)
Dolinnaya, N. G.; Gryaznova, O. I.
1989-08-01
The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Learners misperceive the benefits of redundant text in multimedia learning.
Fenesi, Barbara; Kim, Joseph A
2014-01-01
Research on metacognition has consistently demonstrated that learners fail to endorse instructional designs that produce benefits to memory, and often prefer designs that actually impair comprehension. Unlike previous studies in which learners were only exposed to a single multimedia design, the current study used a within-subjects approach to examine whether exposure to both redundant text and non-redundant text multimedia presentations improved learners' metacognitive judgments about presentation styles that promote better understanding. A redundant text multimedia presentation containing narration paired with verbatim on-screen text (Redundant) was contrasted with two non-redundant text multimedia presentations: (1) narration paired with images and minimal text (Complementary) or (2) narration paired with minimal text (Sparse). Learners watched presentation pairs of either Redundant + Complementary, or Redundant + Sparse. Results demonstrate that Complementary and Sparse presentations produced highest overall performance on the final comprehension assessment, but the Redundant presentation produced highest perceived understanding and engagement ratings. These findings suggest that learners misperceive the benefits of redundant text, even after direct exposure to a non-redundant, effective presentation.
Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji
2015-03-20
Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
ERIC Educational Resources Information Center
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
Xu, Rong; Wang, QuanQiu
2015-02-01
Anticancer drug-associated side effect knowledge often exists in multiple heterogeneous and complementary data sources. A comprehensive anticancer drug-side effect (drug-SE) relationship knowledge base is important for computation-based drug target discovery, drug toxicity predication and drug repositioning. In this study, we present a two-step approach by combining table classification and relationship extraction to extract drug-SE pairs from a large number of high-profile oncological full-text articles. The data consists of 31,255 tables downloaded from the Journal of Oncology (JCO). We first trained a statistical classifier to classify tables into SE-related and -unrelated categories. We then extracted drug-SE pairs from SE-related tables. We compared drug side effect knowledge extracted from JCO tables to that derived from FDA drug labels. Finally, we systematically analyzed relationships between anti-cancer drug-associated side effects and drug-associated gene targets, metabolism genes, and disease indications. The statistical table classifier is effective in classifying tables into SE-related and -unrelated (precision: 0.711; recall: 0.941; F1: 0.810). We extracted a total of 26,918 drug-SE pairs from SE-related tables with a precision of 0.605, a recall of 0.460, and a F1 of 0.520. Drug-SE pairs extracted from JCO tables is largely complementary to those derived from FDA drug labels; as many as 84.7% of the pairs extracted from JCO tables have not been included a side effect database constructed from FDA drug labels. Side effects associated with anticancer drugs positively correlate with drug target genes, drug metabolism genes, and disease indications. Copyright © 2014 Elsevier Inc. All rights reserved.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.
Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D
2014-05-01
The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.
USDA-ARS?s Scientific Manuscript database
Complementary b/y fragment ion pairs from post-source decay (PSD) of metastable YahO protein ion were evaluated for use in the calibration of MALDI-TOF-TOF for tandem mass spectrometry (MS/MS). The yahO gene from pathogenic Escherichia coli O157:H7 strain EDL933 was cloned into a pBAD18 plasmid vect...
Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes
Watkins, Norman E.; SantaLucia, John
2005-01-01
Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087
NASA Technical Reports Server (NTRS)
Pryor, Richard Lee (Inventor)
1977-01-01
A line driver including a pair of complementary transistors having their conduction paths serially connected between an operating and a reference potential and their bases connected through a first switch to a signal input terminal. A second switch is connected between the common base connection and the common connection of the conduction paths. With the second switch open and the first closed, an output voltage, responsive to the input signal, corresponding to first or second binary values is obtained. When the second switch is closed and the first opened, the transistor pair is turned off, disconnecting the line driver from its load, thereby providing tri-state logic operation.
Interface Circuits for Self-Checking Microprocessors
NASA Technical Reports Server (NTRS)
Rennels, D. A.; Chandramouli, R.
1986-01-01
Fault-tolerant-microcomputer concept based on enhancing "simple" computer with redundancy and self-checking logic circuits detect hardware faults. Interface and checking logic and redundant processors confer on 16-bit microcomputer ability to check itself for hardware faults. Checking circuitry also checks itself. Concept of self-checking complementary pairs (SCCP's) employed throughout ICL unit.
Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A
2018-01-25
Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.
Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C
1998-03-03
The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.
Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude
1998-01-01
The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926
Binding of DNA hairpins to an assembler-strand as part of a primordial translation device
NASA Astrophysics Data System (ADS)
Baumann, Ulrich
1987-09-01
A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.
One size does not fit all: older adults benefit from redundant text in multimedia instruction
Fenesi, Barbara; Vandermorris, Susan; Kim, Joseph A.; Shore, David I.; Heisz, Jennifer J.
2015-01-01
The multimedia design of presentations typically ignores that younger and older adults have varying cognitive strengths and weaknesses. We examined whether differential instructional design may enhance learning in these populations. Younger and older participants viewed one of three computer-based presentations: Audio only (narration), Redundant (audio narration with redundant text), or Complementary (audio narration with non-redundant text and images). Younger participants learned better when audio narration was paired with relevant images compared to when audio narration was paired with redundant text. However, older participants learned best when audio narration was paired with redundant text. Younger adults, who presumably have a higher working memory capacity (WMC), appear to benefit more from complementary information that may drive deeper conceptual processing. In contrast, older adults learn better from presentations that support redundant coding across modalities, which may help mitigate the effects of age-related decline in WMC. Additionally, several misconceptions of design quality appeared across age groups: both younger and older participants positively rated less effective designs. Findings suggest that one-size does not fit all, with older adults requiring unique multimedia design tailored to their cognitive abilities for effective learning. PMID:26284000
One size does not fit all: older adults benefit from redundant text in multimedia instruction.
Fenesi, Barbara; Vandermorris, Susan; Kim, Joseph A; Shore, David I; Heisz, Jennifer J
2015-01-01
The multimedia design of presentations typically ignores that younger and older adults have varying cognitive strengths and weaknesses. We examined whether differential instructional design may enhance learning in these populations. Younger and older participants viewed one of three computer-based presentations: Audio only (narration), Redundant (audio narration with redundant text), or Complementary (audio narration with non-redundant text and images). Younger participants learned better when audio narration was paired with relevant images compared to when audio narration was paired with redundant text. However, older participants learned best when audio narration was paired with redundant text. Younger adults, who presumably have a higher working memory capacity (WMC), appear to benefit more from complementary information that may drive deeper conceptual processing. In contrast, older adults learn better from presentations that support redundant coding across modalities, which may help mitigate the effects of age-related decline in WMC. Additionally, several misconceptions of design quality appeared across age groups: both younger and older participants positively rated less effective designs. Findings suggest that one-size does not fit all, with older adults requiring unique multimedia design tailored to their cognitive abilities for effective learning.
Insights into DNA-mediated interparticle interactions from a coarse-grained model
NASA Astrophysics Data System (ADS)
Ding, Yajun; Mittal, Jeetain
2014-11-01
DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.
Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David
2016-01-11
We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin
2015-09-01
In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.
Negash, Canaan; Belachew, Tefera; Henry, Carol J; Kebebu, Afework; Abegaz, Kebede; Whiting, Susan J
2014-12-01
Nutritious complementary foods are needed in countries where undernutrition and stunting are major problems, but mothers may be reluctant to change from traditional gruels. To test whether a recipe-based complementary feeding education intervention would improve knowledge and practice of mothers with young children in Hula, Ethiopia. A baseline survey of 200 eligible, randomly selected mother-child pairs gathered data on sociodemographic characteristics, food security status, knowledge and practices concerning complementary feeding, food group intakes of children aged 6 to 23 months by 24-hour recalls, and children's anthropometric measurements. Twice a month for 6 months, women in the intervention group received an education session consisting of eight specific messages using Alive and Thrive posters and a demonstration and tasting of a local barley and maize porridge recipe containing 30% broad beans. The control group lived in a different area and had no intervention. At 6 months, knowledge and practice scores regarding complementary feeding were significantly improved (p < .001) in the intervention group but not in the control group. The intervention resulted in improvement of children's dietary diversity, as well as mean intake of energy and selected nutrients, compared with children in the control group. Changes in height and weight did not differ between the two groups. Community-based nutrition education over 6 months that included demonstration of a local porridge recipe with broad beans added improved the complementary feeding practices of caregivers and the nutritional status of their young children.
AWG Filter for Wavelength Interrogator
NASA Technical Reports Server (NTRS)
Black, Richard J. (Inventor); Costa, Joannes M. (Inventor); Moslehi, Behzad (Inventor); Sotoudeh, Vahid (Inventor); Faridian, Fereydoun (Inventor)
2015-01-01
A wavelength interrogator is coupled to a circulator which couples optical energy from a broadband source to an optical fiber having a plurality of sensors, each sensor reflecting optical energy at a unique wavelength and directing the reflected optical energy to an AWG. The AWG has a detector coupled to each output, and the reflected optical energy from each grating is coupled to the skirt edge response of the AWG such that the adjacent channel responses form a complementary pair response. The complementary pair response is used to convert an AWG skirt response to a wavelength.
Combined Feature Based and Shape Based Visual Tracker for Robot Navigation
NASA Technical Reports Server (NTRS)
Deans, J.; Kunz, C.; Sargent, R.; Park, E.; Pedersen, L.
2005-01-01
We have developed a combined feature based and shape based visual tracking system designed to enable a planetary rover to visually track and servo to specific points chosen by a user with centimeter precision. The feature based tracker uses invariant feature detection and matching across a stereo pair, as well as matching pairs before and after robot movement in order to compute an incremental 6-DOF motion at each tracker update. This tracking method is subject to drift over time, which can be compensated by the shape based method. The shape based tracking method consists of 3D model registration, which recovers 6-DOF motion given sufficient shape and proper initialization. By integrating complementary algorithms, the combined tracker leverages the efficiency and robustness of feature based methods with the precision and accuracy of model registration. In this paper, we present the algorithms and their integration into a combined visual tracking system.
The colour preference control based on two-colour combinations
NASA Astrophysics Data System (ADS)
Hong, Ji Young; Kwak, Youngshin; Park, Du-Sik; Kim, Chang Yeong
2008-02-01
This paper proposes a framework of colour preference control to satisfy the consumer's colour related emotion. A colour harmony algorithm based on two-colour combinations is developed for displaying the images with several complementary colour pairs as the relationship of two-colour combination. The colours of pixels belonging to complementary colour areas in HSV colour space are shifted toward the target hue colours and there is no colour change for the other pixels. According to the developed technique, dynamic emotions by the proposed hue conversion can be improved and the controlled output image shows improved colour emotions in the preference of the human viewer. The psychophysical experiments are conducted to investigate the optimal model parameters to produce the most pleasant image to the users in the respect of colour emotions.
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid
Hardman, Norman
1974-01-01
Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738
Doubletalk: A Literary Pairing of "The Giver" and "We Are All in the Dumps with Jack and Guy."
ERIC Educational Resources Information Center
Lehman, Barbara A.; Crook, Patricia R.
1998-01-01
Pairs two books that might stimulate children's literary awareness--Lois Lowry's fantasy novel, "The Giver," and Maurice Sendak's picture book, "We Are All in the Dumps with Jack and Guy." Finds that the pairing and comparisons increased understandings about each work and how complementary they really are. (PA)
Study on recognition technology of complementary image
NASA Astrophysics Data System (ADS)
Liu, Chengxiang; Hu, Xuejuan; Jian, Yaobo; Zhang, Li
2006-11-01
Complementation image is often used as a guard technology in the trademark and paper currency. The key point of recognizing this kind of images is judging the complementary effect of complementation printing. The perspective images are usually not clear and legible, so it is difficult to recognize them. In this paper, a new method is proposed. Firstly, capture the image by reflex. Secondly, find the same norm to man-made pair printing. Lastly, judge the true and false of paper currency by the complementary effect of complementation printing. This is the purpose of inspecting the false. Theoretic analysis and simulation results reveal that the effect of man-made pair printing is good, the method has advantages such as simplicity, high calculating speed, and good robust to different RMB. The experiment results reveal that the conclusion is reasonable, and demonstrates that this approach is effective.
CMOS-based carbon nanotube pass-transistor logic integrated circuits
Ding, Li; Zhang, Zhiyong; Liang, Shibo; Pei, Tian; Wang, Sheng; Li, Yan; Zhou, Weiwei; Liu, Jie; Peng, Lian-Mao
2012-01-01
Field-effect transistors based on carbon nanotubes have been shown to be faster and less energy consuming than their silicon counterparts. However, ensuring these advantages are maintained for integrated circuits is a challenge. Here we demonstrate that a significant reduction in the use of field-effect transistors can be achieved by constructing carbon nanotube-based integrated circuits based on a pass-transistor logic configuration, rather than a complementary metal-oxide semiconductor configuration. Logic gates are constructed on individual carbon nanotubes via a doping-free approach and with a single power supply at voltages as low as 0.4 V. The pass-transistor logic configurarion provides a significant simplification of the carbon nanotube-based circuit design, a higher potential circuit speed and a significant reduction in power consumption. In particular, a full adder, which requires a total of 28 field-effect transistors to construct in the usual complementary metal-oxide semiconductor circuit, uses only three pairs of n- and p-field-effect transistors in the pass-transistor logic configuration. PMID:22334080
Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs
Lee, Alex H. F.; Kool, Eric T.
2008-01-01
A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396
Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.
Nakano, Shu-ichi; Sugimoto, Naoki
2014-08-05
The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Hesemann, Peter; Nguyen, Thy Phung; Hankari, Samir El
2014-04-11
The synthesis of nanostructured anionic-surfactant-templated mesoporous silica (AMS) recently appeared as a new strategy for the formation of nanostructured silica based materials. This method is based on the use of anionic surfactants together with a co-structure-directing agent (CSDA), mostly a silylated ammonium precursor. The presence of this CSDA is necessary in order to create ionic interactions between template and silica forming phases and to ensure sufficient affinity between the two phases. This synthetic strategy was for the first time applied in view of the synthesis of surface functionalized silica bearing ammonium groups and was then extended on the formation of materials functionalized with anionic carboxylate and bifunctional amine-carboxylate groups. In the field of silica hybrid materials, the "anionic templating" strategy has recently been applied for the synthesis of silica hybrid materials from cationic precursors. Starting from di- or oligosilylated imidazolium and ammonium precursors, only template directed hydrolysis-polycondensation reactions involving complementary anionic surfactants allowed accessing structured ionosilica hybrid materials. The mechanistic particularity of this approach resides in the formation of precursor-surfactant ion pairs in the hydrolysis-polycondensation mixture. This review gives a systematic overview over the various types of materials accessed from this cooperative ionic templating approach and highlights the high potential of this original strategy for the formation of nanostructured silica based materials which appears as a complementary strategy to conventional soft templating approaches.
Distillation of multipartite entanglement by complementary stabilizer measurements.
Miyake, Akimasa; Briegel, Hans J
2005-11-25
We propose a scheme of multipartite entanglement distillation driven by a complementary pair of stabilizer measurements to distill directly a wider range of states beyond the stabilizer code states (such as the Greenberger-Horne-Zeilinger states). We make our idea explicit by constructing a recurrence protocol for the 3-qubit state [formula: see text]. Noisy states resulting from typical decoherence can be directly purified in a few steps, if their initial fidelity is larger than a threshold. For general input mixed states, we observe distillations to hierarchical fixed points, i.e., not only to the state but also to the 2-qubit Bell pair, depending on their initial entanglement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, X.; Patel, D.J.
The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H/sub 2/O and D/sub 2/O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding themore » dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
An Experimental Study of the Emergence of Human Communication Systems
ERIC Educational Resources Information Center
Galantucci, Bruno
2005-01-01
The emergence of human communication systems is typically investigated via 2 approaches with complementary strengths and weaknesses: naturalistic studies and computer simulations. This study was conducted with a method that combines these approaches. Pairs of participants played video games requiring communication. Members of a pair were…
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
NASA Astrophysics Data System (ADS)
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
Goncharova, Iryna
2014-01-24
Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag(+) ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5'-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Goncharova, Iryna
2014-01-01
Ag(I)-containing compounds are attractive as antibacterial and antifungal agents. The renewed interest in the application of silver(I) compounds has led to the need for detailed knowledge of the mechanism of their action. One of the possible ways is the coordination of Ag(I) to G-C pairs of DNA, where Ag+ ions form Ag(I)-mediated base pairs and inhibit the transcription. Herein, a systematic chiroptical study on silver(I)-mediated homo and mixed pairs of the C-G complementary-base derivatives cytidine(C) and 5‧-guanosine monophosphate(G) in water is presented. Ag(I)-mediated homo and hetero pairs of G and C and their self-assembled species were studied under two pH levels (7.0 and 10.0) by vibrational (VCD) and electronic circular dichroism(ECD). VCD was used for the first time in this field and showed itself to be a powerful method for obtaining specific structural information in solution. Based on results of the VCD experiments, the different geometries of the homo pairs were proposed under pH 7.0 and 10.0. ECD was used as a diagnostic tool to characterize the studied systems and as a contact point between the previously defined structures of the metal or proton mediated pairs of nucleobases and the systems studied here. On the basis of the obtained data, the formation of the self-assembled species of cytidine with a structure similar to the i-motif structure in DNA was proposed at pH 10.0.
Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad
2018-04-29
A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.
Krumm, Sabine; Kivisaari, Sasa L; Monsch, Andreas U; Reinhardt, Julia; Ulmer, Stephan; Stippich, Christoph; Kressig, Reto W; Taylor, Kirsten I
2017-05-01
The parietal lobe is important for successful recognition memory, but its role is not yet fully understood. We investigated the parietal lobes' contribution to immediate paired-associate memory and delayed item-recognition memory separately for hits (targets) and correct rejections (distractors). We compared the behavioral performance of 56 patients with known parietal and medial temporal lobe dysfunction (i.e. early Alzheimer's Disease) to 56 healthy control participants in an immediate paired and delayed single item object memory task. Additionally, we performed voxel-based morphometry analyses to investigate the functional-neuroanatomic relationships between performance and voxel-based estimates of atrophy in whole-brain analyses. Behaviorally, all participants performed better identifying targets than rejecting distractors. The voxel-based morphometry analyses associated atrophy in the right ventral parietal cortex with fewer correct responses to familiar items (i.e. hits) in the immediate and delayed conditions. Additionally, medial temporal lobe integrity correlated with better performance in rejecting distractors, but not in identifying targets, in the immediate paired-associate task. Our findings suggest that the parietal lobe critically supports successful immediate and delayed target recognition memory, and that the ventral aspect of the parietal cortex and the medial temporal lobe may have complementary preferences for identifying targets and rejecting distractors, respectively, during recognition memory. Copyright © 2017. Published by Elsevier Inc.
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity
Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.
2016-01-01
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Orthogonal Luciferase-Luciferin Pairs for Bioluminescence Imaging.
Jones, Krysten A; Porterfield, William B; Rathbun, Colin M; McCutcheon, David C; Paley, Miranda A; Prescher, Jennifer A
2017-02-15
Bioluminescence imaging with luciferase-luciferin pairs is widely used in biomedical research. Several luciferases have been identified in nature, and many have been adapted for tracking cells in whole animals. Unfortunately, the optimal luciferases for imaging in vivo utilize the same substrate and therefore cannot easily differentiate multiple cell types in a single subject. To develop a broader set of distinguishable probes, we crafted custom luciferins that can be selectively processed by engineered luciferases. Libraries of mutant enzymes were iteratively screened with sterically modified luciferins, and orthogonal enzyme-substrate "hits" were identified. These tools produced light when complementary enzyme-substrate partners interacted both in vitro and in cultured cell models. Based on their selectivity, these designer pairs will bolster multicomponent imaging and enable the direct interrogation of cell networks not currently possible with existing tools. Our screening platform is also general and will expedite the identification of more unique luciferases and luciferins, further expanding the bioluminescence toolkit.
Hesemann, Peter; Nguyen, Thy Phung; Hankari, Samir El
2014-01-01
The synthesis of nanostructured anionic-surfactant-templated mesoporous silica (AMS) recently appeared as a new strategy for the formation of nanostructured silica based materials. This method is based on the use of anionic surfactants together with a co-structure-directing agent (CSDA), mostly a silylated ammonium precursor. The presence of this CSDA is necessary in order to create ionic interactions between template and silica forming phases and to ensure sufficient affinity between the two phases. This synthetic strategy was for the first time applied in view of the synthesis of surface functionalized silica bearing ammonium groups and was then extended on the formation of materials functionalized with anionic carboxylate and bifunctional amine-carboxylate groups. In the field of silica hybrid materials, the “anionic templating” strategy has recently been applied for the synthesis of silica hybrid materials from cationic precursors. Starting from di- or oligosilylated imidazolium and ammonium precursors, only template directed hydrolysis-polycondensation reactions involving complementary anionic surfactants allowed accessing structured ionosilica hybrid materials. The mechanistic particularity of this approach resides in the formation of precursor-surfactant ion pairs in the hydrolysis-polycondensation mixture. This review gives a systematic overview over the various types of materials accessed from this cooperative ionic templating approach and highlights the high potential of this original strategy for the formation of nanostructured silica based materials which appears as a complementary strategy to conventional soft templating approaches. PMID:28788602
2011-01-01
Background Available measures of patient-reported outcomes for complementary and alternative medicine (CAM) inadequately capture the range of patient-reported treatment effects. The Self-Assessment of Change questionnaire was developed to measure multi-dimensional shifts in well-being for CAM users. With content derived from patient narratives, items were subsequently focused through interviews on a new cohort of participants. Here we present the development of the final version in which the content and format is refined through cognitive interviews. Methods We conducted cognitive interviews across five iterations of questionnaire refinement with a culturally diverse sample of 28 CAM users. In each iteration, participant critiques were used to revise the questionnaire, which was then re-tested in subsequent rounds of cognitive interviews. Following all five iterations, transcripts of cognitive interviews were systematically coded and analyzed to examine participants' understanding of the format and content of the final questionnaire. Based on this data, we established summary descriptions and selected exemplar quotations for each word pair on the final questionnaire. Results The final version of the Self-Assessment of Change questionnaire (SAC) includes 16 word pairs, nine of which remained unchanged from the original draft. Participants consistently said that these stable word pairs represented opposite ends of the same domain of experience and the meanings of these terms were stable across the participant pool. Five pairs underwent revision and two word pairs were added. Four word pairs were eliminated for redundancy or because participants did not agree on the meaning of the terms. Cognitive interviews indicate that participants understood the format of the questionnaire and considered each word pair to represent opposite poles of a shared domain of experience. Conclusions We have placed lay language and direct experience at the center of questionnaire revision and refinement. In so doing, we provide an innovative model for the development of truly patient-centered outcome measures. Although this instrument was designed and tested in a CAM-specific population, it may be useful in assessing multi-dimensional shifts in well-being across a broader patient population. PMID:22206409
[DNA structure from A to Z--biological implications of structural diversity of DNA].
Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A
2006-01-01
Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.
2004-01-01
With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225
Leblanc, N; Cortey, M; Fernandez Pinero, J; Gallardo, C; Masembe, C; Okurut, A R; Heath, L; van Heerden, J; Sánchez-Vizcaino, J M; Ståhl, K; Belák, S
2013-08-01
African swine fever virus (ASFV) causes one of the most dreaded transboundary animal diseases (TADs) in Suidae. African swine fever (ASF) often causes high rates of morbidity and mortality, which can reach 100% in domestic swine. To date, serological diagnosis has the drawback of not being able to differentiate variants of this virus. Previous studies have identified the 22 genotypes based on sequence variation in the C-terminal region of the p72 gene, which has become the standard for categorizing ASFVs. This article describes a genotyping assay developed using a segment of PCR-amplified genomic DNA of approximately 450 bp, which encompasses the C-terminal end of the p72 gene. Complementary paired DNA probes of 15 or 17 bp in length, which are identical except for a single nucleotide polymorphism (SNP) in the central position, were designed to either individually or in combination differentiate between the 22 genotypes. The assay was developed using xMAP technology; probes were covalently linked to microspheres, hybridized to PCR product, labelled with a reporter and read in the Luminex 200 analyzer. Characterization of the sample was performed by comparing fluorescence of the paired SNP probes, that is, the probe with higher fluorescence in a complementary pair identified the SNP that a particular sample possessed. In the final assay, a total of 52 probes were employed, 24 SNP pairs and 4 for general detection. One or more samples from each of the 22 genotypes were tested. The assay was able to detect and distinguish all 22 genotypes. This novel assay provides a powerful novel tool for the simultaneous rapid diagnosis and genotypic differentiation of ASF. © 2012 Blackwell Verlag GmbH.
The energetic basis of the DNA double helix: a combined microcalorimetric approach
Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.
2015-01-01
Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541
NASA Technical Reports Server (NTRS)
Give'on, Amir; Kern, Brian D.; Shaklan, Stuart
2011-01-01
In this paper we describe the complex electric field reconstruction from image plane intensity measurements for high contrast coronagraphic imaging. A deformable mirror (DM) surface is modied with pairs of complementary shapes to create diversity in the image plane of the science camera where the intensity of the light is measured. Along with the Electric Field Conjugation correction algorithm, this estimation method has been used in various high contrast imaging testbeds to achieve the best contrasts to date both in narrow and in broad band light. We present the basic methodology of estimation in easy to follow list of steps, present results from HCIT and raise several open quations we are confronted with using this method.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.
Kirillova, Svetlana; Carugo, Oliviero
2011-10-19
Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures
2011-01-01
Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
Xie, Duoli; Shi, Tieliu; Wen, Chengping
2017-01-01
Traditional Chinese Medicine (TCM) has been widely used as a complementary medicine in Acute Myeloid Leukemia (AML) treatment. In this study, we proposed a new classification of Chinese Medicines (CMs) by integrating the latest discoveries in disease molecular mechanisms and traditional medicine theory. We screened out a set of chemical compounds on basis of AML differential expression genes and chemical-protein interactions and then mapped them to Traditional Chinese Medicine Integrated Database. 415 CMs contain those compounds and they were categorized into 8 groups according to the Traditional Chinese Pharmacology. Pathway analysis and synthetic lethality gene pairs were applied to analyze the dissimilarity, generality and intergroup relations of different groups. We defined hub CM pairs and alternative CM groups based on the analysis result and finally proposed a formula to form an effective anti-AML prescription which combined the hub CM pairs with alternative CMs according to patients’ molecular features. Our method of formulating CMs based on patients’ stratification provides novel insights into the new usage of conventional CMs and will promote TCM modernization. PMID:28454110
Huang, Lin; Li, Haichang; Xie, Duoli; Shi, Tieliu; Wen, Chengping
2017-06-27
Traditional Chinese Medicine (TCM) has been widely used as a complementary medicine in Acute Myeloid Leukemia (AML) treatment. In this study, we proposed a new classification of Chinese Medicines (CMs) by integrating the latest discoveries in disease molecular mechanisms and traditional medicine theory. We screened out a set of chemical compounds on basis of AML differential expression genes and chemical-protein interactions and then mapped them to Traditional Chinese Medicine Integrated Database. 415 CMs contain those compounds and they were categorized into 8 groups according to the Traditional Chinese Pharmacology. Pathway analysis and synthetic lethality gene pairs were applied to analyze the dissimilarity, generality and intergroup relations of different groups. We defined hub CM pairs and alternative CM groups based on the analysis result and finally proposed a formula to form an effective anti-AML prescription which combined the hub CM pairs with alternative CMs according to patients' molecular features. Our method of formulating CMs based on patients' stratification provides novel insights into the new usage of conventional CMs and will promote TCM modernization.
Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko
2012-01-01
MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782
ERIC Educational Resources Information Center
Smith, Wayne
2016-01-01
When observing skill and determining the competency of children and youth physical education teachers often focus on the coordination dynamics within the individual in the early years and then the individual's ability to play the game as they develop. But in these game contexts the focus is often still on the individuals' actions and not the…
Rodin, Andrei S; Szathmáry, Eörs; Rodin, Sergei N
2009-01-01
Background The genetic code is brought into action by 20 aminoacyl-tRNA synthetases. These enzymes are evenly divided into two classes (I and II) that recognize tRNAs from the minor and major groove sides of the acceptor stem, respectively. We have reported recently that: (1) ribozymic precursors of the synthetases seem to have used the same two sterically mirror modes of tRNA recognition, (2) having these two modes might have helped in preventing erroneous aminoacylation of ancestral tRNAs with complementary anticodons, yet (3) the risk of confusion for the presumably earliest pairs of complementarily encoded amino acids had little to do with anticodons. Accordingly, in this communication we focus on the acceptor stem. Results Our main result is the emergence of a palindrome structure for the acceptor stem's common ancestor, reconstructed from the phylogenetic trees of Bacteria, Archaea and Eukarya. In parallel, for pairs of ancestral tRNAs with complementary anticodons, we present updated evidence of concerted complementarity of the second bases in the acceptor stems. These two results suggest that the first pairs of "complementary" amino acids that were engaged in primordial coding, such as Gly and Ala, could have avoided erroneous aminoacylation if and only if the acceptor stems of their adaptors were recognized from the same, major groove, side. The class II protein synthetases then inherited this "primary preference" from isofunctional ribozymes. Conclusion Taken together, our results support the hypothesis that the genetic code per se (the one associated with the anticodons) and the operational code of aminoacylation (associated with the acceptor) diverged from a common ancestor that probably began developing before translation. The primordial advantage of linking some amino acids (most likely glycine and alanine) to the ancestral acceptor stem may have been selective retention in a protocell surrounded by a leaky membrane for use in nucleotide and coenzyme synthesis. Such acceptor stems (as cofactors) thus transferred amino acids as groups for biosynthesis. Later, with the advent of an anticodon loop, some amino acids (such as aspartic acid, histidine, arginine) assumed a catalytic role while bound to such extended adaptors, in line with the original coding coenzyme handle (CCH) hypothesis. Reviewers This article was reviewed by Rob Knight, Juergen Brosius and Anthony Poole. PMID:19173731
Rymešová, Dana; Králová, Tereza; Promerová, Marta; Bryja, Josef; Tomášek, Oldřich; Svobodová, Jana; Šmilauer, Petr; Šálek, Miroslav; Albrecht, Tomáš
2017-01-01
Sexual selection has been hypothesised as favouring mate choice resulting in production of viable offspring with genotypes providing high pathogen resistance. Specific pathogen recognition is mediated by genes of the major histocompatibility complex (MHC) encoding proteins fundamental for adaptive immune response in jawed vertebrates. MHC genes may also play a role in odour-based individual recognition and mate choice, aimed at avoiding inbreeding. MHC genes are known to be involved in mate choice in a number of species, with 'good genes' (absolute criteria) and 'complementary genes' (self-referential criteria) being used to explain MHC-based mating. Here, we focus on the effect of morphological traits and variation and genetic similarity between individuals in MHC class IIB (MHCIIB) exon 2 on mating in a free-living population of a monogamous bird, the grey partridge. We found no evidence for absolute mate choice criteria as regards grey partridge MHCIIB genotypes, i.e., number and occurrence of amino acid variants, though red chroma of the spot behind eyes was positively associated with male pairing success. On the other hand, mate choice at MHCIIB was based on relative criteria as females preferentially paired with more dissimilar males having a lower number of shared amino acid variants. This observation supports the 'inbreeding avoidance' and 'complementary genes' hypotheses. Our study provides one of the first pieces of evidence for MHC-based mate choice for genetic complementarity in a strictly monogamous bird. The statistical approach employed can be recommended for testing mating preferences in cases where availability of potential mates (recorded with an appropriate method such as radio-tracking) shows considerable temporal variation. Additional genetic analyses using neutral markers may detect whether MHC-based mate choice for complementarity emerges as a by-product of general inbreeding avoidance in grey partridges.
Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.
2005-01-01
We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Sayed, Nour; Jousselin, Ambre; Felden, Brice
2011-12-25
Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.
Complementary mode analyses between sub- and superdiffusion
NASA Astrophysics Data System (ADS)
Saito, Takuya; Sakaue, Takahiro
2017-04-01
Several subdiffusive stochastic processes in nature, e.g., the motion of a tagged monomer in polymers, the height fluctuation of interfaces, particle dynamics in single-file diffusion, etc., can be described rigorously or approximately by the superposition of various modes whose relaxation times are broadly distributed. In this paper, we propose a mode analysis generating superdiffusion, which is paired with or complementary to subdiffusion. The key point in our discussion lies in the identification of a pair of conjugated variables, which undergo sub- and superdiffusion, respectively. We provide a simple interpretation for the sub- and superdiffusion duality for these variables using the language of polymer physics. The analysis also suggests the usefulness of looking at the force fluctuation in experiments, where a polymer is driven by a constant velocity.
Sengupta, Partha Pratim; Gloria, Jared N; Amato, Dahlia N; Amato, Douglas V; Patton, Derek L; Murali, Beddhu; Flynt, Alex S
2015-10-12
Detection of specific RNA or DNA molecules by hybridization to "probe" nucleic acids via complementary base-pairing is a powerful method for analysis of biological systems. Here we describe a strategy for transducing hybridization events through modulating intrinsic properties of the electroconductive polymer polyaniline (PANI). When DNA-based probes electrostatically interact with PANI, its fluorescence properties are increased, a phenomenon that can be enhanced by UV irradiation. Hybridization of target nucleic acids results in dissociation of probes causing PANI fluorescence to return to basal levels. By monitoring restoration of base PANI fluorescence as little as 10(-11) M (10 pM) of target oligonucleotides could be detected within 15 min of hybridization. Detection of complementary oligos was specific, with introduction of a single mismatch failing to form a target-probe duplex that would dissociate from PANI. Furthermore, this approach is robust and is capable of detecting specific RNAs in extracts from animals. This sensor system improves on previously reported strategies by transducing highly specific probe dissociation events through intrinsic properties of a conducting polymer without the need for additional labels.
Accelerating calculations of RNA secondary structure partition functions using GPUs
2013-01-01
Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434
Interaction of influenza virus polymerase with viral RNA in the 'corkscrew' conformation.
Flick, R; Hobom, G
1999-10-01
The influenza virus RNA (vRNA) promoter structure is known to consist of the 5'- and 3'-terminal sequences of the RNA, within very narrow boundaries of 16 and 15 nucleotides, respectively. A complete set of single nucleotide substitutions led to the previously proposed model of a binary hooked or 'corkscrew' conformation for the vRNA promoter when it interacts with the viral polymerase. This functional structure is confirmed here with a complete set of complementary double substitutions, of both the regular A:U and G:C type and also the G:U type of base-pair exchanges. The proposed structure consists of a six base-pair RNA rod in the distal element in conjunction with two stem-loop structures of two short-range base-pairs (positions 2-9; 3-8). These support an exposed tetranucleotide loop within each branch of the proximal element, in an overall oblique organization due to a central unpaired A residue at position 10 in the 5' sequence. Long-range base-pairing between the entire 5' and 3' branches, as required for an unmodified 'panhandle' model, has been excluded for the proximal element, while it is known to represent the mode of interaction within the distal element. A large number of short-range base-pair exchanges in the proximal element constitute promoter-up mutations, which show activities several times above that of the wild-type in reporter gene assays. The unique overall conformation and rather few invariant nucleotides appear to be the core elements in vRNA recognition by polymerase and also in viral ribonucleoprotein packaging, to allow discrimination against the background of other RNA molecules in the cell.
Sharma, Kishor; Tollervey, David
1999-01-01
The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548
Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F
1999-01-01
Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
Rupture of DNA aptamer: New insights from simulations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay
2015-10-28
Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
Dissecting the hybridization of oligonucleotides to structured complementary sequences.
Peracchi, Alessio
2016-06-01
When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.
Searches for pair production of third-generation squarks in √{s}=13 {TeV} pp collisions
NASA Astrophysics Data System (ADS)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Waltenberger, W.; Wulz, C.-E.; Chekhovsky, V.; Dvornikov, O.; Dydyshka, Y.; Emeliantchik, I.; Litomin, A.; Makarenko, V.; Mossolov, V.; Stefanovitch, R.; Suarez Gonzalez, J.; Zykunov, V.; Shumeiko, N.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; De Souza, S. Fonseca; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Pereira, A. Vilela; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Ruan, M.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Tsiakkouri, D.; Finger, M.; Finger, M.; Carrera Jarrin, E.; El-khateeb, E.; Elgammal, S.; Mohamed, A.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; de Monchenault, G. Hamel; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; de Cassagnac, R. Granier; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Bihan, A.-C. Le; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Toriashvili, T.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Zhukov, V.; Albert, A.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Pardos, C. Diez; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Poehlsen, J.; Sander, C.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Baus, C.; Berger, J.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Bencze, G.; Hajdu, C.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Bahinipati, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhowmik, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; de Fatis, T. Tabarelli; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Lanza, G.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Bellato, M.; Benato, L.; Biasotto, M.; Bisello, D.; Boletti, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Ventura, S.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Fallavollita, F.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Solestizi, L. Alunni; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Del Re, D.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Lee, H.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Ali, M. A. B. Md; Mohamad Idris, F.; Abdullah, W. A. T. Wan; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Da Cruz E. Silva, C. Beirão; Calpas, B.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Alexakhin, V.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Savina, M.; Shmatov, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Markin, O.; Popova, E.; Zhemchugov, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Del Valle, A. Escalante; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Lopez, S. Goy; Hernandez, J. M.; Josa, M. I.; De Martino, E. Navarro; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Verweij, M.; Wardle, N.; Wöhri, H. K.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lustermann, W.; Mangano, B.; Marionneau, M.; del Arbol, P. Martinez Ruiz; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Asavapibhop, B.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Bakirci, M. N.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Topaksu, A. Kayis; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Bartek, R.; Dominguez, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Burns, D.; De La Barca Sanchez, M. Calderon; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Squires, M.; Stolp, D.; Tos, K.; Tripathi, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Weber, M.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Della Porta, G. Zevi; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Bunn, J.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Kaufman, G. Nicolas; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; De Sá, R. Lopes; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Wu, Y.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Low, J. F.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Bein, S.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Prosper, H.; Santra, A.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Jung, K.; Sandoval Gonzalez, I. D.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Osherson, M.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Forthomme, L.; Kenny, R. P.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Malta Rodrigues, A.; Meier, F.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; De Lima, R. Teixeira; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Kumar, A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Lange, D.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Svyatkovskiy, A.; Tully, C.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Schulte, J. F.; Shi, X.; Sun, J.; Wang, F.; Xie, W.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; De Guio, F.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Sturdy, J.; Belknap, D. A.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.
2017-05-01
Searches are presented for direct production of top or bottom squark pairs in proton-proton collisions at the CERN LHC. Two searches, based on complementary techniques, are performed in all-jet final states that are characterized by a significant imbalance in transverse momentum. An additional search requires the presence of a charged lepton isolated from other activity in the event. The data were collected in 2015 at a centre-of-mass energy of 13 {TeV} with the CMS detector and correspond to an integrated luminosity of 2.3 {fb}^{-1}. No statistically significant excess of events is found beyond the expected contribution from standard model processes. Exclusion limits are set in the context of simplified models of top or bottom squark pair production. Models with top and bottom squark masses up to 830 and 890 {GeV}, respectively, are probed for light neutralinos. For models with top squark masses of 675 {GeV}, neutralino masses up to 260 {GeV} are excluded at 95% confidence level.
Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.
Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J
2010-04-01
Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick
2014-02-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie
2014-01-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Amino acid fermentation at the origin of the genetic code.
de Vladar, Harold P
2012-02-10
There is evidence that the genetic code was established prior to the existence of proteins, when metabolism was powered by ribozymes. Also, early proto-organisms had to rely on simple anaerobic bioenergetic processes. In this work I propose that amino acid fermentation powered metabolism in the RNA world, and that this was facilitated by proto-adapters, the precursors of the tRNAs. Amino acids were used as carbon sources rather than as catalytic or structural elements. In modern bacteria, amino acid fermentation is known as the Stickland reaction. This pathway involves two amino acids: the first undergoes oxidative deamination, and the second acts as an electron acceptor through reductive deamination. This redox reaction results in two keto acids that are employed to synthesise ATP via substrate-level phosphorylation. The Stickland reaction is the basic bioenergetic pathway of some bacteria of the genus Clostridium. Two other facts support Stickland fermentation in the RNA world. First, several Stickland amino acid pairs are synthesised in abiotic amino acid synthesis. This suggests that amino acids that could be used as an energy substrate were freely available. Second, anticodons that have complementary sequences often correspond to amino acids that form Stickland pairs. The main hypothesis of this paper is that pairs of complementary proto-adapters were assigned to Stickland amino acids pairs. There are signatures of this hypothesis in the genetic code. Furthermore, it is argued that the proto-adapters formed double strands that brought amino acid pairs into proximity to facilitate their mutual redox reaction, structurally constraining the anticodon pairs that are assigned to these amino acid pairs. Significance tests which randomise the code are performed to study the extent of the variability of the energetic (ATP) yield. Random assignments can lead to a substantial yield of ATP and maintain enough variability, thus selection can act and refine the assignments into a proto-code that optimises the energetic yield. Monte Carlo simulations are performed to evaluate the establishment of these simple proto-codes, based on amino acid substitutions and codon swapping. In all cases, donor amino acids are assigned to anticodons composed of U+G, and have low redundancy (1-2 codons), whereas acceptor amino acids are assigned to the the remaining codons. These bioenergetic and structural constraints allow for a metabolic role for amino acids before their co-option as catalyst cofactors.
Catalytic Activity of a Binary Informational Macromolecule
NASA Technical Reports Server (NTRS)
Reader, John S.; Joyce, Gerald F.
2003-01-01
RNA molecules are thought to have played a prominent role in the early history of life on Earth based on their ability both to encode genetic information and to exhibit catalytic function. The modern genetic alphabet relies on two sets of complementary base pairs to store genetic information. However, due to the chemical instability of cytosine, which readily deaminates to uracil, a primitive genetic system composed of the bases A, U, G and C may have been difficult to establish. It has been suggested that the first genetic material instead contained only a single base-pairing unie'. Here we show that binary informational macromolecules, containing only two different nucleotide subunits, can act as catalysts. In vitro evolution was used to obtain ligase ribozymes composed of only 2,6-diaminopurine and uracil nucleotides, which catalyze the template-directed joining of two RNA molecules, one bearing a 5'-triphosphate and the other a 3'-hydroxyl. The active conformation of the fastest isolated ribozyme had a catalytic rate that was about 36,000-fold faster than the uncatalyzed rate of reaction. This ribozyme is specific for the formation of biologically relevant 3',5'-phosphodiester linkages.
Bentil, Helena Joycelyn; Steiner-Asiedu, Matilda; Lartey, Anna
2016-01-01
Several studies have been done on infant feeding practices but few have focused on twins. The aim of this study was to compare the complementary feeding practices between mothers with twins and mothers with singletons. Mother-infant pairs (50 mother-twin pairs and 50 mother-singleton pairs) with children aged 6 to 23 months were recruited from two public health clinics and communities in Tema and Ashaiman. Information was collected on the background characteristics of the mothers. Recumbent length and weight of the children were measured. Dietary information on the infants was collected using 24 hour recall. The differences between two groups were tested using independent t-student test for continuous variables and chi-square test for categorical variables. The minimum dietary diversity (4+ food groups) was met by only 32% of the twins and 40% of the singletons, and 28% of the twins and 38% of the singletons met the requirement for minimum acceptable diet (minimum dietary diversity and the minimum meal frequency). Minimum meal frequency was met by 78% of the twins and 76% of the singletons. There were no significant differences between the two groups of infants. Prevalence of undernutrition was not significantly different among the two groups (twins versus singletons: underweight-26% versus 24%, stunting-20% versus 24% and wasting-14% versus 10%. Complementary feeding practices were suboptimal in both groups of mothers requiring interventions to improve infant feeding practices.
Perceptual judgments made better by indirect interactions: Evidence from a joint localization task
Sebanz, Natalie; Knoblich, Günther
2017-01-01
Others’ perceptual judgments tend to have strong effects on our own, and can improve perceptual judgments when task partners engage in communication. The present study investigated whether individuals benefit from others’ perceptual judgments in indirect interactions, where outcomes of individual decisions can be observed in a shared environment. Participants located a target in a 2D projection of a 3D container either from two complementary viewpoints (Experiment 1), or from a single viewpoint (Experiment 2). Uncertainty about the target location was high on the front-back dimension and low on the left-right dimension. The results showed that pairs of participants benefitted from taking turns in providing judgments. When each member of the pair had access to one complementary perspective, the pair achieved the same level of accuracy as when the two individuals had access to both complimentary perspectives and better performance than when the two individuals had access to only one perspective. These findings demonstrate the important role of a shared environment for successful integration of perceptual information while highlighting limitations in assigning appropriate weights to others’ judgments. PMID:29095951
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
DNA Nanotechnology for Cancer Therapy
Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio
2016-01-01
DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418
Prebiotic chemistry and nucleic acid replication
NASA Technical Reports Server (NTRS)
Orgel, L. E.; Lohrmann, R.
1974-01-01
Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.
Dysregulation of RNA Interference in Breast Cancer
2007-07-01
of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative
Mass sensing based on deterministic and stochastic responses of elastically coupled nanocantilevers.
Gil-Santos, Eduardo; Ramos, Daniel; Jana, Anirban; Calleja, Montserrat; Raman, Arvind; Tamayo, Javier
2009-12-01
Coupled nanomechanical systems and their entangled eigenstates offer unique opportunities for the detection of ultrasmall masses. In this paper we show theoretically and experimentally that the stochastic and deterministic responses of a pair of coupled nanocantilevers provide different and complementary information about the added mass of an analyte and its location. This method allows the sensitive detection of minute quantities of mass even in the presence of large initial differences in the active masses of the two cantilevers. Finally, we show the fundamental limits in mass detection of this sensing paradigm.
Proxy case mix measures for nursing homes.
Cyr, A B
1983-01-01
Nursing home case mix measures are needed for the same purposes that spurred the intensive development of case mix measures for hospitals: management and planning decisions, organizational performance research, and reimbursement policy analysis. This paper develops and validates a pair of complementary measures that are simple to compute, are easy to interpret, and use generally available data. They are not, however, definitive. A secondary purpose of this paper is thus to galvanize the development of data bases that will give rise to superior case mix measures for nursing homes.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
Colour preferences and colour vision in poultry chicks.
Ham, A D; Osorio, D
2007-08-22
The dramatic colours of biological communication signals raise questions about how animals perceive suprathreshold colour differences, and there are long-standing questions about colour preferences and colour categorization by non-human species. This study investigates preferences of foraging poultry chicks (Gallus gallus) as they peck at coloured objects. Work on colour recognition often deals with responses to monochromatic lights and how animals divide the spectrum. We used complementary colours, where the intermediate is grey, and related the chicks' choices to three models of the factors that may affect the attractiveness. Two models assume that attractiveness is determined by a metric based on the colour discrimination threshold either (i) by chromatic contrast against the background or (ii) relative to an internal standard. An alternative third model is that categorization is important. We tested newly hatched and 9-day-old chicks with four pairs of (avian) complementary colours, which were orange, blue, red and green for humans. Chromatic contrast was more relevant to newly hatched chicks than to 9-day-old birds, but in neither case could contrast alone account for preferences; especially for orange over blue. For older chicks, there is evidence for categorization of complementary colours, with a boundary at grey.
Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong
2013-04-08
Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.
Control of myogenesis by rodent SINE-containing lncRNAs
Wang, Jiashi; Gong, Chenguang; Maquat, Lynne E.
2013-01-01
Staufen1-mediated mRNA decay (SMD) degrades mRNAs that harbor a Staufen1-binding site (SBS) in their 3′ untranslated regions (UTRs). Human SBSs can form by intermolecular base-pairing between a 3′ UTR Alu element and an Alu element within a long noncoding RNA (lncRNA) called a ½-sbsRNA. Since Alu elements are confined to primates, it was unclear how SMD occurs in rodents. Here we identify mouse mRNA 3′ UTRs and lncRNAs that contain a B1, B2, B4, or identifier (ID) element. We show that SMD occurs in mouse cells via mRNA–lncRNA base-pairing of partially complementary elements and that mouse ½-sbsRNA (m½-sbsRNA)-triggered SMD regulates C2C12 cell myogenesis. Our findings define new roles for lncRNAs as well as B and ID short interspersed elements (SINEs) in mice that undoubtedly influence many developmental and homeostatic pathways. PMID:23558772
mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay
Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.
2013-01-01
We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942
Computational Approaches to Nucleic Acid Origami.
