Arrays of nucleic acid probes on biological chips
Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.
1998-11-17
DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.
NASA Astrophysics Data System (ADS)
Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein
2015-12-01
Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.
Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.
Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi
2003-03-01
A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.
Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong
2015-01-01
Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.
Orthogonal Polynomials Associated with Complementary Chain Sequences
NASA Astrophysics Data System (ADS)
Behera, Kiran Kumar; Sri Ranga, A.; Swaminathan, A.
2016-07-01
Using the minimal parameter sequence of a given chain sequence, we introduce the concept of complementary chain sequences, which we view as perturbations of chain sequences. Using the relation between these complementary chain sequences and the corresponding Verblunsky coefficients, the para-orthogonal polynomials and the associated Szegő polynomials are analyzed. Two illustrations, one involving Gaussian hypergeometric functions and the other involving Carathéodory functions are also provided. A connection between these two illustrations by means of complementary chain sequences is also observed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy
2014-10-09
A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.
Simulations Using Random-Generated DNA and RNA Sequences
ERIC Educational Resources Information Center
Bryce, C. F. A.
1977-01-01
Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.
Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza
2016-08-15
In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A
2014-03-01
The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel
2004-01-01
An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319
2013-01-01
Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545
ERIC Educational Resources Information Center
Karas, Timothy
2017-01-01
Through a case study approach of a cohort of community college students at a single community college, the impact on success rates in composition courses was analyzed based on the sequence of completing an information literacy course. Two student cohorts were sampled based on completing an information literacy course prior to, or concurrently with…
Kit for detecting nucleic acid sequences using competitive hybridization probes
Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.
2001-01-01
A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.
Deng, Jiajia; Toh, Chee-Seng
2013-06-17
A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.
Sequence-Selective Formation of Synthetic H-Bonded Duplexes
2017-01-01
Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.
Calvet, J P; Meyer, L M; Pederson, T
1982-07-30
Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.
Weaning Time in Preterm Infants: An Audit of Italian Primary Care Paediatricians.
Baldassarre, Maria Elisabetta; Di Mauro, Antonio; Pedico, Annarita; Rizzo, Valentina; Capozza, Manuela; Meneghin, Fabio; Lista, Gianluca; Laforgia, Nicola
2018-05-15
According to the 2016 Italian National Institute of Statistics (Istat) data in Italy, about 6.7% of all newborns are born prematurely. Due to the lack of data on current complementary feeding in preterm infants in Italy, the aim of the survey was to evaluate individual attitudes of primary care paediatricians, concerning the introduction of complementary foods in preterm infants. An internet-based survey was conducted among primary care paediatricians, working in Italy, regarding (1) timing of the introduction of complementary foods to preterm newborns; (2) type of complementary foods introduced; (3) vitamin D and iron supplementations. A total of 347 primary care Italian paediatricians answered the questionnaire; 44% of responders based the timing of the introduction of solid food exclusively on an infant's age, 18% on an infant's neurodevelopmental status and 4% on the body weight; the remaining 34% based the timing on two or more of these aspects. The type of complementary foods did not comply with an evidence-based sequence; 98% of participants promoted vitamin D supplementation and 89% promoted iron supplementation with great diversity in timing and doses. Due to limited evidence, there is a great heterogeneity in the attitudes of primary care paediatricians concerning the introduction of complementary foods to preterm newborns. Further research is needed to provide evidence-based guidelines regarding weaning preterm newborns.
Methods for chromosome-specific staining
Gray, Joe W.; Pinkel, Daniel
1995-01-01
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.
Rapid method to detect duplex formation in sequencing by hybridization methods
Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.
1999-01-19
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.
Rapid method to detect duplex formation in sequencing by hybridization methods
Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich
1999-01-01
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.
Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji
2015-01-01
Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad
2016-01-15
In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.
Methods for chromosome-specific staining
Gray, J.W.; Pinkel, D.
1995-09-05
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.
Methods and compositions for chromosome-specific staining
Gray, Joe W.; Pinkel, Daniel
2003-07-22
Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.
In situ hybridization in paracoccidioidomycosis.
De Brito, T; Sandhu, G S; Kline, B C; Aleff, R A; Sandoval, M P; Santos, R T; Brandão, A A; Lacaz, C S
1999-06-01
In situ hybridization (ISH) was performed using oral biopsies from patients with paracoccidioidomycosis and guinea pig testes inoculated with a culture of Paracoccidioides brasiliensis isolated from soil, employing both a 14 base-pair specific oligoprobe (ACT CCC CCG TGG TC) and its complementary sequence. When combining ISH with the Gridley stain which detects fungal cell walls, about 2-3% of the fungal cells present in the tissues were labelled. When the complementary probe was used, labelling was higher, reaching the 3% level.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-01-01
To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.
Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut
2012-02-01
A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.
Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.
2002-01-01
A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.
Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-11-20
We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.
Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy
2015-03-15
This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.
Patel, D J; Canuel, L L
1977-07-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.
Patel, Dinshaw J.; Canuel, Lita L.
1977-01-01
The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613
NASA Astrophysics Data System (ADS)
Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.
1984-08-01
A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.
Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi
2018-08-27
A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.
Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng
2013-09-07
We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.
Shariati, Mohsen
2018-05-15
In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures
Barth, Anna; Kobbe, Daniela; Focke, Manfred
2016-01-01
Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051
NASA Astrophysics Data System (ADS)
Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria
2015-10-01
In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.
Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo
2011-07-21
Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
ERIC Educational Resources Information Center
Militello, Kevin T.
2013-01-01
Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…
Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-12
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.
Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun
2008-03-15
This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.
Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.
2005-01-01
We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun
2016-12-15
A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid
Hardman, Norman
1974-01-01
Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
Miras, Manuel; Rodríguez-Hernández, Ana M; Romero-López, Cristina; Berzal-Herranz, Alfredo; Colchero, Jaime; Aranda, Miguel A; Truniger, Verónica
2018-01-01
In eukaryotes, the formation of a 5'-cap and 3'-poly(A) dependent protein-protein bridge is required for translation of its mRNAs. In contrast, several plant virus RNA genomes lack both of these mRNA features, but instead have a 3'-CITE (for cap-independent translation enhancer), a RNA element present in their 3'-untranslated region that recruits translation initiation factors and is able to control its cap-independent translation. For several 3'-CITEs, direct RNA-RNA long-distance interactions based on sequence complementarity between the 5'- and 3'-ends are required for efficient translation, as they bring the translation initiation factors bound to the 3'-CITE to the 5'-end. For the carmovirus melon necrotic spot virus (MNSV), a 3'-CITE has been identified, and the presence of its 5'-end in cis has been shown to be required for its activity. Here, we analyze the secondary structure of the 5'-end of the MNSV RNA genome and identify two highly conserved nucleotide sequence stretches that are complementary to the apical loop of its 3'-CITE. In in vivo cap-independent translation assays with mutant constructs, by disrupting and restoring sequence complementarity, we show that the interaction between the 3'-CITE and at least one complementary sequence in the 5'-end is essential for virus RNA translation, although efficient virus translation and multiplication requires both connections. The complementary sequence stretches are invariant in all MNSV isolates, suggesting that the dual 5'-3' RNA:RNA interactions are required for optimal MNSV cap-independent translation and multiplication.