Jabbari, Hosna; Aminpour, Maral; Montemagno, Carlo
2015-10-12
Recent advances in experimental DNA origami have dramatically expanded the horizon of DNA nanotechnology. Complex 3D suprastructures have been designed and developed using DNA origami with applications in biomaterial science, nanomedicine, nanorobotics, and molecular computation. Ribonucleic acid (RNA) origami has recently been realized as a new approach. Similar to DNA, RNA molecules can be designed to form complex 3D structures through complementary base pairings. RNA origami structures are, however, more compact and more thermodynamically stable due to RNA's non-canonical base pairing and tertiary interactions. With all these advantages, the development of RNA origami lags behind DNA origami by a large gap. Furthermore, although computational methods have proven to be effective in designing DNA and RNA origami structures and in their evaluation, advances in computational nucleic acid origami is even more limited. In this paper, we review major milestones in experimental and computational DNA and RNA origami and present current challenges in these fields. We believe collaboration between experimental nanotechnologists and computer scientists are critical for advancing these new research paradigms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
An intercalation-locked parallel-stranded DNA tetraplex
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
2015-01-27
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
Homann, M; Tabler, M; Tzortzakaki, S; Sczakiel, G
1994-01-01
When designed to cleave a target RNA in trans, the hammerhead ribozyme contains two antisense flanks which form helix I and helix III by pairing with the complementary target RNA. The sequences forming helix II are contained on the ribozyme strand and represent a major structural component of the hammerhead structure. In the case of an inhibitory 429 nucleotides long trans-ribozyme (2as-Rz12) which was directed against the 5'-leader/gag region of the human immunodeficiency virus type 1 (HIV-1), helix II was not pre-formed in the single-stranded molecule. Thus, major structural changes are necessary before cleavage can occur. To study whether pre-formation of helix II in the non-paired 2as-Rz12 RNA could influence the observed cleavage rate in vitro and its inhibitory activity on HIV-1 replication, we extended the 4 base pair helix II of 2as-Rz12 to 6, 10, 21, and 22 base pairs respectively. Limited RNase cleavage reactions performed in vitro at 37 degrees C and at physiological ion strength indicated that a helix II of the hammerhead domain was pre-formed when its length was at least six base pairs. This modification neither affected the association rate with target RNA nor the cleavage rate in vitro. In contrast to this, extension of helix II led to a significantly decreased inhibition of HIV-1 replication in human cells. Together with the finding of others that shortening of helix II to less than two base pairs reduces the catalytic activity in vitro, this observation indicates that the length of helix II in the naturally occurring RNAs with a hammerhead domain is already close or identical to the optimal length for catalytic activity in vitro and in vivo. Images PMID:7524030
Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek
2017-10-01
Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.
Mulualem, Demmelash; Henry, Carol J; Berhanu, Getenesh; Whiting, Susan J
2016-01-01
Complementary foods (CFs) in Ethiopia are cereal based and adding locally grown pulses (legumes) to CF would provide needed nutrients. To assess the effects of nutrition education (NEd) using Health Belief Model (HBM) in promoting pulses for CF, a 6-month quasi-experimental study was conducted in 160 mother-child pairs. Knowledge, attitude, and practice (KAP) questions were given to mothers at baseline, midline, and endline, along with anthropometric measurements of children. NEd involving discussions and recipe demonstrations was given twice monthly for 6 months to the intervention group (n = 80) while control mothers received usual education. At baseline, mothers' KAP scores were low at both sites; at 3 and 6 months of NEd, mean KAP scores of mothers increased (p < 0.05) compared to the control site. Significant improvements in children's mean weight, weight for height, and weight for age occurred in the intervention site only. Nutritional status of children improved after providing mothers with pulse-based NEd.
Kit for detecting nucleic acid sequences using competitive hybridization probes
Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.
2001-01-01
A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.
A random access memory immune to single event upset using a T-Resistor
Ochoa, A. Jr.
1987-10-28
In a random access memory cell, a resistance ''T'' decoupling network in each leg of the cell reduces random errors caused by the interaction of energetic ions with the semiconductor material forming the cell. The cell comprises two parallel legs each containing a series pair of complementary MOS transistors having a common gate connected to the node between the transistors of the opposite leg. The decoupling network in each leg is formed by a series pair of resistors between the transistors together with a third resistor interconnecting the junction between the pair of resistors and the gate of the transistor pair forming the opposite leg of the cell. 4 figs.
Random access memory immune to single event upset using a T-resistor
Ochoa, Jr., Agustin
1989-01-01
In a random access memory cell, a resistance "T" decoupling network in each leg of the cell reduces random errors caused by the interaction of energetic ions with the semiconductor material forming the cell. The cell comprises two parallel legs each containing a series pair of complementary MOS transistors having a common gate connected to the node between the transistors of the opposite leg. The decoupling network in each leg is formed by a series pair of resistors between the transistors together with a third resistor interconnecting the junction between the pair of resistors and the gate of the transistor pair forming the opposite leg of the cell.
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-01-01
To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-04-01
To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.
Electron transfer of plurimodified DNA SAMs.
Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff
2007-07-17
An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.
Salwiński, Aleksander; Da Silva, David; Delépée, Raphaël; Maunit, Benoît
2014-04-01
In this report, enzyme-coupled magnetic nanoparticles (EMPs) were shown to be an effective affinity-based tool for finding specific interactions between enzymatic targets and the low-mass molecules in complex mixtures using classic MALDI-TOF apparatus. EMPs used in this work act as nonorganic matrix enabling ionization of small molecules without any interference in the low-mass range (enzyme-coupled nanoparticles-assisted laser desorption ionization MS, ENALDI MS) and simultaneously carry the superficial specific binding sites to capture inhibitors present in a studied mixture. We evaluated ENALDI approach in two complementary variations: 'ion fading' (IF-ENALDI), based on superficial adsorption of inhibitors and 'ion hunting' (IH-ENALDI), based on selective pre-concentration of inhibitors. IF-ENALDI was applied for two sets of enzyme-inhibitor pairs: tyrosinase-glabridin and trypsin-leupeptin and for the real plant sample: Sparrmannia discolor leaf and stem methanol extract. The efficacy of IH-ENALDI was shown for the pair of trypsin-leupeptin. Both ENALDI approaches pose an alternative for bioassay-guided fractionation, the common method for finding inhibitors in the complex mixtures.
Han, Kook; Tjaden, Brian; Lory, Stephen
2017-01-01
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055
Han, Kook; Tjaden, Brian; Lory, Stephen
2016-12-22
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
NASA Astrophysics Data System (ADS)
Yang, Deshan; Li, H. Harold; Goddu, S. Murty; Tan, Jun
2014-10-01
Onboard cone-beam CT (CBCT) has been widely used in image guided radiation therapy. However, the longitudinal coverage is only 15.5 cm in the pelvis scan mode. As a result, a single CBCT scan cannot cover the planning target volume in the longitudinal direction for over 80% of the patients. The common approach is to use double- or multiple-circular scans and then combine multiple CBCT volumes after reconstruction. However it raises concerns regarding doubled imaging dose at the imaging beam junctions due to beam divergence. In this work, we present a new method, DSCS (Dual Scan with Complementary Shifts), to address the CBCT coverage problem using a pair of complementary circular scans. In DSCS, two circular scans were performed at 39.5 cm apart longitudinally. In the superior scan, the detector panel was offset by 16 cm to the left, 15 cm to the inferior. In the inferior scan, the detector panel was shifted 16 cm to the right and 15 cm to the superior. The effective imaging volume is 39.5 cm longitudinally with a 45 cm lateral field-of-view (FOV). Half beam blocks were used to confine the imaging radiation inside the volume of interest. A new image reconstruction algorithm was developed, based on the Feldkamp-Davis-Kress cone-beam CT reconstruction algorithm, to support the DSCS scanning geometry. Digital phantom simulations were performed to demonstrate the feasibility of DSCS. Physical phantom studies were performed using an anthropomorphic phantom on a commercial onboard CBCT system. With basic scattering corrections, the reconstruction results were acceptable. Other issues, including the discrepancy in couch vertical at different couch longitudinal positions, and the inaccuracy in couch table longitudinal movement, were manually corrected during the reconstruction process. In conclusion, the phantom studies showed that, using DSCS, a 39.5 cm longitudinal coverage with a 45 cm FOV was accomplished. The efficiency of imaging dose usage was near 100%. This proposed method could be potentially useful for image guidance and subsequent treatment plan adaptation.
Wu, Cuichen; Wan, Shuo; Hou, Weijia; Zhang, Liqin; Xu, Jiehua; Cui, Cheng; Wang, Yanyue; Hu, Jun; Tan, Weihong
2015-03-04
Nucleic acid-based logic devices were first introduced in 1994. Since then, science has seen the emergence of new logic systems for mimicking mathematical functions, diagnosing disease and even imitating biological systems. The unique features of nucleic acids, such as facile and high-throughput synthesis, Watson-Crick complementary base pairing, and predictable structures, together with the aid of programming design, have led to the widespread applications of nucleic acids (NA) for logic gate and computing in biotechnology and biomedicine. In this feature article, the development of in vitro NA logic systems will be discussed, as well as the expansion of such systems using various input molecules for potential cellular, or even in vivo, applications.
Wu, Cuichen; Wan, Shuo; Hou, Weijia; Zhang, Liqin; Xu, Jiehua; Cui, Cheng; Wang, Yanyue; Hu, Jun
2015-01-01
Nucleic acid-based logic devices were first introduced in 1994. Since then, science has seen the emergence of new logic systems for mimicking mathematical functions, diagnosing disease and even imitating biological systems. The unique features of nucleic acids, such as facile and high-throughput synthesis, Watson-Crick complementary base pairing, and predictable structures, together with the aid of programming design, have led to the widespread applications of nucleic acids (NA) for logic gating and computing in biotechnology and biomedicine. In this feature article, the development of in vitro NA logic systems will be discussed, as well as the expansion of such systems using various input molecules for potential cellular, or even in vivo, applications. PMID:25597946
A Methodology for Selection of a Satellite Servicing Architecture. Volume 3. Appendices.
1985-12-01
draft copies of this work is greatly appreciated. Dis DII ii, I - A special measure of gratitude belongs to Major Dennis Clark for his help with...bute pair when its complementary set changed values, that pair of attributes can be considered PPI of its complemen- tary set. It is recommended that...a system. 2-2 Mission Accomplishment: The system is desired to accomplish its mission by meeting various specifica- tions. These specifications
NASA Astrophysics Data System (ADS)
Li, Hao; Huang, Yue; Yu, Yue; Li, Tianqi; Li, Genxi; Anzai, Jun-Ichi
2016-05-01
Diseases such as cancer arise from systematical reconfiguration of interactions of exceedingly large numbers of proteins in cell signaling. The study of such complicated molecular mechanisms requires multiplexed detection of the inter-connected activities of several proteins in a disease-associated context. However, the existing methods are generally not well-equipped for this kind of application. Here a method for analyzing functionally linked protein activities is developed based on enzyme controlled pairing between complementary peptide helix strands, which simultaneously enables elaborate regulation of catalytic activity of the paired peptides. This method has been used to detect three different types of protein modification enzymes that participate in the modification of extracellular matrix and the formation of invasion front in tumour. In detecting breast cancer tissue samples using this method, up-regulated activity can be observed for two of the assessed enzymes, while the third enzyme is found to have a subtle fluctuation of activity. These results may point to the application of this method in evaluating prometastatic activities of proteins in tumour.
Sirunyan, A M; Tumasyan, A; Adam, W; Asilar, E; Bergauer, T; Brandstetter, J; Brondolin, E; Dragicevic, M; Erö, J; Flechl, M; Friedl, M; Frühwirth, R; Ghete, V M; Hartl, C; Hörmann, N; Hrubec, J; Jeitler, M; König, A; Krätschmer, I; Liko, D; Matsushita, T; Mikulec, I; Rabady, D; Rad, N; Rahbaran, B; Rohringer, H; Schieck, J; Strauss, J; Waltenberger, W; Wulz, C-E; Chekhovsky, V; Dvornikov, O; Dydyshka, Y; Emeliantchik, I; Litomin, A; Makarenko, V; Mossolov, V; Stefanovitch, R; Suarez Gonzalez, J; Zykunov, V; Shumeiko, N; Alderweireldt, S; De Wolf, E A; Janssen, X; Lauwers, J; Van De Klundert, M; Van Haevermaet, H; Van Mechelen, P; Van Remortel, N; Van Spilbeeck, A; Abu Zeid, S; Blekman, F; D'Hondt, J; Daci, N; De Bruyn, I; Deroover, K; Lowette, S; Moortgat, S; Moreels, L; Olbrechts, A; Python, Q; Skovpen, K; Tavernier, S; Van Doninck, W; Van Mulders, P; Van Parijs, I; Brun, H; Clerbaux, B; De Lentdecker, G; Delannoy, H; Fasanella, G; Favart, L; Goldouzian, R; Grebenyuk, A; Karapostoli, G; Lenzi, T; Léonard, A; Luetic, J; Maerschalk, T; Marinov, A; Randle-Conde, A; Seva, T; Vander Velde, C; Vanlaer, P; Vannerom, D; Yonamine, R; Zenoni, F; Zhang, F; Cimmino, A; Cornelis, T; Dobur, D; Fagot, A; Gul, M; Khvastunov, I; Poyraz, D; Salva, S; Schöfbeck, R; Tytgat, M; Van Driessche, W; Yazgan, E; Zaganidis, N; Bakhshiansohi, H; Beluffi, C; Bondu, O; Brochet, S; Bruno, G; Caudron, A; De Visscher, S; Delaere, C; Delcourt, M; Francois, B; Giammanco, A; Jafari, A; Komm, M; Krintiras, G; Lemaitre, V; Magitteri, A; Mertens, A; Musich, M; Piotrzkowski, K; Quertenmont, L; Selvaggi, M; Vidal Marono, M; Wertz, S; Beliy, N; Aldá Júnior, W L; Alves, F L; Alves, G A; Brito, L; Hensel, C; Moraes, A; Pol, M E; Rebello Teles, P; Belchior Batista Das Chagas, E; Carvalho, W; Chinellato, J; Custódio, A; Da Costa, E M; Da Silveira, G G; De Jesus Damiao, D; De Oliveira Martins, C; De Souza, S Fonseca; Huertas Guativa, L M; Malbouisson, H; Matos Figueiredo, D; Mora Herrera, C; Mundim, L; Nogima, H; Prado Da Silva, W L; Santoro, A; Sznajder, A; Tonelli Manganote, E J; Pereira, A Vilela; Ahuja, S; Bernardes, C A; Dogra, S; Fernandez Perez Tomei, T R; Gregores, E M; Mercadante, P G; Moon, C S; Novaes, S F; Padula, Sandra S; Romero Abad, D; Ruiz Vargas, J C; Aleksandrov, A; Hadjiiska, R; Iaydjiev, P; Rodozov, M; Stoykova, S; Sultanov, G; Vutova, M; Dimitrov, A; Glushkov, I; Litov, L; Pavlov, B; Petkov, P; Fang, W; Ahmad, M; Bian, J G; Chen, G M; Chen, H S; Chen, M; Chen, Y; Cheng, T; Jiang, C H; Leggat, D; Liu, Z; Romeo, F; Ruan, M; Shaheen, S M; Spiezia, A; Tao, J; Wang, C; Wang, Z; Zhang, H; Zhao, J; Ban, Y; Chen, G; Li, Q; Liu, S; Mao, Y; Qian, S J; Wang, D; Xu, Z; Avila, C; Cabrera, A; Chaparro Sierra, L F; Florez, C; Gomez, J P; González Hernández, C F; Ruiz Alvarez, J D; Sanabria, J C; Godinovic, N; Lelas, D; Puljak, I; Ribeiro Cipriano, P M; Sculac, T; Antunovic, Z; Kovac, M; Brigljevic, V; Ferencek, D; Kadija, K; Mesic, B; Susa, T; Attikis, A; Mavromanolakis, G; Mousa, J; Nicolaou, C; Ptochos, F; Razis, P A; Rykaczewski, H; Tsiakkouri, D; Finger, M; Finger, M; Carrera Jarrin, E; El-Khateeb, E; Elgammal, S; Mohamed, A; Kadastik, M; Perrini, L; Raidal, M; Tiko, A; Veelken, C; Eerola, P; Pekkanen, J; Voutilainen, M; Härkönen, J; Järvinen, T; Karimäki, V; Kinnunen, R; Lampén, T; Lassila-Perini, K; Lehti, S; Lindén, T; Luukka, P; Tuominiemi, J; Tuovinen, E; Wendland, L; Talvitie, J; Tuuva, T; Besancon, M; Couderc, F; Dejardin, M; Denegri, D; Fabbro, B; Faure, J L; Favaro, C; Ferri, F; Ganjour, S; Ghosh, S; Givernaud, A; Gras, P; de Monchenault, G Hamel; Jarry, P; Kucher, I; Locci, E; Machet, M; Malcles, J; Rander, J; Rosowsky, A; Titov, M; Abdulsalam, A; Antropov, I; Baffioni, S; Beaudette, F; Busson, P; Cadamuro, L; Chapon, E; Charlot, C; Davignon, O; de Cassagnac, R Granier; Jo, M; Lisniak, S; Miné, P; Nguyen, M; Ochando, C; Ortona, G; Paganini, P; Pigard, P; Regnard, S; Salerno, R; Sirois, Y; Strebler, T; Yilmaz, Y; Zabi, A; Zghiche, A; Agram, J-L; Andrea, J; Aubin, A; Bloch, D; Brom, J-M; Buttignol, M; Chabert, E C; Chanon, N; Collard, C; Conte, E; Coubez, X; Fontaine, J-C; Gelé, D; Goerlach, U; Jansová, M; Bihan, A-C Le; Van Hove, P; Gadrat, S; Beauceron, S; Bernet, C; Boudoul, G; Carrillo Montoya, C A; Chierici, R; Contardo, D; Courbon, B; Depasse, P; El Mamouni, H; Fan, J; Fay, J; Gascon, S; Gouzevitch, M; Grenier, G; Ille, B; Lagarde, F; Laktineh, I B; Lethuillier, M; Mirabito, L; Pequegnot, A L; Perries, S; Popov, A; Sabes, D; Sordini, V; Vander Donckt, M; Verdier, P; Viret, S; Toriashvili, T; Tsamalaidze, Z; Autermann, C; Beranek, S; Feld, L; Kiesel, M K; Klein, K; Lipinski, M; Preuten, M; Schomakers, C; Schulz, J; Verlage, T; Zhukov, V; Albert, A; Brodski, M; Dietz-Laursonn, E; Duchardt, D; Endres, M; Erdmann, M; Erdweg, S; Esch, T; Fischer, R; Güth, A; Hamer, M; Hebbeker, T; Heidemann, C; Hoepfner, K; Knutzen, S; Merschmeyer, M; Meyer, A; Millet, P; Mukherjee, S; Olschewski, M; Padeken, K; Pook, T; Radziej, M; Reithler, H; Rieger, M; Scheuch, F; Sonnenschein, L; Teyssier, D; Thüer, S; Cherepanov, V; Flügge, G; Kargoll, B; Kress, T; Künsken, A; Lingemann, J; Müller, T; Nehrkorn, A; Nowack, A; Pistone, C; Pooth, O; Stahl, A; Aldaya Martin, M; Arndt, T; Asawatangtrakuldee, C; Beernaert, K; Behnke, O; Behrens, U; Bin Anuar, A A; Borras, K; Campbell, A; Connor, P; Contreras-Campana, C; Costanza, F; Pardos, C Diez; Dolinska, G; Eckerlin, G; Eckstein, D; Eichhorn, T; Eren, E; Gallo, E; Garay Garcia, J; Geiser, A; Gizhko, A; Grados Luyando, J M; Grohsjean, A; Gunnellini, P; Harb, A; Hauk, J; Hempel, M; Jung, H; Kalogeropoulos, A; Karacheban, O; Kasemann, M; Keaveney, J; Kleinwort, C; Korol, I; Krücker, D; Lange, W; Lelek, A; Leonard, J; Lipka, K; Lobanov, A; Lohmann, W; Mankel, R; Melzer-Pellmann, I-A; Meyer, A B; Mittag, G; Mnich, J; Mussgiller, A; Ntomari, E; Pitzl, D; Placakyte, R; Raspereza, A; Roland, B; Sahin, M Ö; Saxena, P; Schoerner-Sadenius, T; Seitz, C; Spannagel, S; Stefaniuk, N; Van Onsem, G P; Walsh, R; Wissing, C; Blobel, V; Centis Vignali, M; Draeger, A R; Dreyer, T; Garutti, E; Gonzalez, D; Haller, J; Hoffmann, M; Junkes, A; Klanner, R; Kogler, R; Kovalchuk, N; Lapsien, T; Lenz, T; Marchesini, I; Marconi, D; Meyer, M; Niedziela, M; Nowatschin, D; Pantaleo, F; Peiffer, T; Perieanu, A; Poehlsen, J; Sander, C; Scharf, C; Schleper, P; Schmidt, A; Schumann, S; Schwandt, J; Stadie, H; Steinbrück, G; Stober, F M; Stöver, M; Tholen, H; Troendle, D; Usai, E; Vanelderen, L; Vanhoefer, A; Vormwald, B; Akbiyik, M; Barth, C; Baur, S; Baus, C; Berger, J; Butz, E; Caspart, R; Chwalek, T; Colombo, F; De Boer, W; Dierlamm, A; Fink, S; Freund, B; Friese, R; Giffels, M; Gilbert, A; Goldenzweig, P; Haitz, D; Hartmann, F; Heindl, S M; Husemann, U; Katkov, I; Kudella, S; Mildner, H; Mozer, M U; Müller, Th; Plagge, M; Quast, G; Rabbertz, K; Röcker, S; Roscher, F; Schröder, M; Shvetsov, I; Sieber, G; Simonis, H J; Ulrich, R; Wayand, S; Weber, M; Weiler, T; Williamson, S; Wöhrmann, C; Wolf, R; Anagnostou, G; Daskalakis, G; Geralis, T; Giakoumopoulou, V A; Kyriakis, A; Loukas, D; Topsis-Giotis, I; Kesisoglou, S; Panagiotou, A; Saoulidou, N; Tziaferi, E; Evangelou, I; Flouris, G; Foudas, C; Kokkas, P; Loukas, N; Manthos, N; Papadopoulos, I; Paradas, E; Filipovic, N; Bencze, G; Hajdu, C; Horvath, D; Sikler, F; Veszpremi, V; Vesztergombi, G; Zsigmond, A J; Beni, N; Czellar, S; Karancsi, J; Makovec, A; Molnar, J; Szillasi, Z; Bartók, M; Raics, P; Trocsanyi, Z L; Ujvari, B; Bahinipati, S; Choudhury, S; Mal, P; Mandal, K; Nayak, A; Sahoo, D K; Sahoo, N; Swain, S K; Bansal, S; Beri, S B; Bhatnagar, V; Chawla, R; Bhawandeep, U; Kalsi, A K; Kaur, A; Kaur, M; Kumar, R; Kumari, P; Mehta, A; Mittal, M; Singh, J B; Walia, G; Kumar, Ashok; Bhardwaj, A; Choudhary, B C; Garg, R B; Keshri, S; Malhotra, S; Naimuddin, M; Nishu, N; Ranjan, K; Sharma, R; Sharma, V; Bhattacharya, R; Bhattacharya, S; Chatterjee, K; Dey, S; Dutt, S; Dutta, S; Ghosh, S; Majumdar, N; Modak, A; Mondal, K; Mukhopadhyay, S; Nandan, S; Purohit, A; Roy, A; Roy, D; Roy Chowdhury, S; Sarkar, S; Sharan, M; Thakur, S; Behera, P K; Chudasama, R; Dutta, D; Jha, V; Kumar, V; Mohanty, A K; Netrakanti, P K; Pant, L M; Shukla, P; Topkar, A; Aziz, T; Dugad, S; Kole, G; Mahakud, B; Mitra, S; Mohanty, G B; Parida, B; Sur, N; Sutar, B; Banerjee, S; Bhowmik, S; Dewanjee, R K; Ganguly, S; Guchait, M; Jain, Sa; Kumar, S; Maity, M; Majumder, G; Mazumdar, K; Sarkar, T; Wickramage, N; Chauhan, S; Dube, S; Hegde, V; Kapoor, A; Kothekar, K; Pandey, S; Rane, A; Sharma, S; Chenarani, S; Eskandari Tadavani, E; Etesami, S M; Khakzad, M; Mohammadi Najafabadi, M; Naseri, M; Paktinat Mehdiabadi, S; Rezaei Hosseinabadi, F; Safarzadeh, B; Zeinali, M; Felcini, M; Grunewald, M; Abbrescia, M; Calabria, C; Caputo, C; Colaleo, A; Creanza, D; Cristella, L; De Filippis, N; De Palma, M; Fiore, L; Iaselli, G; Maggi, G; Maggi, M; Miniello, G; My, S; Nuzzo, S; Pompili, A; Pugliese, G; Radogna, R; Ranieri, A; Selvaggi, G; Sharma, A; Silvestris, L; Venditti, R; Verwilligen, P; Abbiendi, G; Battilana, C; Bonacorsi, D; Braibant-Giacomelli, S; Brigliadori, L; Campanini, R; Capiluppi, P; Castro, A; Cavallo, F R; Chhibra, S S; Codispoti, G; Cuffiani, M; Dallavalle, G M; Fabbri, F; Fanfani, A; Fasanella, D; Giacomelli, P; Grandi, C; Guiducci, L; Marcellini, S; Masetti, G; Montanari, A; Navarria, F L; Perrotta, A; Rossi, A M; Rovelli, T; Siroli, G P; Tosi, N; Albergo, S; Costa, S; Di Mattia, A; Giordano, F; Potenza, R; Tricomi, A; Tuve, C; Barbagli, G; Ciulli, V; Civinini, C; D'Alessandro, R; Focardi, E; Lenzi, P; Meschini, M; Paoletti, S; Russo, L; Sguazzoni, G; Strom, D; Viliani, L; Benussi, L; Bianco, S; Fabbri, F; Piccolo, D; Primavera, F; Calvelli, V; Ferro, F; Monge, M R; Robutti, E; Tosi, S; Brianza, L; Brivio, F; Ciriolo, V; Dinardo, M E; Fiorendi, S; Gennai, S; Ghezzi, A; Govoni, P; Malberti, M; Malvezzi, S; Manzoni, R A; Menasce, D; Moroni, L; Paganoni, M; Pedrini, D; Pigazzini, S; Ragazzi, S; de Fatis, T Tabarelli; Buontempo, S; Cavallo, N; De Nardo, G; Di Guida, S; Esposito, M; Fabozzi, F; Fienga, F; Iorio, A O M; Lanza, G; Lista, L; Meola, S; Paolucci, P; Sciacca, C; Thyssen, F; Azzi, P; Bacchetta, N; Bellato, M; Benato, L; Biasotto, M; Bisello, D; Boletti, A; Checchia, P; Dall'Osso, M; De Castro Manzano, P; Dosselli, U; Gasparini, F; Gasparini, U; Gozzelino, A; Lacaprara, S; Margoni, M; Meneguzzo, A T; Pazzini, J; Pozzobon, N; Ronchese, P; Simonetto, F; Torassa, E; Ventura, S; Zanetti, M; Zotto, P; Zumerle, G; Braghieri, A; Fallavollita, F; Magnani, A; Montagna, P; Ratti, S P; Re, V; Riccardi, C; Salvini, P; Vai, I; Vitulo, P; Solestizi, L Alunni; Bilei, G M; Ciangottini, D; Fanò, L; Lariccia, P; Leonardi, R; Mantovani, G; Menichelli, M; Saha, A; Santocchia, A; Androsov, K; Azzurri, P; Bagliesi, G; Bernardini, J; Boccali, T; Castaldi, R; Ciocci, M A; Dell'Orso, R; Donato, S; Fedi, G; Giassi, A; Grippo, M T; Ligabue, F; Lomtadze, T; Martini, L; Messineo, A; Palla, F; Rizzi, A; Savoy-Navarro, A; Spagnolo, P; Tenchini, R; Tonelli, G; Venturi, A; Verdini, P G; Barone, L; Cavallari, F; Cipriani, M; Del Re, D; Diemoz, M; Gelli, S; Longo, E; Margaroli, F; Marzocchi, B; Meridiani, P; Organtini, G; Paramatti, R; Preiato, F; Rahatlou, S; Rovelli, C; Santanastasio, F; Amapane, N; Arcidiacono, R; Argiro, S; Arneodo, M; Bartosik, N; Bellan, R; Biino, C; Cartiglia, N; Cenna, F; Costa, M; Covarelli, R; Degano, A; Demaria, N; Finco, L; Kiani, B; Mariotti, C; Maselli, S; Migliore, E; Monaco, V; Monteil, E; Monteno, M; Obertino, M M; Pacher, L; Pastrone, N; Pelliccioni, M; Pinna Angioni, G L; Ravera, F; Romero, A; Ruspa, M; Sacchi, R; Shchelina, K; Sola, V; Solano, A; Staiano, A; Traczyk, P; Belforte, S; Casarsa, M; Cossutti, F; Della Ricca, G; Zanetti, A; Kim, D H; Kim, G N; Kim, M S; Lee, S; Lee, S W; Oh, Y D; Sekmen, S; Son, D C; Yang, Y C; Lee, A; Kim, H; Brochero Cifuentes, J A; Kim, T J; Cho, S; Choi, S; Go, Y; Gyun, D; Ha, S; Hong, B; Jo, Y; Kim, Y; Lee, K; Lee, K S; Lee, S; Lim, J; Park, S K; Roh, Y; Almond, J; Kim, J; Lee, H; Oh, S B; Radburn-Smith, B C; Seo, S H; Yang, U K; Yoo, H D; Yu, G B; Choi, M; Kim, H; Kim, J H; Lee, J S H; Park, I C; Ryu, G; Ryu, M S; Choi, Y; Goh, J; Hwang, C; Lee, J; Yu, I; Dudenas, V; Juodagalvis, A; Vaitkus, J; Ahmed, I; Ibrahim, Z A; Komaragiri, J R; Ali, M A B Md; Mohamad Idris, F; Abdullah, W A T Wan; Yusli, M N; Zolkapli, Z; Castilla-Valdez, H; De La Cruz-Burelo, E; Heredia-De La Cruz, I; Hernandez-Almada, A; Lopez-Fernandez, R; Magaña Villalba, R; Mejia Guisao, J; Sanchez-Hernandez, A; Carrillo Moreno, S; Oropeza Barrera, C; Vazquez Valencia, F; Carpinteyro, S; Pedraza, I; Salazar Ibarguen, H A; Uribe Estrada, C; Morelos Pineda, A; Krofcheck, D; Butler, P H; Ahmad, A; Ahmad, M; Hassan, Q; Hoorani, H R; Khan, W A; Saddique, A; Shah, M A; Shoaib, M; Waqas, M; Bialkowska, H; Bluj, M; Boimska, B; Frueboes, T; Górski, M; Kazana, M; Nawrocki, K; Romanowska-Rybinska, K; Szleper, M; Zalewski, P; Bunkowski, K; Byszuk, A; Doroba, K; Kalinowski, A; Konecki, M; Krolikowski, J; Misiura, M; Olszewski, M; Walczak, M; Bargassa, P; Da Cruz E Silva, C Beirão; Calpas, B; Di Francesco, A; Faccioli, P; Ferreira Parracho, P G; Gallinaro, M; Hollar, J; Leonardo, N; Lloret Iglesias, L; Nemallapudi, M V; Rodrigues Antunes, J; Seixas, J; Toldaiev, O; Vadruccio, D; Varela, J; Vischia, P; Alexakhin, V; Bunin, P; Gavrilenko, M; Golutvin, I; Gorbunov, I; Kamenev, A; Karjavin, V; Lanev, A; Malakhov, A; Matveev, V; Palichik, V; Perelygin, V; Savina, M; Shmatov, S; Skatchkov, N; Smirnov, V; Voytishin, N; Zarubin, A; Chtchipounov, L; Golovtsov, V; Ivanov, Y; Kim, V; Kuznetsova, E; Murzin, V; Oreshkin, V; Sulimov, V; Vorobyev, A; Andreev, Yu; Dermenev, A; Gninenko, S; Golubev, N; Karneyeu, A; Kirsanov, M; Krasnikov, N; Pashenkov, A; Tlisov, D; Toropin, A; Epshteyn, V; Gavrilov, V; Lychkovskaya, N; Popov, V; Pozdnyakov, I; Safronov, G; Spiridonov, A; Toms, M; Vlasov, E; Zhokin, A; Bylinkin, A; Markin, O; Popova, E; Zhemchugov, E; Andreev, V; Azarkin, M; Dremin, I; Kirakosyan, M; Leonidov, A; Terkulov, A; Baskakov, A; Belyaev, A; Boos, E; Bunichev, V; Dubinin, M; Dudko, L; Ershov, A; Gribushin, A; Klyukhin, V; Kodolova, O; Lokhtin, I; Miagkov, I; Obraztsov, S; Petrushanko, S; Savrin, V; Blinov, V; Skovpen, Y; Shtol, D; Azhgirey, I; Bayshev, I; Bitioukov, S; Elumakhov, D; Kachanov, V; Kalinin, A; Konstantinov, D; Krychkine, V; Petrov, V; Ryutin, R; Sobol, A; Troshin, S; Tyurin, N; Uzunian, A; Volkov, A; Adzic, P; Cirkovic, P; Devetak, D; Dordevic, M; Milosevic, J; Rekovic, V; Alcaraz Maestre, J; Barrio Luna, M; Calvo, E; Cerrada, M; Chamizo Llatas, M; Colino, N; De La Cruz, B; Delgado Peris, A; Del Valle, A Escalante; Fernandez Bedoya, C; Fernández Ramos, J P; Flix, J; Fouz, M C; Garcia-Abia, P; Gonzalez Lopez, O; Lopez, S Goy; Hernandez, J M; Josa, M I; De Martino, E Navarro; Pérez-Calero Yzquierdo, A; Puerta Pelayo, J; Quintario Olmeda, A; Redondo, I; Romero, L; Soares, M S; de Trocóniz, J F; Missiroli, M; Moran, D; Cuevas, J; Fernandez Menendez, J; Gonzalez Caballero, I; González Fernández, J R; Palencia Cortezon, E; Sanchez Cruz, S; Suárez Andrés, I; Vizan Garcia, J M; Cabrillo, I J; Calderon, A; Curras, E; Fernandez, M; Garcia-Ferrero, J; Gomez, G; Lopez Virto, A; Marco, J; Martinez Rivero, C; Matorras, F; Piedra Gomez, J; Rodrigo, T; Ruiz-Jimeno, A; Scodellaro, L; Trevisani, N; Vila, I; Vilar Cortabitarte, R; Abbaneo, D; Auffray, E; Auzinger, G; Bachtis, M; Baillon, P; Ball, A H; Barney, D; Bloch, P; Bocci, A; Botta, C; Camporesi, T; Castello, R; Cepeda, M; Cerminara, G; Chen, Y; d'Enterria, D; Dabrowski, A; Daponte, V; David, A; De Gruttola, M; De Roeck, A; Di Marco, E; Dobson, M; Dorney, B; du Pree, T; Duggan, D; Dünser, M; Dupont, N; Elliott-Peisert, A; Everaerts, P; Fartoukh, S; Franzoni, G; Fulcher, J; Funk, W; Gigi, D; Gill, K; Girone, M; Glege, F; Gulhan, D; Gundacker, S; Guthoff, M; Harris, P; Hegeman, J; Innocente, V; Janot, P; Kieseler, J; Kirschenmann, H; Knünz, V; Kornmayer, A; Kortelainen, M J; Kousouris, K; Krammer, M; Lange, C; Lecoq, P; Lourenço, C; Lucchini, M T; Malgeri, L; Mannelli, M; Martelli, A; Meijers, F; Merlin, J A; Mersi, S; Meschi, E; Milenovic, P; Moortgat, F; Morovic, S; Mulders, M; Neugebauer, H; Orfanelli, S; Orsini, L; Pape, L; Perez, E; Peruzzi, M; Petrilli, A; Petrucciani, G; Pfeiffer, A; Pierini, M; Racz, A; Reis, T; Rolandi, G; Rovere, M; Sakulin, H; Sauvan, J B; Schäfer, C; Schwick, C; Seidel, M; Sharma, A; Silva, P; Sphicas, P; Steggemann, J; Stoye, M; Takahashi, Y; Tosi, M; Treille, D; Triossi, A; Tsirou, A; Veckalns, V; Veres, G I; Verweij, M; Wardle, N; Wöhri, H K; Zagozdzinska, A; Zeuner, W D; Bertl, W; Deiters, K; Erdmann, W; Horisberger, R; Ingram, Q; Kaestli, H C; Kotlinski, D; Langenegger, U; Rohe, T; Bachmair, F; Bäni, L; Bianchini, L; Casal, B; Dissertori, G; Dittmar, M; Donegà, M; Grab, C; Heidegger, C; Hits, D; Hoss, J; Kasieczka, G; Lustermann, W; Mangano, B; Marionneau, M; Del Arbol, P Martinez Ruiz; Masciovecchio, M; Meinhard, M T; Meister, D; Micheli, F; Musella, P; Nessi-Tedaldi, F; Pandolfi, F; Pata, J; Pauss, F; Perrin, G; Perrozzi, L; Quittnat, M; Rossini, M; Schönenberger, M; Starodumov, A; Tavolaro, V R; Theofilatos, K; Wallny, R; Aarrestad, T K; Amsler, C; Caminada, L; Canelli, M F; De Cosa, A; Galloni, C; Hinzmann, A; Hreus, T; Kilminster, B; Ngadiuba, J; Pinna, D; Rauco, G; Robmann, P; Salerno, D; Yang, Y; Zucchetta, A; Candelise, V; Doan, T H; Jain, Sh; Khurana, R; Konyushikhin, M; Kuo, C M; Lin, W; Lu, Y J; Pozdnyakov, A; Yu, S S; Kumar, Arun; Chang, P; Chang, Y H; Chao, Y; Chen, K F; Chen, P H; Fiori, F; Hou, W-S; Hsiung, Y; Liu, Y F; Lu, R-S; Miñano Moya, M; Paganis, E; Psallidas, A; Tsai, J F; Asavapibhop, B; Singh, G; Srimanobhas, N; Suwonjandee, N; Adiguzel, A; Bakirci, M N; Cerci, S; Damarseckin, S; Demiroglu, Z S; Dozen, C; Dumanoglu, I; Girgis, S; Gokbulut, G; Guler, Y; Hos, I; Kangal, E E; Kara, O; Topaksu, A Kayis; Kiminsu, U; Oglakci, M; Onengut, G; Ozdemir, K; Tali, B; Turkcapar, S; Zorbakir, I S; Zorbilmez, C; Bilin, B; Bilmis, S; Isildak, B; Karapinar, G; Yalvac, M; Zeyrek, M; Gülmez, E; Kaya, M; Kaya, O; Yetkin, E A; Yetkin, T; Cakir, A; Cankocak, K; Sen, S; Grynyov, B; Levchuk, L; Sorokin, P; Aggleton, R; Ball, F; Beck, L; Brooke, J J; Burns, D; Clement, E; Cussans, D; Flacher, H; Goldstein, J; Grimes, M; Heath, G P; Heath, H F; Jacob, J; Kreczko, L; Lucas, C; Newbold, D M; Paramesvaran, S; Poll, A; Sakuma, T; Seif El Nasr-Storey, S; Smith, D; Smith, V J; Bell, K W; Belyaev, A; Brew, C; Brown, R M; Calligaris, L; Cieri, D; Cockerill, D J A; Coughlan, J A; Harder, K; Harper, S; Olaiya, E; Petyt, D; Shepherd-Themistocleous, C H; Thea, A; Tomalin, I R; Williams, T; Baber, M; Bainbridge, R; Buchmuller, O; Bundock, A; Burton, D; Casasso, S; Citron, M; Colling, D; Corpe, L; Dauncey, P; Davies, G; De Wit, A; Della Negra, M; Di Maria, R; Dunne, P; Elwood, A; Futyan, D; Haddad, Y; Hall, G; Iles, G; James, T; Lane, R; Laner, C; Lucas, R; Lyons, L; Magnan, A-M; Malik, S; Mastrolorenzo, L; Nash, J; Nikitenko, A; Pela, J; Penning, B; Pesaresi, M; Raymond, D M; Richards, A; Rose, A; Seez, C; Summers, S; Tapper, A; Uchida, K; Vazquez Acosta, M; Virdee, T; Wright, J; Zenz, S C; Cole, J E; Hobson, P R; Khan, A; Kyberd, P; Reid, I D; Symonds, P; Teodorescu, L; Turner, M; Borzou, A; Call, K; Dittmann, J; Hatakeyama, K; Liu, H; Pastika, N; Bartek, R; Dominguez, A; Cooper, S I; Henderson, C; Rumerio, P; West, C; Arcaro, D; Avetisyan, A; Bose, T; Gastler, D; Rankin, D; Richardson, C; Rohlf, J; Sulak, L; Zou, D; Benelli, G; Cutts, D; Garabedian, A; Hakala, J; Heintz, U; Hogan, J M; Jesus, O; Kwok, K H M; Laird, E; Landsberg, G; Mao, Z; Narain, M; Piperov, S; Sagir, S; Spencer, E; Syarif, R; Breedon, R; Burns, D; De La Barca Sanchez, M Calderon; Chauhan, S; Chertok, M; Conway, J; Conway, R; Cox, P T; Erbacher, R; Flores, C; Funk, G; Gardner, M; Ko, W; Lander, R; Mclean, C; Mulhearn, M; Pellett, D; Pilot, J; Shalhout, S; Shi, M; Smith, J; Squires, M; Stolp, D; Tos, K; Tripathi, M; Bravo, C; Cousins, R; Dasgupta, A; Florent, A; Hauser, J; Ignatenko, M; Mccoll, N; Saltzberg, D; Schnaible, C; Valuev, V; Weber, M; Bouvier, E; Burt, K; Clare, R; Ellison, J; Gary, J W; Ghiasi Shirazi, S M A; Hanson, G; Heilman, J; Jandir, P; Kennedy, E; Lacroix, F; Long, O R; Olmedo Negrete, M; Paneva, M I; Shrinivas, A; Si, W; Wei, H; Wimpenny, S; Yates, B R; Branson, J G; Cerati, G B; Cittolin, S; Derdzinski, M; Gerosa, R; Holzner, A; Klein, D; Krutelyov, V; Letts, J; Macneill, I; Olivito, D; Padhi, S; Pieri, M; Sani, M; Sharma, V; Simon, S; Tadel, M; Vartak, A; Wasserbaech, S; Welke, C; Wood, J; Würthwein, F; Yagil, A; Della Porta, G Zevi; Amin, N; Bhandari, R; Bradmiller-Feld, J; Campagnari, C; Dishaw, A; Dutta, V; Franco Sevilla, M; George, C; Golf, F; Gouskos, L; Gran, J; Heller, R; Incandela, J; Mullin, S D; Ovcharova, A; Qu, H; Richman, J; Stuart, D; Suarez, I; Yoo, J; Anderson, D; Bendavid, J; Bornheim, A; Bunn, J; Duarte, J; Lawhorn, J M; Mott, A; Newman, H B; Pena, C; Spiropulu, M; Vlimant, J R; Xie, S; Zhu, R Y; Andrews, M B; Ferguson, T; Paulini, M; Russ, J; Sun, M; Vogel, H; Vorobiev, I; Weinberg, M; Cumalat, J P; Ford, W T; Jensen, F; Johnson, A; Krohn, M; Mulholland, T; Stenson, K; Wagner, S R; Alexander, J; Chaves, J; Chu, J; Dittmer, S; Mcdermott, K; Mirman, N; Kaufman, G Nicolas; Patterson, J R; Rinkevicius, A; Ryd, A; Skinnari, L; Soffi, L; Tan, S M; Tao, Z; Thom, J; Tucker, J; Wittich, P; Zientek, M; Winn, D; Abdullin, S; Albrow, M; Apollinari, G; Apresyan, A; Banerjee, S; Bauerdick, L A T; Beretvas, A; Berryhill, J; Bhat, P C; Bolla, G; Burkett, K; Butler, J N; Cheung, H W K; Chlebana, F; Cihangir, S; Cremonesi, M; Elvira, V D; Fisk, I; Freeman, J; Gottschalk, E; Gray, L; Green, D; Grünendahl, S; Gutsche, O; Hare, D; Harris, R M; Hasegawa, S; Hirschauer, J; Hu, Z; Jayatilaka, B; Jindariani, S; Johnson, M; Joshi, U; Klima, B; Kreis, B; Lammel, S; Linacre, J; Lincoln, D; Lipton, R; Liu, M; Liu, T; De Sá, R Lopes; Lykken, J; Maeshima, K; Magini, N; Marraffino, J M; Maruyama, S; Mason, D; McBride, P; Merkel, P; Mrenna, S; Nahn, S; O'Dell, V; Pedro, K; Prokofyev, O; Rakness, G; Ristori, L; Sexton-Kennedy, E; Soha, A; Spalding, W J; Spiegel, L; Stoynev, S; Strait, J; Strobbe, N; Taylor, L; Tkaczyk, S; Tran, N V; Uplegger, L; Vaandering, E W; Vernieri, C; Verzocchi, M; Vidal, R; Wang, M; Weber, H A; Whitbeck, A; Wu, Y; Acosta, D; Avery, P; Bortignon, P; Bourilkov, D; Brinkerhoff, A; Carnes, A; Carver, M; Curry, D; Das, S; Field, R D; Furic, I K; Konigsberg, J; Korytov, A; Low, J F; Ma, P; Matchev, K; Mei, H; Mitselmakher, G; Rank, D; Shchutska, L; Sperka, D; Thomas, L; Wang, J; Wang, S; Yelton, J; Linn, S; Markowitz, P; Martinez, G; Rodriguez, J L; Ackert, A; Adams, T; Askew, A; Bein, S; Hagopian, S; Hagopian, V; Johnson, K F; Prosper, H; Santra, A; Yohay, R; Baarmand, M M; Bhopatkar, V; Colafranceschi, S; Hohlmann, M; Noonan, D; Roy, T; Yumiceva, F; Adams, M R; Apanasevich, L; Berry, D; Betts, R R; Bucinskaite, I; Cavanaugh, R; Evdokimov, O; Gauthier, L; Gerber, C E; Hofman, D J; Jung, K; Sandoval Gonzalez, I D; Varelas, N; Wang, H; Wu, Z; Zakaria, M; Zhang, J; Bilki, B; Clarida, W; Dilsiz, K; Durgut, S; Gandrajula, R P; Haytmyradov, M; Khristenko, V; Merlo, J-P; Mermerkaya, H; Mestvirishvili, A; Moeller, A; Nachtman, J; Ogul, H; Onel, Y; Ozok, F; Penzo, A; Snyder, C; Tiras, E; Wetzel, J; Yi, K; Anderson, I; Blumenfeld, B; Cocoros, A; Eminizer, N; Fehling, D; Feng, L; Gritsan, A V; Maksimovic, P; Osherson, M; Roskes, J; Sarica, U; Swartz, M; Xiao, M; Xin, Y; You, C; Al-Bataineh, A; Baringer, P; Bean, A; Boren, S; Bowen, J; Castle, J; Forthomme, L; Kenny, R P; Khalil, S; Kropivnitskaya, A; Majumder, D; Mcbrayer, W; Murray, M; Sanders, S; Stringer, R; Tapia Takaki, J D; Wang, Q; Ivanov, A; Kaadze, K; Maravin, Y; Mohammadi, A; Saini, L K; Skhirtladze, N; Toda, S; Rebassoo, F; Wright, D; Anelli, C; Baden, A; Baron, O; Belloni, A; Calvert, B; Eno, S C; Ferraioli, C; Gomez, J A; Hadley, N J; Jabeen, S; Kellogg, R G; Kolberg, T; Kunkle, J; Lu, Y; Mignerey, A C; Ricci-Tam, F; Shin, Y H; Skuja, A; Tonjes, M B; Tonwar, S C; Abercrombie, D; Allen, B; Apyan, A; Azzolini, V; Barbieri, R; Baty, A; Bi, R; Bierwagen, K; Brandt, S; Busza, W; Cali, I A; D'Alfonso, M; Demiragli, Z; Di Matteo, L; Gomez Ceballos, G; Goncharov, M; Hsu, D; Iiyama, Y; Innocenti, G M; Klute, M; Kovalskyi, D; Krajczar, K; Lai, Y S; Lee, Y-J; Levin, A; Luckey, P D; Maier, B; Marini, A C; Mcginn, C; Mironov, C; Narayanan, S; Niu, X; Paus, C; Roland, C; Roland, G; Salfeld-Nebgen, J; Stephans, G S F; Tatar, K; Varma, M; Velicanu, D; Veverka, J; Wang, J; Wang, T W; Wyslouch, B; Yang, M; Benvenuti, A C; Chatterjee, R M; Evans, A; Hansen, P; Kalafut, S; Kao, S C; Kubota, Y; Lesko, Z; Mans, J; Nourbakhsh, S; Ruckstuhl, N; Rusack, R; Tambe, N; Turkewitz, J; Acosta, J G; Oliveros, S; Avdeeva, E; Bloom, K; Claes, D R; Fangmeier, C; Gonzalez Suarez, R; Kamalieddin, R; Kravchenko, I; Malta Rodrigues, A; Meier, F; Monroy, J; Siado, J E; Snow, G R; Stieger, B; Alyari, M; Dolen, J; Godshalk, A; Harrington, C; Iashvili, I; Kaisen, J; Kharchilava, A; Parker, A; Rappoccio, S; Roozbahani, B; Alverson, G; Barberis, E; Hortiangtham, A; Massironi, A; Morse, D M; Nash, D; Orimoto, T; De Lima, R Teixeira; Trocino, D; Wang, R-J; Wood, D; Bhattacharya, S; Charaf, O; Hahn, K A; Kumar, A; Mucia, N; Odell, N; Pollack, B; Schmitt, M H; Sung, K; Trovato, M; Velasco, M; Dev, N; Hildreth, M; Hurtado Anampa, K; Jessop, C; Karmgard, D J; Kellams, N; Lannon, K; Marinelli, N; Meng, F; Mueller, C; Musienko, Y; Planer, M; Reinsvold, A; Ruchti, R; Smith, G; Taroni, S; Wayne, M; Wolf, M; Woodard, A; Alimena, J; Antonelli, L; Bylsma, B; Durkin, L S; Flowers, S; Francis, B; Hart, A; Hill, C; Hughes, R; Ji, W; Liu, B; Luo, W; Puigh, D; Winer, B L; Wulsin, H W; Cooperstein, S; Driga, O; Elmer, P; Hardenbrook, J; Hebda, P; Lange, D; Luo, J; Marlow, D; Medvedeva, T; Mei, K; Olsen, J; Palmer, C; Piroué, P; Stickland, D; Svyatkovskiy, A; Tully, C; Malik, S; Barker, A; Barnes, V E; Folgueras, S; Gutay, L; Jha, M K; Jones, M; Jung, A W; Khatiwada, A; Miller, D H; Neumeister, N; Schulte, J F; Shi, X; Sun, J; Wang, F; Xie, W; Parashar, N; Stupak, J; Adair, A; Akgun, B; Chen, Z; Ecklund, K M; Geurts, F J M; Guilbaud, M; Li, W; Michlin, B; Northup, M; Padley, B P; Roberts, J; Rorie, J; Tu, Z; Zabel, J; Betchart, B; Bodek, A; de Barbaro, P; Demina, R; Duh, Y T; Ferbel, T; Galanti, M; Garcia-Bellido, A; Han, J; Hindrichs, O; Khukhunaishvili, A; Lo, K H; Tan, P; Verzetti, M; Agapitos, A; Chou, J P; Gershtein, Y; Gómez Espinosa, T A; Halkiadakis, E; Heindl, M; Hughes, E; Kaplan, S; Kunnawalkam Elayavalli, R; Kyriacou, S; Lath, A; Nash, K; Saka, H; Salur, S; Schnetzer, S; Sheffield, D; Somalwar, S; Stone, R; Thomas, S; Thomassen, P; Walker, M; Delannoy, A G; Foerster, M; Heideman, J; Riley, G; Rose, K; Spanier, S; Thapa, K; Bouhali, O; Celik, A; Dalchenko, M; De Mattia, M; Delgado, A; Dildick, S; Eusebi, R; Gilmore, J; Huang, T; Juska, E; Kamon, T; Mueller, R; Pakhotin, Y; Patel, R; Perloff, A; Perniè, L; Rathjens, D; Safonov, A; Tatarinov, A; Ulmer, K A; Akchurin, N; Cowden, C; Damgov, J; De Guio, F; Dragoiu, C; Dudero, P R; Faulkner, J; Gurpinar, E; Kunori, S; Lamichhane, K; Lee, S W; Libeiro, T; Peltola, T; Undleeb, S; Volobouev, I; Wang, Z; Greene, S; Gurrola, A; Janjam, R; Johns, W; Maguire, C; Melo, A; Ni, H; Sheldon, P; Tuo, S; Velkovska, J; Xu, Q; Arenton, M W; Barria, P; Cox, B; Goodell, J; Hirosky, R; Ledovskoy, A; Li, H; Neu, C; Sinthuprasith, T; Sun, X; Wang, Y; Wolfe, E; Xia, F; Clarke, C; Harr, R; Karchin, P E; Sturdy, J; Belknap, D A; Buchanan, J; Caillol, C; Dasu, S; Dodd, L; Duric, S; Gomber, B; Grothe, M; Herndon, M; Hervé, A; Klabbers, P; Lanaro, A; Levine, A; Long, K; Loveless, R; Ojalvo, I; Perry, T; Pierro, G A; Polese, G; Ruggles, T; Savin, A; Smith, N; Smith, W H; Taylor, D; Woods, N
2017-01-01
Searches are presented for direct production of top or bottom squark pairs in proton-proton collisions at the CERN LHC. Two searches, based on complementary techniques, are performed in all-jet final states that are characterized by a significant imbalance in transverse momentum. An additional search requires the presence of a charged lepton isolated from other activity in the event. The data were collected in 2015 at a centre-of-mass energy of 13[Formula: see text] with the CMS detector and correspond to an integrated luminosity of 2.3[Formula: see text]. No statistically significant excess of events is found beyond the expected contribution from standard model processes. Exclusion limits are set in the context of simplified models of top or bottom squark pair production. Models with top and bottom squark masses up to 830 and 890[Formula: see text], respectively, are probed for light neutralinos. For models with top squark masses of 675[Formula: see text], neutralino masses up to 260[Formula: see text] are excluded at 95% confidence level.
Searches for pair production of third-generation squarks in $$\\sqrt{s}=13$$ TeV pp collisions
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...
2017-05-18
Here, searches are presented for direct production of top or bottom squark pairs in proton–proton collisions at the CERN LHC. Two searches, based on complementary techniques, are performed in all-jet final states that are characterized by a significant imbalance in transverse momentum. An additional search requires the presence of a charged lepton isolated from other activity in the event. The data were collected in 2015 at a centre-of-mass energy of 13more » $$\\,\\text {TeV}$$ with the CMS detector and correspond to an integrated luminosity of 2.3 $$\\,\\text {fb}^{-1}$$. No statistically significant excess of events is found beyond the expected contribution from standard model processes. Exclusion limits are set in the context of simplified models of top or bottom squark pair production. Models with top and bottom squark masses up to 830 and 890 $$\\,\\text {GeV}$$, respectively, are probed for light neutralinos. For models with top squark masses of 675 $$\\,\\text {GeV}$$, neutralino masses up to 260 $$\\,\\text {GeV}$$ are excluded at 95% confidence level.« less
Unconventional pairing symmetry of interacting Dirac fermions on a π -flux lattice
NASA Astrophysics Data System (ADS)
Guo, Huaiming; Khatami, Ehsan; Wang, Yao; Devereaux, Thomas P.; Singh, Rajiv R. P.; Scalettar, Richard T.
2018-04-01
The pairing symmetry of interacting Dirac fermions on the π -flux lattice is studied with the determinant quantum Monte Carlo and numerical linked-cluster expansion methods. The s*- (i.e., extended s -) and d -wave pairing symmetries, which are distinct in the conventional square lattice, are degenerate under the Landau gauge. We demonstrate that the dominant pairing channel at strong interactions is an unconventional d s* -wave phase consisting of alternating stripes of s*- and d -wave phases. A complementary mean-field analysis shows that while the s*- and d -wave symmetries individually have nodes in the energy spectrum, the d s* channel is fully gapped. The results represent a new realization of pairing in Dirac systems, connected to the problem of chiral d -wave pairing on the honeycomb lattice, which might be more readily accessed by cold-atom experiments.
Unconventional pairing symmetry of interacting Dirac fermions on a π -flux lattice
Guo, Huaiming; Khatami, Ehsan; Wang, Yao; ...
2018-04-20
The pairing symmetry of interacting Dirac fermions on the π-flux lattice is studied with the determinant quantum Monte Carlo and numerical linked-cluster expansion methods. The s*- (i.e., extended s-) and d-wave pairing symmetries, which are distinct in the conventional square lattice, are degenerate under the Landau gauge. We demonstrate that the dominant pairing channel at strong interactions is an unconventional ds*-wave phase consisting of alternating stripes of s*- and d-wave phases. A complementary mean-field analysis shows that while the s*- and d-wave symmetries individually have nodes in the energy spectrum, the ds* channel is fully gapped. The results represent amore » new realization of pairing in Dirac systems, connected to the problem of chiral d-wave pairing on the honeycomb lattice, which might be more readily accessed by cold-atom experiments.« less
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
An All-Solution-Based Hybrid CMOS-Like Quantum Dot/Carbon Nanotube Inverter.
Shulga, Artem G; Derenskyi, Vladimir; Salazar-Rios, Jorge Mario; Dirin, Dmitry N; Fritsch, Martin; Kovalenko, Maksym V; Scherf, Ullrich; Loi, Maria A
2017-09-01
The development of low-cost, flexible electronic devices is subordinated to the advancement in solution-based and low-temperature-processable semiconducting materials, such as colloidal quantum dots (QDs) and single-walled carbon nanotubes (SWCNTs). Here, excellent compatibility of QDs and SWCNTs as a complementary pair of semiconducting materials for fabrication of high-performance complementary metal-oxide-semiconductor (CMOS)-like inverters is demonstrated. The n-type field effect transistors (FETs) based on I - capped PbS QDs (V th = 0.2 V, on/off = 10 5 , S S-th = 114 mV dec -1 , µ e = 0.22 cm 2 V -1 s -1 ) and the p-type FETs with tailored parameters based on low-density random network of SWCNTs (V th = -0.2 V, on/off > 10 5 , S S-th = 63 mV dec -1 , µ h = 0.04 cm 2 V -1 s -1 ) are integrated on the same substrate in order to obtain high-performance hybrid inverters. The inverters operate in the sub-1 V range (0.9 V) and have high gain (76 V/V), large maximum-equal-criteria noise margins (80%), and peak power consumption of 3 nW, in combination with low hysteresis (10 mV). © 2017 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Amino acid fermentation at the origin of the genetic code
2012-01-01
There is evidence that the genetic code was established prior to the existence of proteins, when metabolism was powered by ribozymes. Also, early proto-organisms had to rely on simple anaerobic bioenergetic processes. In this work I propose that amino acid fermentation powered metabolism in the RNA world, and that this was facilitated by proto-adapters, the precursors of the tRNAs. Amino acids were used as carbon sources rather than as catalytic or structural elements. In modern bacteria, amino acid fermentation is known as the Stickland reaction. This pathway involves two amino acids: the first undergoes oxidative deamination, and the second acts as an electron acceptor through reductive deamination. This redox reaction results in two keto acids that are employed to synthesise ATP via substrate-level phosphorylation. The Stickland reaction is the basic bioenergetic pathway of some bacteria of the genus Clostridium. Two other facts support Stickland fermentation in the RNA world. First, several Stickland amino acid pairs are synthesised in abiotic amino acid synthesis. This suggests that amino acids that could be used as an energy substrate were freely available. Second, anticodons that have complementary sequences often correspond to amino acids that form Stickland pairs. The main hypothesis of this paper is that pairs of complementary proto-adapters were assigned to Stickland amino acids pairs. There are signatures of this hypothesis in the genetic code. Furthermore, it is argued that the proto-adapters formed double strands that brought amino acid pairs into proximity to facilitate their mutual redox reaction, structurally constraining the anticodon pairs that are assigned to these amino acid pairs. Significance tests which randomise the code are performed to study the extent of the variability of the energetic (ATP) yield. Random assignments can lead to a substantial yield of ATP and maintain enough variability, thus selection can act and refine the assignments into a proto-code that optimises the energetic yield. Monte Carlo simulations are performed to evaluate the establishment of these simple proto-codes, based on amino acid substitutions and codon swapping. In all cases, donor amino acids are assigned to anticodons composed of U+G, and have low redundancy (1-2 codons), whereas acceptor amino acids are assigned to the the remaining codons. These bioenergetic and structural constraints allow for a metabolic role for amino acids before their co-option as catalyst cofactors. Reviewers: this article was reviewed by Prof. William Martin, Prof. Eörs Szathmáry (nominated by Dr. Gáspár Jékely) and Dr. Ádám Kun (nominated by Dr. Sandor Pongor) PMID:22325238
DNA attachment to support structures
Balhorn, Rodney L.; Barry, Christopher H.
2002-01-01
Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).
Transcription and translation in an RNA world
Taylor, William R
2006-01-01
The RNA world hypothesis requires a ribozyme that was an RNA-directed RNA polymerase (ribopolymerase). If such a replicase makes a reverse complementary copy of any sequence (including itself), in a simple RNA world, there is no mechanism to prevent self-hybridization. It is proposed that this can be avoided through the synthesis of a parallel complementary copy. The logical consequences of this are pursued and developed in a computer simulation, where the behaviour of the parallel copy is compared to the conventional reverse complementary copy. It is found that the parallel copy is more efficient at higher temperatures (up to 90°C). A model for the ribopolymerase, based on the core of the large subunit (LSU) of the ribosome, is described. The geometry of a potential active site for this ribopolymerase suggests that it contained a cavity (now occupied by the aminoacyl-tRNA) and that an amino acid binding in this might have ‘poisoned’ the ribopolymerase by cross-reacting with the nucleoside-triphosphate before polymerization could occur. Based on a similarity to the active site components of the class-I tRNA synthetase enzymes, it is proposed that the amino acid could become attached to the nascent RNA transcript producing a variety of aminoacylated tRNA-like products. Using base-pairing interactions, some of these molecules might cross-link two ribopolymerases, giving rise to a precursor of the modern ribosome. A hybrid dimer, half polymerase and half proto-ribosome, could account for mRNA translocation before the advent of protein elongation factors. PMID:17008216
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Circular RNAs: Unexpected outputs of many protein-coding genes
Wilusz, Jeremy E.
2017-01-01
ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848
Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R
1999-07-30
A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A
2011-06-14
Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.
DNA nanostructure-based drug delivery nanosystems in cancer therapy.
Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei
2017-11-25
DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.
Form-Focused Interaction in Online Tandem Learning
ERIC Educational Resources Information Center
O'Rourke, Breffni
2005-01-01
Tandem language learning--a configuration involving pairs of learners with complementary target/native languages--is an underexploited but potentially very powerful use of computer-mediated communication (CMC) in second-language pedagogy. Tandem offers the benefits of authentic, culturally grounded interaction, while also promoting a pedagogical…
Second-generation supramolecular dendrimer with a defined structure due to orthogonal binding.
Eckelmann, Jens; Dethlefs, Christiane; Brammer, Stefan; Doğan, Ahmet; Uphoff, Andreas; Lüning, Ulrich
2012-07-02
A second-generation supramolecular dendrimer has been prepared by orthogonal multiple hydrogen bonding. In the first (inner) recognition domain, the interaction of one bis-isocyanuric acid (25) with two branching units (21) that carry complementary Hamilton receptors has been exploited. In the second (outer) generation, the two ADDA (A=hydrogen-bond acceptor, D=donor) receptors of each branching unit (21) have bound complementary DAAD units (4). The problem of limited solubility of the building blocks has been overcome by the introduction of branched ethylhexyl residues and by the use of flexible alkylene or oligo(ethylene glycol) linking chains. The orthogonal binding of the two hydrogen-bonding pairs was elucidated by chemical induced shift NMR titrations, which proved that the two pairs, isocyanuric acid with the Hamilton receptor and ADDA with DAAD, bind preferentially. The formation of the supramolecular self-assembled 1:2:4 dendrimer with a molecular weight of 5065 g mol(-1) was investigated by diffusion NMR spectroscopy. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tiller, William A
2010-04-01
In Part I of this pair of articles, the fundamental experimental observations and theoretical perspectives were provided for one to understand the key differences between our normal, uncoupled state of physical reality and the human consciousness-induced coupled state of physical reality. Here in Part II, the thermodynamics of complementary and alternative medicine, which deals with the partially coupled state of physical reality, is explored via the use of five different foci of relevance to today's science and medicine: (1) homeopathy; (2) the placebo effect; (3) long-range, room temperature, macroscopic size-scale, information entanglement; (4) an explanation for dark matter/energy plus human levitation possibility; and (5) electrodermal diagnostic devices. The purpose of this pair of articles is to clearly differentiate the use and limitations of uncoupled state physics in both nature and today's orthodox medicine from coupled state physics in tomorrow's complementary and alternative medicine.
Park, Eonyoung; Maquat, Lynne E.
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777
A metallo-DNA nanowire with uninterrupted one-dimensional silver array
NASA Astrophysics Data System (ADS)
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Hattori, Yoshikazu; Saneyoshi, Hisao; Ono, Akira; Tanaka, Yoshiyuki
2017-10-01
The double-helix structure of DNA, in which complementary strands reversibly hybridize to each other, not only explains how genetic information is stored and replicated, but also has proved very attractive for the development of nanomaterials. The discovery of metal-mediated base pairs has prompted the generation of short metal-DNA hybrid duplexes by a bottom-up approach. Here we describe a metallo-DNA nanowire—whose structure was solved by high-resolution X-ray crystallography—that consists of dodecamer duplexes held together by four different metal-mediated base pairs (the previously observed C-Ag-C, as well as G-Ag-G, G-Ag-C and T-Ag-T) and linked to each other through G overhangs involved in interduplex G-Ag-G. The resulting hybrid nanowires are 2 nm wide with a length of the order of micrometres to millimetres, and hold the silver ions in uninterrupted one-dimensional arrays along the DNA helical axis. The hybrid nanowires are further assembled into three-dimensional lattices by interactions between adenine residues, fully bulged out of the double helix.
Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B
2018-07-01
Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.
Intrinsic flexibility of B-DNA: the experimental TRX scale.
Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2010-01-01
B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.
Means, John A.; Simson, Crystal M.; Zhou, Shu; Rachford, Aaron A.; Rack, Jeffrey J.; Hines, Jennifer V.
2009-01-01
The T box transcription antitermination riboswitch is one of the main regulatory mechanisms utilized by Gram-positive bacteria to regulate genes that are involved in amino acid metabolism. The details of the antitermination event, including the role that Mg2+ plays, in this riboswitch have not been completely elucidated. In these studies, details of the antitermination event were investigated utilizing 2-aminopurine to monitor structural changes of a model antiterminator RNA when it was bound to model tRNA. Based on the results of these fluorescence studies, the model tRNA binds the model antiterminator RNA via an induced fit. This binding is enhanced by the presence of Mg2+, facilitating the complete base pairing of the model tRNA acceptor end with the complementary bases in the model antiterminator bulge. PMID:19755116
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Carlsson, Anders; Kuhn, Peter; Luttgen, Madelyn S.; Dizon, Kevin K.; Troncoso, Patricia; Corn, Paul G.; Kolatkar, Anand; Hicks, James B.; Logothetis, Christopher J.; Zurita., Amado J.
2017-01-01
Purpose Recent studies demonstrate that prostate cancer clones from different metastatic sites are dynamically represented in the blood of patients over time, suggesting that the paired evaluation of tumor cells in circulation and bone marrow, the primary target for prostate cancer metastasis, may provide complementary information. Experimental Design We adapted our single-cell high-content liquid biopsy platform to bone marrow aspirates (BMA), to concurrently identify and characterize prostate cancer cells in patients’ blood and bone and thus discern features associated to tumorigenicity and dynamics of metastatic progression. Results The incidence of tumor cells in BMAs increased as the disease advanced: 0% in biochemically-recurrent (n=52), 26% in newly diagnosed metastatic hormone-naïve (n=26), and 39% in metastatic castration-resistant (mCRPC; n=63) patients, and their number was often higher than in paired blood. Tumor cell detection in metastatic patients’ BMAs was concordant but 45% more sensitive than using traditional histopathologic interpretation of core bone marrow biopsies. Tumor cell clusters were more prevalent and bigger in BMAs than in blood, expressed higher levels of the androgen receptor protein per tumor cell and were prognostic in mCRPC. Moreover, the patterns of genomic copy number variation in single tumor cells in paired blood and BMAs showed significant inter and intrapatient heterogeneity. Conclusions Paired analysis of single prostate cancer cells in blood and bone shows promise for clinical application and provides complementary information. The high prevalence and prognostic significance of tumor cell clusters particularly in BMAs, suggest that these structures are key mediators of prostate cancer’s metastatic progression. PMID:27702818
Arikpo, Dachi; Edet, Ededet Sewanu; Chibuzor, Moriam T; Odey, Friday; Caldwell, Deborah M
2018-05-18
Although complementary feeding is a universal practice, the methods and manner in which it is practiced vary between cultures, individuals and socioeconomic classes. The period of complementary feeding is a critical time of transition in the life of an infant, and inappropriate complementary feeding practices, with their associated adverse health consequences, remain a significant global public health problem. Educational interventions are widely acknowledged as effective in promoting public health strategy, and those aimed at improving complementary feeding practices provide information about proper complementary feeding practices to caregivers of infants/children. It is therefore important to summarise evidence on the effectiveness of educational interventions to improve the complementary feeding practices of caregivers of infants. To assess the effectiveness of educational interventions for improving the complementary feeding (weaning) practices of primary caregivers of children of complementary feeding age, and related health and growth outcomes in infants. In November 2017, we searched CENTRAL, MEDLINE, Embase, 10 other databases and two trials registers. We also searched the reference lists of relevant studies and reviews to identify any additional studies. We did not limit the searches by date, language or publication status. Randomised controlled trials (RCTs), comparing educational interventions to no intervention, usual practice, or educational interventions provided in conjunction with another intervention, so long as the educational intervention was only available in the experimental group and the adjunctive intervention was available to the control group. Study participants included caregivers of infants aged 4 to 24 months undergoing complementary feeding. Pregnant women who were expected to give birth and commence complementary feeding during the period of the study were also included. Two review authors independently extracted data on participants, settings, interventions, methodology and outcomes using a specifically-developed and piloted data extraction form. We calculated risk ratios (RR) and 95% confidence intervals (CIs) for dichotomous data, and mean differences (MD) and 95% CIs for continuous data. Where data permitted, we conducted a meta-analysis using a random-effects model. We assessed the included studies for risk of bias and also assessed the quality of evidence using the GRADE approach. We included 23 studies (from 35 reports) with a total of 11,170 caregiver-infant pairs who were randomly assigned to receive an educational intervention delivered to the caregiver or usual care. Nineteen of the included studies were community-based studies while four were facility-based studies. In addition, 13 of the included studies were cluster-randomised while the others were individually randomised. Generally, the interventions were focused on the introduction of complementary feeding at the appropriate time, the types and amount of complementary foods to be fed to infants, and hygiene. Using the GRADE criteria, we assessed the quality of the evidence as moderate, mostly due to inadequate allocation concealment and insufficient blinding.Educational interventions led to improvements in complementary feeding practices for age at introduction of complementary foods (average RR 0.88, 95% CI 0.83 to 0.94; 4 studies, 1738 children; moderate-quality evidence) and hygiene practices (average RR 1.38, 95% CI 1.23 to 1.55; 4 studies, 2029 participants; moderate-quality evidence). For duration of exclusive breastfeeding, pooled results were compatible with both a reduction and an increase in the outcome (average RR 1.58, 95% CI 0.77 to 3.22; 3 studies, 1544 children; very low-quality evidence). There was limited (low to very low-quality) evidence of an effect for all growth outcomes.Quality of evidenceThere is moderate to very low-quality evidence that educational interventions can improve complementary feeding practices but insufficient evidence to conclude that it impacts growth outcomes. Overall, we found evidence that education improves complementary feeding practices.
Yamasaki, Tomohito; Voshall, Adam; Kim, Eun-Jeong; Moriyama, Etsuko; Cerutti, Heriberto; Ohama, Takeshi
2013-12-01
MicroRNAs (miRNAs) are 20-24 nt non-coding RNAs that play important regulatory roles in a broad range of eukaryotes by pairing with mRNAs to direct post-transcriptional repression. The mechanistic details of miRNA-mediated post-transcriptional regulation have been well documented in multicellular model organisms. However, this process remains poorly studied in algae such as Chlamydomonas reinhardtii, and specific features of miRNA biogenesis, target mRNA recognition and subsequent silencing are not well understood. In this study, we report on the characterization of a Chlamydomonas miRNA, cre-miR1174.2, which is processed from a near-perfect hairpin RNA. Using Gaussia luciferase (gluc) reporter genes, we have demonstrated that cre-miR1174.2 is functional in Chlamydomonas and capable of triggering site-specific cleavage at the center of a perfectly complementary target sequence. A mismatch tolerance test assay, based on pools of transgenic strains, revealed that target hybridization to nucleotides of the seed region, at the 5' end of an miRNA, was sufficient to induce moderate repression of expression. In contrast, pairing to the 3' region of the miRNA was not critical for silencing. Our results suggest that the base-pairing requirements for small RNA-mediated repression in C. reinhardtii are more similar to those of metazoans compared with the extensive complementarity that is typical of land plants. Individual Chlamydomonas miRNAs may potentially modulate the expression of numerous endogenous targets as a result of these relaxed base-pairing requirements. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Self-assembly of free-standing RNA membranes
NASA Astrophysics Data System (ADS)
Han, Daehoon; Park, Yongkuk; Kim, Hyejin; Lee, Jong Bum
2014-07-01
RNA has emerged as a promising material for nanostructure and microstructure engineering. Although rare, some macroscopic RNA structures have also been constructed using lipid or polymer materials. Here, we report the first example of an enzymatically generated RNA membrane. This robust and free-standing RNA membrane has a macroscopic structure and is generated without any polymer support or complexation. Our RNA membrane is fabricated following two sequential processes, complementary rolling circle transcription and evaporation-induced self-assembly, and its structural and functional properties are rationally controlled by adjusting RNA base pairing. In this study, three types of RNA membranes are fabricated and are used to demonstrate potential applications.
Mohana, Marimuthu; Muthiah, Packianathan Thomas; McMillen, Colin D
2017-03-01
The design of a pharmaceutical cocrystal is based on the identification of specific hydrogen-bond donor and acceptor groups in active pharmaceutical ingredients (APIs) in order to choose a `complementary interacting' molecule that can act as an efficient coformer. 5-Fluorouracil (5FU) is a pyrimidine derivative with two N-H donors and C=O acceptors and shows a diversity of hydrogen-bonding motifs. Two 1:1 cocrystals of 5-fluorouracil (5FU), namely 5-fluorouracil-4-methylbenzoic acid (5FU-MBA), C 4 H 3 FN 2 O 2 ·C 8 H 8 O 2 , (I), and 5-fluorouracil-3-nitrobenzoic acid (5FU-NBA), C 4 H 3 FN 2 O 2 ·C 7 H 5 NO 4 , (II), have been prepared and characterized by single-crystal X-ray diffraction. In (I), the MBA molecules form carboxylic acid dimers [R 2 2 (8) homosynthon]. Similarly, the 5FU molecules form two types of base pair via a pair of N-H...O hydrogen bonds [R 2 2 (8) homosynthon]. In (II), 5FU interacts with the carboxylic acid group of NBA via N-H...O and O-H...O hydrogen bonds, generating an R 2 2 (8) ring motif (heterosynthon). Furthermore, the 5FU molecules form base pairs [R 2 2 (8) homosynthon] via N-H...O hydrogen bonds. Both of the crystal structures are stabilized by C-H...F interactions.
NASA Astrophysics Data System (ADS)
Cernansky, Robert; Martini, Francesco; Politi, Alberto
2018-02-01
We demonstrate on chip generation of correlated pairs of photons in the near-visible spectrum using a CMOS compatible PECVD Silicon Nitride photonic device. Photons are generated via spontaneous four wave mixing enhanced by a ring resonator with high quality Q-factor of 320,000 resulting in a generation rate of 950,000 $\\frac{pairs}{mW}$. The high brightness of this source offers the opportunity to expand photonic quantum technologies over a broad wavelength range and provides a path to develop fully integrated quantum chips working at room temperature.
NASA Astrophysics Data System (ADS)
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.
Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed
2017-12-18
The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this effect is used for quantification of this food-borne pathogen.
Op. Amps in Power Amplification: A Laboratory Exercise on Feedback.
ERIC Educational Resources Information Center
Borcherds, P. H.
1984-01-01
To demonstrate negative feedback a power amplifier is constructed from an operational amplifier together with a complementary pair of transistors as an output stage. The amplifier is developed and tested stage by stage, and at each stage the defects apparent at the previous stage are eliminated. (JN)
Zhang, Laibin; Li, Huifang; Li, Jilai; Chen, Xiaohua; Bu, Yuxiang
2010-03-01
A comprehensive theoretical study of electronic transitions of naphtho-homologated base analogs, namely, yy-T, yy-C, yy-A, and yy-G, was performed. The nature of the low-lying excited states is discussed, and the results are compared with those from experiment and also with those of y-bases. Geometrical characteristics of the lowest excited singlet pipi* and npi* states were explored using the CIS method, and the effects of methanol solution and paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were examined. The calculated excitation and emission energies agree well with the measured data, where experimental results are available. In methanol solution, the fluorescence from yy-A and yy-G would be expected to occur around 539 and 562 nm, respectively, suggesting that yy-A is a green-colored fluorophore, whereas yy-G is a yellow-colored fluorophore. The methanol solution was found to red-shift both the absorption and emission maxima of yy-A, yy-T, and yy-C, but blue-shift those for yy-G. Generally, though base pairing has no significant effects on the absorption and fluorescence maxima of yy-A, yy-C, and yy-T, it blue-shifts those for yy-G. (c) 2009 Wiley Periodicals, Inc.
Guan, Xiaoyan; Brownstein, Naomi C; Young, Nicolas L; Marshall, Alan G
2017-01-30
Bottom-up tandem mass spectrometry (MS/MS) is regularly used in proteomics to identify proteins from a sequence database. De novo sequencing is also available for sequencing peptides with relatively short sequence lengths. We recently showed that paired Lys-C and Lys-N proteases produce peptides of identical mass and similar retention time, but different tandem mass spectra. Such parallel experiments provide complementary information, and allow for up to 100% MS/MS sequence coverage. Here, we report digestion by paired Lys-C and Lys-N proteases of a seven-protein mixture: human hemoglobin alpha, bovine carbonic anhydrase 2, horse skeletal muscle myoglobin, hen egg white lysozyme, bovine pancreatic ribonuclease, bovine rhodanese, and bovine serum albumin, followed by reversed-phase nanoflow liquid chromatography, collision-induced dissociation, and 14.5 T Fourier transform ion cyclotron resonance mass spectrometry. Matched pairs of product peptide ions of equal precursor mass and similar retention times from each digestion are compared, leveraging single-residue transposed information with independent interferences to confidently identify fragment ion types, residues, and peptides. Selected pairs of product ion mass spectra for de novo sequenced protein segments from each member of the mixture are presented. Pairs of the transposed product ions as well as complementary information from the parallel experiments allow for both high MS/MS coverage for long peptide sequences and high confidence in the amino acid identification. Moreover, the parallel experiments in the de novo sequencing reduce false-positive matches of product ions from the single-residue transposed peptides from the same segment, and thereby further improve the confidence in protein identification. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
ADEpedia 2.0: Integration of Normalized Adverse Drug Events (ADEs) Knowledge from the UMLS.
Jiang, Guoqian; Liu, Hongfang; Solbrig, Harold R; Chute, Christopher G
2013-01-01
A standardized Adverse Drug Events (ADEs) knowledge base that encodes known ADE knowledge can be very useful in improving ADE detection for drug safety surveillance. In our previous study, we developed the ADEpedia that is a standardized knowledge base of ADEs based on drug product labels. The objectives of the present study are 1) to integrate normalized ADE knowledge from the Unified Medical Language System (UMLS) into the ADEpedia; and 2) to enrich the knowledge base with the drug-disorder co-occurrence data from a 51-million-document electronic medical records (EMRs) system. We extracted 266,832 drug-disorder concept pairs from the UMLS, covering 14,256 (1.69%) distinct drug concepts and 19,006 (3.53%) distinct disorder concepts. Of them, 71,626 (26.8%) concept pairs from UMLS co-occurred in the EMRs. We performed a preliminary evaluation on the utility of the UMLS ADE data. In conclusion, we have built an ADEpedia 2.0 framework that intends to integrate known ADE knowledge from disparate sources. The UMLS is a useful source for providing standardized ADE knowledge relevant to indications, contraindications and adverse effects, and complementary to the ADE data from drug product labels. The statistics from EMRs would enable the meaningful use of ADE data for drug safety surveillance.
Olexa, Edward M.; Lawrence, Rick L
2014-01-01
Federal land management agencies provide stewardship over much of the rangelands in the arid andsemi-arid western United States, but they often lack data of the proper spatiotemporal resolution andextent needed to assess range conditions and monitor trends. Recent advances in the blending of com-plementary, remotely sensed data could provide public lands managers with the needed information.We applied the Spatial and Temporal Adaptive Reflectance Fusion Model (STARFM) to five Landsat TMand concurrent Terra MODIS scenes, and used pixel-based regression and difference image analyses toevaluate the quality of synthetic reflectance and NDVI products associated with semi-arid rangeland. Pre-dicted red reflectance data consistently demonstrated higher accuracy, less bias, and stronger correlationwith observed data than did analogous near-infrared (NIR) data. The accuracy of both bands tended todecline as the lag between base and prediction dates increased; however, mean absolute errors (MAE)were typically ≤10%. The quality of area-wide NDVI estimates was less consistent than either spectra lband, although the MAE of estimates predicted using early season base pairs were ≤10% throughout the growing season. Correlation between known and predicted NDVI values and agreement with the 1:1regression line tended to decline as the prediction lag increased. Further analyses of NDVI predictions,based on a 22 June base pair and stratified by land cover/land use (LCLU), revealed accurate estimates through the growing season; however, inter-class performance varied. This work demonstrates the successful application of the STARFM algorithm to semi-arid rangeland; however, we encourage evaluation of STARFM’s performance on a per product basis, stratified by LCLU, with attention given to the influence of base pair selection and the impact of the time lag.
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-01-01
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-09-11
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.
Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart
2014-11-01
In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.
Lee, Jong Won; Choi, Yoon Suk; Ahn, Hyungju; Jo, Won Ho
2016-05-04
Ternary blends composed of two donor absorbers with complementary absorptions provide an opportunity to enhance the short-circuit current and thus the power conversion efficiency (PCE) of organic solar cells. In addition to complementary absorption of two donors, ternary blends may exhibit favorable morphology for high-performance solar cells when one chooses properly the donor pair. For this purpose, we develop a ternary blend with two donors (diketopyrrolopyrrole-based polymer (PTDPP2T) and small molecule ((TDPP)2Ph)) and one acceptor (PC71BM). The solar cell made of a ternary blend with 10 wt % (TDPP)2Ph exhibits higher PCE of 7.49% as compared with the solar cells with binary blends, PTDPP2T:PC71BM (6.58%) and (TDPP)2Ph:PC71BM (3.21%). The higher PCE of the ternary blend solar cell is attributed mainly to complementary absorption of two donors. However, a further increase in (TDPP)2Ph content in the ternary blend (>10 wt %) decreases the PCE. The ternary blend with 10 wt % (TDPP)2Ph exhibits well-developed morphology with narrow-sized fibrils while the blend with 15 wt % (TDPP)2Ph shows phase separation with large-sized domains, demonstrating that the phase morphology and compatibility of ternary blend are important factors to achieve a high-performance solar cell made of ternary blends.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tosello, Michèle; Lévêque, Françoise; Dutillieu, Stéphanie; Hernandez, Guillaume; Vautier, Jean-François
2012-01-01
This communication presents some elements which come from the experience feedback at CEA about the conditions for the successful integration of HOF in the nuclear safety analysis. To point out some of these conditions, one of the concepts proposed by Edgar Morin to describe the functioning of "complex" systems: the dialogical principle has been used. The idea is to look for some dialogical pairs. The elements of this kind of pair are both complementary and antagonist to one another. Three dialogical pairs are presented in this communication. The first two pairs are related to the organization of the HOF network and the last one is related to the methods which are used to analyse the working situations. The three pairs are: specialist - non-specialist actors of the network, centralized - distributed human resources in the network and microscopic - macroscopic levels of HOF methods to analyse the working situations. To continuously improve these three dialogical pairs, it is important to keep the differences which exist between the two elements of a pair and to find and maintain a balance between the two elements of the pairs.
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
NASA Astrophysics Data System (ADS)
Mura, José C.; Paradella, Waldir R.; Gama, Fabio F.; Santos, Athos R.; Galo, Mauricio; Camargo, Paulo O.; Silva, Arnaldo Q.; Silva, Guilherme G.
2014-10-01
We present an investigation of surface deformation using Differential SAR Interferometry (DInSAR) time-series carried out in an active open pit iron mine, the N5W, located in the Carajás Mineral Province (Brazilian Amazon region), using 33 TerraSAR-X (TSX-1) scenes. This mine has presented a historical of instability and surface monitoring measurements over sectors of the mine (pit walls) have been done based on ground based radar. Two complementary approaches were used: the standard DInSAR configuration, as an early warning of the slope instability conditions, and the DInSAR timeseries analysis. In order to decrease the topographic phase error a high resolution DEM was generated based on a stereo GeoEye-1 pair. Despite the fact that a DinSAR contains atmospheric and topographic phase artifacts and noise, it was possible to detect deformation in some interferometric pairs, covering pit benches, road ramps and waste piles. The timeseries analysis was performed using the 31 interferometric pairs, which were selected based on the highest mean coherence of a stack of 107 interferograms, presenting less phase unwrapping errors. The time-series deformation was retrieved by the Least-Squares (LS) solution using an extension of the Singular Value Decomposition (SVD), with a set of additional weighted constrain on the acceleration deformation. The atmospheric phase artifacts were filtered in the space-time domain and the DEM height errors were estimated based on the normal baseline diversity. The DInSAR time-series investigation showed good results for monitoring surface displacement in the N5W mine located in a tropical rainforest environment, providing very useful information about the ground movement for alarm, planning and risk assessment.
Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates
Flores-Jasso, C. Fabián; Salomon, William E.; Zamore, Phillip D.
2013-01-01
Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2′-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete. PMID:23249751
Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates.
Flores-Jasso, C Fabián; Salomon, William E; Zamore, Phillip D
2013-02-01
Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2'-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete.
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek
2015-01-01
Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.
Park, Eonyoung; Maquat, Lynne E
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.
In vivo differentiation of complementary contrast media at dual-energy CT.
Mongan, John; Rathnayake, Samira; Fu, Yanjun; Wang, Runtang; Jones, Ella F; Gao, Dong-Wei; Yeh, Benjamin M
2012-10-01
To evaluate the feasibility of using a commercially available clinical dual-energy computed tomographic (CT) scanner to differentiate the in vivo enhancement due to two simultaneously administered contrast media with complementary x-ray attenuation ratios. Approval from the institutional animal care and use committee was obtained, and National Institutes of Health guidelines for the care and use of laboratory animals were observed. Dual-energy CT was performed in a set of iodine and tungsten solution phantoms and in a rabbit in which iodinated intravenous and bismuth subsalicylate oral contrast media were administered. In addition, a second rabbit was studied after intravenous administration of iodinated and tungsten cluster contrast media. Images were processed to produce virtual monochromatic images that simulated the appearance of conventional single-energy scans, as well as material decomposition images that separate the attenuation due to each contrast medium. Clear separation of each of the contrast media pairs was seen in the phantom and in both in vivo animal models. Separation of bowel lumen from vascular contrast medium allowed visualization of bowel wall enhancement that was obscured by intraluminal bowel contrast medium on conventional CT scans. Separation of two vascular contrast media in different vascular phases enabled acquisition of a perfectly coregistered CT angiogram and venous phase-enhanced CT scan simultaneously in a single examination. Commercially available clinical dual-energy CT scanners can help differentiate the enhancement of selected pairs of complementary contrast media in vivo. © RSNA, 2012.
In Vivo Differentiation of Complementary Contrast Media at Dual-Energy CT
Mongan, John; Rathnayake, Samira; Fu, Yanjun; Wang, Runtang; Jones, Ella F.; Gao, Dong-Wei
2012-01-01
Purpose: To evaluate the feasibility of using a commercially available clinical dual-energy computed tomographic (CT) scanner to differentiate the in vivo enhancement due to two simultaneously administered contrast media with complementary x-ray attenuation ratios. Materials and Methods: Approval from the institutional animal care and use committee was obtained, and National Institutes of Health guidelines for the care and use of laboratory animals were observed. Dual-energy CT was performed in a set of iodine and tungsten solution phantoms and in a rabbit in which iodinated intravenous and bismuth subsalicylate oral contrast media were administered. In addition, a second rabbit was studied after intravenous administration of iodinated and tungsten cluster contrast media. Images were processed to produce virtual monochromatic images that simulated the appearance of conventional single-energy scans, as well as material decomposition images that separate the attenuation due to each contrast medium. Results: Clear separation of each of the contrast media pairs was seen in the phantom and in both in vivo animal models. Separation of bowel lumen from vascular contrast medium allowed visualization of bowel wall enhancement that was obscured by intraluminal bowel contrast medium on conventional CT scans. Separation of two vascular contrast media in different vascular phases enabled acquisition of a perfectly coregistered CT angiogram and venous phase–enhanced CT scan simultaneously in a single examination. Conclusion: Commercially available clinical dual-energy CT scanners can help differentiate the enhancement of selected pairs of complementary contrast media in vivo. © RSNA, 2012 PMID:22778447
Large scale DNA microsequencing device
Foote, Robert S.
1997-01-01
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.
Large scale DNA microsequencing device
Foote, Robert S.
1999-01-01
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.
Shieh, H S; Berman, H M; Dabrow, M; Neidle, S
1980-01-01
A 2:2 complex of proflavine and deoxycytidylyl-3', 5'-guanosine has been crystallized and its structure determined by x-ray crystallography. The two dinucleoside phosphate strands form self complementary duplexes with Watson Crick hydrogen bonds. One proflavin is asymmetrically intercalated between the base pairs and the other is stacked above them. The conformations of the nucleotides are unusual in that one strand has C3',C2'endomixed sugar puckering and the other has C3',C3' endo deoxyribose sugars. These results show that the conformation of the 3'sugar is of secondary importance to the intercalated geometry. PMID:7355129
Large scale DNA microsequencing device
Foote, R.S.
1999-08-31
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.
Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs
Shen, Xiulong; Corey, David R
2018-01-01
Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
Wise, Marcus B.; Thompson, Cyril V.
1998-01-01
An in-line gas monitor capable of accurate gas composition analysis in a continuous real time manner even under strong applied vacuum conditions operates by mixing an air sample with helium forming a sample gas in two complementary sample loops embedded in a manifold which includes two pairs of 3-way solenoid valves. The sample gas is then analyzed in an ion trap mass spectrometer on a continuous basis. Two valve drivers actuate the two pairs of 3-way valves in a reciprocating fashion, so that there is always flow through the in-line gas monitor via one or the other of the sample loops. The duty cycle for the two pairs of 3-way valves is varied by tuning the two valve drivers to a duty cycle typically between 0.2 to 0.7 seconds.
Basics of DNA biosensors and cancer diagnosis.
Sohrabi, Nasrin; Valizadeh, Alireza; Farkhani, Samad Mussa; Akbarzadeh, Abolfazl
2016-01-01
The human genome is exposed to mutations during the life cycle because of many types of changes in the DNA. Viruses, radiation, transposons, mutagenic chemicals, or any errors that happen during DNA replication or the meiotic process in the cell, may cause the mutation. Many mutations have no effect on phenotype or health, while some mutations cause crucial diseases such as cancer or cardiac diseases; therefore, a better understanding of the effects of mutation on phenotype is a very important part of genetic studies. Biosensors based on DNA, RNA, and peptide nucleic acids are the most sensitive tools, due to a strong pairing of lined up nucleotide strands between bases in their complementary parts. These methods can provide information to assist clinicians in making successful treatment decisions and increase the patient survival rate. In this review, we discuss DNA biosensors based on peptide nucleic acids that have an important role in cancer diagnosis.
Test of mutually unbiased bases for six-dimensional photonic quantum systems
D'Ambrosio, Vincenzo; Cardano, Filippo; Karimi, Ebrahim; Nagali, Eleonora; Santamato, Enrico; Marrucci, Lorenzo; Sciarrino, Fabio
2013-01-01
In quantum information, complementarity of quantum mechanical observables plays a key role. The eigenstates of two complementary observables form a pair of mutually unbiased bases (MUBs). More generally, a set of MUBs consists of bases that are all pairwise unbiased. Except for specific dimensions of the Hilbert space, the maximal sets of MUBs are unknown in general. Even for a dimension as low as six, the identification of a maximal set of MUBs remains an open problem, although there is strong numerical evidence that no more than three simultaneous MUBs do exist. Here, by exploiting a newly developed holographic technique, we implement and test different sets of three MUBs for a single photon six-dimensional quantum state (a “qusix”), encoded exploiting polarization and orbital angular momentum of photons. A close agreement is observed between theory and experiments. Our results can find applications in state tomography, quantitative wave-particle duality, quantum key distribution. PMID:24067548
Test of mutually unbiased bases for six-dimensional photonic quantum systems.
D'Ambrosio, Vincenzo; Cardano, Filippo; Karimi, Ebrahim; Nagali, Eleonora; Santamato, Enrico; Marrucci, Lorenzo; Sciarrino, Fabio
2013-09-25
In quantum information, complementarity of quantum mechanical observables plays a key role. The eigenstates of two complementary observables form a pair of mutually unbiased bases (MUBs). More generally, a set of MUBs consists of bases that are all pairwise unbiased. Except for specific dimensions of the Hilbert space, the maximal sets of MUBs are unknown in general. Even for a dimension as low as six, the identification of a maximal set of MUBs remains an open problem, although there is strong numerical evidence that no more than three simultaneous MUBs do exist. Here, by exploiting a newly developed holographic technique, we implement and test different sets of three MUBs for a single photon six-dimensional quantum state (a "qusix"), encoded exploiting polarization and orbital angular momentum of photons. A close agreement is observed between theory and experiments. Our results can find applications in state tomography, quantitative wave-particle duality, quantum key distribution.
Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.
Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris
2016-07-15
A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Focusing light in a bianisotropic slab with negatively refracting materials.
Liu, Yan; Guenneau, Sebastien; Gralak, Boris; Ramakrishna, S Anantha
2013-04-03
We investigate the electromagnetic response of a pair of complementary bianisotropic media, which consist of a medium with positive refractive index (+ε, +μ, +ξ) and a medium with negative refractive index(-ε, -μ, -ξ). We show that this idealized system has peculiar imaging properties in that it reproduces images of a source, in principle, with unlimited resolution. We then consider an infinite array of line sources regularly spaced in a 1D photonic crystal (PC) consisting of 2n layers of bianisotropic complementary media. Using coordinate transformations, we map this system into 2D corner chiral lenses of 2n heterogeneous anisotropic complementary media sharing a vertex, within which light circles around closed trajectories. Alternatively, one can consider corner lenses with homogeneous isotropic media and map them into 1D PCs with heterogeneous bianisotropic layers. Interestingly, such complementary media are described by scalar, or matrix valued, sign-shifting parameters, which satisfy a new version of the generalized lens theorem of Pendry and Ramakrishna. This theorem can be derived using Fourier series solutions of the Maxwell-Tellegen equations, or from space-time symmetry arguments. Also of interest are 2D periodic checkerboards consisting of alternating rectangular cells of complementary media which are such that one point source in one cell gives rise to an infinite set of images with an image in every other cell. Such checkerboards can themselves be mapped into a class of 3D corner lenses of complementary bianisotropic media. These theoretical results are illustrated by finite element computations.
Evolving a polymerase for hydrophobic base analogues.
Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp
2009-10-21
Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
Small RNA-mediated regulation in bacteria: A growing palette of diverse mechanisms.
Dutta, Tanmay; Srivastava, Shubhangi
2018-05-20
Small RNAs (sRNAs) in bacteria have evolved with diverse mechanisms to balance their target gene expression in response to changes in the environment. Accumulating studies on bacterial regulatory processes firmly established that sRNAs modulate their target gene expression generally at the posttranscriptional level. Identification of large number of sRNAs by advanced technologies, like deep sequencing, tilling microarray, indicates the existence of a plethora of distinctive sRNA-mediated regulatory mechanisms in bacteria. Types of the novel mechanisms are increasing with the discovery of new sRNAs. Complementary base pairing between sRNAs and target RNAs assisted by RNA chaperones like Hfq and ProQ, in many occasions, to regulate the cognate gene expression is prevalent in sRNA mechanisms. sRNAs, in most studied cases, can directly base pair with target mRNA to remodel its expression. Base pairing can happen either in the untranslated regions or in the coding regions of mRNA to activate/repress its translation. sRNAs also act as target mimic to titrate away different regulatory RNAs from its target. Other mechanism includes the sequestration of regulatory proteins, especially transcription factors, by sRNAs. Numerous sRNAs, following analogous mechanism, are widespread in bacteria, and thus, has drawn immense attention for the development of RNA-based technologies. Nevertheless, typical sRNA mechanisms are also discovered to be confined in some bacteria. Analysis of the sRNA mechanisms unravels their existence in both the single step processes and the complex regulatory networks with a global effect on cell physiology. This review deals with the diverse array of mechanisms, which sRNAs follow to maintain bacterial lifestyle. Copyright © 2018 Elsevier B.V. All rights reserved.
Human Resource Management and Human Resource Development: Evolution and Contributions
ERIC Educational Resources Information Center
Richman, Nicole
2015-01-01
Research agrees that a high performance organization (HPO) cannot exist without an elevated value placed on human resource management (HRM) and human resource development (HRD). However, a complementary pairing of HRM and HRD has not always existed. The evolution of HRD from its roots in human knowledge transference to HRM and present day HRD…
Vibration dissipation mount for motors or the like
Small, Thomas R.
1987-01-01
A vibration dissipation mount which permits the mounting of a motor, generator, or the like such that the rotatable shaft thereof passes through the mount and the mount permits the dissipation of self-induced and otherwise induced vibrations wherein the mount comprises a pair of plates having complementary concave and convex surfaces, a semi-resilient material being disposed therebetween.
Rostock, Matthias; Naumann, Johannes; Guethlin, Corina; Guenther, Lars; Bartsch, Hans H; Walach, Harald
2011-01-17
Many cancer patients seek homeopathy as a complementary therapy. It has rarely been studied systematically, whether homeopathic care is of benefit for cancer patients. We conducted a prospective observational study with cancer patients in two differently treated cohorts: one cohort with patients under complementary homeopathic treatment (HG; n = 259), and one cohort with conventionally treated cancer patients (CG; n = 380). For a direct comparison, matched pairs with patients of the same tumour entity and comparable prognosis were to be formed. Main outcome parameter: change of quality of life (FACT-G, FACIT-Sp) after 3 months. Secondary outcome parameters: change of quality of life (FACT-G, FACIT-Sp) after a year, as well as impairment by fatigue (MFI) and by anxiety and depression (HADS). HG: FACT-G, or FACIT-Sp, respectively improved statistically significantly in the first three months, from 75.6 (SD 14.6) to 81.1 (SD 16.9), or from 32.1 (SD 8.2) to 34.9 (SD 8.32), respectively. After 12 months, a further increase to 84.1 (SD 15.5) or 35.2 (SD 8.6) was found. Fatigue (MFI) decreased; anxiety and depression (HADS) did not change. CG: FACT-G remained constant in the first three months: 75.3 (SD 17.3) at t0, and 76.6 (SD 16.6) at t1. After 12 months, there was a slight increase to 78.9 (SD 18.1). FACIT-Sp scores improved significantly from t0 (31.0 - SD 8.9) to t1 (32.1 - SD 8.9) and declined again after a year (31.6 - SD 9.4). For fatigue, anxiety, and depression, no relevant changes were found. 120 patients of HG and 206 patients of CG met our criteria for matched-pairs selection. Due to large differences between the two patient populations, however, only 11 matched pairs could be formed. This is not sufficient for a comparative study. In our prospective study, we observed an improvement of quality of life as well as a tendency of fatigue symptoms to decrease in cancer patients under complementary homeopathic treatment. It would take considerably larger samples to find matched pairs suitable for comparison in order to establish a definite causal relation between these effects and homeopathic treatment.