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
ERIC Educational Resources Information Center
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Tramontano, A; Macchiato, M F
1986-01-01
An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761
Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L
2012-01-01
A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian
2010-07-01
In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.
Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers
Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.
2013-01-01
Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-01-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.
Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455
Single-Molecule Counting of Point Mutations by Transient DNA Binding
NASA Astrophysics Data System (ADS)
Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan
2017-03-01
High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.
DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.
Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S
2007-04-15
An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.
Progress in ion torrent semiconductor chip based sequencing.
Merriman, Barry; Rothberg, Jonathan M
2012-12-01
In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Giehr, Pascal; Walter, Jörn
2018-01-01
The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.
NASA Astrophysics Data System (ADS)
He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin
2015-09-01
In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.
Large scale DNA microsequencing device
Foote, Robert S.
1997-01-01
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.
Large scale DNA microsequencing device
Foote, Robert S.
1999-01-01
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.
Large scale DNA microsequencing device
Foote, R.S.
1999-08-31
A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.
probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016
Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas
2016-01-01
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel
2014-01-01
Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104
A nanophosphor-based method for selective DNA recovery in Synthosomes.
Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich
2006-01-01
A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Liang, Yunyun; Liu, Sanyang; Zhang, Shengli
2015-01-01
Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.
A statistical physics perspective on alignment-independent protein sequence comparison.
Chattopadhyay, Amit K; Nasiev, Diar; Flower, Darren R
2015-08-01
Within bioinformatics, the textual alignment of amino acid sequences has long dominated the determination of similarity between proteins, with all that implies for shared structure, function and evolutionary descent. Despite the relative success of modern-day sequence alignment algorithms, so-called alignment-free approaches offer a complementary means of determining and expressing similarity, with potential benefits in certain key applications, such as regression analysis of protein structure-function studies, where alignment-base similarity has performed poorly. Here, we offer a fresh, statistical physics-based perspective focusing on the question of alignment-free comparison, in the process adapting results from 'first passage probability distribution' to summarize statistics of ensemble averaged amino acid propensity values. In this article, we introduce and elaborate this approach. © The Author 2015. Published by Oxford University Press.
Guiding principles for peptide nanotechnology through directed discovery.
Lampel, A; Ulijn, R V; Tuttle, T
2018-05-21
Life's diverse molecular functions are largely based on only a small number of highly conserved building blocks - the twenty canonical amino acids. These building blocks are chemically simple, but when they are organized in three-dimensional structures of tremendous complexity, new properties emerge. This review explores recent efforts in the directed discovery of functional nanoscale systems and materials based on these same amino acids, but that are not guided by copying or editing biological systems. The review summarises insights obtained using three complementary approaches of searching the sequence space to explore sequence-structure relationships for assembly, reactivity and complexation, namely: (i) strategic editing of short peptide sequences; (ii) computational approaches to predicting and comparing assembly behaviours; (iii) dynamic peptide libraries that explore the free energy landscape. These approaches give rise to guiding principles on controlling order/disorder, complexation and reactivity by peptide sequence design.
USDA-ARS?s Scientific Manuscript database
A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...
Large scale DNA microsequencing device
Foote, R.S.
1997-08-26
A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.
Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.
2010-01-01
Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
High-Resolution Sequence-Function Mapping of Full-Length Proteins
Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.
2015-01-01
Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064
Rapid amplification of 5' complementary DNA ends (5' RACE).
2005-08-01
This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-05-01
Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-01-01
Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913
Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†
Liu, Yang; Rokita, Steven E.
2012-01-01
The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337
Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.
Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio
2018-05-03
RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.
Research on Image Encryption Based on DNA Sequence and Chaos Theory
NASA Astrophysics Data System (ADS)
Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin
2018-04-01
Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.
Circular RNAs: Unexpected outputs of many protein-coding genes
Wilusz, Jeremy E.
2017-01-01
ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori
2011-01-01
Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.
Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I
2013-01-01
Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.
Yang, Jianhua; Osman, Kim; Iqbal, Mudassar; Stekel, Dov J.; Luo, Zewei; Armstrong, Susan J.; Franklin, F. Chris H.
2013-01-01
Following successful completion of the Brassica rapa sequencing project, the next step is to investigate functions of individual genes/proteins. For Arabidopsis thaliana, large amounts of protein–protein interaction (PPI) data are available from the major PPI databases (DBs). It is known that Brassica crop species are closely related to A. thaliana. This provides an opportunity to infer the B. rapa interactome using PPI data available from A. thaliana. In this paper, we present an inferred B. rapa interactome that is based on the A. thaliana PPI data from two resources: (i) A. thaliana PPI data from three major DBs, BioGRID, IntAct, and TAIR. (ii) ortholog-based A. thaliana PPI predictions. Linking between B. rapa and A. thaliana was accomplished in three complementary ways: (i) ortholog predictions, (ii) identification of gene duplication based on synteny and collinearity, and (iii) BLAST sequence similarity search. A complementary approach was also applied, which used known/predicted domain–domain interaction data. Specifically, since the two species are closely related, we used PPI data from A. thaliana to predict interacting domains that might be conserved between the two species. The predicted interactome was investigated for the component that contains known A. thaliana meiotic proteins to demonstrate its usability. PMID:23293649
Li, Ying; Ji, Xiaoting; Song, Weiling; Guo, Yingshu
2013-04-03
A cross-circular amplification system for sensitive detection of adenosine triphosphate (ATP) in cancer cells was developed based on aptamer-target interaction, magnetic microbeads (MBs)-assisted strand displacement amplification and target recycling. Here we described a new recognition probe possessing two parts, the ATP aptamer and the extension part. The recognition probe was firstly immobilized on the surface of MBs and hybridized with its complementary sequence to form a duplex. When combined with ATP, the probe changed its conformation, revealing the extension part in single-strand form, which further served as a toehold for subsequent target recycling. The released complementary sequence of the probe acted as the catalyst of the MB-assisted strand displacement reaction. Incorporated with target recycling, a large amount of biotin-tagged MB complexes were formed to stimulate the generation of chemiluminescence (CL) signal in the presence of luminol and H2O2 by incorporating with streptavidin-HRP, reaching a detection limit of ATP as low as 6.1×10(-10)M. Moreover, sample assays of ATP in Ramos Burkitt's lymphoma B cells were performed, which confirmed the reliability and practicality of the protocol. Copyright © 2013 Elsevier B.V. All rights reserved.
Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.
Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping
2018-06-12
The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7 cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.
Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.
Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M
1987-01-01
Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929
Geranyl diphosphate synthase from mint
Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan
1999-01-01
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.
Geranyl diphosphate synthase from mint
Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.
1999-03-02
A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.
Urbarova, Ilona; Karlsen, Bård Ove; Okkenhaug, Siri; Seternes, Ole Morten; Johansen, Steinar D.; Emblem, Åse
2012-01-01
Marine bioprospecting is the search for new marine bioactive compounds and large-scale screening in extracts represents the traditional approach. Here, we report an alternative complementary protocol, called digital marine bioprospecting, based on deep sequencing of transcriptomes. We sequenced the transcriptomes from the adult polyp stage of two cold-water sea anemones, Bolocera tuediae and Hormathia digitata. We generated approximately 1.1 million quality-filtered sequencing reads by 454 pyrosequencing, which were assembled into approximately 120,000 contigs and 220,000 single reads. Based on annotation and gene ontology analysis we profiled the expressed mRNA transcripts according to known biological processes. As a proof-of-concept we identified polypeptide toxins with a potential blocking activity on sodium and potassium voltage-gated channels from digital transcriptome libraries. PMID:23170083
Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C
2015-09-11
Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.
Lee, Imchang; Chalita, Mauricio; Ha, Sung-Min; Na, Seong-In; Yoon, Seok-Hwan; Chun, Jongsik
2017-06-01
Thanks to the recent advancement of DNA sequencing technology, the cost and time of prokaryotic genome sequencing have been dramatically decreased. It has repeatedly been reported that genome sequencing using high-throughput next-generation sequencing is prone to contaminations due to its high depth of sequencing coverage. Although a few bioinformatics tools are available to detect potential contaminations, these have inherited limitations as they only use protein-coding genes. Here we introduce a new algorithm, called ContEst16S, to detect potential contaminations using 16S rRNA genes from genome assemblies. We screened 69 745 prokaryotic genomes from the NCBI Assembly Database using ContEst16S and found that 594 were contaminated by bacteria, human and plants. Of the predicted contaminated genomes, 8 % were not predicted by the existing protein-coding gene-based tool, implying that both methods can be complementary in the detection of contaminations. A web-based service of the algorithm is available at www.ezbiocloud.net/tools/contest16s.
DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.
Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason
2017-11-21
Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.
Circular codes revisited: a statistical approach.
Gonzalez, D L; Giannerini, S; Rosa, R
2011-04-21
In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.
Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng
2018-05-31
By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.
Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J
2017-01-11
We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.
Motif-based analysis of large nucleotide data sets using MEME-ChIP
Ma, Wenxiu; Noble, William S; Bailey, Timothy L
2014-01-01
MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928
Advanced surface-enhanced Raman gene probe systems and methods thereof
Vo-Dinh, Tuan
2001-01-01
The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.
Guzzi, Pietro Hiram; Milenkovic, Tijana
2018-05-01
Analogous to genomic sequence alignment that allows for across-species transfer of biological knowledge between conserved sequence regions, biological network alignment can be used to guide the knowledge transfer between conserved regions of molecular networks of different species. Hence, biological network alignment can be used to redefine the traditional notion of a sequence-based homology to a new notion of network-based homology. Analogous to genomic sequence alignment, there exist local and global biological network alignments. Here, we survey prominent and recent computational approaches of each network alignment type and discuss their (dis)advantages. Then, as it was recently shown that the two approach types are complementary, in the sense that they capture different slices of cellular functioning, we discuss the need to reconcile the two network alignment types and present a recent first step in this direction. We conclude with some open research problems on this topic and comment on the usefulness of network alignment in other domains besides computational biology.
Application of genetic algorithm in integrated setup planning and operation sequencing
NASA Astrophysics Data System (ADS)
Kafashi, Sajad; Shakeri, Mohsen
2011-01-01
Process planning is an essential component for linking design and manufacturing process. Setup planning and operation sequencing is two main tasks in process planning. Many researches solved these two problems separately. Considering the fact that the two functions are complementary, it is necessary to integrate them more tightly so that performance of a manufacturing system can be improved economically and competitively. This paper present a generative system and genetic algorithm (GA) approach to process plan the given part. The proposed approach and optimization methodology analyses the TAD (tool approach direction), tolerance relation between features and feature precedence relations to generate all possible setups and operations using workshop resource database. Based on these technological constraints the GA algorithm approach, which adopts the feature-based representation, optimizes the setup plan and sequence of operations using cost indices. Case study show that the developed system can generate satisfactory results in optimizing the setup planning and operation sequencing simultaneously in feasible condition.
Reiz, Bela; Li, Liang
2010-09-01
Controlled hydrolysis of proteins to generate peptide ladders combined with mass spectrometric analysis of the resultant peptides can be used for protein sequencing. In this paper, two methods of improving the microwave-assisted protein hydrolysis process are described to enable rapid sequencing of proteins containing disulfide bonds and increase sequence coverage, respectively. It was demonstrated that proteins containing disulfide bonds could be sequenced by MS analysis by first performing hydrolysis for less than 2 min, followed by 1 h of reduction to release the peptides originally linked by disulfide bonds. It was shown that a strong base could be used as a catalyst for microwave-assisted protein hydrolysis, producing complementary sequence information to that generated by microwave-assisted acid hydrolysis. However, using either acid or base hydrolysis, amide bond breakages in small regions of the polypeptide chains of the model proteins (e.g., cytochrome c and lysozyme) were not detected. Dynamic light scattering measurement of the proteins solubilized in an acid or base indicated that protein-protein interaction or aggregation was not the cause of the failure to hydrolyze certain amide bonds. It was speculated that there were some unknown local structures that might play a role in preventing an acid or base from reacting with the peptide bonds therein. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei
2016-10-01
A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.
de Bellocq, J Goüy; Leirs, H
2009-09-01
Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.
Yang, Cheng; Lates, Vasilica; Prieto-Simón, Beatriz; Marty, Jean-Louis; Yang, Xiurong
2013-11-15
We report a new label-free colorimetric aptasensor based on DNAzyme-aptamer conjugate for rapid and high-throughput detection of Ochratoxin A (OTA, a possible human carcinogen, group 2B) in wine. Two oligonucleotides were designed for this detection. One is N1 for biorecognition, which includes two adjacent sequences: the OTA-specific aptamer sequence and the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The other is a blocking DNA (B2), which is partially complementary to a part of the OTA aptamer and partially complementary to a part of the DNAzyme. The existence of OTA reduces the hybridization between N1 and B2. Thus, the activity of the non-hybridized DNAzyme is linearly correlated with the concentration of OTA up to 30 nM with a limit of detection of 4 nM (3σ). Meanwhile, a double liquid-liquid extraction (LLE) method is accordingly developed to purify OTA from wine. Compared with the existing HPLC-FD or immunoassay methods, the proposed strategy presents the most appropriate balance between accuracy and facility, resulting in a considerable improvement of real-time quality control, and thereby, preventing chronic poisoning caused by OTA contained red wine. Copyright © 2013 Elsevier B.V. All rights reserved.