An Evidence-Based Course in Complementary Medicines
Hughes, Jeff
2012-01-01
Objective. To evaluate the impact of an evidence-based course in complementary medicines on the attitudes, knowledge, and professional practice behavior of undergraduate pharmacy students. Design. A required 12-week evidence-based complementary medicine course was designed and introduced into the third-year undergraduate pharmacy curriculum. The course included a combination of traditional lectures, interactive tutorial sessions, and a range of formal assessments. Assessment. Pre- and post-course survey instruments were administered to assess changes in students’ attitudes, perceptions, knowledge, and the likelihood they would recommend the use of complementary medicines in a pharmacy practice environment. Conclusion. Completion of a required evidence-based complementary medicines course resulted in a positive change in pharmacy students’ perceptions of the value of various complementary medicines as well as in their willingness to recommend them, and provided students with the required knowledge to make patient-centered recommendations for use of complementary medicines in a professional pharmacy practice setting. These findings support the need for greater evidence-based complementary medicine education within pharmacy curricula to meet consumer demand and to align with pharmacists’ professional responsibilities. PMID:23275665
Decomposition of Proteins into Dynamic Units from Atomic Cross-Correlation Functions.
Calligari, Paolo; Gerolin, Marco; Abergel, Daniel; Polimeno, Antonino
2017-01-10
In this article, we present a clustering method of atoms in proteins based on the analysis of the correlation times of interatomic distance correlation functions computed from MD simulations. The goal is to provide a coarse-grained description of the protein in terms of fewer elements that can be treated as dynamically independent subunits. Importantly, this domain decomposition method does not take into account structural properties of the protein. Instead, the clustering of protein residues in terms of networks of dynamically correlated domains is defined on the basis of the effective correlation times of the pair distance correlation functions. For these properties, our method stands as a complementary analysis to the customary protein decomposition in terms of quasi-rigid, structure-based domains. Results obtained for a prototypal protein structure illustrate the approach proposed.
2013-01-01
An intuitionistic method is proposed to design shadow masks to achieve thickness profile control for evaporation coating processes. The proposed method is based on the concept of the shadow matrix, which is a matrix that contains coefficients that build quantitive relations between shape parameters of masks and shadow quantities of substrate directly. By using the shadow matrix, shape parameters of shadow masks could be derived simply by solving a matrix equation. Verification experiments were performed on a special case where coating materials have different condensation characteristics. By using the designed mask pair with complementary shapes, thickness uniformities of better than 98% are demonstrated for MgF2 (m = 1) and LaF3 (m = 0.5) simultaneously on a 280 mm diameter spherical substrate with the radius curvature of 200 mm. PMID:24227996
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-24
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.
2015-01-01
We previously developed reporter-peptide nucleic acid (PNA)-peptides for sequence-specific radioimaging and fluorescence imaging of particular mRNAs in cells and tumors. However, a direct test for PNA-peptide hybridization with RNA in the cytoplasm would be desirable. Thiazole orange (TO) dye at the 5′ end of a hybridization agent shows a strong increase in fluorescence quantum yield when stacked upon a 5′ terminal base pair, in solution and in cells. We hypothesized that hybridization agents with an internal TO could distinguish a single base mutation in RNA. Thus, we designed KRAS2 PNA-IGF1 tetrapeptide agents with an internal TO adjacent to the middle base of the 12th codon, a frequent site of cancer-initiating mutations. Our molecular dynamics calculations predicted a disordered bulge with weaker hybridization resulting from a single RNA mismatch. We observed that single-stranded PNA-IGF1 tetrapeptide agents with an internal TO showed low fluorescence, but fluorescence escalated 5–6-fold upon hybridization with KRAS2 RNA. Circular dichroism melting curves showed ∼10 °C higher Tm for fully complementary vs single base mismatch TO-PNA-peptide agent duplexes with KRAS2 RNA. Fluorescence measurements of treated human lung cancer cells similarly showed elevated cytoplasmic fluorescence intensity with fully complementary vs single base mismatch agents. Sequence-specific elevation of internal TO fluorescence is consistent with our hypothesis of detecting cytoplasmic PNA-peptide:RNA hybridization if a mutant agent encounters the corresponding mutant mRNA. PMID:25180641
Enhancing the performance of coherent OTDR systems with polarization diversity complementary codes.
Dorize, Christian; Awwad, Elie
2018-05-14
Monitoring the optical phase change in a fiber enables a wide range of applications where fast phase variations are induced by acoustic signals or by vibrations in general. However, the quality of the estimated fiber response strongly depends on the method used to modulate the light sent to the fiber and capture the variations of the optical field. In this paper, we show that distributed optical fiber sensing systems can advantageously exploit techniques from the telecommunication domain, as those used in coherent optical transmission, to enhance their performance in detecting mechanical events, while jointly offering a simpler setup than widespread pulse-cloning or spectral-sweep based schemes with acousto-optic modulators. We periodically capture an overall fiber Jones matrix estimate thanks to a novel probing technique using two mutually orthogonal complementary (Golay) pairs of binary sequences applied simultaneously in phase and quadrature on two orthogonal polarization states. A perfect channel response estimation of the sensor array is achieved, subject to conditions detailed in the paper, thus enhancing the sensitivity and bandwidth of coherent ϕ-OTDR systems. High sensitivity, linear response, and bandwidth coverage up to 18 kHz are demonstrated with a sensor array composed of 10 fiber Bragg gratings (FBGs).
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Enhancing the performance of coherent OTDR systems with polarization diversity complementary codes
NASA Astrophysics Data System (ADS)
Dorize, Christian; Awwad, Elie
2018-05-01
Monitoring the optical phase change in a fiber enables a wide range of applications where fast phase variations are induced by acoustic signals or vibrations in general. However, the quality of the estimated fiber response strongly depends on the method used to modulate the light sent to the fiber and capture the variations of the optical field. In this paper, we show that distributed optical fiber sensing systems can advantageously exploit techniques from the telecommunication domain, as those used in coherent optical transmission, to enhance their performance in detecting mechanical events, while jointly offering a simpler setup than widespread pulse-cloning or spectral-sweep based schemes with acousto-optic modulators. We periodically capture an overall fiber Jones matrix estimate thanks to a novel probing technique using two mutually orthogonal complementary (Golay) pairs of binary sequences applied simultaneously in phase and quadrature on two orthogonal polarization states. A perfect channel response estimation of the sensor array is achieved, subject to conditions detailed in the paper, thus enhancing the sensitivity and bandwidth of coherent phase-OTDR systems. High sensitivity, linear response, and bandwidth coverage up to 18 kHz are demonstrated with a sensor array composed of 10 fiber Bragg gratings (FBGs).
Wise, M.B.; Thompson, C.V.
1998-07-14
An in-line gas monitor capable of accurate gas composition analysis in a continuous real time manner even under strong applied vacuum conditions operates by mixing an air sample with helium forming a sample gas in two complementary sample loops embedded in a manifold which includes two pairs of 3-way solenoid valves. The sample gas is then analyzed in an ion trap mass spectrometer on a continuous basis. Two valve drivers actuate the two pairs of 3-way valves in a reciprocating fashion, so that there is always flow through the in-line gas monitor via one or the other of the sample loops. The duty cycle for the two pairs of 3-way valves is varied by tuning the two valve drivers to a duty cycle typically between 0.2 to 0.7 seconds. 3 figs.
“Ultra-high resolution optical trap with single fluorophore sensitivity”
Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R
2013-01-01
We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286
High-dimensional entanglement certification
Huang, Zixin; Maccone, Lorenzo; Karim, Akib; Macchiavello, Chiara; Chapman, Robert J.; Peruzzo, Alberto
2016-01-01
Quantum entanglement is the ability of joint quantum systems to possess global properties (correlation among systems) even when subsystems have no definite individual property. Whilst the 2-dimensional (qubit) case is well-understood, currently, tools to characterise entanglement in high dimensions are limited. We experimentally demonstrate a new procedure for entanglement certification that is suitable for large systems, based entirely on information-theoretics. It scales more efficiently than Bell’s inequality and entanglement witness. The method we developed works for arbitrarily large system dimension d and employs only two local measurements of complementary properties. This procedure can also certify whether the system is maximally entangled. We illustrate the protocol for families of bipartite states of qudits with dimension up to 32 composed of polarisation-entangled photon pairs. PMID:27311935
Large scale DNA microsequencing device
Foote, R.S.
1997-08-26
A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.
Chromophoric Nucleoside Analogues: Synthesis and Characterization of 6-Aminouracil-Based Nucleodyes.
Freeman, Noam S; Moore, Curtis E; Wilhelmsson, L Marcus; Tor, Yitzhak
2016-06-03
Nucleodyes, visibly colored chromophoric nucleoside analogues, are reported. Design criteria are outlined and the syntheses of cytidine and uridine azo dye analogues derived from 6-aminouracil are described. Structural analysis shows that the nucleodyes are sound structural analogues of their native nucleoside counterparts, and photophysical studies demonstrate that the nucleodyes are sensitive to microenvironmental changes. Quantum chemical calculations are presented as a valuable complementary tool for the design of strongly absorbing nucleodyes, which overlap with the emission of known fluorophores. Förster critical distance (R0) calculations determine that the nucleodyes make good FRET pairs with both 2-aminopurine (2AP) and pyrrolocytosine (PyC). Additionally, unique tautomerization features exhibited by 5-(4-nitrophenylazo)-6-oxocytidine (8) are visualized by an extraordinary crystal structure.
High-dimensional entanglement certification
NASA Astrophysics Data System (ADS)
Huang, Zixin; Maccone, Lorenzo; Karim, Akib; Macchiavello, Chiara; Chapman, Robert J.; Peruzzo, Alberto
2016-06-01
Quantum entanglement is the ability of joint quantum systems to possess global properties (correlation among systems) even when subsystems have no definite individual property. Whilst the 2-dimensional (qubit) case is well-understood, currently, tools to characterise entanglement in high dimensions are limited. We experimentally demonstrate a new procedure for entanglement certification that is suitable for large systems, based entirely on information-theoretics. It scales more efficiently than Bell’s inequality and entanglement witness. The method we developed works for arbitrarily large system dimension d and employs only two local measurements of complementary properties. This procedure can also certify whether the system is maximally entangled. We illustrate the protocol for families of bipartite states of qudits with dimension up to 32 composed of polarisation-entangled photon pairs.
A Prototype of Mathematical Treatment of Pen Pressure Data for Signature Verification.
Li, Chi-Keung; Wong, Siu-Kay; Chim, Lai-Chu Joyce
2018-01-01
A prototype using simple mathematical treatment of the pen pressure data recorded by a digital pen movement recording device was derived. In this study, a total of 48 sets of signature and initial specimens were collected. Pearson's correlation coefficient was used to compare the data of the pen pressure patterns. From the 820 pair comparisons of the 48 sets of genuine signatures, a high degree of matching was found in which 95.4% (782 pairs) and 80% (656 pairs) had rPA > 0.7 and rPA > 0.8, respectively. In the comparison of the 23 forged signatures with their corresponding control signatures, 20 of them (89.2% of pairs) had rPA values < 0.6, showing a lower degree of matching when compared with the results of the genuine signatures. The prototype could be used as a complementary technique to improve the objectivity of signature examination and also has a good potential to be developed as a tool for automated signature identification. © 2017 American Academy of Forensic Sciences.
Mierop, Adrien; Hütter, Mandy; Stahl, Christoph; Corneille, Olivier
2018-02-05
Research that dissociates different types of processes within a given task using a processing tree approach suggests that attitudes may be acquired through evaluative conditioning in the absence of explicit encoding of CS-US pairings in memory. This research distinguishes explicit memory for the CS-US pairings from CS-liking acquired without encoding of CS-US pairs in explicit memory. It has been suggested that the latter effect may be due to an implicit misattribution process that is assumed to operate when US evocativeness is low. In the present research, the latter assumption was supported neither by two high-powered experiments nor by complementary meta-analytic evidence, whereas evocativeness exerted an influence on explicit memory. This pattern of findings is inconsistent with the view that CS-liking acquired without encoding of CS-US pairs in explicit memory reflects an implicit misattribution process at learning. Hence, the underlying learning process is awaiting further empirical scrutiny.
The nuclear contacts and short range correlations in nuclei
NASA Astrophysics Data System (ADS)
Weiss, R.; Cruz-Torres, R.; Barnea, N.; Piasetzky, E.; Hen, O.
2018-05-01
Atomic nuclei are complex strongly interacting systems and their exact theoretical description is a long-standing challenge. An approximate description of nuclei can be achieved by separating its short and long range structure. This separation of scales stands at the heart of the nuclear shell model and effective field theories that describe the long-range structure of the nucleus using a mean-field approximation. We present here an effective description of the complementary short-range structure using contact terms and stylized two-body asymptotic wave functions. The possibility to extract the nuclear contacts from experimental data is presented. Regions in the two-body momentum distribution dominated by high-momentum, close-proximity, nucleon pairs are identified and compared to experimental data. The amount of short-range correlated (SRC) nucleon pairs is determined and compared to measurements. Non-combinatorial isospin symmetry for SRC pairs is identified. The obtained one-body momentum distributions indicate dominance of SRC pairs above the nuclear Fermi-momentum.
Pina, Ana Sofia; Carvalho, Sara; Dias, Ana Margarida G C; Guilherme, Márcia; Pereira, Alice S; Caraça, Luciana T; Coroadinha, Ana Sofia; Lowe, Christopher R; Roque, A Cecília A
2016-11-11
A common strategy for the production and purification of recombinant proteins is to fuse a tag to the protein terminal residues and employ a "tag-specific" ligand for fusion protein capture and purification. In this work, we explored the effect of two tryptophan-based tags, NWNWNW and WFWFWF, on the expression and purification of Green Fluorescence Protein (GFP) used as a model fusion protein. The titers obtained with the expression of these fusion proteins in soluble form were 0.11mgml -1 and 0.48mgml -1 for WFWFWF and NWNWNW, respectively. A combinatorial library comprising 64 ligands based on the Ugi reaction was prepared and screened for binding GFP-tagged and non-tagged proteins. Complementary ligands A2C2 and A3C1 were selected for the effective capture of NWNWNW and WFWFWF tagged proteins, respectively, in soluble forms. These affinity pairs displayed 10 6 M -1 affinity constants and Qmax values of 19.11±2.60ugg -1 and 79.39ugg -1 for the systems WFWFWF AND NWNWNW, respectively. GFP fused to the WFWFWF affinity tag was also produced as inclusion bodies, and a refolding-on column strategy was explored using the ligand A4C8, selected from the combinatorial library of ligands but in presence of denaturant agents. Copyright © 2016 Elsevier B.V. All rights reserved.
Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes
NASA Astrophysics Data System (ADS)
Longuinhos, R.; Lúcio, A. D.; Chacham, H.; Alexandre, S. S.
2016-05-01
Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag4. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag4 or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag4 to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag4 hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.
Cheng, Yiming; Perocchi, Fabiana
2015-07-01
ProtPhylo is a web-based tool to identify proteins that are functionally linked to either a phenotype or a protein of interest based on co-evolution. ProtPhylo infers functional associations by comparing protein phylogenetic profiles (co-occurrence patterns of orthology relationships) for more than 9.7 million non-redundant protein sequences from all three domains of life. Users can query any of 2048 fully sequenced organisms, including 1678 bacteria, 255 eukaryotes and 115 archaea. In addition, they can tailor ProtPhylo to a particular kind of biological question by choosing among four main orthology inference methods based either on pair-wise sequence comparisons (One-way Best Hits and Best Reciprocal Hits) or clustering of orthologous proteins across multiple species (OrthoMCL and eggNOG). Next, ProtPhylo ranks phylogenetic neighbors of query proteins or phenotypic properties using the Hamming distance as a measure of similarity between pairs of phylogenetic profiles. Candidate hits can be easily and flexibly prioritized by complementary clues on subcellular localization, known protein-protein interactions, membrane spanning regions and protein domains. The resulting protein list can be quickly exported into a csv text file for further analyses. ProtPhylo is freely available at http://www.protphylo.org. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Charge-transfer optical absorption mechanism of DNA:Ag-nanocluster complexes.
Longuinhos, R; Lúcio, A D; Chacham, H; Alexandre, S S
2016-05-01
Optical properties of DNA:Ag-nanoclusters complexes have been successfully applied experimentally in Chemistry, Physics, and Biology. Nevertheless, the mechanisms behind their optical activity remain unresolved. In this work, we present a time-dependent density functional study of optical absorption in DNA:Ag_{4}. In all 23 different complexes investigated, we obtain new absorption peaks in the visible region that are not found in either the isolated Ag_{4} or isolated DNA base pairs. Absorption from red to green are predominantly of charge-transfer character, from the Ag_{4} to the DNA fragment, while absorption in the blue-violet range are mostly associated to electronic transitions of a mixed character, involving either DNA-Ag_{4} hybrid orbitals or intracluster orbitals. We also investigate the role of exchange-correlation functionals in the calculated optical spectra. Significant differences are observed between the calculations using the PBE functional (without exact exchange) and the CAM-B3LYP functional (which partly includes exact exchange). Specifically, we observe a tendency of charge-transfer excitations to involve purines bases, and the PBE spectra error is more pronounced in the complexes where the Ag cluster is bound to the purines. Finally, our results also highlight the importance of adding both the complementary base pair and the sugar-phosphate backbone in order to properly characterize the absorption spectrum of DNA:Ag complexes.
Use of Complementary Health Practices in a Church-Based African American Cohort.
Escoto, Kamisha Hamilton; Milbury, Kathrin; Nguyen, Nga; Cho, Dalnim; Roberson, Crystal; Wetter, David; McNeill, Lorna H
2018-06-08
Few studies have examined the use of complementary health practices (e.g., mind/body practices and dietary supplements) among African Americans, particularly those who identify as being spiritual and/or religious. Furthermore, research on the health and health behavior profiles of such complementary health users is scant. The purpose of this study was to explore the use of complementary health practices and their lifestyle and health indicator correlates in a large, church-based African American population. Cross-sectional analysis of 1467 African American adults drawn from a church-based cohort study. Participants reported use of complementary health practices, lifestyle behaviors (e.g., diet and smoking status), and health indicators (e.g., physical health and medical problems). Multiple logistic regressions were conducted to examine associations between lifestyle variables, health indicators, and use of complementary health practices. Outcomes included prevalence of mind/body practices (e.g., meditation and Reiki) and dietary supplements (multivitamins) along with health indicator and lifestyle correlates of use. Use of complementary health practices was high; 40% reported using any mind/body practice and 50% reported using dietary supplements. Poorer physical health was associated with use of mind/body practices, while likelihood of meeting fruit and vegetable recommendations was significantly associated with dietary supplement use. Complementary health practices were used heavily in a church-based sample of African American adults. Poorer physical health was associated with use of complementary health practices, yet users also displayed health conscious behaviors. Given the high engagement in complementary health practices, it may be prudent to consider adapting complementary health approaches for use in wellness interventions targeting African Americans in faith-based settings.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin
Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templatingmore » dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.« less
Dynamic DNA nanotechnology using strand-displacement reactions
NASA Astrophysics Data System (ADS)
Zhang, David Yu; Seelig, Georg
2011-02-01
The specificity and predictability of Watson-Crick base pairing make DNA a powerful and versatile material for engineering at the nanoscale. This has enabled the construction of a diverse and rapidly growing set of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Although it had initially focused on the self-assembly of static structures, DNA nanotechnology is now also becoming increasingly attractive for engineering systems with interesting dynamic properties. Various devices, including circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures, have recently been rationally designed to use DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands. This mechanism allows for the kinetic control of reaction pathways. Here, we review DNA strand-displacement-based devices, and look at how this relatively simple mechanism can lead to a surprising diversity of dynamic behaviour.
Bruegger, Joel; Haushalter, Bob; Vagstad, Anna; Shakya, Gaurav; Mih, Nathan; Townsend, Craig A.; Burkart, Michael D.; Tsai, Shiou-Chuan
2013-01-01
SUMMARY Protein•protein interactions, which often involve interactions between an acyl carrier protein (ACP) and its partner enzymes, are important for coordinating polyketide biosynthesis. However, the nature of such interactions is not well understood, especially in the fungal non-reducing polyketide synthases (NR-PKSs) that biosynthesize toxic and pharmaceutically important polyketides. Here, we employ a mechanism-based crosslinker to successfully probe ACP and ketosynthase (KS) domain interactions in NR-PKSs. We found that crosslinking efficiency is closely correlated with the strength of ACP•KS interactions, and that KS demonstrates strong starter unit selectivity. We further identified positively charged surface residues by KS mutagenesis, which mediate key interactions with the negatively-charged ACP surface. Such complementary/matching contact pairs can serve as “adapter surfaces” for future efforts to generate new polyketides using NR-PKSs. PMID:23993461
Mao, Huihui; Luo, Guanghua; Zhan, Yuxia; Zhang, Jun; Yao, Shuang; Yu, Yang
2018-04-30
The base-quenched probe method for detecting single nucleotide polymorphisms (SNPs) relies on real-time PCR and melting-curve analysis, which might require only one pair of primers and one probe. At present, it has been successfully applied to detect SNPs of multiple genes. However, the mechanism of the base-quenched probe method remains unclear. Therefore, we investigated the possible mechanism of fluorescence quenching by DNA bases in aqueous solution using spectroscopic techniques. It showed that the possible mechanism might be photo-induced electron transfer. We next analyzed electron transfer or transmission between DNA bases and fluorophores. The data suggested that in single-stranded DNA, the electrons of the fluorophore are transferred to the orbital of pyrimidine bases (thymine (T) and cytosine (C)), or that the electron orbitals of the fluorophore are occupied by electrons from purine bases (guanine (G) and adenine (A)), which lead to fluorescence quenching. In addition, the electrons of a fluorophore excited by light can be transmitted along double-stranded DNA, which gives rise to stronger fluorescence quenching. Furthermore, we demonstrated that the quenching efficiency of bases is in the order of G > C ≥ A ≥ T and the capability of electron transmission of base-pairs in double-stranded DNA is in the order of CG[combining low line] ≥ GC[combining low line] > TA[combining low line] ≥ AT[combining low line] (letters representing bases on the complementary strand of the probe are bold and underlined), and the most common commercial fluorophores including FAM, HEX, TET, JOE, and TAMRA could be influenced by bases and are in line with this mechanism and regularity.
Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B
1993-09-01
The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.
2015-01-01
1,3-Butadiene (BD) is an environmental and occupational toxicant classified as a human carcinogen. It is oxidized by cytochrome P450 monooxygenases to 1,2-epoxy-3-butene (EB), which alkylates DNA. BD exposures lead to large numbers of mutations at A:T base pairs even though alkylation of guanines is more prevalent, suggesting that one or more adenine adducts of BD play a role in BD-mediated genotoxicity. However, the etiology of BD-mediated genotoxicity at adenine remains poorly understood. EB alkylates the N6 exocyclic nitrogen of adenine to form N6-(hydroxy-3-buten-1-yl)-2′-dA ((2S)-N6-HB-dA) adducts (TretyakovaN., LinY., SangaiahR., UptonP. B., and SwenbergJ. A. (1997) Carcinogenesis18, 137−1479054600). The structure of the (2S)-N6-HB-dA adduct has been determined in the 5′-d(C1G2G3A4C5Y6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19 C20C21G22)-3′ duplex [Y = (2S)-N6-HB-dA] containing codon 61 (underlined) of the human N-ras protooncogene, from NMR spectroscopy. The (2S)-N6-HB-dA adduct was positioned in the major groove, such that the butadiene moiety was oriented in the 3′ direction. At the Cα carbon, the methylene protons of the modified nucleobase Y6 faced the 5′ direction, which placed the Cβ carbon in the 3′ direction. The Cβ hydroxyl group faced toward the solvent, as did carbons Cγ and Cδ. The Cβ hydroxyl group did not form hydrogen bonds with either T16O4 or T17O4. The (2S)-N6-HB-dA nucleoside maintained the anti conformation about the glycosyl bond, and the modified base retained Watson–Crick base pairing with the complementary base (T17). The adduct perturbed stacking interactions at base pairs C5:G18, Y6:T17, and A7:T16 such that the Y6 base did not stack with its 5′ neighbor C5, but it did with its 3′ neighbor A7. The complementary thymine T17 stacked well with both 5′ and 3′ neighbors T16 and G18. The presence of the (2S)-N6-HB-dA resulted in a 5 °C reduction in the Tm of the duplex, which is attributed to less favorable stacking interactions and adduct accommodation in the major groove. PMID:25238403
Daveau, Romain; Combaret, Valérie; Pierre-Eugène, Cécile; Cazes, Alex; Louis-Brennetot, Caroline; Schleiermacher, Gudrun; Ferrand, Sandrine; Pierron, Gaëlle; Lermine, Alban; Frio, Thomas Rio; Raynal, Virginie; Vassal, Gilles; Barillot, Emmanuel; Delattre, Olivier; Janoueix-Lerosey, Isabelle
2013-01-01
Neuroblastoma is a pediatric cancer of the peripheral nervous system in which structural chromosome aberrations are emblematic of aggressive tumors. In this study, we performed an in-depth analysis of somatic rearrangements in two neuroblastoma cell lines and two primary tumors using paired-end sequencing of mate-pair libraries and RNA-seq. The cell lines presented with typical genetic alterations of neuroblastoma and the two tumors belong to the group of neuroblastoma exhibiting a profile of chromothripsis. Inter and intra-chromosomal rearrangements were identified in the four samples, allowing in particular characterization of unbalanced translocations at high resolution. Using complementary experiments, we further characterized 51 rearrangements at the base pair resolution that revealed 59 DNA junctions. In a subset of cases, complex rearrangements were observed with templated insertion of fragments of nearby sequences. Although we did not identify known particular motifs in the local environment of the breakpoints, we documented frequent microhomologies at the junctions in both chromothripsis and non-chromothripsis associated breakpoints. RNA-seq experiments confirmed expression of several predicted chimeric genes and genes with disrupted exon structure including ALK, NBAS, FHIT, PTPRD and ODZ4. Our study therefore indicates that both non-homologous end joining-mediated repair and replicative processes may account for genomic rearrangements in neuroblastoma. RNA-seq analysis allows the identification of the subset of abnormal transcripts expressed from genomic rearrangements that may be involved in neuroblastoma oncogenesis. PMID:23991058
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
Selectivity assessment of DB-200 and DB-VRX open-tubular capillary columns.
Kiridena, W; Koziola, W W; Poole, C F
2001-10-12
The solvation parameter model is used to study the influence of composition and temperature on the selectivity of two poly(siloxane) stationary phases used for open-tubular capillary column gas chromatography. The poly(methyltrifluoropropyldimethylsiloxane) stationary phase, DB-200, has low cohesion, intermediate dipolarity/polarizability, low hydrogen-bond basicity, no hydrogen-bond acidity, and repulsive electron lone pair interactions. The DB-VRX stationary phase has low cohesion, low dipolarity/polarizability, low hydrogen-bond basicity and no hydrogen-bond acidity and no capacity for electron lone pair interactions. The selectivity of the two stationary phases is complementary to those in a database of 11 stationary phase chemistries determined under the same experimental conditions.
Dion-Côté, Anne-Marie; Symonová, Radka; Lamaze, Fabien C; Pelikánová, Šárka; Ráb, Petr; Bernatchez, Louis
2017-01-01
The role of chromosome changes in speciation remains a debated topic, although demographic conditions associated with divergence should promote their appearance. We tested a potential relationship between chromosome changes and speciation by studying two Lake Whitefish (Coregonus clupeaformis) lineages that recently colonized postglacial lakes following allopatry. A dwarf limnetic species evolved repeatedly from the normal benthic species, becoming reproductively isolated. Lake Whitefish hybrids experience mitotic and meiotic instability, which may result from structurally divergent chromosomes. Motivated by this observation, we test the hypothesis that chromosome organization differs between Lake Whitefish species pairs using cytogenetics. While chromosome and fundamental numbers are conserved between the species (2n = 80, NF = 98), we observe extensive polymorphism of subtle karyotype traits. We describe intrachromosomal differences associated with heterochromatin and repetitive DNA, and test for parallelism among three sympatric species pairs. Multivariate analyses support the hypothesis that differentiation at the level of subchromosomal markers mostly appeared during allopatry. Yet we find no evidence for parallelism between species pairs among lakes, consistent with colonization effect or postcolonization differentiation. The reported intrachromosomal polymorphisms do not appear to play a central role in driving adaptive divergence between normal and dwarf Lake Whitefish. We discuss how chromosomal differentiation in the Lake Whitefish system may contribute to the destabilization of mitotic and meiotic chromosome segregation in hybrids, as documented previously. The chromosome structures detected here are still difficult to sequence and assemble, demonstrating the value of cytogenetics as a complementary approach to understand the genomic bases of speciation. © 2016 John Wiley & Sons Ltd.
Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.
2015-01-01
Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095
Complementary and Alternative Medicine for Patients
... Ask about Your Treatment Research Complementary and Alternative Medicine for Patients Complementary and alternative medicine (CAM) is ... based on scientific evidence from research studies. Complementary medicine refers to treatments that are used with standard ...
2018-01-01
Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus. PMID:29293518
Poggio, Lidia; González, Graciela Esther
2018-01-01
Cytological diploidization process is different in autopolyploid and allopolyploid species. Colchicine applied at the onset of meiosis suppresses the effect of pairing regulator genes resulting multivalents formation in bivalent-forming species. Colchicine treated maizes (4x = 2n = 20, AmAmBmBm) showed up to 5IV, suggesting pairing between chromosomes from genomes homoeologous Am and Bm. In untreated individuals of the alloautooctoploid Zea perennis (8x = 2n = 40, ApApAp´Ap´Bp1Bp1Bp2Bp2) the most frequent configuration was 5IV+10II (formed by A and B genomes, respectively). The colchicine treated Z. perennis show up to 10IV revealing higher affinity within genomes A and B, but any homology among them. These results suggest the presence of a paring regulator locus (PrZ) in maize and Z. perennis, whose expression is suppressed by colchicine. It could be postulated that in Z. perennis, PrZ would affect independently the genomes A and B, being relevant the threshold of homology, the fidelity of pairing in each genomes and the ploidy level. Cytological analysis of the treated hexaploid hybrids (6x = 2n = 30), with Z. perennis as a parental, strongly suggests that PrZ is less effective in only one doses. This conclusion was reinforced by the homoeologous pairing observed in untreated dihaploid maizes, which showed up to 5II. Meiotic behaviour of individuals treated with different doses of colchicine allowed to postulate that PrZ affect the homoeologous association by controlling entire genomes (Am or Bm) rather than individual chromosomes. Based on cytological and statistical results it is possible to propose that the cytological diploidization in Zea species occurs by restriction of pairing between homoeologous chromosomes or by genetical divergence of the homoeologous chromosomes, as was observed in untreated Z. mays ssp. parviglumis. These are independent but complementary systems and could be acting jointly in the same nucleus.
Self-complementary circular codes in coding theory.
Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz
2018-04-01
Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.
Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi
2016-01-01
Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153
Robust Indoor Human Activity Recognition Using Wireless Signals.
Wang, Yi; Jiang, Xinli; Cao, Rongyu; Wang, Xiyang
2015-07-15
Wireless signals-based activity detection and recognition technology may be complementary to the existing vision-based methods, especially under the circumstance of occlusions, viewpoint change, complex background, lighting condition change, and so on. This paper explores the properties of the channel state information (CSI) of Wi-Fi signals, and presents a robust indoor daily human activity recognition framework with only one pair of transmission points (TP) and access points (AP). First of all, some indoor human actions are selected as primitive actions forming a training set. Then, an online filtering method is designed to make actions' CSI curves smooth and allow them to contain enough pattern information. Each primitive action pattern can be segmented from the outliers of its multi-input multi-output (MIMO) signals by a proposed segmentation method. Lastly, in online activities recognition, by selecting proper features and Support Vector Machine (SVM) based multi-classification, activities constituted by primitive actions can be recognized insensitive to the locations, orientations, and speeds.
Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen
2018-04-30
Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.
Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.
Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K
2018-06-04
The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.
Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.
Mello-Sampayo, T
1973-01-01
Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.
Computing Role Assignments of Proper Interval Graphs in Polynomial Time
NASA Astrophysics Data System (ADS)
Heggernes, Pinar; van't Hof, Pim; Paulusma, Daniël
A homomorphism from a graph G to a graph R is locally surjective if its restriction to the neighborhood of each vertex of G is surjective. Such a homomorphism is also called an R-role assignment of G. Role assignments have applications in distributed computing, social network theory, and topological graph theory. The Role Assignment problem has as input a pair of graphs (G,R) and asks whether G has an R-role assignment. This problem is NP-complete already on input pairs (G,R) where R is a path on three vertices. So far, the only known non-trivial tractable case consists of input pairs (G,R) where G is a tree. We present a polynomial time algorithm that solves Role Assignment on all input pairs (G,R) where G is a proper interval graph. Thus we identify the first graph class other than trees on which the problem is tractable. As a complementary result, we show that the problem is Graph Isomorphism-hard on chordal graphs, a superclass of proper interval graphs and trees.
Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S
2002-01-22
The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.
Expansion of the Genetic Alphabet: A Chemist's Approach to Synthetic Biology.
Feldman, Aaron W; Romesberg, Floyd E
2018-02-20
The information available to any organism is encoded in a four nucleotide, two base pair genetic code. Since its earliest days, the field of synthetic biology has endeavored to impart organisms with novel attributes and functions, and perhaps the most fundamental approach to this goal is the creation of a fifth and sixth nucleotide that pair to form a third, unnatural base pair (UBP) and thus allow for the storage and retrieval of increased information. Achieving this goal, by definition, requires synthetic chemistry to create unnatural nucleotides and a medicinal chemistry-like approach to guide their optimization. With this perspective, almost 20 years ago we began designing unnatural nucleotides with the ultimate goal of developing UBPs that function in vivo, and thus serve as the foundation of semi-synthetic organisms (SSOs) capable of storing and retrieving increased information. From the beginning, our efforts focused on the development of nucleotides that bear predominantly hydrophobic nucleobases and thus that pair not based on the complementary hydrogen bonds that are so prominent among the natural base pairs but rather via hydrophobic and packing interactions. It was envisioned that such a pairing mechanism would provide a basal level of selectivity against pairing with natural nucleotides, which we expected would be the greatest challenge; however, this choice mandated starting with analogs that have little or no homology to their natural counterparts and that, perhaps not surprisingly, performed poorly. Progress toward their optimization was driven by the construction of structure-activity relationships, initially from in vitro steady-state kinetic analysis, then later from pre-steady-state and PCR-based assays, and ultimately from performance in vivo, with the results augmented three times with screens that explored combinations of the unnatural nucleotides that were too numerous to fully characterize individually. The structure-activity relationship data identified multiple features required by the UBP, and perhaps most prominent among them was a substituent ortho to the glycosidic linkage that is capable of both hydrophobic packing and hydrogen bonding, and nucleobases that stably stack with flanking natural nucleobases in lieu of the potentially more stabilizing stacking interactions afforded by cross strand intercalation. Most importantly, after the examination of hundreds of unnatural nucleotides and thousands of candidate UBPs, the efforts ultimately resulted in the identification of a family of UBPs that are well recognized by DNA polymerases when incorporated into DNA and that have been used to create SSOs that store and retrieve increased information. In addition to achieving a longstanding goal of synthetic biology, the results have important implications for our understanding of both the molecules and forces that can underlie biological processes, so long considered the purview of molecules benefiting from eons of evolution, and highlight the promise of applying the approaches and methodologies of synthetic and medical chemistry in the pursuit of synthetic biology.
Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics
Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2015-01-01
The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165
Wemakor, Anthony; Iddrisu, Habib
2018-06-25
Maternal depression may affect child feeding practice which is an important determinant of child nutritional status. The objective of this study was to explore the association between maternal depression and WHO complementary feeding indicators [minimum dietary diversity (MDD), minimum meal frequency (MMF) and minimum acceptable diet (MAD)] or stunting status of children (6-23 months) in Tamale Metropolis, Ghana. A community-based cross-sectional study was carried out involving 200 mother-child pairs randomly sampled from three communities in Tamale Metropolis, Ghana. The prevalence of MDD, MMF, and MAD were 56.5, 65.0, and 44.0% respectively and 41.0% of the children sampled were stunted. A third of the mothers (33.5%) screened positive for depression. Maternal depression did not influence significantly MDD (p = 0.245), MMF (p = 0.442), and MAD (p = 0.885) or children's risk of stunting (p = 0.872). In conclusion maternal depression and child stunting are prevalent in Northern Ghana but there is a lack of evidence of an association between maternal depression and child feeding practices or nutritional status in this study population. Further research is needed to assess the effect of maternal depression on feeding practices and growth of young children.
Zhang, Laibin; Ren, Tingqi; Tian, Jianxiang; Yang, Xiuqin; Zhou, Liuzhu; Li, Xiaoming
2013-04-18
Design and synthesis of fluorescent nucleobase analogues for studying structures and dynamics of nucleic acids have attracted much attention in recent years. In the present work, a comprehensive theoretical study of electronic transitions of naphtho-homologated base analogues, namely, xxC, xxT, xxA, and xxG, was performed. The nature of the low-lying excited states was discussed, and the results were compared with those of x-bases. Geometrical characteristics of the lowest excited singlet ππ* states were explored using the CIS method. The calculated excitation maxima are 423, 397, 383, and 357 nm for xxA, xxG, xxC, and xxT, respectively, and they are greatly red-shifted compared with x-bases and natural bases, allowing them to be selectively excited in the presence of the natural bases. In the gas phase, the fluorescence from them would be expected to occur around 497, 461, 457, and 417 nm, respectively. The effects of methanol solution, deoxyribose, and base paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were also examined.
NASA Technical Reports Server (NTRS)
Vranish, John M. (Inventor)
1998-01-01
A spin bearing assembly including, a pair of mutually opposing complementary bearing support members having mutually spaced apart bearing support surfaces which may be, for example, bearing races and a set of spin bearings located therebetween. Each spin bearing includes a pair of end faces, a central rotational axis passing through the end faces, a waist region substantially mid-way between the end faces and having a first thickness dimension, and discrete side surface regions located between the waist region and the end faces and having a second thickness dimension different from the first thickness dimension of the waist region and wherein the side surface regions further have respective curvilinear contact surfaces adapted to provide a plurality of bearing contact points on the bearing support members.
NASA Astrophysics Data System (ADS)
Chou, Y. C.
2018-04-01
The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.
Teng, Ye; Pramanik, Smritimoy; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Sugimoto, Naoki
2018-02-05
The trinucleotide repeat d(CXG) (X = A, C, G or T) is the most common sequence causing repeat expansion disorders. The formation of non-canonical structures, such as hairpin structures with X-X mismatches, has been proposed to affect gene expression and regulation, which are important in pathological studies of these devastating neurological diseases. However, little information is available regarding the thermodynamics of the repeat sequence under crowded cellular conditions where many non-canonical structures such as G-quadruplexes are highly stabilized, while duplexes are destabilised. In this study, we investigated the different stabilities of X-X mismatches in the context of internal d(CXG) self-complementary sequences in an environment with a high concentration of cosolutes to mimic the crowding conditions in cells. The stabilities of full-matched duplexes and duplexes with A-A, G-G, and T-T mismatched base pairs under molecular crowding conditions were notably decreased compared to under dilute conditions. However, the stability of the DNA duplex with a C-C mismatch base pair was only slightly destabilised. Investigating different stabilities of X-X mismatches in d(CXG) sequences is important for improving our understanding of the formation and transition of multiple non-canonical structures in trinucleotide repeat diseases, and may provide insights for pathological studies and drug development. Copyright © 2018 Elsevier Inc. All rights reserved.
Dual beam optical system for pulsed laser ablation film deposition
Mashburn, D.N.
1996-09-24
A laser ablation apparatus having a laser source outputting a laser ablation beam includes an ablation chamber having a sidewall, a beam divider for dividing the laser ablation beam into two substantially equal halves, and a pair of mirrors for converging the two halves on a surface of the target from complementary angles relative to the target surface normal, thereby generating a plume of ablated material emanating from the target. 3 figs.
Dual beam optical system for pulsed laser ablation film deposition
Mashburn, Douglas N.
1996-01-01
A laser ablation apparatus having a laser source outputting a laser ablation beam includes an ablation chamber having a sidewall, a beam divider for dividing the laser ablation beam into two substantially equal halves, and a pair of mirrors for converging the two halves on a surface of the target from complementary angles relative to the target surface normal, thereby generating a plume of ablated material emanating from the target.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bialynicki-Birula, Iwo
Quantum-mechanical uncertainty relations for position and momentum are expressed in the form of inequalities involving the Renyi entropies. The proof of these inequalities requires the use of the exact expression for the (p,q)-norm of the Fourier transformation derived by Babenko and Beckner. Analogous uncertainty relations are derived for angle and angular momentum and also for a pair of complementary observables in N-level systems. All these uncertainty relations become more attractive when expressed in terms of the symmetrized Renyi entropies.
DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.
Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui
2014-10-15
An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.
Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu
2017-05-15
We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.
Crooks, Richard O; Baxter, Daniel; Panek, Anna S; Lubben, Anneke T; Mason, Jody M
2016-01-29
Interactions between naturally occurring proteins are highly specific, with protein-network imbalances associated with numerous diseases. For designed protein-protein interactions (PPIs), required specificity can be notoriously difficult to engineer. To accelerate this process, we have derived peptides that form heterospecific PPIs when combined. This is achieved using software that generates large virtual libraries of peptide sequences and searches within the resulting interactome for preferentially interacting peptides. To demonstrate feasibility, we have (i) generated 1536 peptide sequences based on the parallel dimeric coiled-coil motif and varied residues known to be important for stability and specificity, (ii) screened the 1,180,416 member interactome for predicted Tm values and (iii) used predicted Tm cutoff points to isolate eight peptides that form four heterospecific PPIs when combined. This required that all 32 hypothetical off-target interactions within the eight-peptide interactome be disfavoured and that the four desired interactions pair correctly. Lastly, we have verified the approach by characterising all 36 pairs within the interactome. In analysing the output, we hypothesised that several sequences are capable of adopting antiparallel orientations. We subsequently improved the software by removing sequences where doing so led to fully complementary electrostatic pairings. Our approach can be used to derive increasingly large and therefore complex sets of heterospecific PPIs with a wide range of potential downstream applications from disease modulation to the design of biomaterials and peptides in synthetic biology. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Zhou, Feng; Noor, M Omair; Krull, Ulrich J
2014-03-04
A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.
2016-12-01
based complementary filter developed at the Naval Postgraduate School, is developed. The performance of a consumer-grade nine-degrees-of-freedom IMU...measurement unit, complementary filter , gait phase detection, zero velocity update, MEMS, IMU, AHRS, GPS denied, distributed sensor, virtual sensor...algorithm and quaternion-based complementary filter developed at the Naval Postgraduate School, is developed. The performance of a consumer-grade nine
López-Aguilar, Celeste; Romero-López, Cristina; Espinosa, Manuel; Berzal-Herranz, Alfredo; del Solar, Gloria
2015-01-01
Rolling-circle replication of streptococcal plasmid pMV158 is controlled by the concerted action of two trans-acting elements, namely transcriptional repressor CopG and antisense RNAII, which inhibit expression of the repB gene encoding the replication initiator protein. The pMV158-encoded antisense RNAII exerts its activity of replication control by inhibiting translation of the essential repB gene. RNAII is the smallest and simplest among the characterized antisense RNAs involved in control of plasmid replication. Structure analysis of RNAII revealed that it folds into an 8-bp-long stem containing a 1-nt bulge and closed by a 6-nt apical loop. This hairpin is flanked by a 17-nt-long single-stranded 5′-tail and an 8-nt-long 3′-terminal U-rich stretch. Here, the 3′ and 5′ regions of the 5′-tail of RNAII are shown to play a critical role in the binding to the target mRNA and in the inhibition of repB translation, respectively. In contrast, the apical loop of the single hairpin of RNAII plays a rather secondary role and the upper stem region hardly contributes to the binding or inhibition processes. The entire 5′-tail is required for efficient inhibition of repB translation, though only the 8-nt-long region adjacent to the hairpin seems to be essential for rapid binding to the mRNA. These results show that a “kissing” interaction involving base-pairing between complementary hairpin loops in RNAII and mRNA is not critical for efficient RNA/RNA binding or repB translation inhibition. A singular binding mechanism is envisaged whereby initial pairing between complementary single-stranded regions in the antisense and sense RNAs progresses upwards into the corresponding hairpin stems to form the intermolecular duplex. PMID:26175752
Genetics and the making of Homo sapiens.
Carroll, Sean B
2003-04-24
Understanding the genetic basis of the physical and behavioural traits that distinguish humans from other primates presents one of the great new challenges in biology. Of the millions of base-pair differences between humans and chimpanzees, which particular changes contributed to the evolution of human features after the separation of the Pan and Homo lineages 5-7 million years ago? How can we identify the 'smoking guns' of human genetic evolution from neutral ticks of the molecular evolutionary clock? The magnitude and rate of morphological evolution in hominids suggests that many independent and incremental developmental changes have occurred that, on the basis of recent findings in model animals, are expected to be polygenic and regulatory in nature. Comparative genomics, population genetics, gene-expression analyses and medical genetics have begun to make complementary inroads into the complex genetic architecture of human evolution.
NASA Astrophysics Data System (ADS)
Köster, K. W.; Klocke, T.; Wieland, F.; Böhmer, R.
2017-10-01
Protonic defects on ice lattices induced by doping with acids such as HCl and HF or bases such as KOH can facilitate order-disorder transitions. In laboratory experiments KOH doping is efficient in promoting the ordering transition from hexagonal ice I to ice XI, but it is ineffective for other known ice phases, for which HCl can trigger hydrogen ordering. Aiming at understanding these differences, random-walk simulations of the defect diffusion are performed on two- and three-dimensional ice lattices under the constraints imposed by the Bernal-Fowler ice rules. Effective defect diffusion coefficients are calculated for a range of dopants, concentrations, and ice phases. The interaction of different defects, incorporated by different dopants, is investigated to clarify the particular motion-enhancing role played by complementary defect pairs.
Complementary Paired G4FETs as Voltage-Controlled NDR Device
NASA Technical Reports Server (NTRS)
Mojarradi, Mohammad; Chen, Suheng; Blalock, Ben; Britton, Chuck; Prothro, Ben; Vandersand, James; Schrimph, Ron; Cristoloveanu, Sorin; Akavardar, Kerem; Gentil, P.
2009-01-01
It is possible to synthesize a voltage-controlled negative-differential-resistance (NDR) device or circuit by use of a pair of complementary G4FETs (four-gate field-effect transistors). [For more information about G4FETs, please see the immediately preceding article]. As shown in Figure 1, the present voltage-controlled NDR device or circuit is an updated version of a prior NDR device or circuit, known as a lambda diode, that contains a pair of complementary junction field-effect transistors (JFETs). (The lambda diode is so named because its current-versus- voltage plot bears some resemblance to an upper-case lambda.) The present version can be derived from the prior version by substituting G4FETs for the JFETs and connecting both JFET gates of each G4FET together. The front gate terminals of the G4FETs constitute additional terminals (that is, terminals not available in the older JFET version) to which one can apply control voltages VN and VP. Circuits in which NDR devices have been used include (1) Schmitt triggers and (2) oscillators containing inductance/ capacitance (LC) resonant circuits. Figure 2 depicts such circuits containing G4FET NDR devices like that of Figure 1. In the Schmitt trigger shown here, the G4FET NDR is loaded with an ordinary inversion-mode, p-channel, metal oxide/semiconductor field-effect transistor (inversion-mode PMOSFET), the VN terminal of the G4FET NDR device is used as an input terminal, and the input terminals of the PMOSFET and the G4FET NDR device are connected. VP can be used as an extra control voltage (that is, a control voltage not available in a typical prior Schmitt trigger) for adjusting the pinch-off voltage of the p-channel G4FET and thereby adjusting the trigger-voltage window. In the oscillator, a G4FET NDR device is loaded with a conventional LC tank circuit. As in other LC NDR oscillators, oscillation occurs because the NDR counteracts the resistance in the tank circuit. The advantage of this G4FET-NDR LC oscillator over a conventional LC NDR oscillator is that one can apply a time-varying signal to one of the extra control input terminals (VN or VP) to modulate the conductance of the NDR device and thereby amplitude-modulate the output signal.
Wang, Fenglei; Liu, Huijuan; Wan, Yi; Li, Jing; Chen, Yu; Zheng, Jusheng; Huang, Tao; Li, Duo
2017-03-23
Age of complementary foods introduction is associated with childhood anemia, but the ideal age for the introduction of complementary foods to infants is a continuing topic of debate. We examined the longitudinal association between complementary foods introduction age and risk of anemia in 18,446 children from the Jiaxing Birth Cohort, who had detailed complementary feeding records at 3 and 6 months of age and had hemoglobin concentrations measured at 4-6 years. Early introduction of complementary foods at 3-6 months of age was significantly associated with a higher risk of anemia (odds ratio = 1.14; 95% confidence interval: 1.01-1.28) and a lower hemoglobin concentration of -0.84 g/L (95% confidence interval: -1.33 to -0.35) in children aged 4-6 years, compared with those fed complementary foods starting at 6 months of age. When it comes to the specific type of complementary foods, early introduction of all plant-based foods was associated with increased anemia risks and lower hemoglobin concentrations, while early introduction of most animal-based foods was not. These findings may be informative regarding the appropriate time to introduce complementary foods in infants.
Pitfall Traps and Mini-Winkler Extractor as Complementary Methods to Sample Soil Coleoptera.
Carneiro, A C; Batistella, D A; Battirola, L D; Marques, M I
2016-02-01
We compared abundance, species richness, and capture efficiency with pitfall traps and mini-Winkler extractors to examine their use as complementary methods for sampling soil Coleoptera during dry (2010) and high water seasons (2011) in three areas, including inundated and non-inundated regions, in the Pantanal of Poconé, Mato Grosso, Brazil. We paired treatments with two 10 × 10 m plots in inundated and non-inundated locations that were repeated three times in each location for a total of 18 plots. In each plot, we used nine pitfall traps and collected 2 m(2) of leaf litter and surface soil samples with mini-Winkler extractors. We collected a total of 4260 adult beetles comprising 36 families, 113 genera, and 505 species. Most were caught in pitfalls (69%) and the remainder in the mini-Winkler extractors (31%). Each method provided distinct information about the beetle community: 252 species were captured only in pitfall traps, 147 using only the mini-Winkler extractors, and these methods shared another 106 species. Pitfall and mini-Winkler contribute in different ways for the sampling of the soil beetle community, and so they should be considered complementary for a more thorough assessment of community diversity.
Laboratory-based characterization of plutonium in soil particles using micro-XRF and 3D confocal XRF
McIntosh, Kathryn Gallagher; Cordes, Nikolaus Lynn; Patterson, Brian M.; ...
2015-03-29
The investigation of plutonium (Pu) in a soil matrix is of interest in safeguards, nuclear forensics, and environmental remediation activities. The elemental composition of two plutonium contaminated soil particles was characterized nondestructively using a pair of micro X-ray fluorescence spectrometry (micro-XRF) techniques including high resolution X-ray (hiRX) and 3D confocal XRF. The three dimensional elemental imaging capability of confocal XRF permitted the identification two distinct Pu particles within the samples: one external to the Ferich soil matrix and another co-located with Cu within the soil matrix. The size and morphology of the particles was assessed with X-ray transmission microscopy andmore » micro X-ray computed tomography (micro-CT) providing complementary morphological information. Limits of detection for a 30 μm Pu particle are <10 ng for each of the XRF techniques. Ultimately, this study highlights the capability for lab-based, nondestructive, spatially resolved characterization of heterogeneous matrices on the micrometer scale with nanogram sensitivity.« less
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-01-01
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson–Crick base-pairing even in the 3′-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5′ base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region. PMID:27325485
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-06-21
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.
The Revolution Continues: Newly Discovered Systems Expand the CRISPR-Cas Toolkit.
Murugan, Karthik; Babu, Kesavan; Sundaresan, Ramya; Rajan, Rakhi; Sashital, Dipali G
2017-10-05
CRISPR-Cas systems defend prokaryotes against bacteriophages and mobile genetic elements and serve as the basis for revolutionary tools for genetic engineering. Class 2 CRISPR-Cas systems use single Cas endonucleases paired with guide RNAs to cleave complementary nucleic acid targets, enabling programmable sequence-specific targeting with minimal machinery. Recent discoveries of previously unidentified CRISPR-Cas systems have uncovered a deep reservoir of potential biotechnological tools beyond the well-characterized Type II Cas9 systems. Here we review the current mechanistic understanding of newly discovered single-protein Cas endonucleases. Comparison of these Cas effectors reveals substantial mechanistic diversity, underscoring the phylogenetic divergence of related CRISPR-Cas systems. This diversity has enabled further expansion of CRISPR-Cas biotechnological toolkits, with wide-ranging applications from genome editing to diagnostic tools based on various Cas endonuclease activities. These advances highlight the exciting prospects for future tools based on the continually expanding set of CRISPR-Cas systems. Copyright © 2017 Elsevier Inc. All rights reserved.
An experimental study of the emergence of human communication systems.
Galantucci, Bruno
2005-09-10
The emergence of human communication systems is typically investigated via 2 approaches with complementary strengths and weaknesses: naturalistic studies and computer simulations. This study was conducted with a method that combines these approaches. Pairs of participants played video games requiring communication. Members of a pair were physically separated but exchanged graphic signals through a medium that prevented the use of standard symbols (e.g., letters). Communication systems emerged and developed rapidly during the games, integrating the use of explicit signs with information implicitly available to players and silent behavior-coordinating procedures. The systems that emerged suggest 3 conclusions: (a) signs originate from different mappings; (b) sign systems develop parsimoniously; (c) sign forms are perceptually distinct, easy to produce, and tolerant to variations. 2005 Lawrence Erlbaum Associates, Inc.
A 5GHz Band Low Noise and Wide Tuning Range Si-CMOS VCO with a Novel Varactors Pair Circuit
NASA Astrophysics Data System (ADS)
Ta, Tuan Thanh; Kameda, Suguru; Takagi, Tadashi; Tsubouchi, Kazuo
In this paper, a fully integrated 5GHz voltage controlled oscillator (VCO) is presented. The VCO is designed with 0.18µm silicon complementary metal oxide semiconductor (Si-CMOS) process. To achieve low phase noise, a novel varactors pair circuit is proposed to cancel effects of capacitance fluctuation that makes harmonic currents which increase phase noise of VCO. The VCO with the proposed varactor circuit has tuning range from 5.1GHz to 6.1GHz (relative value of 17.9%) and phase noise of lower than -110.8dBc/Hz at 1MHz offset over the full tuning range. Figure-of-merit-with-tuning-range (FOMT) of the proposed VCO is -182dBc/Hz.
Programmable Spectral Source and Design Tool for 3D Imaging Using Complementary Bandpass Filters
NASA Technical Reports Server (NTRS)
Bae, Youngsam (Inventor); Korniski, Ronald J. (Inventor); Ream, Allen (Inventor); Shearn, Michael J. (Inventor); Shahinian, Hrayr Karnig (Inventor); Fritz, Eric W. (Inventor)
2017-01-01
An endoscopic illumination system for illuminating a subject for stereoscopic image capture, includes a light source which outputs light; a first complementary multiband bandpass filter (CMBF) and a second CMBF, the first and second CMBFs being situated in first and second light paths, respectively, where the first CMBF and the second CMBF filter the light incident thereupon to output filtered light; and a camera which captures video images of the subject and generates corresponding video information, the camera receiving light reflected from the subject and passing through a pupil CMBF pair and a detection lens. The pupil CMBF includes a first pupil CMBF and a second pupil CMBF, the first pupil CMBF being identical to the first CMBF and the second pupil CMBF being identical to the second CMBF, and the detection lens includes one unpartitioned section that covers both the first pupil CMBF and the second pupil CMBF.
Salience of unique hues and implications for color theory
Wool, Lauren E.; Komban, Stanley J.; Kremkow, Jens; Jansen, Michael; Li, Xiaobing; Alonso, Jose-Manuel; Zaidi, Qasim
2015-01-01
The unique hues—blue, green, yellow, red—form the fundamental dimensions of opponent-color theories, are considered universal across languages, and provide useful mental representations for structuring color percepts. However, there is no neural evidence for them from neurophysiology or low-level psychophysics. Tapping a higher prelinguistic perceptual level, we tested whether unique hues are particularly salient in search tasks. We found no advantage for unique hues over their nonunique complementary colors. However, yellowish targets were detected faster, more accurately, and with fewer saccades than their complementary bluish targets (including unique blue), while reddish-greenish pairs were not significantly different in salience. Similarly, local field potentials in primate V1 exhibited larger amplitudes and shorter latencies for yellowish versus bluish stimuli, whereas this effect was weaker for reddish versus greenish stimuli. Consequently, color salience is affected more by early neural response asymmetries than by any possible mental or neural representation of unique hues. PMID:25761328
Kits for Characterization of Chromosomal Inversions Using Probes
NASA Technical Reports Server (NTRS)
Ray, F. Andrew (Inventor)
2017-01-01
A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maruyama, Sho
2015-12-15
The invariant mass of tau lepton pairs turns out to be smaller than the resonant mass of their mother particle and the invariant mass distribution is stretched wider than the width of the resonant mass as significant fraction of tau lepton momenta are carried away by neutrinos escaping undetected at collider experiments. This paper describes a new approach to reconstruct resonant masses of heavy particles decaying to tau leptons at such experiments. A typical example is a Z or Higgs boson decaying to a tau pair. Although the new technique can be used for each tau lepton separately, I combinemore » two tau leptons to improve mass resolution by requiring the two tau leptons are lined up in a transverse plane. The method is simple to implement and complementary to the collinear approximation technique that works well when tau leptons are not lined up in a transverse plane. The reconstructed mass can be used as another variable in analyses that already use a visible tau pair mass and missing transverse momentum as these variables are not explicitly used in the stochastic mass-reconstruction to select signal-like events.« less
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Coloring your information: How designers use Theory of Color in creative ways to present infographic
NASA Astrophysics Data System (ADS)
Lucius, C. R.; Fuad, A.
2017-12-01
Various methods of data presentation is now visualized through engaging infographics and perform the presentation techniques a new kind of storytelling. Geometric elements for infographics perform interesting data, which is developed with color harmony. There are categories of colors based on color circle from the theory of color design: primary color, secondary color and tertiary color. This color circle allows a designer to visualize the balance and harmony of colors when they are side by side. These composition of colors can be formed as a harmonious dyad, triad, or tetrads. A harmonious dyad is formed from two diametrically opposed colors on the color circle, which known as contrast complementary and works best in color harmonious if one of the colors is dominant. A harmonious triad is represented by three colors from the color circle which positions with an equilateral triangle. An triangle of yellow-red-blue shows the most powerful of harmonious triad and call as the fundamental triad. A harmonious tetrad is developed from two pairs of complementary colors, which can be formed by rectangle or square on the color circle. It help to figure out how objects are connected on presenting data. To create an efficiency infographic, presenting data has to prepare with some strategic. The color circle has the power to perform the infographic when it is made for a fascinating design.
Misra, Arvind; Mishra, Satyendra; Misra, Krishna
2004-01-01
Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.
Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.
2016-01-01
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011
Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G
2016-06-24
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.
... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... and gemcitabine in patients with advanced solid tumors. Evidence-Based Complementary and Alternative Medicine. 2013;2013:964592. National ...
... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... 495. Holland S, Silberstein SD, Freitag F, et al. Evidence-based guideline update: NSAIDs and other complementary treatments for ...
Templeman, Kate; Robinson, Anske; McKenna, Lisa
2016-09-01
The aim of this study was to identify Australian medical students' complementary medicine information needs. Thirty medical students from 10 medical education faculties across Australian universities were recruited. Data were generated using in-depth semi-structured interviews and constructivist grounded theory method was used to analyze and construct data. Students sought complementary medicine information from a range of inadequate sources, such as pharmacological texts, Internet searches, peer-reviewed medical journals, and drug databases. The students identified that many complementary medicine resources may not be regarded as objective, reliable, differentiated, or comprehensive, leaving much that medical education needs to address. Most students sought succinct, easily accessible, evidence-based information to inform safe and appropriate clinical decisions about complementary medicines. A number of preferred resources were identified that can be recommended and actively promoted to medical students. Therefore, specific, evidence-based complementary medicine databases and secondary resources should be subscribed and recommended to medical schools and students, to assist meeting professional responsibilities regarding complementary medicines. These findings may help inform the development of appropriate medical information resources regarding complementary medicines. © 2016 John Wiley & Sons Australia, Ltd.
Interpreting contact angle results under air, water and oil for the same surfaces
NASA Astrophysics Data System (ADS)
Ozkan, Orkun; Yildirim Erbil, H.
2017-06-01
Under-water and under-oil superhydropobicity and superhydrophilicity have gained significant attention over the last few years. In this study, contact angles on five flat surfaces (polypropylene, poly(methyl methacrylate), polycarbonate, TEFLON-FEP and glass slide) were measured in water drop-in-air, air bubble-under-water, oil drop-in-air, air bubble-under-oil, oil drop-under-water and water drop-under-oil conditions. Heptane, octane, nonane, decane, dodecane, and hexadecane hydrocarbons were used as oils. Immiscible water/oil pairs were previously mutually saturated to provide thermodynamical equilibrium conditions and their surface and interfacial tensions were determined experimentally. These pairs were used in the two-liquid contact angle measurements. Surface free energies of the solid surfaces in air were determined independently by using the van Oss-Good method, using the contact angle results of pure water, ethylene glycol, formamide, methylene iodide and α-bromonaphalene. In addition, Zisman’s ‘critical surface tension’ values were also determined for comparison. In theory, the summation of contact angle results in a complementary case would give a total of 180° for ideal surfaces. However, it was determined that there are large deviations from this rule in practical cases and these deviations depend on surface free energies of solids. Three complementary cases of (water-in-air with air bubble-under-water); (oil-in-air with air bubble-under-oil); and (oil-under-water with water-under-oil) were investigated in particular to determine the deviations from ideality. A novel approach, named ‘complementary hysteresis’ [γ WA(cosθ 1 - cosθ 2) and γ OW(cosθ 6 - cosθ 5)] was developed where γ WA and γ OW represent the interfacial tensions of water/air and oil/water, and θ 1, θ 2, θ 5, and θ 6 were the contact angles of water/air, air bubble/water, oil/water and water/oil respectively. It was experimentally determined that complementary hysteresis varies almost linearly with the surface free energy of the flat solid samples. This is the first report showing the relation of the surface free energy of a solid which is determined under-air with the contact angles obtained on the same solid in different three-phase systems.
Discovering complementary colors from the perspective of steam education
NASA Astrophysics Data System (ADS)
Karabey, Burak; Yigit Koyunkaya, Melike; Enginoglu, Turan; Yurumezoglu, Kemal
2018-05-01
This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of complementary colors accessible to all through practical applications and provides a multidisciplinary, integrated and innovative technique of teaching the subject of colors, which could be used to teach complementary colors.
NASA Technical Reports Server (NTRS)
Buratti, B. J.; Dunbar, R. S.; Tedesco, E. F.; Gibson, J.; Marcialis, R. L.; Wong, F.; Bennett, S.; Dobrovolskis, A.
1995-01-01
We present observations of 15 Pluto-Charon mutual events which were obtained with the 60 in. telescope at Palomar Mountain Observatory. A CCD camera and Johnson V filter were used for the observations, except for one event that was observed with a Johnson B filter, and another event that was observed with a Gunn R filter. We observed two events in their entirety, and three pairs of complementary mutual occultation-transit events.
Weaning Time in Preterm Infants: An Audit of Italian Primary Care Paediatricians.
Baldassarre, Maria Elisabetta; Di Mauro, Antonio; Pedico, Annarita; Rizzo, Valentina; Capozza, Manuela; Meneghin, Fabio; Lista, Gianluca; Laforgia, Nicola
2018-05-15
According to the 2016 Italian National Institute of Statistics (Istat) data in Italy, about 6.7% of all newborns are born prematurely. Due to the lack of data on current complementary feeding in preterm infants in Italy, the aim of the survey was to evaluate individual attitudes of primary care paediatricians, concerning the introduction of complementary foods in preterm infants. An internet-based survey was conducted among primary care paediatricians, working in Italy, regarding (1) timing of the introduction of complementary foods to preterm newborns; (2) type of complementary foods introduced; (3) vitamin D and iron supplementations. A total of 347 primary care Italian paediatricians answered the questionnaire; 44% of responders based the timing of the introduction of solid food exclusively on an infant's age, 18% on an infant's neurodevelopmental status and 4% on the body weight; the remaining 34% based the timing on two or more of these aspects. The type of complementary foods did not comply with an evidence-based sequence; 98% of participants promoted vitamin D supplementation and 89% promoted iron supplementation with great diversity in timing and doses. Due to limited evidence, there is a great heterogeneity in the attitudes of primary care paediatricians concerning the introduction of complementary foods to preterm newborns. Further research is needed to provide evidence-based guidelines regarding weaning preterm newborns.
Ye, Congting; Ji, Guoli; Li, Lei; Liang, Chun
2014-01-01
Inverted repeats are present in abundance in both prokaryotic and eukaryotic genomes and can form DNA secondary structures--hairpins and cruciforms that are involved in many important biological processes. Bioinformatics tools for efficient and accurate detection of inverted repeats are desirable, because existing tools are often less accurate and time consuming, sometimes incapable of dealing with genome-scale input data. Here, we present a MATLAB-based program called detectIR for the perfect and imperfect inverted repeat detection that utilizes complex numbers and vector calculation and allows genome-scale data inputs. A novel algorithm is adopted in detectIR to convert the conventional sequence string comparison in inverted repeat detection into vector calculation of complex numbers, allowing non-complementary pairs (mismatches) in the pairing stem and a non-palindromic spacer (loop or gaps) in the middle of inverted repeats. Compared with existing popular tools, our program performs with significantly higher accuracy and efficiency. Using genome sequence data from HIV-1, Arabidopsis thaliana, Homo sapiens and Zea mays for comparison, detectIR can find lots of inverted repeats missed by existing tools whose outputs often contain many invalid cases. detectIR is open source and its source code is freely available at: https://sourceforge.net/projects/detectir.
Interactional leader–follower sensorimotor communication strategies during repetitive joint actions
Candidi, Matteo; Curioni, Arianna; Donnarumma, Francesco; Sacheli, Lucia Maria; Pezzulo, Giovanni
2015-01-01
Non-verbal communication is the basis of animal interactions. In dyadic leader–follower interactions, leaders master the ability to carve their motor behaviour in order to ‘signal’ their future actions and internal plans while these signals influence the behaviour of follower partners, who automatically tend to imitate the leader even in complementary interactions. Despite their usefulness, signalling and imitation have a biomechanical cost, and it is unclear how this cost–benefits trade-off is managed during repetitive dyadic interactions that present learnable regularities. We studied signalling and imitation dynamics (indexed by movement kinematics) in pairs of leaders and followers during a repetitive, rule-based, joint action. Trial-by-trial Bayesian model comparison was used to evaluate the relation between signalling, imitation and pair performance. The different models incorporate different hypotheses concerning the factors (past interactions versus online movements) influencing the leader's signalling (or follower's imitation) kinematics. This approach showed that (i) leaders' signalling strategy improves future couple performance, (ii) leaders used the history of past interactions to shape their signalling, (iii) followers' imitative behaviour is more strongly affected by the online movement of the leader. This study elucidates the ways online sensorimotor communication help individuals align their task representations and ultimately improves joint action performance. PMID:26333815
Rohani, Nazanin; Parmeggiani, Andrea; Winklbauer, Rudolf; Fagotto, François
2014-01-01
Ephrins and Eph receptors are involved in the establishment of vertebrate tissue boundaries. The complexity of the system is puzzling, however in many instances, tissues express multiple ephrins and Ephs on both sides of the boundary, a situation that should in principle cause repulsion between cells within each tissue. Although co-expression of ephrins and Eph receptors is widespread in embryonic tissues, neurons, and cancer cells, it is still unresolved how the respective signals are integrated into a coherent output. We present a simple explanation for the confinement of repulsion to the tissue interface: Using the dorsal ectoderm–mesoderm boundary of the Xenopus embryo as a model, we identify selective functional interactions between ephrin–Eph pairs that are expressed in partial complementary patterns. The combined repulsive signals add up to be strongest across the boundary, where they reach sufficient intensity to trigger cell detachments. The process can be largely explained using a simple model based exclusively on relative ephrin and Eph concentrations and binding affinities. We generalize these findings for the ventral ectoderm–mesoderm boundary and the notochord boundary, both of which appear to function on the same principles. These results provide a paradigm for how developmental systems may integrate multiple cues to generate discrete local outcomes. PMID:25247423
Rohani, Nazanin; Parmeggiani, Andrea; Winklbauer, Rudolf; Fagotto, François
2014-09-01
Ephrins and Eph receptors are involved in the establishment of vertebrate tissue boundaries. The complexity of the system is puzzling, however in many instances, tissues express multiple ephrins and Ephs on both sides of the boundary, a situation that should in principle cause repulsion between cells within each tissue. Although co-expression of ephrins and Eph receptors is widespread in embryonic tissues, neurons, and cancer cells, it is still unresolved how the respective signals are integrated into a coherent output. We present a simple explanation for the confinement of repulsion to the tissue interface: Using the dorsal ectoderm-mesoderm boundary of the Xenopus embryo as a model, we identify selective functional interactions between ephrin-Eph pairs that are expressed in partial complementary patterns. The combined repulsive signals add up to be strongest across the boundary, where they reach sufficient intensity to trigger cell detachments. The process can be largely explained using a simple model based exclusively on relative ephrin and Eph concentrations and binding affinities. We generalize these findings for the ventral ectoderm-mesoderm boundary and the notochord boundary, both of which appear to function on the same principles. These results provide a paradigm for how developmental systems may integrate multiple cues to generate discrete local outcomes.
Interactional leader-follower sensorimotor communication strategies during repetitive joint actions.
Candidi, Matteo; Curioni, Arianna; Donnarumma, Francesco; Sacheli, Lucia Maria; Pezzulo, Giovanni
2015-09-06
Non-verbal communication is the basis of animal interactions. In dyadic leader-follower interactions, leaders master the ability to carve their motor behaviour in order to 'signal' their future actions and internal plans while these signals influence the behaviour of follower partners, who automatically tend to imitate the leader even in complementary interactions. Despite their usefulness, signalling and imitation have a biomechanical cost, and it is unclear how this cost-benefits trade-off is managed during repetitive dyadic interactions that present learnable regularities. We studied signalling and imitation dynamics (indexed by movement kinematics) in pairs of leaders and followers during a repetitive, rule-based, joint action. Trial-by-trial Bayesian model comparison was used to evaluate the relation between signalling, imitation and pair performance. The different models incorporate different hypotheses concerning the factors (past interactions versus online movements) influencing the leader's signalling (or follower's imitation) kinematics. This approach showed that (i) leaders' signalling strategy improves future couple performance, (ii) leaders used the history of past interactions to shape their signalling, (iii) followers' imitative behaviour is more strongly affected by the online movement of the leader. This study elucidates the ways online sensorimotor communication help individuals align their task representations and ultimately improves joint action performance. © 2015 The Author(s).
Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2015-01-01
The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000
Selection and characterization of a DNA aptamer to crystal violet.
Chen, Yang; Wang, Jine; Zhang, Yajie; Xu, Lijun; Gao, Tian; Wang, Bing; Pei, Renjun
2018-06-13
Aptamers are short single-stranded DNA or RNA, which can be selected in vitro by systematic evolution of ligands by exponential enrichment (SELEX). In order to develop novel light-up probes to substitute G-quadruplex (G4), we selected a DNA aptamer for crystal violet (CV), a triphenylmethane light-up dye, by a modified affinity chromatography-based SELEX. The ssDNA pool was first coupled on streptavidin-coated agarose beads through a biotin labeled complementary oligonucleotide, and then the aptamer sequences would be released from agarose beads by CV affinity. This method is simple, straightforward and effective. The aptamer sequence with a low micromolar dissociation constant (Kd) and good specificity was achieved after 11 rounds of selection. The light-up properties of the CV-aptamer were also investigated, and the CV showed dramatic fluorescence enhancement. The CV-aptamer pair could be further used as a novel light-up fluorescent probe to design biosensors.
Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB
Sugiman-Marangos, Seiji N.; Weiss, Yoni M.; Junop, Murray S.
2016-01-01
Accurate pairing of DNA strands is essential for repair of DNA double-strand breaks (DSBs). How cells achieve accurate annealing when large regions of single-strand DNA are unpaired has remained unclear despite many efforts focused on understanding proteins, which mediate this process. Here we report the crystal structure of a single-strand annealing protein [DdrB (DNA damage response B)] in complex with a partially annealed DNA intermediate to 2.2 Å. This structure and supporting biochemical data reveal a mechanism for accurate annealing involving DdrB-mediated proofreading of strand complementarity. DdrB promotes high-fidelity annealing by constraining specific bases from unauthorized association and only releases annealed duplex when bound strands are fully complementary. To our knowledge, this mechanism provides the first understanding for how cells achieve accurate, protein-assisted strand annealing under biological conditions that would otherwise favor misannealing. PMID:27044084
Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.
Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo
2013-11-15
We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.
A low power low noise analog front end for portable healthcare system
NASA Astrophysics Data System (ADS)
Yanchao, Wang; Keren, Ke; Wenhui, Qin; Yajie, Qin; Ting, Yi; Zhiliang, Hong
2015-10-01
The presented analog front end (AFE) used to process human bio-signals consists of chopping instrument amplifier (IA), chopping spikes filter and programmable gain and bandwidth amplifier. The capacitor-coupling input of AFE can reject the DC electrode offset. The power consumption of current-feedback based IA is reduced by adopting capacitor divider in the input and feedback network. Besides, IA's input thermal noise is decreased by utilizing complementary CMOS input pairs which can offer higher transconductance. Fabricated in Global Foundry 0.35 μm CMOS technology, the chip consumes 3.96 μA from 3.3 V supply. The measured input noise is 0.85 μVrms (0.5-100 Hz) and the achieved noise efficient factor is 6.48. Project supported by the Science and Technology Commission of Shanghai Municipality (No. 13511501100), the State Key Laboratory Project of China (No. 11MS002), and the State Key Laboratory of ASIC & System, Fudan University.
Sheng, Gang; Zhao, Hongtu; Wang, Jiuyu; Rao, Yu; Tian, Wenwen; Swarts, Daan C.; van der Oost, John; Patel, Dinshaw J.; Wang, Yanli
2014-01-01
We report on crystal structures of ternary Thermus thermophilus Argonaute (TtAgo) complexes with 5′-phosphorylated guide DNA and a series of DNA targets. These ternary complex structures of cleavage-incompatible, cleavage-compatible, and postcleavage states solved at improved resolution up to 2.2 Å have provided molecular insights into the orchestrated positioning of catalytic residues, a pair of Mg2+ cations, and the putative water nucleophile positioned for in-line attack on the cleavable phosphate for TtAgo-mediated target cleavage by a RNase H-type mechanism. In addition, these ternary complex structures have provided insights into protein and DNA conformational changes that facilitate transition between cleavage-incompatible and cleavage-compatible states, including the role of a Glu finger in generating a cleavage-competent catalytic Asp-Glu-Asp-Asp tetrad. Following cleavage, the seed segment forms a stable duplex with the complementary segment of the target strand. PMID:24374628
Low dose irradiation facilitates hepatocellular carcinoma genesis involving HULC.
Li, Yuan; Ge, Chang; Feng, Guoxing; Xiao, Huiwen; Dong, Jiali; Zhu, Changchun; Jiang, Mian; Cui, Ming; Fan, Saijun
2018-03-24
Irradiation exposure positive correlates with tumor formation, such as breast cancer and lung cancer. However, whether low dose irradiation induces hepatocarcinogenesis and the underlying mechanism remain poorly defined. In the present study, we reported that low dose irradiation facilitated the proliferation of hepatocyte through up-regulating HULC in vitro and in vivo. Low dose irradiation exposure elevated HULC expression level in hepatocyte. Deletion of heightened HULC erased the cells growth accelerated following low dose irradiation exposure. CDKN1, the neighbor gene of HULC, was down-regulated by overexpression of HULC following low dose irradiation exposure via complementary base pairing, resulting in promoting cell cycle process. Thus, our findings provide new insights into the mechanism of low dose irradiation-induced hepatocarcinogenesis through HULC/CDKN1 signaling, and shed light on the potential risk of low dose irradiation for the development of hepatocellular carcinoma in pre-clinical settings. © 2018 Wiley Periodicals, Inc.
Lan, Jiayi; Núñez Galindo, Antonio; Doecke, James; Fowler, Christopher; Martins, Ralph N; Rainey-Smith, Stephanie R; Cominetti, Ornella; Dayon, Loïc
2018-04-06
Over the last two decades, EDTA-plasma has been used as the preferred sample matrix for human blood proteomic profiling. Serum has also been employed widely. Only a few studies have assessed the difference and relevance of the proteome profiles obtained from plasma samples, such as EDTA-plasma or lithium-heparin-plasma, and serum. A more complete evaluation of the use of EDTA-plasma, heparin-plasma, and serum would greatly expand the comprehensiveness of shotgun proteomics of blood samples. In this study, we evaluated the use of heparin-plasma with respect to EDTA-plasma and serum to profile blood proteomes using a scalable automated proteomic pipeline (ASAP 2 ). The use of plasma and serum for mass-spectrometry-based shotgun proteomics was first tested with commercial pooled samples. The proteome coverage consistency and the quantitative performance were compared. Furthermore, protein measurements in EDTA-plasma and heparin-plasma samples were comparatively studied using matched sample pairs from 20 individuals from the Australian Imaging, Biomarkers and Lifestyle (AIBL) Study. We identified 442 proteins in common between EDTA-plasma and heparin-plasma samples. Overall agreement of the relative protein quantification between the sample pairs demonstrated that shotgun proteomics using workflows such as the ASAP 2 is suitable in analyzing heparin-plasma and that such sample type may be considered in large-scale clinical research studies. Moreover, the partial proteome coverage overlaps (e.g., ∼70%) showed that measures from heparin-plasma could be complementary to those obtained from EDTA-plasma.
Use of molecular binding pair technology for definitive product marking and identification
NASA Astrophysics Data System (ADS)
Rittenburg, James H.
1998-04-01
Counterfeiting and diversion of brand name products is a significant worldwide problem. Loss of revenue to the manufacturers is obviously important, however erosion of consumer confidence, and liability for adverse health effects or performance caused by poor quality product can be of even greater significance. Biocode has developed a novel approach to product marking and identification that utilizes molecular binding pair technologies such as immunoassay. The sensitivity, specificity, and ease of use of immunoassay provides a powerful method for detecting trace levels of intentionally added chemical markers. Using the diversity of the immune response, Biocode has developed a library of binding molecules and highly sensitive immunoassay systems for detection and measurement of a variety of chemical markers. The markers have been selected based on their stability and compatibility within various types of products. For food, beverage, and pharmaceutical applications, common and naturally occurring food ingredients and pharmaceutical excipients provide markers which are safe, readily available, and already approved for use. For other applications such as fuel and lubricant marking. Solubility and chemical stability of the markers are a major consideration. In addition to incorporating markers directly into products, Biocode has also developed invisible inks that can be printed onto the surface of products, packaging, or labels. The trace levels of marker that is printed onto the surface of a product or package can only be revealed by using the complementary binding pair that has been developed by Biocode. This technology provides for simple field tests and very high level of security as it is virtually impossible to copy.
Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho
2016-01-01
Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479
Nelson, Paul A.; Thorne, Avril; Shapiro, Lauren A.
2011-01-01
Close college-age friendships provide differential opportunities for reinforcing dispositional tendencies and fostering accommodation or change. This finding was obtained from a cross-sectional study of 66 pairs of same-sex college-age friends (58% female). Each pair of friends was extreme and either very similar or different with regard to extraversion-introversion. Interviews with each friend were analyzed for references to each other's role in various friendship domains, including the setting of the friendship and position with regard to chatting, disclosing, expressing opinions about peers, and energizing the friendship. Matched friends mutually reinforced each other's similar dispositional tendencies. Friends with contrasting personalities showed patterns of personality accommodation as well as complementary reinforcement. Implications are discussed for embedding reciprocal theories of personality development in close friendships. PMID:21241308
Dedicated Stereophotogrammetric X-Ray System For Craniofacial Research And Treatment Planning
NASA Astrophysics Data System (ADS)
Baumrind, Sheldon; Moffitt, Francis; Curry, Sean; Isaacson, Robert J.
1983-07-01
We have constructed and brought into use what we believe to be the first dedicated coplanar craniofacial stereometric x-ray system for clinical use. Paired Machlett Dynamax 50/58 x-ray tubes with 0.3 mm focal spots are employed. Displacement between emitters is 16 inches. The focus film distance for both emitters is 66.5 inches. The mid-sagittal plane to focus distance is 60 inches. One film of each stereo pair conforms with the standards of the Second Roentgenocephalometric Workshop and can be used to make all standard two-dimensional orthodontic and cephalometric measurements. When supplemented by data from the conjugate film, a three-dimensional coordinate map can be generated as a machine operation. Specialized complementary software has been developed to increase the reliability of landmark location both in two and in three dimensions.
Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles
2015-02-17
Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.
Ensemble-based prediction of RNA secondary structures.
Aghaeepour, Nima; Hoos, Holger H
2013-04-24
Accurate structure prediction methods play an important role for the understanding of RNA function. Energy-based, pseudoknot-free secondary structure prediction is one of the most widely used and versatile approaches, and improved methods for this task have received much attention over the past five years. Despite the impressive progress that as been achieved in this area, existing evaluations of the prediction accuracy achieved by various algorithms do not provide a comprehensive, statistically sound assessment. Furthermore, while there is increasing evidence that no prediction algorithm consistently outperforms all others, no work has been done to exploit the complementary strengths of multiple approaches. In this work, we present two contributions to the area of RNA secondary structure prediction. Firstly, we use state-of-the-art, resampling-based statistical methods together with a previously published and increasingly widely used dataset of high-quality RNA structures to conduct a comprehensive evaluation of existing RNA secondary structure prediction procedures. The results from this evaluation clarify the performance relationship between ten well-known existing energy-based pseudoknot-free RNA secondary structure prediction methods and clearly demonstrate the progress that has been achieved in recent years. Secondly, we introduce AveRNA, a generic and powerful method for combining a set of existing secondary structure prediction procedures into an ensemble-based method that achieves significantly higher prediction accuracies than obtained from any of its component procedures. Our new, ensemble-based method, AveRNA, improves the state of the art for energy-based, pseudoknot-free RNA secondary structure prediction by exploiting the complementary strengths of multiple existing prediction procedures, as demonstrated using a state-of-the-art statistical resampling approach. In addition, AveRNA allows an intuitive and effective control of the trade-off between false negative and false positive base pair predictions. Finally, AveRNA can make use of arbitrary sets of secondary structure prediction procedures and can therefore be used to leverage improvements in prediction accuracy offered by algorithms and energy models developed in the future. Our data, MATLAB software and a web-based version of AveRNA are publicly available at http://www.cs.ubc.ca/labs/beta/Software/AveRNA.
Structural basis for microRNA targeting
Schirle, Nicole T.; Sheu-Gruttadauria, Jessica; MacRae, Ian J.
2014-10-31
MicroRNAs (miRNAs) control expression of thousands of genes in plants and animals. miRNAs function by guiding Argonaute proteins to complementary sites in messenger RNAs (mRNAs) targeted for repression. In this paper, we determined crystal structures of human Argonaute-2 (Ago2) bound to a defined guide RNA with and without target RNAs representing miRNA recognition sites. These structures suggest a stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions withmore » the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Spurious slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion. Finally, these results explain the conserved nucleotide-pairing patterns in animal miRNA target sites first observed over two decades ago.« less
Arlt, Martin F.; Ozdemir, Alev Cagla; Birkeland, Shanda R.; Lyons, Robert H.; Glover, Thomas W.; Wilson, Thomas E.
2011-01-01
Copy-number variants (CNVs) are a major source of genetic variation in human health and disease. Previous studies have implicated replication stress as a causative factor in CNV formation. However, existing data are technically limited in the quality of comparisons that can be made between human CNVs and experimentally induced variants. Here, we used two high-resolution strategies—single nucleotide polymorphism (SNP) arrays and mate-pair sequencing—to compare CNVs that occur constitutionally to those that arise following aphidicolin-induced DNA replication stress in the same human cells. Although the optimized methods provided complementary information, sequencing was more sensitive to small variants and provided superior structural descriptions. The majority of constitutional and all aphidicolin-induced CNVs appear to be formed via homology-independent mechanisms, while aphidicolin-induced CNVs were of a larger median size than constitutional events even when mate-pair data were considered. Aphidicolin thus appears to stimulate formation of CNVs that closely resemble human pathogenic CNVs and the subset of larger nonhomologous constitutional CNVs. PMID:21212237
Pooled-matrix protein interaction screens using Barcode Fusion Genetics.
Yachie, Nozomu; Petsalaki, Evangelia; Mellor, Joseph C; Weile, Jochen; Jacob, Yves; Verby, Marta; Ozturk, Sedide B; Li, Siyang; Cote, Atina G; Mosca, Roberto; Knapp, Jennifer J; Ko, Minjeong; Yu, Analyn; Gebbia, Marinella; Sahni, Nidhi; Yi, Song; Tyagi, Tanya; Sheykhkarimli, Dayag; Roth, Jonathan F; Wong, Cassandra; Musa, Louai; Snider, Jamie; Liu, Yi-Chun; Yu, Haiyuan; Braun, Pascal; Stagljar, Igor; Hao, Tong; Calderwood, Michael A; Pelletier, Laurence; Aloy, Patrick; Hill, David E; Vidal, Marc; Roth, Frederick P
2016-04-22
High-throughput binary protein interaction mapping is continuing to extend our understanding of cellular function and disease mechanisms. However, we remain one or two orders of magnitude away from a complete interaction map for humans and other major model organisms. Completion will require screening at substantially larger scales with many complementary assays, requiring further efficiency gains in proteome-scale interaction mapping. Here, we report Barcode Fusion Genetics-Yeast Two-Hybrid (BFG-Y2H), by which a full matrix of protein pairs can be screened in a single multiplexed strain pool. BFG-Y2H uses Cre recombination to fuse DNA barcodes from distinct plasmids, generating chimeric protein-pair barcodes that can be quantified via next-generation sequencing. We applied BFG-Y2H to four different matrices ranging in scale from ~25 K to 2.5 M protein pairs. The results show that BFG-Y2H increases the efficiency of protein matrix screening, with quality that is on par with state-of-the-art Y2H methods. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Exploiting Nanotechnology for the Development of MicroRNA-Based Cancer Therapeutics.
Tyagi, Nikhil; Arora, Sumit; Deshmukh, Sachin K; Singh, Seema; Marimuthu, Saravanakumar; Singh, Ajay P
2016-01-01
MicroRNAs (miRNAs/miRs) represent a novel class of small non-coding RNAs that post-transcriptionally regulate gene expression by base pairing with complementary sequences in the 3' untranslated region (UTR) of target mRNAs. Functional studies suggest that miRNAs control almost every biological process, and their aberrant expression leads to a disease state, such as cancer. Differential expression of miRNAs in cancerous versus normal cells have generated enormous interest for the development of miRNA-based cancer cell-targeted therapeutics. Depending on the miRNA function and expression in cancer, two types of miRNA-based therapeutic strategies can be utilized that either restore or inhibit miRNA function through exogenous delivery of miRNAs mimics or inhibitors (anti-miRs). However, hydrophilic nature of miRNA mimics/anti-miRs, sensitivity to nuclease degradation in serum, poor penetration and reduced uptake by the tumor cells are chief hurdles in accomplishing their efficient in vivo delivery. To overcome these barriers, several nanotechnology-based systems are being developed and tested for delivery efficacy. This review summarizes the importance of miRNAs-based therapeutics in cancer, associated translational challenges and novel nanotechnology-assisted delivery systems that hold potential for next-generation miRNA-based cancer therapeutics.
Avoiding escalation from play to aggression in adult male rats: The role of ultrasonic calls.
Burke, Candace J; Kisko, Theresa M; Pellis, Sergio M; Euston, David R
2017-11-01
Play fighting is most commonly associated with juvenile animals, but in some species, including rats, it can continue into adulthood. Post-pubertal engagement in play fighting is often rougher and has an increased chance of escalation to aggression, making the use of play signals to regulate the encounter more critical. During play, both juvenile and adult rats emit many 50-kHz calls and some of these may function as play facilitating signals. In the present study, unfamiliar adult male rats were introduced in a neutral enclosure and their social interactions were recorded. While all pairs escalated their playful encounters to become rougher, only the pairs in which one member was devocalized escalated to serious biting. A Monte Carlo shuffling technique was used for the analysis of the correlations between the overt playful and aggressive actions performed and the types and frequencies of various 50-kHz calls that were emitted. The analysis revealed that lower frequency (20-30kHz) calls with a flat component maybe particularly critical for de-escalating encounters and so allowing play to continue. Moreover, coordinating calls reciprocally, with either the same call mimicked in close, temporal association or with complementary calls emitted by participants as they engage in complementary actions (e.g., attacking the nape, being attacked on the nape), appeared to be ways with which calls could be potentially used to avoid escalation to aggression and so sustain playful interactions. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Chen, Kuan-I.; Pan, Chien-Yuan; Li, Keng-Hui; Huang, Ying-Chih; Lu, Chia-Wei; Tang, Chuan-Yi; Su, Ya-Wen; Tseng, Ling-Wei; Tseng, Kun-Chang; Lin, Chi-Yun; Chen, Chii-Dong; Lin, Shih-Shun; Chen, Yit-Tsong
2015-11-01
Many transcribed RNAs are non-coding RNAs, including microRNAs (miRNAs), which bind to complementary sequences on messenger RNAs to regulate the translation efficacy. Therefore, identifying the miRNAs expressed in cells/organisms aids in understanding genetic control in cells/organisms. In this report, we determined the binding of oligonucleotides to a receptor-modified silicon nanowire field-effect transistor (SiNW-FET) by monitoring the changes in conductance of the SiNW-FET. We first modified a SiNW-FET with a DNA probe to directly and selectively detect the complementary miRNA in cell lysates. This SiNW-FET device has 7-fold higher sensitivity than reverse transcription-quantitative polymerase chain reaction in detecting the corresponding miRNA. Next, we anchored viral p19 proteins, which bind the double-strand small RNAs (ds-sRNAs), on the SiNW-FET. By perfusing the device with synthesized ds-sRNAs of different pairing statuses, the dissociation constants revealed that the nucleotides at the 3‧-overhangs and pairings at the terminus are important for the interactions. After perfusing the total RNA mixture extracted from Nicotiana benthamiana across the device, this device could enrich the ds-sRNAs for sequence analysis. Finally, this bionanoelectronic SiNW-FET, which is able to isolate and identify the interacting protein-RNA, adds an additional tool in genomic technology for the future study of direct biomolecular interactions.
Discovering Complementary Colors from the Perspective of STEAM Education
ERIC Educational Resources Information Center
Karabey, Burak; Koyunkaya, Melike Yigit; Enginoglu, Turan; Yurumezoglu, Kemal
2018-01-01
This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of…
Kinematics fingerprints of leader and follower role-taking during cooperative joint actions.
Sacheli, Lucia Maria; Tidoni, Emmanuele; Pavone, Enea Francesco; Aglioti, Salvatore Maria; Candidi, Matteo
2013-05-01
Performing online complementary motor adjustments is quintessential to joint actions since it allows interacting people to coordinate efficiently and achieve a common goal. We sought to determine whether, during dyadic interactions, signaling strategies and simulative processes are differentially implemented on the basis of the interactional role played by each partner. To this aim, we recorded the kinematics of the right hand of pairs of individuals who were asked to grasp as synchronously as possible a bottle-shaped object according to an imitative or complementary action schedule. Task requirements implied an asymmetric role assignment so that participants performed the task acting either as (1) Leader (i.e., receiving auditory information regarding the goal of the task with indications about where to grasp the object) or (2) Follower (i.e., receiving instructions to coordinate their movements with their partner's by performing imitative or complementary actions). Results showed that, when acting as Leader, participants used signaling strategies to enhance the predictability of their movements. In particular, they selectively emphasized kinematic parameters and reduced movement variability to provide the partner with implicit cues regarding the action to be jointly performed. Thus, Leaders make their movements more "communicative" even when not explicitly instructed to do so. Moreover, only when acting in the role of Follower did participants tend to imitate the Leader, even in complementary actions where imitation is detrimental to joint performance. Our results show that mimicking and signaling are implemented in joint actions according to the interactional role of the agent, which in turn is reflected in the kinematics of each partner.
Gain-Scheduled Complementary Filter Design for a MEMS Based Attitude and Heading Reference System
Yoo, Tae Suk; Hong, Sung Kyung; Yoon, Hyok Min; Park, Sungsu
2011-01-01
This paper describes a robust and simple algorithm for an attitude and heading reference system (AHRS) based on low-cost MEMS inertial and magnetic sensors. The proposed approach relies on a gain-scheduled complementary filter, augmented by an acceleration-based switching architecture to yield robust performance, even when the vehicle is subject to strong accelerations. Experimental results are provided for a road captive test during which the vehicle dynamics are in high-acceleration mode and the performance of the proposed filter is evaluated against the output from a conventional linear complementary filter. PMID:22163824
Yagi, Kiyoshi; Otaki, Hiroki
2014-02-28
A perturbative extension to optimized coordinate vibrational self-consistent field (oc-VSCF) is proposed based on the quasi-degenerate perturbation theory (QDPT). A scheme to construct the degenerate space (P space) is developed, which incorporates degenerate configurations and alleviates the divergence of perturbative expansion due to localized coordinates in oc-VSCF (e.g., local O-H stretching modes of water). An efficient configuration selection scheme is also implemented, which screens out the Hamiltonian matrix element between the P space configuration (p) and the complementary Q space configuration (q) based on a difference in their quantum numbers (λpq = ∑s|ps - qs|). It is demonstrated that the second-order vibrational QDPT based on optimized coordinates (oc-VQDPT2) smoothly converges with respect to the order of the mode coupling, and outperforms the conventional one based on normal coordinates. Furthermore, an improved, fast algorithm is developed for optimizing the coordinates. First, the minimization of the VSCF energy is conducted in a restricted parameter space, in which only a portion of pairs of coordinates is selectively transformed. A rational index is devised for this purpose, which identifies the important coordinate pairs to mix from others that may remain unchanged based on the magnitude of harmonic coupling induced by the transformation. Second, a cubic force field (CFF) is employed in place of a quartic force field, which bypasses intensive procedures that arise due to the presence of the fourth-order force constants. It is found that oc-VSCF based on CFF together with the pair selection scheme yields the coordinates similar in character to the conventional ones such that the final vibrational energy is affected very little while gaining an order of magnitude acceleration. The proposed method is applied to ethylene and trans-1,3-butadiene. An accurate, multi-resolution potential, which combines the MP2 and coupled-cluster with singles, doubles, and perturbative triples level of electronic structure theory, is generated and employed in the oc-VQDPT2 calculation to obtain the fundamental tones as well as selected overtones/combination tones coupled to the fundamentals through the Fermi resonance. The calculated frequencies of ethylene and trans-1,3-butadiene are found to be in excellent agreement with the experimental values with a mean absolute error of 8 and 9 cm(-1), respectively.
Xiao, Kunyi; Liu, Juan; Chen, Hui; Zhang, Song; Kong, Jilie
2017-05-15
A label-free and high-efficient graphene oxide (GO)-based aptasensor was developed for the detection of low quantity cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and dye-labeled linker DNAs stably coexisted in solution, and the fluorescence was quenched by the GO-based FÖrster resonance energy transfer (FRET) process. In the presence of target cells, the specific binding of HAPs with the target cells triggered a conformational alternation, which resulted in linker DNA complementary pairing and cleavage by nicking endonuclease-strand scission cycles. Consequently, more cleaved fragments of linker DNAs with more the terminal labeled dyes could show the enhanced fluorescence because these cleaved DNA fragments hardly combine with GOs and prevent the FRET process. Fluorescence analysis demonstrated that this GO-based aptasensor exhibited selective and sensitive response to the presence of target CCRF-CEM cells in the concentration range from 50 to 10 5 cells. The detection limit of this method was 25 cells, which was approximately 20 times lower than the detection limit of normal fluorescence aptasensors without amplification. With high sensitivity and specificity, it provided a simple and cost-effective approach for early cancer diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Yap, Kevin Yi-Lwern; See, Cheng Shang; Kuo, En Yi; Chui, Wai Keung; Chan, Alexandre
2012-02-01
Patients with cancer who use complementary and alternative medicines (CAMs) in conjunction with chemotherapy treatment are at risk of manifesting anticancer drug-CAM interactions (DCIs), which may lead to negative therapeutic outcomes. This article describes a novel iPhone application developed for the Mobile Internet, called OncoRx-MI, which identifies DCIs of single-agent and multiple-agent chemotherapy regimen (CReg) prescriptions. Drug-, CAM-, and DCI-related information was compiled from various hardcopy and softcopy sources, and published literature from PubMed. Overall management plans for the CRegs were then developed. The iPhone Web documents were constructed using Adobe software and programming scripts, and mounted onto a third-party server. DCI searches are based on CReg acronyms, and OncoRx-MI is designed to fit the iPhone screen configuration for improved usability. A small usability study was also carried out and the user feedback presented. OncoRx-MI is able to detect over 2700 interactions between 256 CRegs and 166 CAMs, making up a total of over 4400 DCI pairs. The CAMs are classified into seven categories based on their uses in supportive care, and non-cancer-related CAMs are also included. The majority of the DCIs are pharmacokinetic in nature (79%), involving the induction and inhibition of the cytochrome P450 isozymes and p-glycoprotein. Pharmacodynamic DCIs include hepatotoxicity (39%), altered corticosteroid efficacies (30%), and increased risks of hypoglycemia (4%), hypertensive crisis (2%), bleeding, and serotonin syndrome (1% each). OncoRx-MI is the first mobile application of its kind that allows searching of DCIs for CRegs through 3G networks, and is intended to improve pharmaceutical care of patients with cancer by assisting health care practitioners in managing CReg interactions in their clinical practices.
[Complementary and alternative medicine in oncology].