Amarger, V; Mercier, L
1995-01-01
We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.
Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B
2018-07-01
Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.
Sayed, Nour; Jousselin, Ambre; Felden, Brice
2011-12-25
Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G
2007-01-01
Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.
Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU
1996-09-03
A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.
Saleh, Mona; El-Matbouli, Mansour
2015-06-01
Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.
Gambling on a shortcut to genome sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roberts, L.
1991-06-21
Almost from the start of the Human Genome Project, a debate has been raging over whether to sequence the entire human genome, all 3 billion bases, or just the genes - a mere 2% or 3% of the genome, and by far the most interesting part. In England, Sydney Brenner convinced the Medical Research Council (MRC) to start with the expressed genes, or complementary DNAs. But the US stance has been that the entire sequence is essential if we are to understand the blueprint of man. Craig Venter of the National Institute of Neurological Disorders and Stroke says that focusingmore » on the expressed genes may be even more useful than expected. His strategy involves randomly selecting clones from cDNA libraries which theoretically contain all the genes that are switched on at a particular time in a particular tissue. Then the researchers sequence just a short stretch of each clone, about 400 to 500 bases, to create can expressed sequence tag or EST. The sequences of these ESTs are then stored in a database. Using that information, other researchers can then recreate that EST by using polymerase chain reaction techniques.« less
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
He, Yaodong; Ma, Tiantian; Zhang, Xiaobo
2017-01-01
MicroRNAs (miRNAs), important factors in animal innate immunity, suppress the expressions of their target genes by binding to target mRNA’s 3′ untranslated regions (3′UTRs). However, the mechanism of synchronous regulation of multiple targets by a single miRNA remains unclear. In this study, the interaction between a white spot syndrome virus (WSSV) miRNA (WSSV-miR-N32) and its two viral targets (wsv459 and wsv322) was characterized in WSSV-infected shrimp. The outcomes indicated that WSSV-encoded miRNA (WSSV-miR-N32) significantly inhibited virus infection by simultaneously targeting wsv459 and wsv322. The silencing of wsv459 or wsv322 by siRNA led to significant decrease of WSSV copies in shrimp, showing that the two viral genes were required for WSSV infection. WSSV-miR-N32 could mediate 5′–3′ exonucleolytic digestion of its target mRNAs, which stopped at the sites of target mRNA 3′UTRs close to the sequence complementary to the miRNA seed sequence. The complementary bases (to the target mRNA sequence) of a miRNA 9th–18th non-seed sequence were essential for the miRNA targeting. Therefore, our findings presented novel insights into the mechanism of miRNA-mediated suppression of target gene expressions, which would be helpful for understanding the roles of miRNAs in innate immunity of invertebrate. PMID:29230209
Guilfoyle, Richard A.; Guo, Zhen
2001-01-01
A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.
Guilfoyle, Richard A.; Guo, Zhen
1999-01-01
A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.
Microchip method for the enrichment of specific DNA sequences
Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.
1998-12-22
A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.
Microchip method for the enrichment of specific DNA sequences
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna
1998-01-01
A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.
Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao
2012-03-01
CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.
An integrated semiconductor device enabling non-optical genome sequencing.
Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James
2011-07-20
The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.
Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.
2005-01-01
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487
Osmylated DNA, a novel concept for sequencing DNA using nanopores
NASA Astrophysics Data System (ADS)
Kanavarioti, Anastassia
2015-03-01
Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.
Generation of RNA in abiotic conditions.
NASA Astrophysics Data System (ADS)
di Mauro, Ernesto
Generation of RNA in abiotic conditions. Ernesto Di Mauro Dipartimento di Genetica Bi-ologia Molecolare, Universit` "Sapienza" Roma, Italy. a At least four conditions must be satisfied for the spontaneous generation of (pre)-genetic poly-mers: 1) availability of precursors that are activated enough to spontaneously polymerize. Preliminary studies showed that (a) nucleic bases and acyclonucleosides can be synthesized from formamide H2NCOH by simply heating with prebiotically available mineral catalysts [last reviewed in (1)], and that b) nucleic bases can be phosphorylated in every possible posi-tion [2'; 3'; 5'; cyclic 2',3'; cyclic 3',5' (2)]. The higher stability of the cyclic forms allows their accumulation. 2) A polymerization mechanism. A reaction showing the formation of RNA polymers starting from prebiotically plausible precursors (3',5' cyclic GMP and 3', 5'cyclic AMP) was recently reported (3). Polymerization in these conditions is thermodynamically up-hill and an equilibrium is attained that limits the maximum length of the polymer produced to about 40 nucleotides for polyG and 100 nucleotides for polyA. 3) Ligation of the synthesized oligomers. If this type of reaction could occur according to a terminal-joining mechanism and could generate canonical 3',5' phosphodiester bonds, exponential growth would be obtained of the generated oligomers. This type of reaction has been reported (4) , limited to homogeneous polyA sequences and leading to the production of polyA dimers and tetramers. What is still missing are: 4) mechanisms that provide the proof of principle for the generation of sequence complexity. We will show evidence for two mechanisms providing this proof of principle for simple complementary sequences. Namely: abiotic sequence complementary-driven terminal ligation and sequence-complementary terminal growth. In conclusion: all the steps leading to the generation of RNA in abiotic conditions are satisfied. (1) R Saladino, C Crestini, F. Ciciriello, S. Pino, G. Costanzo, E. Di Mauro. From formamide to RNA: the roles of formamide and water in the evolution of chemical information. Research In Microbiology, Special Issue on The Origin of life and Microbiology (2009) 160:441-448. (2) Costanzo, G., Saladino, R., Crestini, C., Ciciriello, F., and Di Mauro, E. Nucleoside phos-phorylation by phosphate minerals. J. Biol. Chem. (2007) 282: 16729-16735. (3) Samanta Pino, Fabiana Ciciriello, Giovanna Costanzo and E. Di Mauro, Nonenzymatic RNA Ligation in Water J. Biol. Chem. (2008), 283: 36494-36503 (4) Costanzo, G., Pino, S., Ciciriello, F., and Di Mauro, E. Generation of long RNA chains in water. J Biol Chem. (2009) 284:33206-33216.
Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu
2017-05-15
We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.
Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K
2004-01-01
The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.
Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, James Weifu; Meller, Amit
2007-01-01
Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, whichmore » looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.« less
2015-01-01
We previously developed reporter-peptide nucleic acid (PNA)-peptides for sequence-specific radioimaging and fluorescence imaging of particular mRNAs in cells and tumors. However, a direct test for PNA-peptide hybridization with RNA in the cytoplasm would be desirable. Thiazole orange (TO) dye at the 5′ end of a hybridization agent shows a strong increase in fluorescence quantum yield when stacked upon a 5′ terminal base pair, in solution and in cells. We hypothesized that hybridization agents with an internal TO could distinguish a single base mutation in RNA. Thus, we designed KRAS2 PNA-IGF1 tetrapeptide agents with an internal TO adjacent to the middle base of the 12th codon, a frequent site of cancer-initiating mutations. Our molecular dynamics calculations predicted a disordered bulge with weaker hybridization resulting from a single RNA mismatch. We observed that single-stranded PNA-IGF1 tetrapeptide agents with an internal TO showed low fluorescence, but fluorescence escalated 5–6-fold upon hybridization with KRAS2 RNA. Circular dichroism melting curves showed ∼10 °C higher Tm for fully complementary vs single base mismatch TO-PNA-peptide agent duplexes with KRAS2 RNA. Fluorescence measurements of treated human lung cancer cells similarly showed elevated cytoplasmic fluorescence intensity with fully complementary vs single base mismatch agents. Sequence-specific elevation of internal TO fluorescence is consistent with our hypothesis of detecting cytoplasmic PNA-peptide:RNA hybridization if a mutant agent encounters the corresponding mutant mRNA. PMID:25180641
Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.
Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y
1996-01-01
The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.
incaRNAfbinv: a web server for the fragment-based design of RNA sequences
Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny
2016-01-01
Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893
Jézéquel, Laetitia; Loeper, Jacqueline; Pompon, Denis
2008-11-01
Combinatorial libraries coding for mosaic enzymes with predefined crossover points constitute useful tools to address and model structure-function relationships and for functional optimization of enzymes based on multivariate statistics. The presented method, called sequence-independent generation of a chimera-ordered library (SIGNAL), allows easy shuffling of any predefined amino acid segment between two or more proteins. This method is particularly well adapted to the exchange of protein structural modules. The procedure could also be well suited to generate ordered combinatorial libraries independent of sequence similarities in a robotized manner. Sequence segments to be recombined are first extracted by PCR from a single-stranded template coding for an enzyme of interest using a biotin-avidin-based method. This technique allows the reduction of parental template contamination in the final library. Specific PCR primers allow amplification of two complementary mosaic DNA fragments, overlapping in the region to be exchanged. Fragments are finally reassembled using a fusion PCR. The process is illustrated via the construction of a set of mosaic CYP2B enzymes using this highly modular approach.
Misra, Arvind; Mishra, Satyendra; Misra, Krishna
2004-01-01
Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.
Single-primer fluorescent sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.
Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less
Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František
2018-05-09
The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Lyons, James; Dehzangi, Abdollah; Heffernan, Rhys; Sharma, Alok; Paliwal, Kuldip; Sattar, Abdul; Zhou, Yaoqi; Yang, Yuedong
2014-10-30
Because a nearly constant distance between two neighbouring Cα atoms, local backbone structure of proteins can be represented accurately by the angle between C(αi-1)-C(αi)-C(αi+1) (θ) and a dihedral angle rotated about the C(αi)-C(αi+1) bond (τ). θ and τ angles, as the representative of structural properties of three to four amino-acid residues, offer a description of backbone conformations that is complementary to φ and ψ angles (single residue) and secondary structures (>3 residues). Here, we report the first machine-learning technique for sequence-based prediction of θ and τ angles. Predicted angles based on an independent test have a mean absolute error of 9° for θ and 34° for τ with a distribution on the θ-τ plane close to that of native values. The average root-mean-square distance of 10-residue fragment structures constructed from predicted θ and τ angles is only 1.9Å from their corresponding native structures. Predicted θ and τ angles are expected to be complementary to predicted ϕ and ψ angles and secondary structures for using in model validation and template-based as well as template-free structure prediction. The deep neural network learning technique is available as an on-line server called Structural Property prediction with Integrated DEep neuRal network (SPIDER) at http://sparks-lab.org. Copyright © 2014 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Debon, Renaud; Le Guillou, Clara; Cauvin, Jean-Michel; Solaiman, Basel; Roux, Christian
2001-08-01
Medical domain makes intensive use of information fusion. In particular, the gastro-enterology is a discipline where physicians have the choice between several imagery modalities that offer complementary advantages. Among all existing systems, videoendoscopy (based on a CCD sensor) and echoendoscopy (based on an ultrasound sensor) are the most efficient. The use of each system corresponds to a given step in the physician diagnostic elaboration. Nowadays, several works aim to achieve automatic interpretation of videoendoscopic sequences. These systems can quantify color and superficial textures of the digestive tube. Unfortunately the relief information, which is important for the diagnostic, is very difficult to retrieve. On the other hand, some studies have proved that 3D information can be easily quantified using echoendoscopy image sequences. That is why the idea to combine these information, acquired from two very different points of view, can be considered as a real challenge for the medical image fusion topic. In this paper, after a review of actual works concerning numerical exploitation of videoendoscopy and echoendoscopy, the following question will be discussed: how can the use of complementary aspects of the different systems ease the automatic exploitation of videoendoscopy ? In a second time, we will evaluate the feasibility of the achievement of a realistic 3D reconstruction based both on information given by echoendoscopy (relief) and videoendoscopy (texture). Enumeration of potential applications of such a fusion system will then follow. Further discussions and perspectives will conclude this first study.
Mapping copy number variation by population-scale genome sequencing.
Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O
2011-02-03
Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.
Simple diazonium chemistry to develop specific gene sensing platforms.
Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E
2014-02-27
A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.
Simplified Identification of mRNA or DNA in Whole Cells
NASA Technical Reports Server (NTRS)
Almeida, Eduardo; Kadambi, Geeta
2007-01-01
A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.
The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation
NASA Astrophysics Data System (ADS)
Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.
1989-06-01
The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.
ConoDictor: a tool for prediction of conopeptide superfamilies.
Koua, Dominique; Brauer, Age; Laht, Silja; Kaplinski, Lauris; Favreau, Philippe; Remm, Maido; Lisacek, Frédérique; Stöcklin, Reto
2012-07-01
ConoDictor is a tool that enables fast and accurate classification of conopeptides into superfamilies based on their amino acid sequence. ConoDictor combines predictions from two complementary approaches-profile hidden Markov models and generalized profiles. Results appear in a browser as tables that can be downloaded in various formats. This application is particularly valuable in view of the exponentially increasing number of conopeptides that are being identified. ConoDictor was written in Perl using the common gateway interface module with a php submission page. Sequence matching is performed with hmmsearch from HMMER 3 and ps_scan.pl from the pftools 2.3 package. ConoDictor is freely accessible at http://conco.ebc.ee.