Hübner, J
2013-06-01
Complementary and alternative medicine are frequently used by cancer patients. The main benefit of complementary medicine is that it gives patients the chance to become active. Complementary therapy can reduce the side effects of conventional therapy. However, we have to give due consideration to side effects and interactions: the latter being able to reduce the effectiveness of cancer therapy and so to jeopardise the success of therapy. Therefore, complementary therapy should be managed by the oncologist. It is based on a common concept of cancerogenesis with conventional therapy. Complement therapy can be assessed in studies. Alternative medicine in contrast rejects common rules of evidence-based medicine. It starts from its own concepts of cancerogenesis, which is often in line with the thinking of lay persons. Alternative medicine is offered as either "alternative" to recommended cancer treatment or is used at the same time but without due regard for the interactions. Alternative medicine is a high risk to patients. In the following two parts of the article, the most important complementary and alternative therapies cancer patients use nowadays are presented and assessed according to published evidence.
Levett, K M; Smith, C A; Bensoussan, A; Dahlen, H G
2016-09-01
to gain insight into the experiences of women, partners and midwives who participated in the Complementary Therapies for Labour and Birth Study, an evidence based complementary medicine (CM) antenatal education course. qualitative in-depth interviews and a focus group as part of the Complementary Therapies for Labour and Birth Study. thirteen low risk primiparous women and seven partners who had participated in the study group of a randomised controlled trial of the complementary therapies for labour and birth study, and 12 midwives caring for these women. The trial was conducted at two public hospitals, and through the Western Sydney University in Sydney, Australia. the Complementary Therapies for Labour and Birth (CTLB) protocol, based on the She Births® course and the Acupressure for labour and birth protocol, incorporated six evidence-based complementary medicine (CM) techniques; acupressure, relaxation, visualisation, breathing, massage, yoga techniques and incorporated facilitated partner support. Randomisation to the trial occurred at 24-36 weeks' gestation, and participants attended a two-day antenatal education programme, plus standard care, or standard care alone. the overarching theme identified in the qualitative data was making sense of labour and birth. Women used information about normal birth physiology from the course to make sense of labour, and to utilise the CM techniques to support normal birth and reduce interventions in labour. Women's, partners' and midwives' experience of the course and its use during birth gave rise to supporting themes such as: working for normal; having a toolkit; and finding what works. the Complementary Therapies for Labour and Birth Study provided women and their partners with knowledge to understand the physiology of normal labour and birth and enabled them to use evidence-based CM tools to support birth and reduce interventions. the Complementary Therapies for Labour and Birth Study introduces concepts of what constitutes normal birth and provides skills to support women, partners and midwives. It appears to be an effective form of antenatal education that supports normal birth, and maternity services need to consider how they can reform current antenatal education in line with this evidence. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Socolovsky, Eduardo A.; Bushnell, Dennis M. (Technical Monitor)
2002-01-01
The cosine or correlation measures of similarity used to cluster high dimensional data are interpreted as projections, and the orthogonal components are used to define a complementary dissimilarity measure to form a similarity-dissimilarity measure pair. Using a geometrical approach, a number of properties of this pair is established. This approach is also extended to general inner-product spaces of any dimension. These properties include the triangle inequality for the defined dissimilarity measure, error estimates for the triangle inequality and bounds on both measures that can be obtained with a few floating-point operations from previously computed values of the measures. The bounds and error estimates for the similarity and dissimilarity measures can be used to reduce the computational complexity of clustering algorithms and enhance their scalability, and the triangle inequality allows the design of clustering algorithms for high dimensional distributed data.
Nelson, Paul A; Thorne, Avril; Shapiro, Lauren A
2011-10-01
Close college-age friendships provide differential opportunities for reinforcing dispositional tendencies and fostering accommodation or change. This finding was obtained from a cross-sectional study of 66 pairs of same-sex college-age friends (58% female). Each pair of friends was extreme and either very similar or different with regard to extraversion-introversion. Interviews with each friend were analyzed for references to each other's role in various friendship domains, including the setting of the friendship and position with regard to chatting, disclosing, expressing opinions about peers, and energizing the friendship. Matched friends mutually reinforced each other's similar dispositional tendencies. Friends with contrasting personalities showed patterns of personality accommodation as well as complementary reinforcement. Implications are discussed for embedding reciprocal theories of personality development in close friendships. © 2011 The Authors. Journal of Personality © 2011, Wiley Periodicals, Inc.
Bosonic Confinement and Coherence in Disordered Nanodiamond Arrays.
Zhang, Gufei; Samuely, Tomas; Du, Hongchu; Xu, Zheng; Liu, Liwang; Onufriienko, Oleksandr; May, Paul W; Vanacken, Johan; Szabó, Pavol; Kačmarčík, Jozef; Yuan, Haifeng; Samuely, Peter; Dunin-Borkowski, Rafal E; Hofkens, Johan; Moshchalkov, Victor V
2017-11-28
In the presence of disorder, superconductivity exhibits short-range characteristics linked to localized Cooper pairs which are responsible for anomalous phase transitions and the emergence of quantum states such as the bosonic insulating state. Complementary to well-studied homogeneously disordered superconductors, superconductor-normal hybrid arrays provide tunable realizations of the degree of granular disorder for studying anomalous quantum phase transitions. Here, we investigate the superconductor-bosonic dirty metal transition in disordered nanodiamond arrays as a function of the dispersion of intergrain spacing, which ranges from angstroms to micrometers. By monitoring the evolved superconducting gaps and diminished coherence peaks in the single-quasiparticle density of states, we link the destruction of the superconducting state and the emergence of bosonic dirty metallic state to breaking of the global phase coherence and persistence of the localized Cooper pairs. The observed resistive bosonic phase transitions are well modeled using a series-parallel circuit in the framework of bosonic confinement and coherence.
Design and control of an embedded vision guided robotic fish with multiple control surfaces.
Yu, Junzhi; Wang, Kai; Tan, Min; Zhang, Jianwei
2014-01-01
This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface.
Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.
Vatolin, Sergei; Weil, Robert J
2008-01-01
Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.
On the verge of an astronomy CubeSat revolution
NASA Astrophysics Data System (ADS)
Shkolnik, Evgenya L.
2018-05-01
CubeSats are small satellites built in standard sizes and form factors, which have been growing in popularity but have thus far been largely ignored within the field of astronomy. When deployed as space-based telescopes, they enable science experiments not possible with existing or planned large space missions, filling several key gaps in astronomical research. Unlike expensive and highly sought after space telescopes such as the Hubble Space Telescope, whose time must be shared among many instruments and science programs, CubeSats can monitor sources for weeks or months at time, and at wavelengths not accessible from the ground such as the ultraviolet, far-infrared and low-frequency radio. Science cases for CubeSats being developed now include a wide variety of astrophysical experiments, including exoplanets, stars, black holes and radio transients. Achieving high-impact astronomical research with CubeSats is becoming increasingly feasible with advances in technologies such as precision pointing, compact sensitive detectors and the miniaturization of propulsion systems. CubeSats may also pair with the large space- and ground-based telescopes to provide complementary data to better explain the physical processes observed.
Visual stimulus presentation using fiber optics in the MRI scanner.
Huang, Ruey-Song; Sereno, Martin I
2008-03-30
Imaging the neural basis of visuomotor actions using fMRI is a topic of increasing interest in the field of cognitive neuroscience. One challenge is to present realistic three-dimensional (3-D) stimuli in the subject's peripersonal space inside the MRI scanner. The stimulus generating apparatus must be compatible with strong magnetic fields and must not interfere with image acquisition. Virtual 3-D stimuli can be generated with a stereo image pair projected onto screens or via binocular goggles. Here, we describe designs and implementations for automatically presenting physical 3-D stimuli (point-light targets) in peripersonal and near-face space using fiber optics in the MRI scanner. The feasibility of fiber-optic based displays was demonstrated in two experiments. The first presented a point-light array along a slanted surface near the body, and the second presented multiple point-light targets around the face. Stimuli were presented using phase-encoded paradigms in both experiments. The results suggest that fiber-optic based displays can be a complementary approach for visual stimulus presentation in the MRI scanner.
An uracil-linked hydroxyflavone probe for the recognition of ATP
Bojtár, Márton; Janzsó-Berend, Péter Zoltán; Mester, Dávid; Hessz, Dóra; Kállay, Mihály; Kubinyi, Miklós
2018-01-01
Background: Nucleotides are essential molecules in living systems due to their paramount importance in various physiological processes. In the past years, numerous attempts were made to selectively recognize and detect these analytes, especially ATP using small-molecule fluorescent chemosensors. Despite the various solutions, the selective detection of ATP is still challenging due to the structural similarity of various nucleotides. In this paper, we report the conjugation of a uracil nucleobase to the known 4’-dimethylamino-hydroxyflavone fluorophore. Results: The complexation of this scaffold with ATP is already known. The complex is held together by stacking and electrostatic interactions. To achieve multi-point recognition, we designed the uracil-appended version of this probe to include complementary base-pairing interactions. The theoretical calculations revealed the availability of multiple complex structures. The synthesis was performed using click chemistry and the nucleotide recognition properties of the probe were evaluated using fluorescence spectroscopy. Conclusions: The first, uracil-containing fluorescent ATP probe based on a hydroxyflavone fluorophore was synthesized and evaluated. A selective complexation with ATP was observed and a ratiometric response in the excitation spectrum. PMID:29719572
NASA Technical Reports Server (NTRS)
Alhorn, D. C.; Polites, M. E.
1994-01-01
Rotating unbalanced-mass (RUM) devices are a new way to scan space-based, balloon-borne, and ground-based gimbaled payloads, like x-ray and gamma-ray telescopes. They can also be used to scan free-flying spacecraft. Circular scans, linear scans, and raster scans can be generated. A pair of RUM devices generates the basic scan motion and an auxiliary control system using torque motors, control moment gyros, or reaction wheels keeps the scan centered on the target and produces some complementary motion for raster scanning. Previous analyses and simulation results show that this approach offers significant power savings compared to scanning only with the auxiliary control system, especially with large payloads and high scan frequencies. However, these claims have never been proven until now. This paper describes a laboratory experiment which tests the concept of scanning a gimbaled payload with RUM devices. A description of the experiment is given and test results that prove the concept are presented. The test results are compared with those from a computer simulation model of the experiment and the differences are discussed.
CRISPR-Cas9 Structures and Mechanisms.
Jiang, Fuguo; Doudna, Jennifer A
2017-05-22
Many bacterial clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems employ the dual RNA-guided DNA endonuclease Cas9 to defend against invading phages and conjugative plasmids by introducing site-specific double-stranded breaks in target DNA. Target recognition strictly requires the presence of a short protospacer adjacent motif (PAM) flanking the target site, and subsequent R-loop formation and strand scission are driven by complementary base pairing between the guide RNA and target DNA, Cas9-DNA interactions, and associated conformational changes. The use of CRISPR-Cas9 as an RNA-programmable DNA targeting and editing platform is simplified by a synthetic single-guide RNA (sgRNA) mimicking the natural dual trans-activating CRISPR RNA (tracrRNA)-CRISPR RNA (crRNA) structure. This review aims to provide an in-depth mechanistic and structural understanding of Cas9-mediated RNA-guided DNA targeting and cleavage. Molecular insights from biochemical and structural studies provide a framework for rational engineering aimed at altering catalytic function, guide RNA specificity, and PAM requirements and reducing off-target activity for the development of Cas9-based therapies against genetic diseases.
Design and Control of an Embedded Vision Guided Robotic Fish with Multiple Control Surfaces
Wang, Kai; Tan, Min; Zhang, Jianwei
2014-01-01
This paper focuses on the development and control issues of a self-propelled robotic fish with multiple artificial control surfaces and an embedded vision system. By virtue of the hybrid propulsion capability in the body plus the caudal fin and the complementary maneuverability in accessory fins, a synthesized propulsion scheme including a caudal fin, a pair of pectoral fins, and a pelvic fin is proposed. To achieve flexible yet stable motions in aquatic environments, a central pattern generator- (CPG-) based control method is employed. Meanwhile, a monocular underwater vision serves as sensory feedback that modifies the control parameters. The integration of the CPG-based motion control and the visual processing in an embedded microcontroller allows the robotic fish to navigate online. Aquatic tests demonstrate the efficacy of the proposed mechatronic design and swimming control methods. Particularly, a pelvic fin actuated sideward swimming gait was first implemented. It is also found that the speeds and maneuverability of the robotic fish with coordinated control surfaces were largely superior to that of the swimming robot propelled by a single control surface. PMID:24688413
Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J
2013-07-25
A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.
Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias
2013-01-01
We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2
Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.
Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langkilde, Annette E., E-mail: annette.langkilde@sund.ku.dk; Morris, Kyle L.; Serpell, Louise C.
The aggregation process and the fibril state of an amyloidogenic peptide suggest monomer addition to be the prevailing mechanism of elongation and a model of the peptide packing in the fibrils has been obtained. Structural analysis of protein fibrillation is inherently challenging. Given the crucial role of fibrils in amyloid diseases, method advancement is urgently needed. A hybrid modelling approach is presented enabling detailed analysis of a highly ordered and hierarchically organized fibril of the GNNQQNY peptide fragment of a yeast prion protein. Data from small-angle X-ray solution scattering, fibre diffraction and electron microscopy are combined with existing high-resolution X-raymore » crystallographic structures to investigate the fibrillation process and the hierarchical fibril structure of the peptide fragment. The elongation of these fibrils proceeds without the accumulation of any detectable amount of intermediate oligomeric species, as is otherwise reported for, for example, glucagon, insulin and α-synuclein. Ribbons constituted of linearly arranged protofilaments are formed. An additional hierarchical layer is generated via the pairing of ribbons during fibril maturation. Based on the complementary data, a quasi-atomic resolution model of the protofilament peptide arrangement is suggested. The peptide structure appears in a β-sheet arrangement reminiscent of the β-zipper structures evident from high-resolution crystal structures, with specific differences in the relative peptide orientation. The complexity of protein fibrillation and structure emphasizes the need to use multiple complementary methods.« less
Two-dimensional self-assembly of DNA-functionalized gold nanoparticles
NASA Astrophysics Data System (ADS)
Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David
2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Iadevaia, Giulia; Núñez-Villanueva, Diego; Stross, Alexander E; Hunter, Christopher A
2018-06-06
Synthetic oligomers equipped with complementary H-bond donor and acceptor side chains form multiply H-bonded duplexes in organic solvents. Comparison of the duplex forming properties of four families of oligomers with different backbones shows that formation of an extended duplex with three or four inter-strand H-bonds is more challenging than formation of complexes that make only two H-bonds. The stabilities of 1 : 1 complexes formed between length complementary homo-oligomers equipped with either phosphine oxide or phenol recognition modules were measured in toluene. When the backbone is very flexible (pentane-1,5-diyl thioether), the stability increases uniformly by an order of magnitude for each additional base-pair added to the duplex: the effective molarities for formation of the first intramolecular H-bond (duplex initiation) and subsequent intramolecular H-bonds (duplex propagation) are similar. This flexible system is compared with three more rigid backbones that are isomeric combinations of an aromatic ring and methylene groups. One of the rigid systems behaves in exactly the same way as the flexible backbone, but the other two do not. For these systems, the effective molarity for formation of the first intramolecular H-bond is the same as that found for the other two backbones, but additional H-bonds are not formed between the longer oligomers. The effective molarities are too low for duplex propagation in these systems, because the oligomer backbones cannot adopt conformations compatible with formation of an extended duplex.
A metamaterial terahertz modulator based on complementary planar double-split-ring resonator
NASA Astrophysics Data System (ADS)
Wang, Chang-hui; Kuang, Deng-feng; Chang, Sheng-jiang; Lin, Lie
2013-07-01
A metamaterial based on complementary planar double-split-ring resonator (DSRR) structure is presented and demonstrated, which can optically tune the transmission of the terahertz (THz) wave. Unlike the traditional DSRR metamaterials, the DSRR discussed in this paper consists of two split rings connected by two bridges. Numerical simulations with the finite-difference time-domain (FDTD) method reveal that the transmission spectra of the original and the complementary metamaterials are both in good agreement with Babinet's principle. Then by increasing the carrier density of the intrinsic GaAs substrate, the magnetic response of the complementary special DSRR metamaterial can be weakened or even turned off. This metamaterial structure is promised to be a narrow-band THz modulator with response time of several nanoseconds.
A Robust Linear Feature-Based Procedure for Automated Registration of Point Clouds
Poreba, Martyna; Goulette, François
2015-01-01
With the variety of measurement techniques available on the market today, fusing multi-source complementary information into one dataset is a matter of great interest. Target-based, point-based and feature-based methods are some of the approaches used to place data in a common reference frame by estimating its corresponding transformation parameters. This paper proposes a new linear feature-based method to perform accurate registration of point clouds, either in 2D or 3D. A two-step fast algorithm called Robust Line Matching and Registration (RLMR), which combines coarse and fine registration, was developed. The initial estimate is found from a triplet of conjugate line pairs, selected by a RANSAC algorithm. Then, this transformation is refined using an iterative optimization algorithm. Conjugates of linear features are identified with respect to a similarity metric representing a line-to-line distance. The efficiency and robustness to noise of the proposed method are evaluated and discussed. The algorithm is valid and ensures valuable results when pre-aligned point clouds with the same scale are used. The studies show that the matching accuracy is at least 99.5%. The transformation parameters are also estimated correctly. The error in rotation is better than 2.8% full scale, while the translation error is less than 12.7%. PMID:25594589
miRNAtools: Advanced Training Using the miRNA Web of Knowledge.
Stępień, Ewa Ł; Costa, Marina C; Enguita, Francisco J
2018-02-16
Micro-RNAs (miRNAs) are small non-coding RNAs that act as negative regulators of the genomic output. Their intrinsic importance within cell biology and human disease is well known. Their mechanism of action based on the base pairing binding to their cognate targets have helped the development not only of many computer applications for the prediction of miRNA target recognition but also of specific applications for functional assessment and analysis. Learning about miRNA function requires practical training in the use of specific computer and web-based applications that are complementary to wet-lab studies. In order to guide the learning process about miRNAs, we have created miRNAtools (http://mirnatools.eu), a web repository of miRNA tools and tutorials. This article compiles tools with which miRNAs and their regulatory action can be analyzed and that function to collect and organize information dispersed on the web. The miRNAtools website contains a collection of tutorials that can be used by students and tutors engaged in advanced training courses. The tutorials engage in analyses of the functions of selected miRNAs, starting with their nomenclature and genomic localization and finishing with their involvement in specific cellular functions.
The substrate binding interface of alkylpurine DNA glycosylase AlkD.
Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F
2014-01-01
Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.
Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye
2012-01-01
The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808
Zhang, Xu; Wadkins, Randy M.
2009-01-01
Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D. PMID:19254547
Zhang, Xu; Wadkins, Randy M
2009-03-04
Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy transfer donor for the fluorescent drug 7-aminoactinomycin D.
Estimating Velocities of Glaciers Using Sentinel-1 SAR Imagery
NASA Astrophysics Data System (ADS)
Gens, R.; Arnoult, K., Jr.; Friedl, P.; Vijay, S.; Braun, M.; Meyer, F. J.; Gracheva, V.; Hogenson, K.
2017-12-01
In an international collaborative effort, software has been developed to estimate the velocities of glaciers by using Sentinel-1 Synthetic Aperture Radar (SAR) imagery. The technique, initially designed by the University of Erlangen-Nuremberg (FAU), has been previously used to quantify spatial and temporal variabilities in the velocities of surging glaciers in the Pakistan Karakoram. The software estimates surface velocities by first co-registering image pairs to sub-pixel precision and then by estimating local offsets based on cross-correlation. The Alaska Satellite Facility (ASF) at the University of Alaska Fairbanks (UAF) has modified the software to make it more robust and also capable of migration into the Amazon Cloud. Additionally, ASF has implemented a prototype that offers the glacier tracking processing flow as a subscription service as part of its Hybrid Pluggable Processing Pipeline (HyP3). Since the software is co-located with ASF's cloud-based Sentinel-1 archive, processing of large data volumes is now more efficient and cost effective. Velocity maps are estimated for Single Look Complex (SLC) SAR image pairs and a digital elevation model (DEM) of the local topography. A time series of these velocity maps then allows the long-term monitoring of these glaciers. Due to the all-weather capabilities and the dense coverage of Sentinel-1 data, the results are complementary to optically generated ones. Together with the products from the Global Land Ice Velocity Extraction project (GoLIVE) derived from Landsat 8 data, glacier speeds can be monitored more comprehensively. Examples from Sentinel-1 SAR-derived results are presented along with optical results for the same glaciers.
NASA Astrophysics Data System (ADS)
Sluse, D.; Tewes, M.
2014-11-01
The advent of large area photometric surveys has raised a great deal of interest in the possibility of using broadband photometric data, instead of spectra, to measure the size of the broad line region of active galactic nuclei. We describe here a new method that uses time-delay lensed quasars where one or several images are affected by microlensing due to stars in the lensing galaxy. Because microlensing decreases (or increases) the flux of the continuum compared to the broad line region, it changes the contrast between these two emission components. We show that this effect can be used to effectively disentangle the intrinsic variability of those two regions, offering the opportunity to perform reverberation mapping based on single-band photometric data. Based on simulated light curves generated using a damped random walk model of quasar variability, we show that measurement of the size of the broad line region can be achieved using this method, provided one spectrum has been obtained independently during the monitoring. This method is complementary to photometric reverberation mapping and could also be extended to multi-band data. Because the effect described above produces a variability pattern in difference light curves between pairs of lensed images that is correlated with the time-lagged continuum variability, it can potentially produce systematic errors in measurement of time delays between pairs of lensed images. Simple simulations indicate that time-delay measurement techniques that use a sufficiently flexible model for the extrinsic variability are not affected by this effect and produce accurate time delays.
Kalloush, Rawan M.; Vivet-Boudou, Valérie; Ali, Lizna M.; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A.
2016-01-01
MPMV has great potential for development as a vector for gene therapy. In this respect, precisely defining the sequences and structural motifs that are important for dimerization and packaging of its genomic RNA (gRNA) are of utmost importance. A distinguishing feature of the MPMV gRNA packaging signal is two phylogenetically conserved long-range interactions (LRIs) between U5 and gag complementary sequences, LRI-I and LRI-II. To test their biological significance in the MPMV life cycle, we introduced mutations into these structural motifs and tested their effects on MPMV gRNA packaging and propagation. Furthermore, we probed the structure of key mutants using SHAPE (selective 2′hydroxyl acylation analyzed by primer extension). Disrupting base-pairing of the LRIs affected gRNA packaging and propagation, demonstrating their significance to the MPMV life cycle. A double mutant restoring a heterologous LRI-I was fully functional, whereas a similar LRI-II mutant failed to restore gRNA packaging and propagation. These results demonstrate that while LRI-I acts at the structural level, maintaining base-pairing is not sufficient for LRI-II function. In addition, in vitro RNA dimerization assays indicated that the loss of RNA packaging in LRI mutants could not be attributed to the defects in dimerization. Our findings suggest that U5-gag LRIs play an important architectural role in maintaining the structure of the 5′ region of the MPMV gRNA, expanding the crucial role of LRIs to the nonlentiviral group of retroviruses. PMID:27095024
Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto
2013-03-14
The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].
ERIC Educational Resources Information Center
DeStefano, Joseph; Moore, Audrey-Marie Schuh; Balwanz, David; Hartwell, Ash
2006-01-01
This issues brief describes how complementary education approaches that rely on community, nongovernmental, and ministry collaboration present a promising response to the challenge to the limitations of conventional primary schooling. The brief is based on nine case studies of successful complementary education programs in Afghanistan, Bangladesh,…
Complementary and Alternative Medicine: Core Competencies for Family Nurse Practitioners.
ERIC Educational Resources Information Center
Burman, Mary E.
2003-01-01
Directors of family nurse practitioner education programs (n=141) reported inclusion of some complementary/alternative medicine content (CAM), most commonly interviewing patients about CAM, critical thinking, evidence-based medicine, laws, ethics, and spiritual/cultural beliefs. Definition of CAM was medically, not holistically based. More faculty…
Antibiotic combination efficacy (ACE) networks for a Pseudomonas aeruginosa model
Barbosa, Camilo; Beardmore, Robert; Jansen, Gunther
2018-01-01
The spread of antibiotic resistance is always a consequence of evolutionary processes. The consideration of evolution is thus key to the development of sustainable therapy. Two main factors were recently proposed to enhance long-term effectiveness of drug combinations: evolved collateral sensitivities between the drugs in a pair and antagonistic drug interactions. We systematically assessed these factors by performing over 1,600 evolution experiments with the opportunistic nosocomial pathogen Pseudomonas aeruginosa in single- and multidrug environments. Based on the growth dynamics during these experiments, we reconstructed antibiotic combination efficacy (ACE) networks as a new tool for characterizing the ability of the tested drug combinations to constrain bacterial survival as well as drug resistance evolution across time. Subsequent statistical analysis of the influence of the factors on ACE network characteristics revealed that (i) synergistic drug interactions increased the likelihood of bacterial population extinction—irrespective of whether combinations were compared at the same level of inhibition or not—while (ii) the potential for evolved collateral sensitivities between 2 drugs accounted for a reduction in bacterial adaptation rates. In sum, our systematic experimental analysis allowed us to pinpoint 2 complementary determinants of combination efficacy and to identify specific drug pairs with high ACE scores. Our findings can guide attempts to further improve the sustainability of antibiotic therapy by simultaneously reducing pathogen load and resistance evolution. PMID:29708964
Digital quantification of gene expression using emulsion PCR.
Shi, Xiaolong; Tang, Chao; Wang, Wei; Zhou, Dequan; Lu, Zuhong
2010-01-01
Here we describe a single-molecule quantitative assay of mRNA levels based on mRNA mediate-ligation and BEAMing (beads, emulsion, amplification, and magnetics) technique, which allows accurate and parallel measurement of multiple genes from a small amount of cells. In this method, a pair of oligos complementary target mRNA was used to probe transcripts for each gene of interest. The ligated products of oligos pair were clonally amplified on beads in millions of parallel compartmentalized droplets in a water-in-oil emulsion. The levels of each transcript within a sample were measured by counting the number of the correspondingly amplified beads which were immobilized on a glass surface. To demonstrate its utility, this method has been applied to the quantitation of the mRNA levels for two transcription factors, Klf4 and Sox5, and a housekeeping gene, Gapdh, in human leukemia K562 cells before and after induction with phorbol 12-myristate 13-acetate. Interestingly, we found a significant downregulation of the mRNA level of Sox5 after phorbol 12-myristate 13-acetate treatment. The mRNA mediate-ligation and BEAMing technique provides an accurate and sensitive way to quantify the amount of multiple specific mRNA in a very small number of cells, which may be valuable in the studies requiring precise and parallel quantization of multiple mRNA in the defined cell populations.
Acidic Residues in the Hfq Chaperone Increase the Selectivity of sRNA Binding and Annealing.
Panja, Subrata; Santiago-Frangos, Andrew; Schu, Daniel J; Gottesman, Susan; Woodson, Sarah A
2015-11-06
Hfq facilitates gene regulation by small non-coding RNAs (sRNAs), thereby affecting bacterial attributes such as biofilm formation and virulence. Escherichia coli Hfq recognizes specific U-rich and AAN motifs in sRNAs and target mRNAs, after which an arginine patch on the rim promotes base pairing between their complementary sequences. In the cell, Hfq must discriminate between many similar RNAs. Here, we report that acidic amino acids lining the sRNA binding channel between the inner pore and rim of the Hfq hexamer contribute to the selectivity of Hfq's chaperone activity. RNase footprinting, in vitro binding and stopped-flow fluorescence annealing assays showed that alanine substitution of D9, E18 or E37 strengthened RNA interactions with the rim of Hfq and increased annealing of non-specific or U-tailed RNA oligomers. Although the mutants were less able than wild-type Hfq to anneal sRNAs with wild-type rpoS mRNA, the D9A mutation bypassed recruitment of Hfq to an (AAN)4 motif in rpoS, both in vitro and in vivo. These results suggest that acidic residues normally modulate access of RNAs to the arginine patch. We propose that this selectivity limits indiscriminate target selection by E. coli Hfq and enforces binding modes that favor genuine sRNA and mRNA pairs. Copyright © 2015 Elsevier Ltd. All rights reserved.
Krueger, Andrew T; Kool, Eric T
2008-03-26
We recently described the synthesis and helix assembly properties of expanded DNA (xDNA), which contains base pairs 2.4 A larger than natural DNA pairs. This designed genetic set is under study with the goals of mimicking the functions of the natural DNA-based genetic system and of developing useful research tools. Here, we study the fluorescence properties of the four expanded bases of xDNA (xA, xC, xG, xT) and evaluate how their emission varies with changes in oligomer length, composition, and hybridization. Experiments were carried out with short oligomers of xDNA nucleosides conjugated to a DNA oligonucleotide, and we investigated the effects of hybridizing these fluorescent oligomers to short complementary DNAs with varied bases opposite the xDNA bases. As monomer nucleosides, the xDNA bases absorb light in two bands: one at approximately 260 nm (similar to DNA) and one at longer wavelength ( approximately 330 nm). All are efficient violet-blue fluorophores with emission maxima at approximately 380-410 nm and quantum yields (Phifl) of 0.30-0.52. Short homo-oligomers of the xDNA bases (length 1-4 monomers) showed moderate self-quenching except xC, which showed enhancement of Phifl with increasing length. Interestingly, multimers of xA emitted at longer wavelengths (520 nm) as an apparent excimer. Hybridization of an oligonucleotide to the DNA adjacent to the xDNA bases (with the xDNA portion overhanging) resulted in no change in fluorescence. However, addition of one, two, or more DNA bases in these duplexes opposite the xDNA portion resulted in a number of significant fluorescence responses, including wavelength shifts, enhancements, or quenching. The strongest responses were the enhancement of (xG)n emission by hybridization of one or more adenines opposite them, and the quenching of (xT)n and (xC)n emission by guanines opposite. The data suggest multiple ways in which the xDNA bases, both alone and in oligomers, may be useful as tools in biophysical analysis and biotechnological applications.
Daniel, Michelle M; Ross, Paula; Stalmeijer, Renée E; de Grave, Willem
2018-01-01
Phenomenon: Interdisciplinary coteaching has become a popular pedagogic model in medical education, yet there is insufficient research to guide effective practices in this context. Coteaching relationships are not always effective, which has the potential to affect the student experience. The purpose of this study was to explore interdisciplinary coteaching relationships between a physician (MD) and social behavioral scientist (SBS) in an undergraduate clinical skills course. We aimed to gain an in-depth understanding of what teachers perceive as influencing the quality of relationships to begin to construct a framework for collaborative teaching in medical education. A qualitative study was conducted consisting of 12 semistructured interviews (6 MD and 6 SBS) and 2 monodisciplinary focus groups. Sampling was purposive and aimed at maximal variation from among 64 possible faculty. The data were analyzed using the constant comparative method to develop a grounded theory. Five major themes resulted from the analysis that outline a framework for interdisciplinary coteaching: respect, shared goals, shared knowledge and understanding, communication, and complementary pairings. Insights: The first 4 themes align with elements of relational coordination theory, an organizational theory of collaborative practice that describes how work roles interact. The complementary pairings extend this theory from work roles to individuals, with unique identities and personal beliefs and values about teaching. Prior studies on coteaching have not provided a clear linkage to theory. The conceptual framework helps suggest future directions for coteaching research and has practical implications for administrative practices and faculty development. These findings contribute to the sparse research in medical education on interdisciplinary coteaching relationships.
Islam, Mohammad Tariqul; Islam, Md. Moinul; Samsuzzaman, Md.; Faruque, Mohammad Rashed Iqbal; Misran, Norbahiah
2015-01-01
This paper presents a negative index metamaterial incorporated UWB antenna with an integration of complementary SRR (split-ring resonator) and CLS (capacitive loaded strip) unit cells for microwave imaging sensor applications. This metamaterial UWB antenna sensor consists of four unit cells along one axis, where each unit cell incorporates a complementary SRR and CLS pair. This integration enables a design layout that allows both a negative value of permittivity and a negative value of permeability simultaneous, resulting in a durable negative index to enhance the antenna sensor performance for microwave imaging sensor applications. The proposed MTM antenna sensor was designed and fabricated on an FR4 substrate having a thickness of 1.6 mm and a dielectric constant of 4.6. The electrical dimensions of this antenna sensor are 0.20 λ × 0.29 λ at a lower frequency of 3.1 GHz. This antenna sensor achieves a 131.5% bandwidth (VSWR < 2) covering the frequency bands from 3.1 GHz to more than 15 GHz with a maximum gain of 6.57 dBi. High fidelity factor and gain, smooth surface-current distribution and nearly omni-directional radiation patterns with low cross-polarization confirm that the proposed negative index UWB antenna is a promising entrant in the field of microwave imaging sensors. PMID:26007721
Islam, Mohammad Tariqul; Islam, Md Moinul; Samsuzzaman, Md; Faruque, Mohammad Rashed Iqbal; Misran, Norbahiah
2015-05-20
This paper presents a negative index metamaterial incorporated UWB antenna with an integration of complementary SRR (split-ring resonator) and CLS (capacitive loaded strip) unit cells for microwave imaging sensor applications. This metamaterial UWB antenna sensor consists of four unit cells along one axis, where each unit cell incorporates a complementary SRR and CLS pair. This integration enables a design layout that allows both a negative value of permittivity and a negative value of permeability simultaneous, resulting in a durable negative index to enhance the antenna sensor performance for microwave imaging sensor applications. The proposed MTM antenna sensor was designed and fabricated on an FR4 substrate having a thickness of 1.6 mm and a dielectric constant of 4.6. The electrical dimensions of this antenna sensor are 0.20 λ × 0.29 λ at a lower frequency of 3.1 GHz. This antenna sensor achieves a 131.5% bandwidth (VSWR < 2) covering the frequency bands from 3.1 GHz to more than 15 GHz with a maximum gain of 6.57 dBi. High fidelity factor and gain, smooth surface-current distribution and nearly omni-directional radiation patterns with low cross-polarization confirm that the proposed negative index UWB antenna is a promising entrant in the field of microwave imaging sensors.
Lee, Jungeun Olivia; Cho, Junhan; Yoon, Yoewon; Bello, Mariel S; Khoddam, Rubin; Leventhal, Adam M
2018-02-01
Although lower socioeconomic status has been linked to increased youth substance use, much less research has determined potential mechanisms explaining the association. The current longitudinal study tested whether alternative (i.e., pleasure gained from activities without any concurrent use of substances) and complementary (i.e., pleasure gained from activities in tandem with substance use) reinforcement mediate the link between lower socioeconomic status and youth substance use. Further, we tested whether alternative and complementary reinforcement and youth substance use gradually unfold over time and then intersect with one another in a cascading manner. Potential sex differences are also examined. Data were drawn from a longitudinal survey of substance use and mental health among high school students in Los Angeles. Data collection involved four semiannual assessment waves beginning in fall 2013 (N = 3395; M baseline age = 14.1; 47% Hispanic, 16.2% Asian, 16.1% multiethnic, 15.7% White, and 5% Black; 53.4% female). The results from a negative binomial path model suggested that lower parental socioeconomic status (i.e., lower parental education) was significantly related to an increased number of substances used by youth. The final path model revealed that the inverse association was statistically mediated by adolescents' diminished engagement in pleasurable substance-free activities (i.e., alternative reinforcers) and elevated engagement in pleasurable activities paired with substance use (i.e., complementary reinforcers). The direct effect of lower parental education on adolescent substance use was not statistically significant after accounting for the hypothesized mediating mechanisms. No sex differences were detected. Increasing access to and engagement in pleasant activities of high quality that do not need a reinforcement enhancer, such as substances, may be useful in interrupting the link between lower parental socioeconomic status and youth substance use.
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Amagloh, Francis Kweku; Mutukumira, Anthony N.; Brough, Louise; Weber, Janet L.; Hardacre, Allan; Coad, Jane
2013-01-01
Background Cereal-based complementary foods from non-malted ingredients form a relatively high viscous porridge. Therefore, excessive dilution, usually with water, is required to reduce the viscosity to be appropriate for infant feeding. The dilution invariably leads to energy and nutrient thinning, that is, the reduction of energy and nutrient densities. Carbohydrate is the major constituent of food that significantly influences viscosity when heated in water. Objectives To compare the sweetpotato-based complementary foods (extrusion-cooked ComFa, roller-dried ComFa, and oven-toasted ComFa) and enriched Weanimix (maize-based formulation) regarding their 1) carbohydrate composition, 2) viscosity and water solubility index (WSI), and 3) sensory acceptance evaluated by sub-Sahara African women as model caregivers. Methods The level of simple sugars/carbohydrates was analysed by spectrophotometry, total dietary fibre by enzymatic-gravimetric method, and total carbohydrate and starch levels estimated by calculation. A Rapid Visco™ Analyser was used to measure viscosity. WSI was determined gravimetrically. A consumer sensory evaluation was used to evaluate the product acceptance of the roller-dried ComFa, oven-toasted ComFa, and enriched Weanimix. Results The sweetpotato-based complementary foods were, on average, significantly higher in maltose, sucrose, free glucose and fructose, and total dietary fibre, but they were markedly lower in starch content compared with the levels in the enriched Weanimix. Consequently, the sweetpotato-based complementary foods had relatively low apparent viscosity, and high WSI, than that of enriched Weanimix. The scores of sensory liking given by the caregivers were highest for the roller-dried ComFa, followed by the oven-toasted ComFa, and, finally, the enriched Weanimix. Conclusion The sweetpotato-based formulations have significant advantages as complementary food due to the high level of endogenous sugars and low starch content that reduce the viscosity, increase the solubility, impart desirable sensory characteristics, and potentially avoid excessive energy and nutrient thinning. PMID:23516115
Jaruzel, Candace B; Kelechi, Teresa J
2016-08-01
To analyze and clarify the concept of providing relief from anxiety using complementary therapies in the perioperative period utilizing the epistemological, pragmatic, linguistic and logical principles of a principle-based concept analysis to examine the state of the science. The majority of patients scheduled for surgery experience anxiety in the perioperative period. Anxiety has the potential to limit a patient's ability to participate in his or her care throughout their hospitalization. Although medications are the conventional medical treatment for anxiety in the perioperative period, the addition of a complementary therapy could be an effective holistic approach to providing relief from anxiety. Principle-based concept analysis. In 2015, strategic literature searches of CINHAL and PUBMED using keywords were performed. Fifty-six full text articles were assessed for eligibility. Twelve studies were used in the final analysis to clarify the concept of relief from anxiety using complementary therapies in the perioperative period. This analysis has clarified the maturity and boundaries, within the four principles of a principle-based concept analysis, of the concept of relief from anxiety using complementary therapies in the perioperative period. A greater understanding of relief from anxiety using complimentary therapies in the perioperative period as an adjunct to conventional medicine will allow perioperative nurses and anesthesia providers to modify and specify the plan of care for their surgical patients. The use of complementary therapies for relief in the perioperative period appears to be an area of promising research and treatment for patients, families and providers. Copyright © 2016 Elsevier Ltd. All rights reserved.
LHC vector resonance searches in the t\\overline{t}Z final state
NASA Astrophysics Data System (ADS)
Backović, Mihailo; Flacke, Thomas; Jain, Bithika; Lee, Seung J.
2017-03-01
LHC searches for BSM resonances in l + l - , jj, t\\overline{t} , γγ and VV final states have so far not resulted in discovery of new physics. Current results set lower limits on mass scales of new physics resonances well into the O(1) TeV range, assuming that the new resonance decays dominantly to a pair of Standard Model particles. While the SM pair searches are a vital probe of possible new physics, it is important to re-examine the scope of new physics scenarios probed with such final states. Scenarios where new resonances decay dominantly to final states other than SM pairs, even though well theoretically motivated, lie beyond the scope of SM pair searches. In this paper we argue that LHC searches for (vector) resonances beyond two particle final states would be useful complementary probes of new physics scenarios. As an example, we consider a class of composite Higgs models, and identify specific model parameter points where the color singlet, electrically neutral vector resonance ρ0 decays dominantly not to a pair of SM particles, but to a fermionic top partner T f1 and a top quark, with T f1 → tZ. We show that dominant decays of ρ 0 → T f1 t in the context of Composite Higgs models are possible even when the decay channel to a pair of T f1 is kinematically open. Our analysis deals with scenarios where both m ρ and {m}_T{{}{_f}}{_1} are of O(1) TeV, leading to highly boosted t\\overline{t}Z final state topologies. We show that the particular composite Higgs scenario we consider is discoverable at the LHC13 with as little as 30 fb-1, while being allowed by other existing experimental constraints.
Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao
2012-03-01
CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.
Kerbrat, P; Lhommé, C; Fervers, B; Guastalla, J P; Thomas, L; Basuyau, J P; Duvillard, P; Cohen-Solal, C; Dauplat, J; Tournemaine, N
2000-12-09
Suprapubic and transvaginal pelvic ultrasound exploration is indicated for suspected ovarian tumor (standard). Diagnosis and search for extension require surgery and pathology examination. Systematic preoperative computed tomography is not recommended (standard). Surgery for cancer of the ovary is a specialized procedure requiring skill in cancer, gynecology, visceral surgery and laparoscopic surgery. If the patient is referred to a specialized center after a primary procedure considered to be inadequate, a new procedure is recommended for staging. Residual tumor volume after the primary procedure has prognostic value. Systematic second look procedures are not recommended for routine practice (standard). For patients with grade IA G1 tumors, there is no indication for complementary treatment (standard). For patients with grade IA G2-3 or clear cell tumors, IB, IC, IIA, there is no standard. no complementary treatment, complementary chemotherapy using platinum, complementary external abdominopelvic radiotherapy. A complementary treatment is recommended for grades IC and IIA. Complementary treatment for grades IIB (no residual tissue), IIC (with residual tissue), III (no residual tissue), is based on: complementary chemotherapy with platinium, complementary external abdominopelvic radiotherapy (options). Complementary treatment for advanced forms (IIB (with residual tissue), IIC (with residual tissue), III (with residual tissue) and IV) is based on polychemotherapy with platinium (standard). platinium combined with paclitaxel (intravenous), platinium combined with cyclophosphamide and/or doxorubicin (intravenous) or intraperitoneal cisplatin combined with cyclophosphamide (intravenous). The chemotherapy work-up includes physical examination, assay of serum markers (particularly CA125) and abdominopelvic computed tomography (proof level B) (standard). Physical examination is recommended for monitoring patients in complete remission with no sign of suspected recurrence (standard). This document was reviewed in April 1977. The working group again validated the Standards, OPTIONS and Recommendations, without modifications in June 1999.
NASA Astrophysics Data System (ADS)
Boer, Marie
2017-09-01
Generalized Parton Distributions (GPDs) contain the correlation between the parton's longitudinal momentum and their transverse distribution. They are accessed through hard exclusive processes such as exclusive Compton processes, where two photons are exchanged with a quark of the nucleon, and at least one of them has a high virtuality. Exclusive Compton processes are considered ``golden'' channels, as the only non-perturbative part of the process corresponds to the GPDs. Deeply Virtual Compton Scattering (DVCS) corresponds to the lepto-production of a real photon and has been intensively studied in the past decade. We propose to access GPDs with the two other cases of exclusive Compton processes: Timelike Compton Scattering (TCS) corresponds to the photo-production of a lepton pair, and Double Deeply Virtual Compton Scattering (DDVCS) corresponds to the lepto-production of a lepton pair. The study of these two reactions is complementary to DVCS and will bring new constraints on our understanding of the nucleon structure, in particular for a tomographic interpretation of GPDs. We will discuss the interest of TCS and DDVCS in terms of GPD studies, and present the efforts held at Jefferson Lab for new experiments aiming at measuring TCS and DDVCS.
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Report on Pairing-based Cryptography
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435
Physical Realization of a Supervised Learning System Built with Organic Memristive Synapses
NASA Astrophysics Data System (ADS)
Lin, Yu-Pu; Bennett, Christopher H.; Cabaret, Théo; Vodenicarevic, Damir; Chabi, Djaafar; Querlioz, Damien; Jousselme, Bruno; Derycke, Vincent; Klein, Jacques-Olivier
2016-09-01
Multiple modern applications of electronics call for inexpensive chips that can perform complex operations on natural data with limited energy. A vision for accomplishing this is implementing hardware neural networks, which fuse computation and memory, with low cost organic electronics. A challenge, however, is the implementation of synapses (analog memories) composed of such materials. In this work, we introduce robust, fastly programmable, nonvolatile organic memristive nanodevices based on electrografted redox complexes that implement synapses thanks to a wide range of accessible intermediate conductivity states. We demonstrate experimentally an elementary neural network, capable of learning functions, which combines four pairs of organic memristors as synapses and conventional electronics as neurons. Our architecture is highly resilient to issues caused by imperfect devices. It tolerates inter-device variability and an adaptable learning rule offers immunity against asymmetries in device switching. Highly compliant with conventional fabrication processes, the system can be extended to larger computing systems capable of complex cognitive tasks, as demonstrated in complementary simulations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkadesh, S.; Mandal, P.K.; Gautham, N., E-mail: n_gautham@hotmail.com
Highlights: {yields} This is the first crystal structure of a four-way junction with sticky ends. {yields} Four junction structures bind to each other and form a rhombic cavity. {yields} Each rhombus binds to others to form 'infinite' 2D tiles. {yields} This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind tomore » each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.« less
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
Coincidence ion imaging with a fast frame camera
NASA Astrophysics Data System (ADS)
Lee, Suk Kyoung; Cudry, Fadia; Lin, Yun Fei; Lingenfelter, Steven; Winney, Alexander H.; Fan, Lin; Li, Wen
2014-12-01
A new time- and position-sensitive particle detection system based on a fast frame CMOS (complementary metal-oxide semiconductors) camera is developed for coincidence ion imaging. The system is composed of four major components: a conventional microchannel plate/phosphor screen ion imager, a fast frame CMOS camera, a single anode photomultiplier tube (PMT), and a high-speed digitizer. The system collects the positional information of ions from a fast frame camera through real-time centroiding while the arrival times are obtained from the timing signal of a PMT processed by a high-speed digitizer. Multi-hit capability is achieved by correlating the intensity of ion spots on each camera frame with the peak heights on the corresponding time-of-flight spectrum of a PMT. Efficient computer algorithms are developed to process camera frames and digitizer traces in real-time at 1 kHz laser repetition rate. We demonstrate the capability of this system by detecting a momentum-matched co-fragments pair (methyl and iodine cations) produced from strong field dissociative double ionization of methyl iodide.
Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.
Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François
2009-07-08
Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.
Antiviral effects of herpes simplex virus specific anti-sense nucleic acids.
Cantin, E M; Podsakoff, G; Willey, D E; Openshaw, H
1992-01-01
We have targeted mRNA sequences encompassing the translation initiation codon of the essential herpes simplex virus type 1 (HSV-1) IE3 gene with three kinds of anti-sense molecule. Addition of a 15mer oligodeoxyribonucleoside methylphosphonate to tissue culture cells resulted in suppression of viral replication. HSV-1 replication was also inhibited in cultured cells containing anti-sense vectors expressing transcripts complementary to the IE3 mRNA. We have also constructed a ribozyme which upon base pairing with the target IE3 mRNA induces cleavage at the predicted GUC site. A major obstacle to anti-sense studies in animals is drug delivery of preformed antisense molecules to ganglionic neurons, the site of HSV latency and reactivation. We speculate as to how this may be accomplished through carrier compounds which are taken up by nerve terminals and transported by retrograde axoplasmic flow. By the same route, HSV itself may be used as an anti-sense vector.
Mechanism of foreign DNA selection in a bacterial adaptive immune system
Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.
2012-01-01
Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690
A novel architecture of non-volatile magnetic arithmetic logic unit using magnetic tunnel junctions
NASA Astrophysics Data System (ADS)
Guo, Wei; Prenat, Guillaume; Dieny, Bernard
2014-04-01
Complementary metal-oxide-semiconductor (CMOS) technology is facing increasingly difficult obstacles such as power consumption and interconnection delay. Novel hybrid technologies and architectures are being investigated with the aim to circumvent some of these limits. In particular, hybrid CMOS/magnetic technology based on magnetic tunnel junctions (MTJs) is considered as a very promising approach thanks to the full compatibility of MTJs with CMOS technology. By tightly merging the conventional electronics with magnetism, both logic and memory functions can be implemented in the same device. As a result, non-volatility is directly brought into logic circuits, yielding significant improvement of device performances and new functionalities as well. We have conceived an innovative methodology to construct non-volatile magnetic arithmetic logic units (MALUs) combining spin-transfer torque MTJs with MOS transistors. The present 4-bit MALU utilizes 4 MTJ pairs to store its operation code (opcode). Its operations and performances have been confirmed and evaluated through electrical simulations.
Hao, Jie; Gao, Yuxia; Li, Ying; Yan, Qiang; Hu, Jun; Ju, Yong
2017-09-05
Thermoresponsive water-soluble polymers are of great importance since they typically show a lower critical solution temperature (LCST) in aqueous media. In this research, the LCST change in broad temperature ranges of copolymers composed of natural glycyrrhetinic acid (GA)-based methacrylate and N,N'-dimethylacrylamides (DMAs) was investigated as a function of the concentration and the content of GA pendants. By complexation of GA pendants with β-cyclodextrin (β-CD), a side-chain polypseudorotaxane was obtained, which exhibited a significant increase in the LCST of copolymers. Moreover, the precisely reversible control of the LCST behavior was realized through adding a competing guest molecule, sodium 1-admantylcarboxylate. This work illustrates a simple and effective approach to endow water-soluble polymers with broad temperature tunability and helps us further understand the effect of a biocompatible host-guest complementary β-CD/GA pair on the thermoresponsive process. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Physical Realization of a Supervised Learning System Built with Organic Memristive Synapses.