Brodie, Nicholas I; Huguet, Romain; Zhang, Terry; Viner, Rosa; Zabrouskov, Vlad; Pan, Jingxi; Petrotchenko, Evgeniy V; Borchers, Christoph H
2018-03-06
Top-down hydrogen-deuterium exchange (HDX) analysis using electron capture or transfer dissociation Fourier transform mass spectrometry (FTMS) is a powerful method for the analysis of secondary structure of proteins in solution. The resolution of the method is a function of the degree of fragmentation of backbone bonds in the proteins. While fragmentation is usually extensive near the N- and C-termini, electron capture (ECD) or electron transfer dissociation (ETD) fragmentation methods sometimes lack good coverage of certain regions of the protein, most often in the middle of the sequence. Ultraviolet photodissociation (UVPD) is a recently developed fast-fragmentation technique, which provides extensive backbone fragmentation that can be complementary in sequence coverage to the aforementioned electron-based fragmentation techniques. Here, we explore the application of electrospray ionization (ESI)-UVPD FTMS on an Orbitrap Fusion Lumos Tribrid mass spectrometer to top-down HDX analysis of proteins. We have incorporated UVPD-specific fragment-ion types and fragment-ion mixtures into our isotopic envelope fitting software (HDX Match) for the top-down HDX analysis. We have shown that UVPD data is complementary to ETD, thus improving the overall resolution when used as a combined approach.
Aparicio, Joaquín; Jiménez, Ana; Álvarez, Fernando J.; Ureña, Jesús; De Marziani, Carlos; Diego, Cristina
2011-01-01
The great variability usually found in underwater media makes modeling a challenging task, but helpful for better understanding or predicting the performance of future deployed systems. In this work, an underwater acoustic propagation model is presented. This model obtains the multipath structure by means of the ray tracing technique. Using this model, the behavior of a relative positioning system is presented. One of the main advantages of relative positioning systems is that only the distances between all the buoys are needed to obtain their positions. In order to obtain the distances, the propagation times of acoustic signals coded by Complementary Set of Sequences (CSS) are used. In this case, the arrival instants are obtained by means of correlation processes. The distances are then used to obtain the position of the buoys by means of the Multidimensional Scaling Technique (MDS). As an early example of an application using this relative positioning system, a tracking of the position of the buoys at different times is performed. With this tracking, the surface current of a particular region could be studied. The performance of the system is evaluated in terms of the distance from the real position to the estimated one. PMID:22247661
Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H
2016-12-01
Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2002-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna
2000-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.
Han, Kook; Tjaden, Brian; Lory, Stephen
2016-12-22
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.
Quantum dot-based microfluidic biosensor for cancer detection
NASA Astrophysics Data System (ADS)
Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar
2015-05-01
We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.
Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use
Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.
2001-04-03
Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J
2005-01-01
Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134
Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F
2013-02-15
Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.
Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus
NASA Astrophysics Data System (ADS)
Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.
2014-09-01
An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.
Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.
Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J
2008-10-15
The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.
ERIC Educational Resources Information Center
Fong, Kristen E.; Melguizo, Tatiana; Prather, George
2015-01-01
This study tracks students' progression through developmental math sequences and defines progression as both attempting and passing each level of the sequence. A model of successful progression in developmental education was built utilizing individual-, institutional-, and developmental math-level factors. Employing step-wise logistic regression…
The presence of codon-anticodon pairs in the acceptor stem of tRNAs.
Rodin, S; Rodin, A; Ohno, S
1996-01-01
A total of 1268 available (excluding mitochondrial) tRNA sequences was used to reconstruct the common consensus image of their acceptor domains. Its structure appeared as a 11-bp-long double-stranded palindrome with complementary triplets in the center, each flanked by the 3'-ACCD and NGGU-5' motifs on each strand (D, base determinator). The palindrome readily extends up to the modern tRNA-like cloverleaf passing through an intermediate hairpin having in the center the single-stranded triplet, in supplement to its double-stranded precursor. The latter might represent an original anticodon-codon pair mapped at 1-2-3 positions of the present-day tRNA acceptors. This conclusion is supported by the striking correlation: in pairs of consensus tRNAs with complementary anticodons, their bases at the 2nd position of the acceptor stem were also complementary. Accordingly, inverse complementarity was also evident at the 71st position of the acceptor stem. With a single exception (tRNA(Phe)-tRNA(Glu) pair), the parallelism is especially impressive for the pairs of tRNAs recognized by aminoacyl-tRNA synthetases (aaRS) from the opposite classes. The above complementarity still doubly presented at the key central position of real single-stranded anticodons and their hypothetical double-stranded precursors is consistent with our previous data pointing to the double-strand use of ancient RNAs in the origin of the main actors in translation- tRNAs with complementary anticodons and the two classes of aaRS. Images Fig. 3 Table 2 Fig. 4 PMID:8643439
A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences
Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.
2010-01-01
Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615
Controlling charge current through a DNA based molecular transistor
NASA Astrophysics Data System (ADS)
Behnia, S.; Fathizadeh, S.; Ziaei, J.
2017-01-01
Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.
Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin
2008-11-04
We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.
Self-complementary circular codes in coding theory.
Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz
2018-04-01
Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information
2008-09-22
the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell
A hybrid model based on neural networks for biomedical relation extraction.
Zhang, Yijia; Lin, Hongfei; Yang, Zhihao; Wang, Jian; Zhang, Shaowu; Sun, Yuanyuan; Yang, Liang
2018-05-01
Biomedical relation extraction can automatically extract high-quality biomedical relations from biomedical texts, which is a vital step for the mining of biomedical knowledge hidden in the literature. Recurrent neural networks (RNNs) and convolutional neural networks (CNNs) are two major neural network models for biomedical relation extraction. Neural network-based methods for biomedical relation extraction typically focus on the sentence sequence and employ RNNs or CNNs to learn the latent features from sentence sequences separately. However, RNNs and CNNs have their own advantages for biomedical relation extraction. Combining RNNs and CNNs may improve biomedical relation extraction. In this paper, we present a hybrid model for the extraction of biomedical relations that combines RNNs and CNNs. First, the shortest dependency path (SDP) is generated based on the dependency graph of the candidate sentence. To make full use of the SDP, we divide the SDP into a dependency word sequence and a relation sequence. Then, RNNs and CNNs are employed to automatically learn the features from the sentence sequence and the dependency sequences, respectively. Finally, the output features of the RNNs and CNNs are combined to detect and extract biomedical relations. We evaluate our hybrid model using five public (protein-protein interaction) PPI corpora and a (drug-drug interaction) DDI corpus. The experimental results suggest that the advantages of RNNs and CNNs in biomedical relation extraction are complementary. Combining RNNs and CNNs can effectively boost biomedical relation extraction performance. Copyright © 2018 Elsevier Inc. All rights reserved.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan
2008-05-01
Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.
Predicting PDZ domain mediated protein interactions from structure
2013-01-01
Background PDZ domains are structural protein domains that recognize simple linear amino acid motifs, often at protein C-termini, and mediate protein-protein interactions (PPIs) in important biological processes, such as ion channel regulation, cell polarity and neural development. PDZ domain-peptide interaction predictors have been developed based on domain and peptide sequence information. Since domain structure is known to influence binding specificity, we hypothesized that structural information could be used to predict new interactions compared to sequence-based predictors. Results We developed a novel computational predictor of PDZ domain and C-terminal peptide interactions using a support vector machine trained with PDZ domain structure and peptide sequence information. Performance was estimated using extensive cross validation testing. We used the structure-based predictor to scan the human proteome for ligands of 218 PDZ domains and show that the predictions correspond to known PDZ domain-peptide interactions and PPIs in curated databases. The structure-based predictor is complementary to the sequence-based predictor, finding unique known and novel PPIs, and is less dependent on training–testing domain sequence similarity. We used a functional enrichment analysis of our hits to create a predicted map of PDZ domain biology. This map highlights PDZ domain involvement in diverse biological processes, some only found by the structure-based predictor. Based on this analysis, we predict novel PDZ domain involvement in xenobiotic metabolism and suggest new interactions for other processes including wound healing and Wnt signalling. Conclusions We built a structure-based predictor of PDZ domain-peptide interactions, which can be used to scan C-terminal proteomes for PDZ interactions. We also show that the structure-based predictor finds many known PDZ mediated PPIs in human that were not found by our previous sequence-based predictor and is less dependent on training–testing domain sequence similarity. Using both predictors, we defined a functional map of human PDZ domain biology and predict novel PDZ domain function. Users may access our structure-based and previous sequence-based predictors at http://webservice.baderlab.org/domains/POW. PMID:23336252
Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use
Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.
2003-10-21
Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.
Mainardi, L T; Pattini, L; Cerutti, S
2007-01-01
A novel method is presented for the investigation of protein properties of sequences using Ramanujan Fourier Transform (RFT). The new methodology involves the preprocessing of protein sequence data by numerically encoding it and then applying the RFT. The RFT is based on projecting the obtained numerical series on a set of basis functions constituted by Ramanujan sums (RS). In RS components, periodicities of finite integer length, rather than frequency, (as in classical harmonic analysis) are considered. The potential of the new approach is documented by a few examples in the analysis of hydrophobic profiles of proteins in two classes including abundance of alpha-helices (group A) or beta-strands (group B). Different patterns are provided as evidence. RFT can be used to characterize the structural properties of proteins and integrate complementary information provided by other signal processing transforms.
Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua
2016-01-01
Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738
Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.
Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J
2010-04-01
Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.
Properties of an unusual DNA primase from an archaeal plasmid
Beck, Kirsten; Lipps, Georg
2007-01-01
Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343
Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F
1999-01-01
Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136
Method for identifying and quantifying nucleic acid sequence aberrations
Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.
1998-01-01
A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.
Method for identifying and quantifying nucleic acid sequence aberrations
Lucas, J.N.; Straume, T.; Bogen, K.T.
1998-07-21
A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.
Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.
Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed
2017-12-18
The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this effect is used for quantification of this food-borne pathogen.
Hibio, Naoki; Hino, Kimihiro; Shimizu, Eigo; Nagata, Yoshiro; Ui-Tei, Kumiko
2012-01-01
MicroRNAs (miRNAs) are key regulators of sequence-specific gene silencing. However, crucial factors that determine the efficacy of miRNA-mediated target gene silencing are poorly understood. Here we mathematized base-pairing stability and showed that miRNAs with an unstable 5′ terminal duplex and stable seed-target duplex exhibit strong silencing activity. The results are consistent with the previous findings that an RNA strand with unstable 5′ terminal in miRNA duplex easily loads onto the RNA-induced silencing complex (RISC), and miRNA recognizes target mRNAs with seed-complementary sequences to direct posttranscriptional repression. Our results suggested that both the unwinding and target recognition processes of miRNAs could be proficiently controlled by the thermodynamics of base-pairing in protein-free condition. Interestingly, such thermodynamic parameters might be evolutionarily well adapted to the body temperatures of various species. PMID:23251782
Boulila, Moncef
2010-06-01
To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.
Chen, Xin; Wu, Qiong; Sun, Ruimin; Zhang, Louxin
2012-01-01
The discovery of single-nucleotide polymorphisms (SNPs) has important implications in a variety of genetic studies on human diseases and biological functions. One valuable approach proposed for SNP discovery is based on base-specific cleavage and mass spectrometry. However, it is still very challenging to achieve the full potential of this SNP discovery approach. In this study, we formulate two new combinatorial optimization problems. While both problems are aimed at reconstructing the sample sequence that would attain the minimum number of SNPs, they search over different candidate sequence spaces. The first problem, denoted as SNP - MSP, limits its search to sequences whose in silico predicted mass spectra have all their signals contained in the measured mass spectra. In contrast, the second problem, denoted as SNP - MSQ, limits its search to sequences whose in silico predicted mass spectra instead contain all the signals of the measured mass spectra. We present an exact dynamic programming algorithm for solving the SNP - MSP problem and also show that the SNP - MSQ problem is NP-hard by a reduction from a restricted variation of the 3-partition problem. We believe that an efficient solution to either problem above could offer a seamless integration of information in four complementary base-specific cleavage reactions, thereby improving the capability of the underlying biotechnology for sensitive and accurate SNP discovery.
On site DNA barcoding by nanopore sequencing
Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo
2017-01-01
Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016
Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics
Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2015-01-01
The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165
DNA-COMPACT: DNA COMpression Based on a Pattern-Aware Contextual Modeling Technique
Li, Pinghao; Wang, Shuang; Kim, Jihoon; Xiong, Hongkai; Ohno-Machado, Lucila; Jiang, Xiaoqian
2013-01-01
Genome data are becoming increasingly important for modern medicine. As the rate of increase in DNA sequencing outstrips the rate of increase in disk storage capacity, the storage and data transferring of large genome data are becoming important concerns for biomedical researchers. We propose a two-pass lossless genome compression algorithm, which highlights the synthesis of complementary contextual models, to improve the compression performance. The proposed framework could handle genome compression with and without reference sequences, and demonstrated performance advantages over best existing algorithms. The method for reference-free compression led to bit rates of 1.720 and 1.838 bits per base for bacteria and yeast, which were approximately 3.7% and 2.6% better than the state-of-the-art algorithms. Regarding performance with reference, we tested on the first Korean personal genome sequence data set, and our proposed method demonstrated a 189-fold compression rate, reducing the raw file size from 2986.8 MB to 15.8 MB at a comparable decompression cost with existing algorithms. DNAcompact is freely available at https://sourceforge.net/projects/dnacompact/for research purpose. PMID:24282536
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
Röder, Christoph; König, Helmut; Fröhlich, Jürgen
2007-09-01
Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.