Lin, Yu-Pu; Bennett, Christopher H; Cabaret, Théo; Vodenicarevic, Damir; Chabi, Djaafar; Querlioz, Damien; Jousselme, Bruno; Derycke, Vincent; Klein, Jacques-Olivier
2016-09-07
Multiple modern applications of electronics call for inexpensive chips that can perform complex operations on natural data with limited energy. A vision for accomplishing this is implementing hardware neural networks, which fuse computation and memory, with low cost organic electronics. A challenge, however, is the implementation of synapses (analog memories) composed of such materials. In this work, we introduce robust, fastly programmable, nonvolatile organic memristive nanodevices based on electrografted redox complexes that implement synapses thanks to a wide range of accessible intermediate conductivity states. We demonstrate experimentally an elementary neural network, capable of learning functions, which combines four pairs of organic memristors as synapses and conventional electronics as neurons. Our architecture is highly resilient to issues caused by imperfect devices. It tolerates inter-device variability and an adaptable learning rule offers immunity against asymmetries in device switching. Highly compliant with conventional fabrication processes, the system can be extended to larger computing systems capable of complex cognitive tasks, as demonstrated in complementary simulations.
Using a combined computational-experimental approach to predict antibody-specific B cell epitopes.
Sela-Culang, Inbal; Benhnia, Mohammed Rafii-El-Idrissi; Matho, Michael H; Kaever, Thomas; Maybeno, Matt; Schlossman, Andrew; Nimrod, Guy; Li, Sheng; Xiang, Yan; Zajonc, Dirk; Crotty, Shane; Ofran, Yanay; Peters, Bjoern
2014-04-08
Antibody epitope mapping is crucial for understanding B cell-mediated immunity and required for characterizing therapeutic antibodies. In contrast to T cell epitope mapping, no computational tools are in widespread use for prediction of B cell epitopes. Here, we show that, utilizing the sequence of an antibody, it is possible to identify discontinuous epitopes on its cognate antigen. The predictions are based on residue-pairing preferences and other interface characteristics. We combined these antibody-specific predictions with results of cross-blocking experiments that identify groups of antibodies with overlapping epitopes to improve the predictions. We validate the high performance of this approach by mapping the epitopes of a set of antibodies against the previously uncharacterized D8 antigen, using complementary techniques to reduce method-specific biases (X-ray crystallography, peptide ELISA, deuterium exchange, and site-directed mutagenesis). These results suggest that antibody-specific computational predictions and simple cross-blocking experiments allow for accurate prediction of residues in conformational B cell epitopes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
USDA-ARS?s Scientific Manuscript database
Poor complementary feeding practices are associated with stunting and growth faltering throughout the developing world. The objective was to compare the effect of using peanut-/soy-based fortified spread (FS) and corn porridge fortified with fish powder (FP) as complementary foods on growth in rural...
Suri, Devika J; Tano-Debrah, Kwaku; Ghosh, Shibani A
2014-09-01
Nutritionally adequate complementary foods made from locally available ingredients are of high priority in developing countries, including Ghana. The majority of complementary foods in these countries are cereal-based and are unable to meet the nutrient intakes recommended by the World Health Organization. To evaluate the nutrient content and protein quality of local cereal-legume blends for complementary foods against recommendations and to determine the quantities of additional ingredients required to meet needs by using linear programming. Nine cereal-legume combinations (maize, sorghum, or millet combined with cowpea, peanut, or soybean) and koko (a traditional Ghanaian maize-based complementary food) were evaluated based on the macronutrient targets for a daily ration of complementary food for the age group 12 to 24 months: 264 kcal, 6.5 g of protein, and 8.2 to 11.7 g of fat. Protein quality was assessed by the Protein Digestibility Corrected Amino Acid Score (PDCAAS). Linear programming was then used to determine the amounts of additional oil, sugar, and lysine needed to meet macronutrient requirements. No traditional cereal-legume food met all complementary food macronutrient requirements on its own. Cereal-legume blends made with peanut or cowpeas were low in quality protein, while those with soybean were low in fat. Lysine was the limiting amino acid (PDCAAS 0.50 to 0.82) in all blends. Adding lysine increased utilizable protein by 1% to 10% in soybean blends, 35% to 40% in peanut blends, and 14% to 24% in cowpea blends. Peanut-maize, peanut-millet, and all soybean-cereal blends were able to meet macronutrient targets; most micronutrients remained below recommended levels. Traditional cereal-legume blends made from locally available ingredients do not meet energy, quality protein, and fat recommendations for complementary foods; however, such complementary food blends may be optimized to meet nutrient requirements by using linear programming as a tool to determine the exact levels of fortificants to be added (including, but not limited to, added fat, amino acids, and micronutrients).
Popov, Alexander V; Endutkin, Anton V; Vorobjev, Yuri N; Zharkov, Dmitry O
2017-05-08
Formamidopyrimidine-DNA glycosylase (Fpg) removes abundant pre-mutagenic 8-oxoguanine (oxoG) bases from DNA through nucleophilic attack of its N-terminal proline at C1' of the damaged nucleotide. Since oxoG efficiently pairs with both C and A, Fpg must excise oxoG from pairs with C but not with A, otherwise a mutation occurs. The crystal structures of several Fpg-DNA complexes have been solved, yet no structure with A opposite the lesion is available. Here we use molecular dynamic simulation to model interactions in the pre-catalytic complex of Lactococcus lactis Fpg with DNA containing oxoG opposite C or A, the latter in either syn or anti conformation. The catalytic dyad, Pro1-Glu2, was modeled in all four possible protonation states. Only one transition was observed in the experimental reaction rate pH dependence plots, and Glu2 kept the same set of interactions regardless of its protonation state, suggesting that it does not limit the reaction rate. The adenine base opposite oxoG was highly distorting for the adjacent nucleotides: in the more stable syn models it formed non-canonical bonds with out-of-register nucleotides in both the damaged and the complementary strand, whereas in the anti models the adenine either formed non-canonical bonds or was expelled into the major groove. The side chains of Arg109 and Phe111 that Fpg inserts into DNA to maintain its kinked conformation tended to withdraw from their positions if A was opposite to the lesion. The region showing the largest differences in the dynamics between oxoG:C and oxoG:A substrates was unexpectedly remote from the active site, located near the linker joining the two domains of Fpg. This region was also highly conserved among 124 analyzed Fpg sequences. Three sites trapping water molecules through multiple bonds were identified on the protein-DNA interface, apparently helping to maintain enzyme-induced DNA distortion and participating in oxoG recognition. Overall, the discrimination against A opposite to the lesion seems to be due to incorrect DNA distortion around the lesion-containing base pair and, possibly, to gross movement of protein domains connected by the linker.
All-DNA finite-state automata with finite memory
Wang, Zhen-Gang; Elbaz, Johann; Remacle, F.; Levine, R. D.; Willner, Itamar
2010-01-01
Biomolecular logic devices can be applied for sensing and nano-medicine. We built three DNA tweezers that are activated by the inputs H+/OH-; ; nucleic acid linker/complementary antilinker to yield a 16-states finite-state automaton. The outputs of the automata are the configuration of the respective tweezers (opened or closed) determined by observing fluorescence from a fluorophore/quencher pair at the end of the arms of the tweezers. The system exhibits a memory because each current state and output depend not only on the source configuration but also on past states and inputs. PMID:21135212
High-Voltage-Input Level Translator Using Standard CMOS
NASA Technical Reports Server (NTRS)
Yager, Jeremy A.; Mojarradi, Mohammad M.; Vo, Tuan A.; Blalock, Benjamin J.
2011-01-01
proposed integrated circuit would translate (1) a pair of input signals having a low differential potential and a possibly high common-mode potential into (2) a pair of output signals having the same low differential potential and a low common-mode potential. As used here, "low" and "high" refer to potentials that are, respectively, below or above the nominal supply potential (3.3 V) at which standard complementary metal oxide/semiconductor (CMOS) integrated circuits are designed to operate. The input common-mode potential could lie between 0 and 10 V; the output common-mode potential would be 2 V. This translation would make it possible to process the pair of signals by use of standard 3.3-V CMOS analog and/or mixed-signal (analog and digital) circuitry on the same integrated-circuit chip. A schematic of the circuit is shown in the figure. Standard 3.3-V CMOS circuitry cannot withstand input potentials greater than about 4 V. However, there are many applications that involve low-differential-potential, high-common-mode-potential input signal pairs and in which standard 3.3-V CMOS circuitry, which is relatively inexpensive, would be the most appropriate circuitry for performing other functions on the integrated-circuit chip that handles the high-potential input signals. Thus, there is a need to combine high-voltage input circuitry with standard low-voltage CMOS circuitry on the same integrated-circuit chip. The proposed circuit would satisfy this need. In the proposed circuit, the input signals would be coupled into both a level-shifting pair and a common-mode-sensing pair of CMOS transistors. The output of the level-shifting pair would be fed as input to a differential pair of transistors. The resulting differential current output would pass through six standoff transistors to be mirrored into an output branch by four heterojunction bipolar transistors. The mirrored differential current would be converted back to potential by a pair of diode-connected transistors, which, by virtue of being identical to the input transistors, would reproduce the input differential potential at the output
Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors
Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C. P.; Gelinck, Gerwin H.; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2016-01-01
Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics. PMID:27762321
Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors.
Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C P; Gelinck, Gerwin H; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2016-10-20
Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics.
Moral injury: A new challenge for complementary and alternative medicine.
Kopacz, Marek S; Connery, April L; Bishop, Todd M; Bryan, Craig J; Drescher, Kent D; Currier, Joseph M; Pigeon, Wilfred R
2016-02-01
Moral injury represents an emerging clinical construct recognized as a source of morbidity in current and former military personnel. Finding effective ways to support those affected by moral injury remains a challenge for both biomedical and complementary and alternative medicine. This paper introduces the concept of moral injury and suggests two complementary and alternative medicine, pastoral care and mindfulness, which may prove useful in supporting military personnel thought to be dealing with moral injury. Research strategies for developing an evidence-base for applying these, and other, complementary and alternative medicine modalities to moral injury are discussed. Published by Elsevier Ltd.
Nucleic acid duplexes incorporating a dissociable covalent base pair
NASA Technical Reports Server (NTRS)
Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.
Thyroid Disease and Complementary and Alternative Medicine (CAM)
... spirit; this combines standard medicine with CAM practices. TYPES OF COMPLEMENTARY AND ALTERNATIVE MEDICINE (CAM) The NIH ... on stories from a handful of people) or qualitative evidence (based on feelings about the treatment) is ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor
Complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH3/CO2 temperature programmed desorption (NH3/CO2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn2+more » and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO2, caused by steam reforming. The incorporation of atomic Zn2+ into the ZrO2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., ). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C3=-C6=) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor
Here, complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH 3/CO 2 temperature programmed desorption (NH 3/CO 2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO 2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn 2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO 2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn 2+ and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO 2, caused by steam reforming. The incorporation of atomic Zn 2+ into the ZrO 2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO 2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., Zr—omore » $$\\curvearrowleft\\atop{e\\atop—}$$Zn). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C 3 =-C 6 =) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less
Baylon, Rebecca A. L.; Sun, Junming; Kovarik, Libor; ...
2018-04-22
Here, complementary characterizations, such as nitrogen sorption, X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), visible Raman, scanning transmission electron microscopy (STEM) coupled with elemental mapping, NH 3/CO 2 temperature programmed desorption (NH 3/CO 2-TPD), infrared spectroscopic analysis of adsorbed pyridine (Py-IR), and CO 2-IR, have been employed to identify the structure and surface chemistry (i.e., acid-base) of mixed Zn xZr yO z oxide catalysts of varied ratios of Zn/Zr. Atomically dispersed Zn 2+ species are present in the framework within a thin surface shell (1.5-2.0 nm) of ZrO 2 particles when the Zn/Zr ratio is smaller than 1/10; when the ratio is above this, both atomically dispersed Zn 2+ and ZnO clusters coexist in mixed Zn xZr yO z oxide catalysts. The presence of ZnO clusters shows no significant side effect but only a slight increase of selectivity to CO 2, caused by steam reforming. The incorporation of atomic Zn 2+ into the ZrO 2 framework was found to not only passivate strong Lewis acid sites (i.e., Zr-O-Zr) on ZrO 2, but to also generate new Lewis acid-base site pairs with enhanced Lewis basicity on the bridged O (i.e., Zr—omore » $$\\curvearrowleft\\atop{e\\atop—}$$Zn). In the mixed ketone (i.e., acetone and methyl ethyl ketone (MEK)) reactions, while the passivation of strong acid sites can be correlated to the inhibition of side reactions, such as ketone decomposition and coking, the new Lewis acid-base pairs introduced enhance the cascade aldolization and self-deoxygenation reactions involved in olefin (C 3 =-C 6 =) production. More importantly, the surface acid-base properties change with varying Zn/Zr ratios, which in turn affect the cross- and self-condensation reactivity and subsequent distribution of olefins.« less
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Balancing Hole and Electron Conduction in Ambipolar Split-Gate Thin-Film Transistors.
Yoo, Hocheon; Ghittorelli, Matteo; Lee, Dong-Kyu; Smits, Edsger C P; Gelinck, Gerwin H; Ahn, Hyungju; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon
2017-07-10
Complementary organic electronics is a key enabling technology for the development of new applications including smart ubiquitous sensors, wearable electronics, and healthcare devices. High-performance, high-functionality and reliable complementary circuits require n- and p-type thin-film transistors with balanced characteristics. Recent advancements in ambipolar organic transistors in terms of semiconductor and device engineering demonstrate the great potential of this route but, unfortunately, the actual development of ambipolar organic complementary electronics is currently hampered by the uneven electron (n-type) and hole (p-type) conduction in ambipolar organic transistors. Here we show ambipolar organic thin-film transistors with balanced n-type and p-type operation. By manipulating air exposure and vacuum annealing conditions, we show that well-balanced electron and hole transport properties can be easily obtained. The method is used to control hole and electron conductions in split-gate transistors based on a solution-processed donor-acceptor semiconducting polymer. Complementary logic inverters with balanced charging and discharging characteristics are demonstrated. These findings may open up new opportunities for the rational design of complementary electronics based on ambipolar organic transistors.
Saldan, Paula Chuproski; Venancio, Sonia Isoyama; Saldiva, Silvia Regina Dias Medici; de Mello, Débora Falleiros
2016-09-01
This study compares complementary feeding World Health Organization (WHO) indicators with those built in accordance with Brazilian recommendations (Ten Steps to Healthy Feeding). A cross-sectional study was carried out during the National Immunization Campaign against Poliomyelitis in Guarapuava-Paraná, Brazil, in 2012. Feeding data from 1,355 children aged 6-23 months were obtained through the 24 h diet recall. Based on five indicators, the proportion of adequacy was evaluated: introduction of solid, semi-solid, or soft foods; minimum dietary diversity; meal frequency; acceptable diet; and consumption of iron-rich foods. Complementary feeding showed adequacy higher than 85% in most WHO indicators, while review by the Ten Steps assessment method showed a less favorable circumstance and a high intake of unhealthy foods. WHO indicators may not reflect the complementary feeding conditions of children in countries with low malnutrition rates and an increased prevalence of overweight/obesity. The use of indicators according to the Ten Steps can be useful to identify problems and redirect actions aimed at promoting complementary feeding. © 2016 John Wiley & Sons Australia, Ltd.
Schiff, Elad; Ben-Arye, Eran; Attias, Samuel; Sroka, Gideon; Matter, Ibrahim; Keshet, Yael
2012-12-01
This study aims to examine the meaning and practical implications of integration of a complementary medicine-based surgery service in a hospital setting (CISS--Complementary/Integrative Surgery Service) through analysis of consultation reports associated with this service. Thematic analysis was used to evaluate CISS consultation reports in a hospital electronic consultant charting system during the first half year of the service's activity. 304 consultation reports were analyzed. Nurses initiated significantly more consultations than physicians (55% vs 7%). Consultation requests were gradually more focused on specific symptoms, possibly manifesting a better understanding of the scope of complementary medicine in the surgery setting. CISS practitioners responded in more biomedical language over time, albeit offering a more holistic perspective regarding patients' needs as well as clarifications regarding the nature of the treatment they provided. Diverse communication patterns in consultations evolved over time representing dynamics in multiple levels of integration of the CISS. Documented communication through consultations can provide a window to the process of integration of complementary medicine-based services in health systems. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
DNA hybridization detection on electrical microarrays using coulostatic pulse technique.
Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R
2006-12-15
We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.
Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C
2015-09-11
Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.
Cytoplasmic Control of Sense-Antisense mRNA Pairs.
Sinturel, Flore; Navickas, Albertas; Wery, Maxime; Descrimes, Marc; Morillon, Antonin; Torchet, Claire; Benard, Lionel
2015-09-22
Transcriptome analyses have revealed that convergent gene transcription can produce many 3'-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3'-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3'-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3'-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD) in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs) form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5'-3' cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Downie, Kelsey; Adetola, Gbolagade; Carstens, Eric B
2013-11-01
Autographa californica nucleopolyhedrovirus late expression factor 3 (LEF-3) is required for late viral gene expression probably through its numerous functions related to DNA replication, including nuclear localization of the virus helicase P143 and binding to ssDNA. LEF-3 appears to interact with itself as a homo-oligomer, although the details of this oligomeric structure are not yet known. To examine LEF-3-LEF-3 interactions, a bimolecular fluorescent protein complementation assay was used. Pairs of recombinant plasmids expressing full-length LEF-3 fused to one of two complementary fragments (V1 or V2) of a variant of yellow fluorescent protein named 'Venus' were constructed. Plasmids expressing fusions with complementary fragments of Venus were co-transfected into Sf21 cells and analysed by fluorescence microscopy. Co-transfected plasmids expressing full-length V1-LEF-3 and V2-LEF-3 showed positive fluorescence, confirming the formation of homo-oligomers. A series of truncated V1/V2-LEF-3 fusions was constructed and used to investigate interactions with one another as well as with full-length LEF-3.
Complementary Barrier Infrared Detector (CBIRD) Contact Methods
NASA Technical Reports Server (NTRS)
Ting, David Z.; Hill, Cory J.; Gunapala, Sarath D.
2013-01-01
The performance of the CBIRD detector is enhanced by using new device contacting methods that have been developed. The detector structure features a narrow gap adsorber sandwiched between a pair of complementary, unipolar barriers that are, in turn, surrounded by contact layers. In this innovation, the contact adjacent to the hole barrier is doped n-type, while the contact adjacent to the electron barrier is doped p-type. The contact layers can have wider bandgaps than the adsorber layer, so long as good electrical contacts are made to them. If good electrical contacts are made to either (or both) of the barriers, then one could contact the barrier(s) directly, obviating the need for additional contact layers. Both the left and right contacts can be doped either n-type or ptype. Having an n-type contact layer next to the electron barrier creates a second p-n junction (the first being the one between the hole barrier and the adsorber) over which applied bias could drop. This reduces the voltage drop over the adsorber, thereby reducing dark current generation in the adsorber region.
NASA Astrophysics Data System (ADS)
Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing
2018-01-01
The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.
Nucleic acid duplexes incorporating a dissociable covalent base pair
Gao, Kui; Orgel, Leslie E.
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yagi, Kiyoshi, E-mail: kiyoshi.yagi@riken.jp; Otaki, Hiroki
A perturbative extension to optimized coordinate vibrational self-consistent field (oc-VSCF) is proposed based on the quasi-degenerate perturbation theory (QDPT). A scheme to construct the degenerate space (P space) is developed, which incorporates degenerate configurations and alleviates the divergence of perturbative expansion due to localized coordinates in oc-VSCF (e.g., local O–H stretching modes of water). An efficient configuration selection scheme is also implemented, which screens out the Hamiltonian matrix element between the P space configuration (p) and the complementary Q space configuration (q) based on a difference in their quantum numbers (λ{sub pq} = ∑{sub s}|p{sub s} − q{sub s}|). Itmore » is demonstrated that the second-order vibrational QDPT based on optimized coordinates (oc-VQDPT2) smoothly converges with respect to the order of the mode coupling, and outperforms the conventional one based on normal coordinates. Furthermore, an improved, fast algorithm is developed for optimizing the coordinates. First, the minimization of the VSCF energy is conducted in a restricted parameter space, in which only a portion of pairs of coordinates is selectively transformed. A rational index is devised for this purpose, which identifies the important coordinate pairs to mix from others that may remain unchanged based on the magnitude of harmonic coupling induced by the transformation. Second, a cubic force field (CFF) is employed in place of a quartic force field, which bypasses intensive procedures that arise due to the presence of the fourth-order force constants. It is found that oc-VSCF based on CFF together with the pair selection scheme yields the coordinates similar in character to the conventional ones such that the final vibrational energy is affected very little while gaining an order of magnitude acceleration. The proposed method is applied to ethylene and trans-1,3-butadiene. An accurate, multi-resolution potential, which combines the MP2 and coupled-cluster with singles, doubles, and perturbative triples level of electronic structure theory, is generated and employed in the oc-VQDPT2 calculation to obtain the fundamental tones as well as selected overtones/combination tones coupled to the fundamentals through the Fermi resonance. The calculated frequencies of ethylene and trans-1,3-butadiene are found to be in excellent agreement with the experimental values with a mean absolute error of 8 and 9 cm{sup −1}, respectively.« less
Veerabhadraswamy, Bhyranalyar N; Rao, Doddamane S Shankar; Yelamaggad, Channabasaveshwar V
2018-04-16
The chiral ferroelectric smectic C (SmC*) phase, characterized by a helical superstructure, has been well exploited in developing high-resolution microdisplays that have been effectively employed in the fabrication of a wide varieties of portable devices. Although, an overwhelming number of optically active (chiral) liquid crystals (LCs) exhibiting a SmC* phase have been designed and synthesized, the search for new systems continues so as to realize mesogens capable of meeting technical necessities and specifications for their end-use. In continuation of our research work in this direction, herein we report the design, synthesis, and thermal behavior of twenty new optically active, three-ring calamitic LCs belonging to four series. The first two series comprise five pairs of enantiomeric Schiff bases whereas the other two series are composed of five pairs of enantiomeric salicylaldimines. In each pair of optical isomers, the configuration of a chiral center in one stereoisomer is opposite to that of the analogous center in the other isomer as they are derived from (3 S)-3,7-dimethyloctyloxy and (3 R)-3,7-dimethyloctyloxy tails. To probe the structure-property correlations in each series, the length of the n-alkoxy tail situated at the other end of the mesogens has been varied from n-octyloxy to n-dodecyloxy. The measurement of optical activity of these chiral mesogens was carried out by recording their specific rotations. As expected, enantiomers rotate plane polarized light in the opposite direction but by the same magnitude. The thermal behavior of the compounds was established by using a combination of optical polarizing microscopy, differential scanning calorimetry, and powder X-ray diffraction. These complementary techniques demonstrate the existence of the expected, thermodynamically stable, chiral smectic C (SmC*) LC phase besides blue phase I/II (BPI or BPII) and chiral nematic (N*) phase. However, as noted in our previous analogous study, the vast majority of the Schiff bases show an additional metastable, unfamiliar smectic (SmX) phase just below the SmC* phase. Notably, the SmC* phase persists over the temperature range ≈80-115 °C. Two mesogens chosen each from Schiff bases and salicylaldimines were investigated for their electrical switching behavior. The study reveals the ferroelectric switching characteristics of the SmC* phase featuring the spontaneous polarization (P S ) in the range 69-96 nC cm -2 . The helical twist sense of the SmC* phase as well as the N* phase formed by a pair of enantiomeric Schiff bases and salicylaldimines has been established with the help of circular dichroism (CD) spectroscopic technique. As expected, the SmC* and the N* phase of a pair of enantiomers showed mirror image CD signals. Most importantly, the reversal of helical handedness from left to right and vice versa has been evidenced during the N* to SmC* phase transition, implying that the screw sense of the helical array of the N* phase and the SmC* phase of an enantiomer is opposite. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dhankar, Mukesh
2018-01-01
The aim was to study the prevalence of complementary and alternative medicine use in acutely sick hospitalized children and factors associated with it. This is a cross-sectional, hospital-based study in a tertiary care center of Delhi, India. Children admitted to a pediatric unit during the study period were assessed using a specially designed questionnaire. Out of the total 887 admitted children, 161 (18.1%) were using complementary and alternate medicine in one form or another. Of these, 113 (70.2%) were using complementary and alternate medicine for the current illness directly leading to admission and the remaining 48 (29.8%) had used complementary and alternate medicine in past. The common complementary and alternate medicine use observed in our study was combined ayurveda and spiritual approach (25.5%), ayurveda (24.8%), spiritual (21.7%), homeopathic (13%), and 47.2% of children were using spiritual approach in form of Jhada (tying piece of cloth on arm or leg or keeping a knife by the side of child). The significant factors associated with complementary and alternate medicine use were younger age, female gender, and father being employed. Complementary and alternate medicine is commonly used even in acutely sick children. PMID:29616560
Falsini, Benedetto; Ziccardi, Lucia; Lazzareschi, Ilaria; Ruggiero, Antonio; Placentino, Luca; Dickmann, Anna; Liotti, Lucia; Piccardi, Marco; Balestrazzi, Emilio; Colosimo, Cesare; Di Rocco, Concezio; Riccardi, Riccardo
2008-05-01
The aim of this study was to evaluate longitudinally functional and neuro-radiologic findings in childhood optic gliomas (OG), by comparing flicker visual evoked potentials (F-VEPs) with brain magnetic resonance imaging (MRI) changes. Fourteen children (age range: 1-13 years) with OGs underwent serial F-VEP, MRI and neuro-ophthalmic examinations over a 38 month (median, range: 6-76) follow-up. F-VEPs were elicited by 8 Hz sine-wave flicker stimuli presented in a mini-Ganzfeld. Contrast-enhanced MRI examinations were performed. Results of both tests were blindly assessed by independent evaluators. F-VEPs were judged to be improved, stable or worsened if changes in the amplitude and/or phase angle of the response exceeded the limits of test-retest variability (+/-90th percentile) established for the same patients. MRI results were judged to show regression, stabilization or progression of OG based on its changes in size (+/-20%) or extension. Two to seven pairs of F-VEP/MRI examinations per patient (median: 4) were collected. Based on a total of 38 pairs of F-VEP/MRI examinations, both tests agreed in showing worsening (progression), stabilization and improvement (regression) in 5, 15 and 10 cases, respectively. In 3 cases, F-VEPs showed a worsening and MRI a stabilization, while in 5 cases F-VEPs showed an improvement and MRI a stabilization. Agreement between F-VEP and MRI changes was 78.9% (95% CI: +/- 37%, K statistics = 0.67, P < 0.001). The results indicate that longitudinal F-VEP changes can predict changes in MRI-assessed OG size and extension, providing a non-invasive functional assay, complementary to neuro-imaging, for OG follow-up.
NASA Astrophysics Data System (ADS)
Kim, Bongjae; Khmelevskyi, Sergii; Mazin, Igor I.; Agterberg, Daniel F.; Franchini, Cesare
2017-07-01
Sr2RuO4 is the best candidate for spin-triplet superconductivity, an unusual and elusive superconducting state of fundamental importance. In the last three decades, Sr2RuO4 has been very carefully studied and despite its apparent simplicity when compared with strongly correlated high-Tc cuprates, for which the pairing symmetry is understood, there is no scenario that can explain all the major experimental observations, a conundrum that has generated tremendous interest. Here, we present a density-functional-based analysis of magnetic interactions in Sr2RuO4 and discuss the role of magnetic anisotropy in its unconventional superconductivity. Our goal is twofold. First, we access the possibility of the superconducting order parameter rotation in an external magnetic field of 200 Oe, and conclude that the spin-orbit interaction in this material is several orders of magnitude too strong to be consistent with this hypothesis. Thus, the observed invariance of the Knight shift across Tc has no plausible explanation, and casts doubt on using the Knight shift as an ultimate litmus paper for the pairing symmetry. Second, we propose a quantitative double-exchange-like model for combining itinerant fermions with an anisotropic Heisenberg magnetic Hamiltonian. This model is complementary to the Hubbard-model-based calculations published so far, and forms an alternative framework for exploring superconducting symmetry in Sr2RuO4. As an example, we use this model to analyze the degeneracy between various p-triplet states in the simplest mean-field approximation, and show that it splits into a single and two doublets with the ground state defined by the competition between the "Ising" and "compass" anisotropic terms.
NASA Technical Reports Server (NTRS)
Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.
2003-01-01
We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.
Kalloush, Rawan M; Vivet-Boudou, Valérie; Ali, Lizna M; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A
2016-06-01
MPMV has great potential for development as a vector for gene therapy. In this respect, precisely defining the sequences and structural motifs that are important for dimerization and packaging of its genomic RNA (gRNA) are of utmost importance. A distinguishing feature of the MPMV gRNA packaging signal is two phylogenetically conserved long-range interactions (LRIs) between U5 and gag complementary sequences, LRI-I and LRI-II. To test their biological significance in the MPMV life cycle, we introduced mutations into these structural motifs and tested their effects on MPMV gRNA packaging and propagation. Furthermore, we probed the structure of key mutants using SHAPE (selective 2'hydroxyl acylation analyzed by primer extension). Disrupting base-pairing of the LRIs affected gRNA packaging and propagation, demonstrating their significance to the MPMV life cycle. A double mutant restoring a heterologous LRI-I was fully functional, whereas a similar LRI-II mutant failed to restore gRNA packaging and propagation. These results demonstrate that while LRI-I acts at the structural level, maintaining base-pairing is not sufficient for LRI-II function. In addition, in vitro RNA dimerization assays indicated that the loss of RNA packaging in LRI mutants could not be attributed to the defects in dimerization. Our findings suggest that U5-gag LRIs play an important architectural role in maintaining the structure of the 5' region of the MPMV gRNA, expanding the crucial role of LRIs to the nonlentiviral group of retroviruses. © 2016 Kalloush et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Maurer, B; Bannert, H; Darai, G; Flügel, R M
1988-01-01
The nucleotide sequence of the human spumaretrovirus (HSRV) genome was determined. The 5' long terminal repeat region was analyzed by strong stop cDNA synthesis and S1 nuclease mapping. The length of the RU5 region was determined and found to be 346 nucleotides long. The 5' long terminal repeat is 1,123 base pairs long and is bound by an 18-base-pair primer-binding site complementary to the 3' end of mammalian lysine-1,2-specific tRNA. Open reading frames for gag and pol genes were identified. Surprisingly, the HSRV gag protein does not contain the cysteine motif of the nucleic acid-binding proteins found in and typical of all other retroviral gag proteins; instead the HSRV gag gene encodes a strongly basic protein reminiscent of those of hepatitis B virus and retrotransposons. The carboxy-terminal part of the HSRV gag gene products encodes a protease domain. The pol gene overlaps the gag gene and is postulated to be synthesized as a gag/pol precursor via translational frameshifting analogous to that of Rous sarcoma virus, with 7 nucleotides immediately upstream of the termination codons of gag conserved between the two viral genomes. The HSRV pol gene is 2,730 nucleotides long, and its deduced protein sequence is readily subdivided into three well-conserved domains, the reverse transcriptase, the RNase H, and the integrase. Although the degree of homology of the HSRV reverse transcriptase domain is highest to that of murine leukemia virus, the HSRV genomic organization is more similar to that of human and simian immunodeficiency viruses. The data justify classifying the spumaretroviruses as a third subfamily of Retroviridae. Images PMID:2451755
Godsey, Brian; Heiser, Diane; Civin, Curt
2012-01-01
MicroRNAs (miRs) are known to play an important role in mRNA regulation, often by binding to complementary sequences in "target" mRNAs. Recently, several methods have been developed by which existing sequence-based target predictions can be combined with miR and mRNA expression data to infer true miR-mRNA targeting relationships. It has been shown that the combination of these two approaches gives more reliable results than either by itself. While a few such algorithms give excellent results, none fully addresses expression data sets with a natural ordering of the samples. If the samples in an experiment can be ordered or partially ordered by their expected similarity to one another, such as for time-series or studies of development processes, stages, or types, (e.g. cell type, disease, growth, aging), there are unique opportunities to infer miR-mRNA interactions that may be specific to the underlying processes, and existing methods do not exploit this. We propose an algorithm which specifically addresses [partially] ordered expression data and takes advantage of sample similarities based on the ordering structure. This is done within a Bayesian framework which specifies posterior distributions and therefore statistical significance for each model parameter and latent variable. We apply our model to a previously published expression data set of paired miR and mRNA arrays in five partially ordered conditions, with biological replicates, related to multiple myeloma, and we show how considering potential orderings can improve the inference of miR-mRNA interactions, as measured by existing knowledge about the involved transcripts.
Cao, Yuan; Ye, Wenbin; Han, Qingbang; Pan, Xiaofang
2018-01-01
Authentication is a crucial security service for the wireless sensor networks (WSNs) in versatile domains. The deployment of WSN devices in the untrusted open environment and the resource-constrained nature make the on-chip authentication an open challenge. The strong physical unclonable function (PUF) came in handy as light-weight authentication security primitive. In this paper, we present the first ring oscillator (RO) based strong physical unclonable function (PUF) with high resilience to both the electromagnetic (EM) side-channel attack and the support vector machine (SVM) modelling attack. By employing an RO based PUF architecture with the current starved inverter as the delay cell, the oscillation power is significantly reduced to minimize the emitted EM signal, leading to greatly enhanced immunity to the EM side-channel analysis attack. In addition, featuring superior reconfigurability due to the conspicuously simplified circuitries, the proposed implementation is capable of withstanding the SVM modelling attack by generating and comparing a large number of RO frequency pairs. The reported experimental results validate the prototype of a 9-stage RO PUF fabricated using standard 65 nm complementary-metal-oxide-semiconductor (CMOS) process. Operating at the supply voltage of 1.2 V and the frequency of 100 KHz, the fabricated RO PUF occupies a compact silicon area of 250 μm2 and consumes a power as low as 5.16 μW per challenge-response pair (CRP). Furthermore, the uniqueness and the worst-case reliability are measured to be 50.17% and 98.30% for the working temperature range of −40∼120 ∘C and the supply voltage variation of ±2%, respectively. Thus, the proposed PUF is applicable for the low power, low cost and secure WSN communications. PMID:29360790
Bonnet, Romaric; Farre, Carole; Valera, Lionel; Vossier, Ludivine; Léon, Fanny; Dagland, Typhaine; Pouzet, Agnès; Jaffrézic-Renault, Nicole; Fareh, Jeannette; Fournier-Wirth, Chantal; Chaix, Carole
2018-05-15
A nanoparticle-based electrochemical sandwich immunoassay was developed for bacteria detection in platelet concentrates. For the assay, magnetic beads were functionalized with antibodies to allow the specific capture of bacteria from the complex matrix, and innovative methylene blue-DNA/nanoparticle assemblies provided the electrochemical response for amplified detection. This nanoparticular system was designed as a temperature-sensitive nano-tool for electrochemical detection. First, oligonucleotide-functionalized nanoparticles were obtained by direct synthesis of the DNA strands on the nanoparticle surface using an automated oligonucleotide synthesizer. Densely packed DNA coverage was thus obtained. Then, DNA duplexes were constructed on the NP surface with a complementary strand bearing a 3 methylene blue tag. This strategy ultimately produced highly functionalized nanoparticles with electrochemical markers. These assemblies enabled amplification of the electrochemical signal, resulting in a very good sensitivity. A proof-of-concept was carried out for E. coli detection in human platelet concentrates. Bacterial contamination of this complex biological matrix is the highest residual infectious risk in blood transfusion. The development of a rapid assay that could reach 10-102 CFU mL-1 sensitivity is a great challenge. The nanoparticle-based electrochemical sandwich immunoassay carried out on a boron doped diamond electrode proved to be sensitive for E. coli detection in human platelets. Two antibody pairs were used to develop either a generic assay against certain Gram negative strains or a specific assay for E. coli. The methylene blue-DNA/nanoparticles amplify sensitivity ×1000 compared with the assay run without NPs for electrochemical detection. A limit of detection of 10 CFU mL-1 in a biological matrix was achieved for E. coli using the highly specific antibody pair.
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
Semantic congruence affects hippocampal response to repetition of visual associations.
McAndrews, Mary Pat; Girard, Todd A; Wilkins, Leanne K; McCormick, Cornelia
2016-09-01
Recent research has shown complementary engagement of the hippocampus and medial prefrontal cortex (mPFC) in encoding and retrieving associations based on pre-existing or experimentally-induced schemas, such that the latter supports schema-congruent information whereas the former is more engaged for incongruent or novel associations. Here, we attempted to explore some of the boundary conditions in the relative involvement of those structures in short-term memory for visual associations. The current literature is based primarily on intentional evaluation of schema-target congruence and on study-test paradigms with relatively long delays between learning and retrieval. We used a continuous recognition paradigm to investigate hippocampal and mPFC activation to first and second presentations of scene-object pairs as a function of semantic congruence between the elements (e.g., beach-seashell versus schoolyard-lamp). All items were identical at first and second presentation and the context scene, which was presented 500ms prior to the appearance of the target object, was incidental to the task which required a recognition response to the central target only. Very short lags 2-8 intervening stimuli occurred between presentations. Encoding the targets with congruent contexts was associated with increased activation in visual cortical regions at initial presentation and faster response time at repetition, but we did not find enhanced activation in mPFC relative to incongruent stimuli at either presentation. We did observe enhanced activation in the right anterior hippocampus, as well as regions in visual and lateral temporal and frontal cortical regions, for the repetition of incongruent scene-object pairs. This pattern demonstrates rapid and incidental effects of schema processing in hippocampal, but not mPFC, engagement during continuous recognition. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fasano, Valerio
2017-01-01
Abstract Lower Lewis acidity boranes demonstrate greater tolerance to combinations of water/strong Brønsted bases than B(C6F5)3, this enables Si−H bond activation by a frustrated Lewis pair (FLP) mechanism to proceed in the presence of H2O/alkylamines. Specifically, BPh3 has improved water tolerance in the presence of alkylamines as the Brønsted acidic adduct H2O–BPh3 does not undergo irreversible deprotonation with aliphatic amines in contrast to H2O–B(C6F5)3. Therefore BPh3 is a catalyst for the reductive amination of aldehydes and ketones with alkylamines using silanes as reductants. A range of amines inaccessible using B(C6F5)3 as catalyst, were accessible by reductive amination catalysed by BPh3 via an operationally simple methodology requiring no purification of BPh3 or reagents/solvent. BPh3 has a complementary reductive amination scope to B(C6F5)3 with the former not an effective catalyst for the reductive amination of arylamines, while the latter is not an effective catalyst for the reductive amination of alkylamines. This disparity is due to the different pK a values of the water–borane adducts and the greater susceptibility of BPh3 species towards protodeboronation. An understanding of the deactivation processes occurring using B(C6F5)3 and BPh3 as reductive amination catalysts led to the identification of a third triarylborane, B(3,5‐Cl2C6H3)3, that has a broader substrate scope being able to catalyse the reductive amination of both aryl and alkyl amines with carbonyls. PMID:27977048
Cao, Yuan; Zhao, Xiaojin; Ye, Wenbin; Han, Qingbang; Pan, Xiaofang
2018-01-23
Authentication is a crucial security service for the wireless sensor networks (WSNs) in versatile domains. The deployment of WSN devices in the untrusted open environment and the resource-constrained nature make the on-chip authentication an open challenge. The strong physical unclonable function (PUF) came in handy as light-weight authentication security primitive. In this paper, we present the first ring oscillator (RO) based strong physical unclonable function (PUF) with high resilience to both the electromagnetic (EM) side-channel attack and the support vector machine (SVM) modelling attack. By employing an RO based PUF architecture with the current starved inverter as the delay cell, the oscillation power is significantly reduced to minimize the emitted EM signal, leading to greatly enhanced immunity to the EM side-channel analysis attack. In addition, featuring superior reconfigurability due to the conspicuously simplified circuitries, the proposed implementation is capable of withstanding the SVM modelling attack by generating and comparing a large number of RO frequency pairs. The reported experimental results validate the prototype of a 9-stage RO PUF fabricated using standard 65 nm complementary-metal-oxide-semiconductor (CMOS) process. Operating at the supply voltage of 1.2 V and the frequency of 100 KHz, the fabricated RO PUF occupies a compact silicon area of 250 μ m 2 and consumes a power as low as 5.16 μ W per challenge-response pair (CRP). Furthermore, the uniqueness and the worst-case reliability are measured to be 50.17% and 98.30% for the working temperature range of -40∼120 ∘ C and the supply voltage variation of ±2%, respectively. Thus, the proposed PUF is applicable for the low power, low cost and secure WSN communications.
Li, Z Jane; Abramov, Yuriy; Bordner, Jon; Leonard, Jason; Medek, Ales; Trask, Andrew V
2006-06-28
A cancer candidate, compound 1, is a weak base with two heterocyclic basic nitrogens and five hydrogen-bonding functional groups, and is sparingly soluble in water rendering it unsuitable for pharmaceutical development. The crystalline acid-base pairs of 1, collectively termed solid acid-base complexes, provide significant increases in the solubility and bioavailability compared to the free base, 1. Three dicarboxylic acid-base complexes, sesquisuccinate 2, dimalonate 3, and dimaleate 4, show the most favorable physicochemical profiles and are studied in greater detail. The structural analyses of the three complexes using crystal structure and solid-state NMR reveal that the proton-transfer behavior in these organic acid-base complexes vary successively correlating with Delta pKa. As a result, 2 is a neutral complex, 3 is a mixed ionic and zwitterionic complex and 4 is an ionic salt. The addition of the acidic components leads to maximized hydrogen bond interactions forming extended three-dimensional networks. Although structurally similar, the packing arrangements of the three complexes are considerably different due to the presence of multiple functional groups and the flexible backbone of 1. The findings in this study provide insight into the structural characteristics of complexes involving heterocyclic bases and carboxylic acids, and demonstrate that X-ray crystallography and 15N solid-state NMR are truly complementary in elucidating hydrogen bonding interactions and the degree of proton transfer of these complexes.
Graveley, Brenton R.
2008-01-01
Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213
Tôrres, Adamastor Rodrigues; Lyra, Wellington da Silva; de Andrade, Stéfani Iury Evangelista; Andrade, Renato Allan Navarro; da Silva, Edvan Cirino; Araújo, Mário César Ugulino; Gaião, Edvaldo da Nóbrega
2011-05-15
This work proposes the use of digital image-based method for determination of total acidity in red wines by means of acid-base titration without using an external indicator or any pre-treatment of the sample. Digital images present the colour of the emergent radiation which is complementary to the radiation absorbed by anthocyanines present in wines. Anthocyanines change colour depending on the pH of the medium, and from the variation of colour in the images obtained during titration, the end point can be localized with accuracy and precision. RGB-based values were employed to build titration curves, and end points were localized by second derivative curves. The official method recommends potentiometric titration with a NaOH standard solution, and sample dilution until the pH reaches 8.2-8.4. In order to illustrate the feasibility of the proposed method, titrations of ten red wines were carried out. Results were compared with the reference method, and no statistically significant difference was observed between the results by applying the paired t-test at the 95% confidence level. The proposed method yielded more precise results than the official method. This is due to the trivariate nature of the measurements (RGB), associated with digital images. Copyright © 2011 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The major aim of this trial was to compare the development of 18-month-old infants who received complementary feeding for 1 year with either lipid-based nutrient supplements or micronutrient-fortified corn-soy porridge. Our secondary aim was to determine the socio-economic factors associated with de...
High Performance Complementary Circuits Based on p-SnO and n-IGZO Thin-Film Transistors.
Zhang, Jiawei; Yang, Jia; Li, Yunpeng; Wilson, Joshua; Ma, Xiaochen; Xin, Qian; Song, Aimin
2017-03-21
Oxide semiconductors are regarded as promising materials for large-area and/or flexible electronics. In this work, a ring oscillator based on n-type indium-gallium-zinc-oxide (IGZO) and p-type tin monoxide (SnO) is presented. The IGZO thin-film transistor (TFT) shows a linear mobility of 11.9 cm²/(V∙s) and a threshold voltage of 12.2 V. The SnO TFT exhibits a mobility of 0.51 cm²/(V∙s) and a threshold voltage of 20.1 V which is suitable for use with IGZO TFTs to form complementary circuits. At a supply voltage of 40 V, the complementary inverter shows a full output voltage swing and a gain of 24 with both TFTs having the same channel length/channel width ratio. The three-stage ring oscillator based on IGZO and SnO is able to operate at 2.63 kHz and the peak-to-peak oscillation amplitude reaches 36.1 V at a supply voltage of 40 V. The oxide-based complementary circuits, after further optimization of the operation voltage, may have wide applications in practical large-area flexible electronics.
High Performance Complementary Circuits Based on p-SnO and n-IGZO Thin-Film Transistors
Zhang, Jiawei; Yang, Jia; Li, Yunpeng; Wilson, Joshua; Ma, Xiaochen; Xin, Qian; Song, Aimin
2017-01-01
Oxide semiconductors are regarded as promising materials for large-area and/or flexible electronics. In this work, a ring oscillator based on n-type indium-gallium-zinc-oxide (IGZO) and p-type tin monoxide (SnO) is presented. The IGZO thin-film transistor (TFT) shows a linear mobility of 11.9 cm2/(V∙s) and a threshold voltage of 12.2 V. The SnO TFT exhibits a mobility of 0.51 cm2/(V∙s) and a threshold voltage of 20.1 V which is suitable for use with IGZO TFTs to form complementary circuits. At a supply voltage of 40 V, the complementary inverter shows a full output voltage swing and a gain of 24 with both TFTs having the same channel length/channel width ratio. The three-stage ring oscillator based on IGZO and SnO is able to operate at 2.63 kHz and the peak-to-peak oscillation amplitude reaches 36.1 V at a supply voltage of 40 V. The oxide-based complementary circuits, after further optimization of the operation voltage, may have wide applications in practical large-area flexible electronics. PMID:28772679
Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph
2006-07-01
To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.
Ye, Ping; Peyser, Brian D; Spencer, Forrest A; Bader, Joel S
2005-01-01
Background In a genetic interaction, the phenotype of a double mutant differs from the combined phenotypes of the underlying single mutants. When the single mutants have no growth defect, but the double mutant is lethal or exhibits slow growth, the interaction is termed synthetic lethality or synthetic fitness. These genetic interactions reveal gene redundancy and compensating pathways. Recently available large-scale data sets of genetic interactions and protein interactions in Saccharomyces cerevisiae provide a unique opportunity to elucidate the topological structure of biological pathways and how genes function in these pathways. Results We have defined congruent genes as pairs of genes with similar sets of genetic interaction partners and constructed a genetic congruence network by linking congruent genes. By comparing path lengths in three types of networks (genetic interaction, genetic congruence, and protein interaction), we discovered that high genetic congruence not only exhibits correlation with direct protein interaction linkage but also exhibits commensurate distance with the protein interaction network. However, consistent distances were not observed between genetic and protein interaction networks. We also demonstrated that congruence and protein networks are enriched with motifs that indicate network transitivity, while the genetic network has both transitive (triangle) and intransitive (square) types of motifs. These results suggest that robustness of yeast cells to gene deletions is due in part to two complementary pathways (square motif) or three complementary pathways, any two of which are required for viability (triangle motif). Conclusion Genetic congruence is superior to genetic interaction in prediction of protein interactions and function associations. Genetically interacting pairs usually belong to parallel compensatory pathways, which can generate transitive motifs (any two of three pathways needed) or intransitive motifs (either of two pathways needed). PMID:16283923
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Identification and DUS Testing of Rice Varieties through Microsatellite Markers.
Pourabed, Ehsan; Jazayeri Noushabadi, Mohammad Reza; Jamali, Seyed Hossein; Moheb Alipour, Naser; Zareyan, Abbas; Sadeghi, Leila
2015-01-01
Identification and registration of new rice varieties are very important to be free from environmental effects and using molecular markers that are more reliable. The objectives of this study were, first, the identification and distinction of 40 rice varieties consisting of local varieties of Iran, improved varieties, and IRRI varieties using PIC, and discriminating power, second, cluster analysis based on Dice similarity coefficient and UPGMA algorithm, and, third, determining the ability of microsatellite markers to separate varieties utilizing the best combination of markers. For this research, 12 microsatellite markers were used. In total, 83 polymorphic alleles (6.91 alleles per locus) were found. In addition, the variation of PIC was calculated from 0.52 to 0.9. The results of cluster analysis showed the complete discrimination of varieties from each other except for IR58025A and IR58025B. Moreover, cluster analysis could detect the most of the improved varieties from local varieties. Based on the best combination of markers analysis, five pair primers together have shown the same results of all markers for detection among all varieties. Considering the results of this research, we can propose that microsatellite markers can be used as a complementary tool for morphological characteristics in DUS tests.
DNA origami metallized site specifically to form electrically conductive nanowires.
Pearson, Anthony C; Liu, Jianfei; Pound, Elisabeth; Uprety, Bibek; Woolley, Adam T; Davis, Robert C; Harb, John N
2012-09-06
DNA origami is a promising tool for use as a template in the design and fabrication of nanoscale structures. The ability to engineer selected staple strands on a DNA origami structure provides a high density of addressable locations across the structure. Here we report a method using site-specific attachment of gold nanoparticles to modified staple strands and subsequent metallization to fabricate conductive wires from DNA origami templates. We have modified DNA origami structures by lengthening each staple strand in select regions with a 10-base nucleotide sequence and have attached DNA-modified gold nanoparticles to the lengthened staple strands via complementary base-pairing. The high density of extended staple strands allowed the gold nanoparticles to pack tightly in the modified regions of the DNA origami, where the measured median gap size between neighboring particles was 4.1 nm. Gold metallization processes were optimized so that the attached gold nanoparticles grew until gaps between particles were filled and uniform continuous nanowires were formed. Finally, electron beam lithography was used to pattern electrodes in order to measure the electrical conductivity of metallized DNA origami, which showed an average resistance of 2.4 kΩ per metallized structure.
Organization of 'nanocrystal molecules' using DNA
NASA Astrophysics Data System (ADS)
Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.
1996-08-01
PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.
A clocked high-pass-filter-based offset cancellation technique for high-gain biomedical amplifiers
NASA Astrophysics Data System (ADS)
Pal, Dipankar; Goswami, Manish
2010-05-01
In this article, a simple offset cancellation technique based on a clocked high-pass filter with extremely low output offset is presented. The configuration uses the on-resistance of a complementary metal oxide semiconductor (CMOS) transmission gate (X-gate) and tunes the lower 3-dB cut-off frequency with a matched pair of floating capacitors. The results compare favourably with the more complex auto-zeroing and chopper stabilisation techniques of offset cancellation in terms of power dissipation, component count and bandwidth, while reporting inferior output noise performance. The design is suitable for use in biomedical amplifier systems for applications such as ENG-recording. The system is simulated in Spectre Cadence 5.1.41 using 0.6 μm CMOS technology and the total block gain is ∼83.0 dB while the phase error is <5°. The power consumption is 10.2 mW and the output offset obtained for an input monotone signal of 5 μVpp is 1.28 μV. The input-referred root mean square noise voltage between 1 and 5 kHz is 26.32 nV/√Hz.
Oxygenation as a driver of the Great Ordovician Biodiversification Event
NASA Astrophysics Data System (ADS)
Edwards, Cole T.; Saltzman, Matthew R.; Royer, Dana L.; Fike, David A.
2017-12-01
The largest radiation of Phanerozoic marine animal life quadrupled genus-level diversity towards the end of the Ordovician Period about 450 million years ago. A leading hypothesis for this Great Ordovician Biodiversification Event is that cooling of the Ordovician climate lowered sea surface temperatures into the thermal tolerance window of many animal groups, such as corals. A complementary role for oxygenation of subsurface environments has been inferred based on the increasing abundance of skeletal carbonate, but direct constraints on atmospheric O2 levels remain elusive. Here, we use high-resolution paired bulk carbonate and organic carbon isotope records to determine the changes in isotopic fractionation between these phases throughout the Ordovician radiation. These results can be used to reconstruct atmospheric O2 levels based on the O2-dependent fractionation of carbon isotopes by photosynthesis. We find a strong temporal link between the Great Ordovician Biodiversification Event and rising O2 concentrations, a pattern that is corroborated by O2 models that use traditional carbon-sulfur mass balance. We conclude that that oxygen levels probably played an important role in regulating early Palaeozoic biodiversity levels, even after the Cambrian Explosion.
Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses
2005-01-01
Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.
Service, Christina N.; Adams, Megan S.; Artelle, Kyle A.; Paquet, Paul; Grant, Laura V.; Darimont, Chris T.
2014-01-01
Range shifts among wildlife can occur rapidly and impose cascading ecological, economic, and cultural consequences. However, occurrence data used to define distributional limits derived from scientific approaches are often outdated for wide ranging and elusive species, especially in remote environments. Accordingly, our aim was to amalgamate indigenous and western scientific evidence of grizzly bear (Ursus arctos horribilis) records and detail a potential range shift on the central coast of British Columbia, Canada. In addition, we test the hypothesis that data from each method yield similar results, as well as illustrate the complementary nature of this coupled approach. Combining information from traditional and local ecological knowledge (TEK/LEK) interviews with remote camera, genetic, and hunting data revealed that grizzly bears are now present on 10 islands outside their current management boundary. LEK interview data suggested this expansion has accelerated over the last 10 years. Both approaches provided complementary details and primarily affirmed one another: all islands with scientific evidence for occupation had consistent TEK/LEK evidence. Moreover, our complementary methods approach enabled a more spatially and temporally detailed account than either method would have afforded alone. In many cases, knowledge already held by local indigenous people could provide timely and inexpensive data about changing ecological processes. However, verifying the accuracy of scientific and experiential knowledge by pairing sources at the same spatial scale allows for increased confidence and detail. A similarly coupled approach may be useful across taxa in many regions. PMID:25054635
Specificity of hammerhead ribozyme cleavage.
Hertel, K J; Herschlag, D; Uhlenbeck, O C
1996-01-01
To be effective in gene inactivation, the hammerhead ribozyme must cleave a complementary RNA target without deleterious effects from cleaving non-target RNAs that contain mismatches and shorter stretches of complementarity. The specificity of hammerhead cleavage was evaluated using HH16, a well-characterized ribozyme designed to cleave a target of 17 residues. Under standard reaction conditions, HH16 is unable to discriminate between its full-length substrate and 3'-truncated substrates, even when six fewer base pairs are formed between HH16 and the substrate. This striking lack of specificity arises because all the substrates bind to the ribozyme with sufficient affinity so that cleavage occurs before their affinity differences are manifested. In contrast, HH16 does exhibit high specificity towards certain 3'-truncated versions of altered substrates that either also contain a single base mismatch or are shortened at the 5' end. In addition, the specificity of HH16 is improved in the presence of p7 nucleocapsid protein from human immunodeficiency virus (HIV)-1, which accelerates the association and dissociation of RNA helices. These results support the view that the hammerhead has an intrinsic ability to discriminate against incorrect bases, but emphasizes that the high specificity is only observed in a certain range of helix lengths. Images PMID:8670879
Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.
Kimoto, Michiko; Hirao, Ichiro
2017-10-20
Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.
Paired-Pulse Depression at Photoreceptor Synapses
Rabl, Katalin; Cadetti, Lucia; Thoreson, Wallace B.
2011-01-01
Synaptic depression produced by repetitive stimulation is likely to be particularly important in shaping responses of second-order retinal neurons at the tonically active photoreceptor synapse. We analyzed the time course and mechanisms of synaptic depression at rod and cone synapses using paired-pulse protocols involving two complementary measurements of exocytosis: (1) paired whole-cell recordings of the postsynaptic current (PSC) in second-order retinal neurons and (2) capacitance measurements of vesicular membrane fusion in rods and cones. PSCs in ON bipolar, OFF bipolar, and horizontal cells evoked by stimulation of either rods or cones recovered from paired-pulse depression (PPD) at rates similar to the recovery of exocytotic capacitance changes in rods and cones. Correlation between presynaptic and postsynaptic measures of recovery from PPD suggests that 80 –90% of the depression at these synapses is presynaptic in origin. Consistent with a predominantly presynaptic mechanism, inhibiting desensitization of postsynaptic glutamate receptors had little effect on PPD. The depression of exocytotic capacitance changes exceeded depression of the presynaptic calcium current, suggesting that it is primarily caused by a depletion of synaptic vesicles. In support of this idea, limiting Ca2+ influx by using weaker depolarizing stimuli promoted faster recovery from PPD. Although cones exhibit much faster exocytotic kinetics than rods, exocytotic capacitance changes recovered from PPD at similar rates in both cell types. Thus, depression of release is not likely to contribute to differences in the kinetics of transmission from rods and cones. PMID:16510733
Nanocrystal-based complementary inverters constructed on flexible plastic substrates.
Jang, Jaewon; Cho, Kyoungah; Yun, Junggwon; Kim, Sangsig
2013-05-01
We demonstrate a nanocrystal (NC)-based complementary inverter constructed on a flexible plastic substrate. The NC-based complementary inverter consists of n-type HgSe NC- and p-type HgTe NC-based thin-film transistors (TFTs). Solid films on a plastic substrate obtained from HgSe and HgTe nanocrystals by thermal transformation are utilized as the n- and p-channel layers in these TFTs, respectively. The electrical properties of these component TFTs on unstrained and strained substrates are characterized and the performance of the inverter on the flexible substrate is investigated. The inverter on the unstrained substrate exhibits a logic gain of about 8, a logic swing of 90%, and a noise margin of 2.0 V. The characteristics of the inverter are changed under tensile and compressive strains, but not very significantly. Moreover, a comparison of the electrical characteristics of the n- and p-channel TFTs and the inverter is made in this paper.
Castro-Chavez, Fernando
2012-01-01
Background Three binary representations of the genetic code according to the ancient I Ching of Fu-Xi will be presented, depending on their defragging capabilities by pairing based on three biochemical properties of the nucleic acids: H-bonds, Purine/Pyrimidine rings, and the Keto-enol/Amino-imino tautomerism, yielding the last pair a 32/32 single-strand self-annealed genetic code and I Ching tables. Methods Our working tool is the ancient binary I Ching's resulting genetic code chromosomes defragged by vertical and by horizontal pairing, reverse engineered into non-binaries of 2D rotating 4×4×4 circles and 8×8 squares and into one 3D 100% symmetrical 16×4 tetrahedron coupled to a functional tetrahedron with apical signaling and central hydrophobicity (codon formula: 4[1(1)+1(3)+1(4)+4(2)]; 5:5, 6:6 in man) forming a stella octangula, and compared to Nirenberg's 16×4 codon table (1965) pairing the first two nucleotides of the 64 codons in axis y. Results One horizontal and one vertical defragging had the start Met at the center. Two, both horizontal and vertical pairings produced two pairs of 2×8×4 genetic code chromosomes naturally arranged (M and I), rearranged by semi-introversion of central purines or pyrimidines (M' and I') and by clustering hydrophobic amino acids; their quasi-identity was disrupted by amino acids with odd codons (Met and Tyr pairing to Ile and TGA Stop); in all instances, the 64-grid 90° rotational ability was restored. Conclusions We defragged three I Ching representations of the genetic code while emphasizing Nirenberg's historical finding. The synthetic genetic code chromosomes obtained reflect the protective strategy of enzymes with a similar function, having both humans and mammals a biased G-C dominance of three H-bonds in the third nucleotide of their most used codons per amino acid, as seen in one chromosome of the i, M and M' genetic codes, while a two H-bond A-T dominance was found in their complementary chromosome, as seen in invertebrates and plants. The reverse engineering of chromosome I' into 2D rotating circles and squares was undertaken, yielding a 100% symmetrical 3D geometry which was coupled to a previously obtained genetic code tetrahedron in order to differentiate the start methionine from the methionine that is acting as a codifying non-start codon. PMID:23431415
Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses
2005-01-01
Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305
Higher similarity in beta topography between tasks than subjects.
Basile, Luis F H; Sato, João R; Pasquini, Henrique A; Velasques, Bruna; Ribeiro, Pedro; Anghinah, Renato
2018-05-01
We have recently provided evidence for highly idiosyncratic topographic distributions of beta oscillations (as well as slow potentials) across individuals. More recently, by emphasizing the analysis of similarity instead of differences across tasks, we concluded that differences between an attention task and quiet resting may be negligible or at least unsystematic across subjects. Due to the possibility that individual differences could be due to noise in a wide sense or some inherent instability of beta activity, we designed a replication study to explicitly test whether pairs of individuals matched for head size and shape would still present less similar beta topography than each individual between sessions or tasks. We used independent component analysis (ICA) for an exhaustive decomposition of beta activity in a visual attention task and in quiet resting, recorded by 256-channel EEG in 20 subjects, on two separate days. We evaluated whether each ICA component obtained in one task and in one given individual could be explained by a linear regression model based on the topographic patterns of the complementary task (correlation between one component with a linear combination of components from complementary conditions), of the same task in a second session and of a matched individual. Results again showed a high topographic similarity between conditions, as previously seen between reasoning and simple visual attention beta correlates. From an overall number of 16 components representing brain activity obtained for the tasks (out of 60 originally computed where the remaining were considered noise), over 92% could satisfactorily be explained by the complementary task. Although the similarity between sessions was significantly smaller than between tasks on each day, the similarity between sessions was statistically higher than that between subjects in a highly significant way. We discuss the possible biases of group spatial averaging and the emphasis on differences as opposed to similarities, and noise in a wide sense, as the main causes of hardly replicable findings on task-related forms of activity and the inconclusive state of a universal functional mapping of cortical association areas.
NASA Astrophysics Data System (ADS)
Yang, Bo; Rodgers, M. T.
2015-08-01
Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.
Inkjet printed circuits based on ambipolar and p-type carbon nanotube thin-film transistors
NASA Astrophysics Data System (ADS)
Kim, Bongjun; Geier, Michael L.; Hersam, Mark C.; Dodabalapur, Ananth
2017-02-01
Ambipolar and p-type single-walled carbon nanotube (SWCNT) thin-film transistors (TFTs) are reliably integrated into various complementary-like circuits on the same substrate by inkjet printing. We describe the fabrication and characteristics of inverters, ring oscillators, and NAND gates based on complementary-like circuits fabricated with such TFTs as building blocks. We also show that complementary-like circuits have potential use as chemical sensors in ambient conditions since changes to the TFT characteristics of the p-channel TFTs in the circuit alter the overall operating characteristics of the circuit. The use of circuits rather than individual devices as sensors integrates sensing and signal processing functions, thereby simplifying overall system design.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional DNA molecules such as artificial DNAzymes and DNA machines. In addition, the metallo-base pairing system is a powerful tool for the construction of homogeneous and heterogeneous metal arrays, which can lead to DNA-based nanomaterials such as electronic wires and magnetic devices. Recently researchers have investigated these systems as enzyme replacements, which may offer an additional contribution to chemical biology and synthetic biology through the expansion of the genetic alphabet.
Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.
Paukku, Y; Hill, G
2011-05-12
Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.
Huybregts, Lieven; Martin-Prevel, Yves; Donnen, Philippe; Lanou, Hermann; Grosemans, Joep; Offoh, Priscilla; Dramaix-Wilmet, Michèle; Sondo, Blaise; Roberfroid, Dominique; Kolsteren, Patrick
2017-01-01
The period from conception to 24 months of age is a crucial window for nutrition interventions. Personalized maternal counseling may improve childbirth outcomes, growth, and health. We assessed the effectiveness of facility-based personalized maternal nutrition counseling (from pregnancy to 18 months after birth) in improving child growth and health in rural Burkina Faso. We conducted a paired cluster randomized controlled trial in a rural district of Burkina Faso with 12 primary health centers (clusters). Healthcare providers in the intervention centers received patient-centered communication and nutrition counseling training. Pregnant women in the third trimester living in the center catchment areas and intending to stay for the next 2 years were prospectively included. We followed 2253 mother-child pairs quarterly until the child was aged 18 months. Women were interviewed about counseling experiences, dietary practices during pregnancy, and their child’s feeding practices and morbidity history. Anthropometric measurements were taken at each visit using standardized methods. The primary outcomes were the cumulative incidence of wasting, and changes in child weight-for-height z-score (WHZ). Secondary outcomes were the women’s prenatal dietary practices, early breastfeeding practices, exclusive breastfeeding, timely introduction of complementary food, child’s feeding frequency and dietary diversity, children’s mean birth weight, endpoint prevalence of stunting, and cumulative incidence of diarrhea, fever, and acute respiratory infection. All analyses were by intention-to-treat using mixed effects models. The intervention and control arms each included six health centers. Mothers in the intervention arm had a significantly higher exposure to counseling with 11.2% for breastfeeding techniques to 75.7% for counseling on exclusive breastfeeding. Mothers of infants below 6 months of age in the intervention arm were more likely to exclusively breastfeed (54.3% vs 42.3%; Difference of Proportion (DP) 12.8%; 95% CI: 2.1, 23.6; p = 0.020) as compared to the control arm. Between 6 and 18 months of age, more children in the intervention arm benefited from the required feeding frequency (68.8% vs 53.4%; DP 14.1%; 95% CI: 9.0, 19.2; p<0.001) and a larger proportion had a minimum dietary diversity (28.6% vs 22.0%; DP 5.9%; 95% CI: 2.7, 9.2; p<0.001). Birth weight of newborns in the intervention arm was on average 84.8 g (p = 0.037) larger compared to the control arm. However, we found no significant differences in child anthropometry or morbidity between study arms. Facility-based personalized maternal nutrition counseling was associated with an improved prenatal dietary practices, Infant and Young Child Feeding practices, and child birth weight. Complementary strategies are warranted to obtain meaningful impact on child growth and morbidity. This includes strategies to ensure good coverage of facility-based services and effective nutrition/care practices in early childhood. PMID:28542391
Base pairing and base mis-pairing in nucleic acids
NASA Technical Reports Server (NTRS)
Wang, A. H. J.; Rich, A.
1986-01-01
In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.
Miles, Robin R [Danville, CA; Belgrader, Phillip [Severna Park, MD; Fuller, Christopher D [Oakland, CA
2007-01-02
Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bialynicki-Birula, Iwo
Quantum mechanical uncertainty relations for the position and the momentum and for the angle and the angular momentum are expressed in the form of inequalities involving the Renyi entropies. These uncertainty relations hold not only for pure but also for mixed states. Analogous uncertainty relations are valid also for a pair of complementary observables (the analogs of x and p) in N-level systems. All these uncertainty relations become more attractive when expressed in terms of the symmetrized Renyi entropies. The mathematical proofs of all the inequalities discussed in this paper can be found in Phys. Rev. A 74, No. 5more » (2006); arXiv:quant-ph/0608116.« less
Complementary junction heterostructure field-effect transistor
Baca, Albert G.; Drummond, Timothy J.; Robertson, Perry J.; Zipperian, Thomas E.
1995-01-01
A complimentary pair of compound semiconductor junction heterostructure field-effect transistors and a method for their manufacture are disclosed. The p-channel junction heterostructure field-effect transistor uses a strained layer to split the degeneracy of the valence band for a greatly improved hole mobility and speed. The n-channel device is formed by a compatible process after removing the strained layer. In this manner, both types of transistors may be independently optimized. Ion implantation is used to form the transistor active and isolation regions for both types of complimentary devices. The invention has uses for the development of low power, high-speed digital integrated circuits.
Complementary junction heterostructure field-effect transistor
Baca, A.G.; Drummond, T.J.; Robertson, P.J.; Zipperian, T.E.
1995-12-26
A complimentary pair of compound semiconductor junction heterostructure field-effect transistors and a method for their manufacture are disclosed. The p-channel junction heterostructure field-effect transistor uses a strained layer to split the degeneracy of the valence band for a greatly improved hole mobility and speed. The n-channel device is formed by a compatible process after removing the strained layer. In this manner, both types of transistors may be independently optimized. Ion implantation is used to form the transistor active and isolation regions for both types of complimentary devices. The invention has uses for the development of low power, high-speed digital integrated circuits. 10 figs.
Bertz, Steven H; Hardin, Richard A; Heavey, Thomas J; Jones, Daniel S; Monroe, T Blake; Murphy, Michael D; Ogle, Craig A; Whaley, Tara N
2013-07-29
Grow slow: The usual direct treatment of MeLi and CuSPh did not yield X-ray quality crystals of MeCu(SPh)Li. An indirect method starting from Me2CuLi⋅LiSPh and chalcone afforded the desired crystals by the slow reaction of the intermediate π-complex (see scheme). This strategy produced the first X-ray crystal structure of a Posner cuprate. A complementary NMR study showed that the contact ion pair was also the main species in solution. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhu, Yong; Romitti, Paul A; Conway, Kristin M; Andrews, Jennifer; Liu, Ke; Meaney, F John; Street, Natalie; Puzhankara, Soman; Druschel, Charlotte M; Matthews, Dennis J
2014-07-01
Complementary and alternative medicine is frequently used in the management of chronic pediatric diseases, but little is known about its use by those with Duchenne or Becker muscular dystrophy. Complementary and alternative medicine use by male patients with Duchenne or Becker muscular dystrophy and associations with characteristics of male patients and their caregivers were examined through interviews with 362 primary caregivers identified from the Muscular Dystrophy Surveillance, Tracking, and Research Network. Overall, 272 of the 362 (75.1%) primary caregivers reported that they had used any complementary and alternative medicine for the oldest Muscular Dystrophy Surveillance, Tracking, and Research Network male in their family. The most commonly reported therapies were from the mind-body medicine domain (61.0%) followed by those from the biologically based practice (39.2%), manipulative and body-based practice (29.3%), and whole medical system (6.9%) domains. Aquatherapy, prayer and/or blessing, special diet, and massage were the most frequently used therapies. Compared with nonusers, male patients who used any therapy were more likely to have an early onset of symptoms and use a wheel chair; their caregivers were more likely to be non-Hispanic white. Among domains, associations were observed with caregiver education and family income (mind-body medicines [excluding prayer and/or blessing only] and whole medical systems) and Muscular Dystrophy Surveillance, Tracking, and Research Network site (biologically based practices and mind-body medicines [excluding prayer and/or blessing only]). Complementary and alternative medicine use was common in the management of Duchenne and Becker muscular dystrophies among Muscular Dystrophy Surveillance, Tracking, and Research Network males. This widespread use suggests further study to evaluate the efficacy of integrating complementary and alternative medicine into treatment regimens for Duchenne and Becker muscular dystrophies. Copyright © 2014 Elsevier Inc. All rights reserved.
Structural landscape of base pairs containing post-transcriptional modifications in RNA
Seelam, Preethi P.; Sharma, Purshotam
2017-01-01
Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.
NASA Astrophysics Data System (ADS)
(O' Lee, Dominic J.
2018-02-01
At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.
Adams, J
2000-12-01
Amidst the substantial change currently gripping primary health care are two developments central to contemporary debate regarding the very nature, territory and identity of general practice - the integration of complementary and alternative medicine (CAM) and the rise of evidence-based medicine (EBM). This paper reports findings from a study based upon 25 in-depth interviews with general practitioners (GPs) personally practising complementary therapies alongside more conventional medicine to treat their NHS patients. The paper outlines the GPs' perceptions of EBM, its relationship to their personal development of CAM, and their notions of good clinical practice more generally. Analysis of the GPs' accounts demonstrates how CAM can be seen as a useful resource with which some GPs defend their clinical autonomy from what they perceive to be the threat of EBM. Copyright 2000 Harcourt Publishers Ltd.
Evidence-based Research in Complementary and Alternative Medicine I: History
2005-01-01
Contemporary Western medicine has witnessed a fragmentation of our conceptualization of the medical endeavor into ‘traditional medicine’ and ‘non-traditional medicine’. The former is meant to refer to the Western medical tradition, the latter encompasses both ‘complementary’ and ‘alternative’ medical practices. Complementary medicine complements conventional medical treatments, and alternative modes of medical interventions are meant to replace traditional Western medicine. Evidence-based research must be directed at establishing the best available evidence in complementary and alternative medicine. This paper is the first of a set of four ‘lectures’ that reviews the process of evidence-based research, and discusses its implications and applications for the early decades of the 21st century. The purpose of this paper is to introduce the series by examining some of the historical and philosophical foundations of this research endeavor. PMID:16322801
Reveal quantum correlation in complementary bases
Wu, Shengjun; Ma, Zhihao; Chen, Zhihua; Yu, Sixia
2014-01-01
An essential feature of genuine quantum correlation is the simultaneous existence of correlation in complementary bases. We reveal this feature of quantum correlation by defining measures based on invariance under a basis change. For a bipartite quantum state, the classical correlation is the maximal correlation present in a certain optimum basis, while the quantum correlation is characterized as a series of residual correlations in the mutually unbiased bases. Compared with other approaches to quantify quantum correlation, our approach gives information-theoretical measures that directly reflect the essential feature of quantum correlation. PMID:24503595
Sousa, Islandia Maria Carvalho de; Tesser, Charles Dalcanale
2017-01-23
This study aimed to analyze the inclusion of Traditional and Complementary Medicine in Brazilian Unified National Health System (SUS) and its integration with primary healthcare (PHC). A qualitative study drew on institutional data, indexed articles, and case studies in selected Brazilian cities: Campinas (São Paulo State), Florianópolis (Santa Catarina State), Recife (Pernambuco State), Rio de Janeiro, and São Paulo. The analysis adopted the perspective of inclusion of Traditional and Complementary Medicine in the healthcare network and its integration with primary healthcare, based on the following dimensions: presence of Traditional and Complementary Medicine on the municipal agenda; position in the services; mode of access to Traditional and Complementary Medicine; Traditional and Complementary Medicine practitioners; types of practices; demand profile; and potential for expansion in the SUS. The authors identified and characterized four types of inclusion and integration of Traditional and Complementary Medicine, whether in association or not: Type 1 - in primary healthcare via professionals from the family health teams - Integrated; Type 2 - in primary healthcare via professionals with full-time employment - Juxtaposed; Type 3 - in primary healthcare via matrix-organized teams - Matrix Organization; Type 4 - in specialized services - Without Integration. The combination of types 1 and 3 was considered a potential guideline for the expansion of Traditional and Complementary Medicine in the SUS and can orient the growth and integration of Traditional and Complementary Medicine with primary healthcare. The growing presence of Traditional and Complementary Medicine in the SUS requires conceiving its strategic expansion, while existing experiences should not be wasted.
Hollingsworth, Scott A.; Lewis, Matthew C.; Berkholz, Donald S.; Wong, Weng-Keen; Karplus, P. Andrew
2011-01-01
A deep understanding of protein structure benefits from the use of a variety of classification strategies that enhance our ability to effectively describe local patterns of conformation. Here, we use a clustering algorithm to analyze 76,533 all-trans segments from protein structures solved at 1.2 Å resolution or better to create a purely φ,ψ-based comprehensive empirical categorization of common conformations adopted by two adjacent φ,ψ-pairs (i.e. (φ,ψ)2-motifs). The clustering algorithm works in an origin-shifted 4-dimensional space based on the two φ,ψ-pairs to yield a parameter-dependent list of (φ,ψ)2-motifs – in order of their prominence. The results are remarkably distinct from and complementary to the standard hydrogen-bond centered view of secondary structure. New insights include an unprecedented level of precision in describing the φ,ψ-angles of both previously known and novel motifs, an ordering of these motifs by their population density, a data-driven recommendation that the standard Cαi…Cαi+3 < 7 Å criteria for defining turns be changed to 6.5 Å, an identification of β-strand and turn capping motifs, and of conformational capping by residues in the polypeptide-II (PII) conformation. We further document that the conformational preferences of a residue are substantially influenced by the conformation of its neighbors, and suggest that accounting for these dependencies will improve protein modeling accuracy. Although the CUEVAS-4D(r10є14) “parts list” presented here is only an initial exploration of the complex (φ,ψ)2-landscape of proteins, it shows there is value to be had from this approach and opens the door to more in-depth characterizations at the (φ,ψ)2-level and at higher dimensions. PMID:22198294
Hollingsworth, Scott A; Lewis, Matthew C; Berkholz, Donald S; Wong, Weng-Keen; Karplus, P Andrew
2012-02-10
A deep understanding of protein structure benefits from the use of a variety of classification strategies that enhance our ability to effectively describe local patterns of conformation. Here, we use a clustering algorithm to analyze 76,533 all-trans segments from protein structures solved at 1.2 Å resolution or better to create a purely φ,ψ-based comprehensive empirical categorization of common conformations adopted by two adjacent φ,ψ pairs (i.e., (φ,ψ)(2) motifs). The clustering algorithm works in an origin-shifted four-dimensional space based on the two φ,ψ pairs to yield a parameter-dependent list of (φ,ψ)(2) motifs, in order of their prominence. The results are remarkably distinct from and complementary to the standard hydrogen-bond-centered view of secondary structure. New insights include an unprecedented level of precision in describing the φ,ψ angles of both previously known and novel motifs, ordering of these motifs by their population density, a data-driven recommendation that the standard C(α(i))…C(α(i+3))<7 Å criteria for defining turns be changed to 6.5 Å, identification of β-strand and turn capping motifs, and identification of conformational capping by residues in polypeptide II conformation. We further document that the conformational preferences of a residue are substantially influenced by the conformation of its neighbors, and we suggest that accounting for these dependencies will improve protein modeling accuracy. Although the CUEVAS-4D(r(10)є(14)) 'parts list' presented here is only an initial exploration of the complex (φ,ψ)(2) landscape of proteins, it shows that there is value to be had from this approach, and it opens the door to more in-depth characterizations at the (φ,ψ)(2) level and at higher dimensions. Copyright © 2011 Elsevier Ltd. All rights reserved.
Whitehouse, Andrew J O
2013-09-01
Complementary and alternative medicine is widely used for children with autism spectrum disorder, despite uncertainty regarding efficacy. This review describes complementary and alternative practices commonly used among this population, the rationale for the use of each practice, as well as the side-effect profile and evidence for efficacy. The existing evidence base indicates that melatonin can be recommended as a treatment for sleeping disturbances associated with autism spectrum disorder, while secretin can be rejected as an efficacious treatment for broader autistic symptoms. There is insufficient evidence to draw conclusions on the efficacy of modified diets, hyperbaric oxygen therapy, immune therapy, and vitamin and fatty acid supplementation. There is a clear need for methodologically rigorous studies to provide evidence-based guidance to families and clinicians regarding complementary and alternative practices for individuals with autism spectrum disorders. © 2013 The Author. Journal of Paediatrics and Child Health © 2013 Paediatrics and Child Health Division (Royal Australasian College of Physicians).
Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J; Hu, Xiaohua; Luo, Zewei
2014-01-01
Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3'-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3'-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands.
Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J.; Hu, Xiaohua; Luo, Zewei
2014-01-01
Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3′-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3′-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision model, which postulates a clash between simultaneous transcriptional processes occurring on opposite DNA strands. PMID:24465217
2015-09-01
OAT) and laser-induced ultrasound tomography (LUT) to obtain coregistered maps of tissue optical absorption and speed of sound , displayed within the...computed tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound ...tomography (UST) can provide high-resolution anatomical images of breast lesions based on three complementary acoustic properties (speed-of- sound
Wilcox, Jennifer L; Bevilacqua, Philip C
2013-10-22
Shifting of pKa's in RNA is important for many biological processes; however, the driving forces responsible for shifting are not well understood. Herein, we determine how structural environments surrounding protonated bases affect pKa shifting in double-stranded RNA (dsRNA). Using (31)P NMR, we determined the pKa of the adenine in an A(+)·C base pair in various sequence and structural environments. We found a significant dependence of pKa on the base pairing strength of nearest neighbors and the location of a nearby bulge. Increasing nearest neighbor base pairing strength shifted the pKa of the adenine in an A(+)·C base pair higher by an additional 1.6 pKa units, from 6.5 to 8.1, which is well above neutrality. The addition of a bulge two base pairs away from a protonated A(+)·C base pair shifted the pKa by only ~0.5 units less than a perfectly base paired hairpin; however, positioning the bulge just one base pair away from the A(+)·C base pair prohibited formation of the protonated base pair as well as several flanking base pairs. Comparison of data collected at 25 °C and 100 mM KCl to biological temperature and Mg(2+) concentration revealed only slight pKa changes, suggesting that similar sequence contexts in biological systems have the potential to be protonated at biological pH. We present a general model to aid in the determination of the roles protonated bases may play in various dsRNA-mediated processes including ADAR editing, miRNA processing, programmed ribosomal frameshifting, and general acid-base catalysis in ribozymes.
Database of non-canonical base pairs found in known RNA structures
NASA Technical Reports Server (NTRS)
Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.
2000-01-01
Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.
Salamonsen, Anita; Ahlzén, Rolf
2018-07-01
Modern Western public healthcare systems offer predominantly publicly subsidized healthcare traditionally based on biomedicine as the most important basis to cure persons who suffer from disorders of somatic or psychiatric nature. To which extent this epistemological position is suitable for this purpose is under scientific debate and challenged by some people's personal understandings of health and illness, their individual illness experiences and their decision-making. Current studies show decreasing levels of patient trust in Western public healthcare and a widespread patient-initiated use of complementary and alternative medicine which is often linked to unmet patient-defined healthcare needs. Patients'/complementary and alternative medicine users' understandings of their afflictions are often based on elements of biomedical knowledge as well as embodied and experience-based knowledge. We believe this points to the need for a phenomenologically and socially based understanding of health and illness. In this article, we analyze challenges in contemporary healthcare systems, exemplified by people's widespread use of complementary and alternative medicine and based on three ways of understanding and relating to unhealth: disease (the biomedical perspective), illness (the phenomenological perspective), and sickness (the social perspective). In public healthcare systems aiming at involving patients in treatment processes, acknowledging the coexistence of differing epistemologies may be of great importance to define and reach goals of treatment and compliance.
Have complementary therapies demonstrated effectiveness in rheumatoid arthritis?
Fernández-Llanio Comella, Nagore; Fernández Matilla, Meritxell; Castellano Cuesta, Juan Antonio
2016-01-01
In recent decades the treatment of rheumatoid arthritis (RA) has improved thanks to the use of highly effective drugs. However, patients usually require long term therapy, which is not free of side effects. Therefore RA patients often demand complementary medicine, they seek additional sources of relief and/or less side effects. In fact 30-60% of rheumatic patients use some form of complementary medicine. Therefore, from conventional medicine, if we want to optimally treat our patients facilitating communication with them we must know the most commonly used complementary medicines. The aim of this review is to assess, based on published scientific research, what complementary therapies commonly used by patients with RA are effective and safe. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs
2017-01-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980
Swinton Darious, Robert; Thomas Muthiah, Packianathan
2018-01-01
The crystals of two new salts, 2,6-diamino-4-chloropyrimidin-1-ium 5-chlorosalicylate, C4H6ClN4 +·C7H4ClO3 −, (I), and bis(2,6-diamino-4-chloropyrimidin-1-ium) naphthalene-1,5-di-sulfonate, 2C4H6ClN4 +·C10H6O6S2 2−, (II), have been synthesized and characterized by single-crystal X-ray diffraction. In both compounds, the N atom of the pyrimidine group in between the amino substituents is protonated and the pyrimidinium cation forms a pair of N—H⋯O hydrogen bonds with the carboxylate/sulfonate ion, leading to a robust R 2 2(8) motif (supramolecular heterosynthon). In compound (I), a self-complementary base pairing involving the other pyrimidinium ring nitrogen atom and one of the amino groups via a pair of N—H⋯N hydrogen bonds [R 2 2(8) homosynthon] is also present. In compound (II), the crystallographic inversion centre coincides with the inversion centre of the naphthalene-1,5-disulfonate ion and all the sulfonate O atoms are hydrogen-bond acceptors, generating fused-ring motifs and a quadruple DDAA array. A halogen-bond (Cl⋯Cl) interaction is present in (I) with a distance and angle of 3.3505 (12) Å and 151.37 (10)°, respectively. In addition, a C—Cl⋯π interaction and a π–π interaction in (I) and a π–π interaction in (II) further stabilize these crystal structures. PMID:29850062
Near-IR Spectroscopy of Herbig Ae/Be Companion Stars
NASA Astrophysics Data System (ADS)
Rodgers, B. M.; van der Bliek, N. S.; Brandvig, B.; Thomas, S.; Doppmann, G.; Bouvier, J.
2005-12-01
We present first results of a program to obtain near-infrared spectra of candidate companions to intermediate mass pre-main sequence Herbig Ae/Be (HAEBE) stars. Accurate spectral classification is critical to proper identification of the secondary star and interpretation of its spectral energy distribution. Spectra also allow analysis of emission lines and other stellar charcteristics such as veiling and rotation, to determine the companion's evolutionary status and help establish binarity. Of the first six objects observed with GNIRS on Gemini South (AS310 NW, HD76534, HD150193, HR5999, HD141569 and CO Ori), we find two B+B companion pairs, three early A primaries with T Tauri type secondaries (G, K and M type), and a peculiar F+F pair in which the secondary star is the primary emission star (respectively). If true binaries, three systems are similar spectral type pairs but with very different extinction and emission properties. The three late-type secondaries all exhibit significant near-infrared excess, but only weak emission lines. Other components of our project are an AO-fed near-infrared imaging survey of a large sample of HAEBE systems (N. S. van der Bliek et al. poster) and modeling of companion spectral energy distributions (B. Brandvig et al. poster). Together, these three complementary approaches will result in the most thorough accounting of multiple HAEBE systems to date. Our initial spectroscopy sample contains about 40 objects taken from the literature, roughly half from Bouvier and Corporon (2001). Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the Particle Physics and Astronomy Research Council (United Kingdom), the National Research Council (Canada), CONICYT (Chile), the Australian Research Council (Australia), CNPq (Brazil) and CONICET (Argentina).
Ground Characterization Studies in Canakkale Pilot Site of LIQUEFACT Project
NASA Astrophysics Data System (ADS)
Ozcep, F.; Oztoprak, S.; Aysal, N.; Bozbey, I.; Tezel, O.; Ozer, C.; Sargin, S.; Bekin, E.; Almasraf, M.; Cengiz Cinku, M.; Ozdemir, K.
2017-12-01
The our aim is to outline the ground characterisation studies in Canakkale test site. Study is based on the EU H2020 LIQUEFACT project entitled "Liquefact: Assessment and mitigation of liquefaction potential across Europe: a holistic approach to protect structures / infrastructures for improved resilience to earthquake-induced liquefaction disasters". Objectives and extent of ground characterization for Canakkale test site includes pre-existing soil investigation studies and complementary field studies. There were several SPT and geophysical tests carried out in the study area. Within the context of the complementary tests, six (6) study areas in the test site were chosen and complementary tests were carried out in these areas. In these areas, additional boreholes were opened and SPT tests were performed. It was decided that additional CPT (CPTU and SCPT) and Marchetti Dilatometer (DMT) tests should be carried out within the scope of the complementary testing. Seismic refraction, MASW and micro tremor measurements had been carried out in pre-existing studies. Shear wave velocities obtained from MASW measurements were evaluated to the most rigorous level. These tests were downhole seismic, PS-logging, seismic refraction, 2D-ReMi, MASW, micro tremor (H/V Nakamura method), 2D resistivity and resonance acoustic profiling (RAP). RAP is a new technique which will be explained briefly in the relevant section. Dynamic soil properties had not been measured in pre-existing studies, therefore these properties were investigated within the scope of the complementary tests. Selection of specific experimental tests of the complementary campaign was based on cost-benefit considerations Within the context of complementary field studies, dynamic soil properties were measured using resonant column and cyclic direct shear tests. Several sieve analyses and Atterberg Limits tests which were documented in the pre-existing studies were evaluated. In the complementary study carried out, additional sieve analyses and Atterberg Limit tests were carried out. It was aimed to make some correlations between geophysical measurements and other field measurements; such as SPT, blow count values.
Cho, Ah-Jin; Park, Kee Chan; Kwon, Jang-Yeon
2015-01-01
For several years, graphene has been the focus of much attention due to its peculiar characteristics, and it is now considered to be a representative 2-dimensional (2D) material. Even though many research groups have studied on the graphene, its intrinsic nature of a zero band-gap, limits its use in practical applications, particularly in logic circuits. Recently, transition metal dichalcogenides (TMDs), which are another type of 2D material, have drawn attention due to the advantage of having a sizable band-gap and a high mobility. Here, we report on the design of a complementary inverter, one of the most basic logic elements, which is based on a MoS2 n-type transistor and a WSe2 p-type transistor. The advantages provided by the complementary metal-oxide-semiconductor (CMOS) configuration and the high-performance TMD channels allow us to fabricate a TMD complementary inverter that has a high-gain of 13.7. This work demonstrates the operation of the MoS2 n-FET and WSe2 p-FET on the same substrate, and the electrical performance of the CMOS inverter, which is based on a different driving current, is also measured.
Inkjet printed circuits based on ambipolar and p-type carbon nanotube thin-film transistors
Kim, Bongjun; Geier, Michael L.; Hersam, Mark C.; Dodabalapur, Ananth
2017-01-01
Ambipolar and p-type single-walled carbon nanotube (SWCNT) thin-film transistors (TFTs) are reliably integrated into various complementary-like circuits on the same substrate by inkjet printing. We describe the fabrication and characteristics of inverters, ring oscillators, and NAND gates based on complementary-like circuits fabricated with such TFTs as building blocks. We also show that complementary-like circuits have potential use as chemical sensors in ambient conditions since changes to the TFT characteristics of the p-channel TFTs in the circuit alter the overall operating characteristics of the circuit. The use of circuits rather than individual devices as sensors integrates sensing and signal processing functions, thereby simplifying overall system design. PMID:28145438
Iron Bioavailability and Provitamin A from Sweet Potato- and Cereal-Based Complementary Foods
Christides, Tatiana; Amagloh, Francis Kweku; Coad, Jane
2015-01-01
Iron and vitamin A deficiencies in childhood are public health problems in the developing world. Introduction of cereal-based complementary foods, that are often poor sources of both vitamin A and bioavailable iron, increases the risk of deficiency in young children. Alternative foods with higher levels of vitamin A and bioavailable iron could help alleviate these micronutrient deficiencies. The objective of this study was to compare iron bioavailability of β-carotene-rich sweet potato-based complementary foods (orange-flesh based sweet potato (OFSP) ComFa and cream-flesh sweet potato based (CFSP) ComFa with a household cereal-based complementary food (Weanimix) and a commercial cereal (Cerelac®), using the in vitro digestion/Caco-2 cell model. Iron bioavailability relative to total iron, concentrations of iron-uptake inhibitors (fibre, phytates, and polyphenols), and enhancers (ascorbic acid, ß-carotene and fructose) was also evaluated. All foods contained similar amounts of iron, but bioavailability varied: Cerelac® had the highest, followed by OFSP ComFa and Weanimix, which had equivalent bioavailable iron; CFSP ComFa had the lowest bioavailability. The high iron bioavailability from Cerelac® was associated with the highest levels of ascorbic acid, and the lowest levels of inhibitors; polyphenols appeared to limit sweet potato-based food iron bioavailability. Taken together, the results do not support that CFSP- and OFSP ComFa are better sources of bioavailable iron compared with non-commercial/household cereal-based weaning foods; however, they may be a good source of provitamin A in the form of β-carotene. PMID:28231217
2013-01-01
Background Exclusive breastfeeding (EBF) for the first six months of life is critical for the wellbeing of the child. In the mean while, timely initiation and starting nutritionally-adequate, safe, age-appropriate complementary feeding at six months is recommended for the better health and development of infants. According to the Ethiopian Demographic and Health Survey 2011, timely initiation of complementary feeding in Ethiopia at the 6th month was only 51%. The purpose of this study is to determine the magnitude of timely initiation of complementary feeding and associated factors in Mekelle town, Northern Ethiopia. Methods An institutional based cross-sectional study design was conducted among 422 mothers of infants aged from six months to one year selected from six public health facilities. Sample size proportional to the patient flow rate of each institution was allocated and systematic random sampling method was used to get the study participant. An exit interview using structured questionnaire was conducted about their experience on complementary feeding and related experience. The questionnaire was pretested among 21 mothers. Data were entered with EPI info version 3.5.1 and cleaning and analysis was done by using SPSS version 16. Frequencies distribution, binary and multiple logistic regressions were done. OR and 95% confidence interval was computed. Result The prevalence of timely initiation of complementary feeding at sixth month was 62.8% (265/422, 95% C.I: 58.1, 67.31%). Educational level, occupation of mother, parity, having ANC follow up, and birth preparedness were found to be independent predictor of timely initiation of complementary feeding. Conclusions Almost two-third of mothers initiated complementary feeding at six month of child’ age as recommended. This was relatively higher prevalence than most developing countries. However, significant proportion of mothers still did not initiate complementary feeding timely. Mothers who are illiterate and completed only primary school need more attention. All mothers must be encouraged to make antenatal care follow up. PMID:24195592
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Pérard, Marion; Mittring, Nadine; Schweiger, David; Kummer, Christopher; Witt, Claudia M
2015-06-09
Today, the increasing demand for complementary medicine encourages health care providers to adapt and create integrative medicine departments or services within clinics. However, because of their differing philosophies, historical development, and settings, merging the partners (conventional and complementary medicine) is often difficult. It is necessary to understand the similarities and differences in both cultures to support a successful and sustainable integration. The aim of this project was to develop a theoretical model and practical steps that are based on theories from mergers in business to facilitate the implementation of an integrative medicine department. Based on a literature search and expert discussions, the cultures were described and model domains were developed. These were applied to two case studies to develop the final model. Furthermore, a checklist with practical steps was devised. Conventional medicine and complementary medicine have developed different corporate cultures. The final model, which should help to foster integration by bridging between these cultures, is based on four overall aspects: culture, strategy, organizational tools and outcomes. Each culture is represented by three dimensions in the model: corporate philosophy (core and identity of the medicine and the clinic), patient (all characteristics of the professional team's contact with the patient), and professional team (the characteristics of the interactions within the professional team). Overall, corporate culture differs between conventional and complementary medicine; when planning the implementation of an integrative medicine department, the developed model and the checklist can support better integration.
Whitebird, Robin R; Kreitzer, Mary Jo; Lewis, Beth A; Hanson, Leah R; Crain, A Lauren; Enstad, Chris J; Mehta, Adele
2011-09-01
Caregivers for a family member with dementia experience chronic long-term stress that may benefit from new complementary therapies such as mindfulness-based stress reduction. Little is known however, about the challenges of recruiting and retaining family caregivers to research on mind-body based complementary therapies. Our pilot study is the first of its kind to successfully recruit caregivers for a family member with dementia to a randomized controlled pilot study of mindfulness-based stress reduction. The study used an array of recruitment strategies and techniques that were tailored to fit the unique features of our recruitment sources and employed retention strategies that placed high value on establishing early and ongoing communication with potential participants. Innovative recruitment methods including conducting outreach to health plan members and generating press coverage were combined with standard methods of community outreach and paid advertising. We were successful in exceeding our recruitment goal and retained 92% of the study participants at post-intervention (2 months) and 90% at 6 months. Recruitment and retention for family caregiver interventions employing mind-body based complementary therapies can be successful despite many challenges. Barriers include cultural perceptions about the use and benefit of complementary therapies, cultural differences with how the role of family caregiver is perceived, the use of group-based designs requiring significant time commitment by participants, and travel and respite care needs for busy family caregivers. Copyright © 2011 Elsevier Inc. All rights reserved.
Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J
1997-10-01
The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).
CCR4-NOT deadenylates mRNA associated with RNA-induced silencing complexes in human cells.
Piao, Xianghua; Zhang, Xue; Wu, Ligang; Belasco, Joel G
2010-03-01
MicroRNAs (miRNAs) repress gene expression posttranscriptionally by inhibiting translation and by expediting deadenylation so as to trigger rapid mRNA decay. Their regulatory influence is mediated by the protein components of the RNA-induced silencing complex (RISC), which deliver miRNAs and siRNAs to their mRNA targets. Here, we present evidence that CCR4-NOT is the deadenylase that removes poly(A) from messages destabilized by miRNAs in human cells. Overproducing a mutationally inactivated form of either of the catalytic subunits of this deadenylase (CCR4 or CAF1/POP2) significantly impedes the deadenylation and decay of mRNA targeted by a partially complementary miRNA. The same deadenylase initiates the degradation of "off-target" mRNAs that are bound by an imperfectly complementary siRNA introduced by transfection. The greater inhibitory effect of inactive CAF1 or POP2 (versus inactive CCR4) suggests a predominant role for this catalytic subunit of CCR4-NOT in miRNA- or small interfering RNA (siRNA)-mediated deadenylation. These effects of mi/siRNAs and CCR4-NOT can be fully reproduced by directly tethering RISC to mRNA without the guidance of a small RNA, indicating that the ability of RISC to accelerate deadenylation is independent of RNA base pairing. Despite its importance for mi/siRNA-mediated deadenylation, CCR4-NOT appears not to associate significantly with RISC, as judged by the failure of CAF1 and POP2 to coimmunoprecipitate detectably with either the Ago or TNRC6 subunit of RISC, a finding at odds with deadenylase recruitment as the mechanism by which RISC accelerates poly(A) removal.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
Hanessian, Stephen; Schroeder, Benjamin R; Merner, Bradley L; Chen, Bin; Swayze, Eric E; Seth, Punit P
2013-09-20
Two α-L-ribo-configured bicyclic nucleic acid modifications, represented by analogues 12 and 13, which are epimeric at C3' and C5' have been synthesized using a carbohydrate-based approach to build the bicyclic core structure. An intramolecular L-proline-mediated aldol reaction was employed to generate the cis-configured ring junction of analogue 12 and represents a rare application of this venerable organocatalytic reaction to a carbohydrate system. In the case of analogue 13, where a trans-ring junction was desired, an intermolecular diastereoselective Grignard reaction followed by ring-closing metathesis was used. In order to set the desired stereochemistry at the C5' positions of both nucleoside targets, a study of diastereoselective Lewis acid mediated allylation reactions on a common bicyclic aldehyde precursor was carried out. Analogue 12 was incorporated in oligonucleotide sequences, and thermal denaturation experiments indicate that it is destabilizing when paired with complementary DNA and RNA. However, this construct shows a significant improvement in nuclease stability relative to a DNA oligonucleotide.
Improved silencing properties using small internally segmented interfering RNAs
Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen
2007-01-01
RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057
Memristive crypto primitive for building highly secure physical unclonable functions
NASA Astrophysics Data System (ADS)
Gao, Yansong; Ranasinghe, Damith C.; Al-Sarawi, Said F.; Kavehei, Omid; Abbott, Derek
2015-08-01
Physical unclonable functions (PUFs) exploit the intrinsic complexity and irreproducibility of physical systems to generate secret information. The advantage is that PUFs have the potential to provide fundamentally higher security than traditional cryptographic methods by preventing the cloning of devices and the extraction of secret keys. Most PUF designs focus on exploiting process variations in Complementary Metal Oxide Semiconductor (CMOS) technology. In recent years, progress in nanoelectronic devices such as memristors has demonstrated the prevalence of process variations in scaling electronics down to the nano region. In this paper, we exploit the extremely large information density available in nanocrossbar architectures and the significant resistance variations of memristors to develop an on-chip memristive device based strong PUF (mrSPUF). Our novel architecture demonstrates desirable characteristics of PUFs, including uniqueness, reliability, and large number of challenge-response pairs (CRPs) and desirable characteristics of strong PUFs. More significantly, in contrast to most existing PUFs, our PUF can act as a reconfigurable PUF (rPUF) without additional hardware and is of benefit to applications needing revocation or update of secure key information.