Huang, Lin; Wu, Jingjing; Zheng, Lei; Qian, Haisheng; Xue, Feng; Wu, Yucheng; Pan, Daodong; Adeloju, Samuel B; Chen, Wei
2013-11-19
A novel electrochemical aptasensor is described for rapid and ultrasensitive detection of ochratoxin A (OTA) based on signal enhancement with rolling circle amplification (RCA). The primer for RCA was designed to compose of a two-part sequence, one part of the aptamer sequence directed against OTA while the other part was complementary to the capture probe on the electrode surface. In the presence of target OTA, the primer, originally hybridized with the RCA padlock, is replaced to combine with OTA. This induces the inhibition of RCA and decreases the OTA sensing signal obtained with the electrochemical aptasensor. Under the optimized conditions, ultrasensitive detection of OTA was achieved with a limit of detection (LOD) of 0.065 ppt (pg/mL), which is much lower than previously reported. The electrochemical aptasensor was also successfully applied to the determination of OTA in wine samples. This ultrasensitive electrochemical aptasensor is of great practical importance in food safety and could be widely extended to the detection of other toxins by replacing the sequence of the recognition aptamer.
Intrinsic flexibility of B-DNA: the experimental TRX scale.
Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2010-01-01
B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
Computational clustering for viral reference proteomes
Chen, Chuming; Huang, Hongzhan; Mazumder, Raja; Natale, Darren A.; McGarvey, Peter B.; Zhang, Jian; Polson, Shawn W.; Wang, Yuqi; Wu, Cathy H.
2016-01-01
Motivation: The enormous number of redundant sequenced genomes has hindered efforts to analyze and functionally annotate proteins. As the taxonomy of viruses is not uniformly defined, viral proteomes pose special challenges in this regard. Grouping viruses based on the similarity of their proteins at proteome scale can normalize against potential taxonomic nomenclature anomalies. Results: We present Viral Reference Proteomes (Viral RPs), which are computed from complete virus proteomes within UniProtKB. Viral RPs based on 95, 75, 55, 35 and 15% co-membership in proteome similarity based clusters are provided. Comparison of our computational Viral RPs with UniProt’s curator-selected Reference Proteomes indicates that the two sets are consistent and complementary. Furthermore, each Viral RP represents a cluster of virus proteomes that was consistent with virus or host taxonomy. We provide BLASTP search and FTP download of Viral RP protein sequences, and a browser to facilitate the visualization of Viral RPs. Availability and implementation: http://proteininformationresource.org/rps/viruses/ Contact: chenc@udel.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153712
Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.
Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W
2005-01-01
Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.
Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2017-11-01
The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.
Teaching Note--Integrating Theory and Research Methods in a First-Year Doctoral Sequence or Program
ERIC Educational Resources Information Center
Pollio, David E.; MacNeil, Gordon; Womack, Bethany; Brazeal, Michelle; Church, Wesley T., II
2016-01-01
This teaching note describes an innovative process in which faculty members worked collaboratively to create an integrated three-course sequence of requisite course content in a PhD program, developed complementary assignments, and coordinated a classroom experience that led to the creation of an individualized area statement and eventual…
Moll, Karen M; Zhou, Peng; Ramaraj, Thiruvarangan; Fajardo, Diego; Devitt, Nicholas P; Sadowsky, Michael J; Stupar, Robert M; Tiffin, Peter; Miller, Jason R; Young, Nevin D; Silverstein, Kevin A T; Mudge, Joann
2017-08-04
Third generation sequencing technologies, with sequencing reads in the tens- of kilo-bases, facilitate genome assembly by spanning ambiguous regions and improving continuity. This has been critical for plant genomes, which are difficult to assemble due to high repeat content, gene family expansions, segmental and tandem duplications, and polyploidy. Recently, high-throughput mapping and scaffolding strategies have further improved continuity. Together, these long-range technologies enable quality draft assemblies of complex genomes in a cost-effective and timely manner. Here, we present high quality genome assemblies of the model legume plant, Medicago truncatula (R108) using PacBio, Dovetail Chicago (hereafter, Dovetail) and BioNano technologies. To test these technologies for plant genome assembly, we generated five assemblies using all possible combinations and ordering of these three technologies in the R108 assembly. While the BioNano and Dovetail joins overlapped, they also showed complementary gains in continuity and join numbers. Both technologies spanned repetitive regions that PacBio alone was unable to bridge. Combining technologies, particularly Dovetail followed by BioNano, resulted in notable improvements compared to Dovetail or BioNano alone. A combination of PacBio, Dovetail, and BioNano was used to generate a high quality draft assembly of R108, a M. truncatula accession widely used in studies of functional genomics. As a test for the usefulness of the resulting genome sequence, the new R108 assembly was used to pinpoint breakpoints and characterize flanking sequence of a previously identified translocation between chromosomes 4 and 8, identifying more than 22.7 Mb of novel sequence not present in the earlier A17 reference assembly. Adding Dovetail followed by BioNano data yielded complementary improvements in continuity over the original PacBio assembly. This strategy proved efficient and cost-effective for developing a quality draft assembly compared to traditional reference assemblies.
Quantum dot-based microfluidic biosensor for cancer detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli
2015-05-11
We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
An algorithm to compute the sequency ordered Walsh transform
NASA Technical Reports Server (NTRS)
Larsen, H.
1976-01-01
A fast sequency-ordered Walsh transform algorithm is presented; this sequency-ordered fast transform is complementary to the sequency-ordered fast Walsh transform introduced by Manz (1972) and eliminating gray code reordering through a modification of the basic fast Hadamard transform structure. The new algorithm retains the advantages of its complement (it is in place and is its own inverse), while differing in having a decimation-in time structure, accepting data in normal order, and returning the coefficients in bit-reversed sequency order. Applications include estimation of Walsh power spectra for a random process, sequency filtering and computing logical autocorrelations, and selective bit reversing.
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Paiva, Anthony M; Sheardy, Richard D
2005-04-20
The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.
FMLRC: Hybrid long read error correction using an FM-index.
Wang, Jeremy R; Holt, James; McMillan, Leonard; Jones, Corbin D
2018-02-09
Long read sequencing is changing the landscape of genomic research, especially de novo assembly. Despite the high error rate inherent to long read technologies, increased read lengths dramatically improve the continuity and accuracy of genome assemblies. However, the cost and throughput of these technologies limits their application to complex genomes. One solution is to decrease the cost and time to assemble novel genomes by leveraging "hybrid" assemblies that use long reads for scaffolding and short reads for accuracy. We describe a novel method leveraging a multi-string Burrows-Wheeler Transform with auxiliary FM-index to correct errors in long read sequences using a set of complementary short reads. We demonstrate that our method efficiently produces significantly more high quality corrected sequence than existing hybrid error-correction methods. We also show that our method produces more contiguous assemblies, in many cases, than existing state-of-the-art hybrid and long-read only de novo assembly methods. Our method accurately corrects long read sequence data using complementary short reads. We demonstrate higher total throughput of corrected long reads and a corresponding increase in contiguity of the resulting de novo assemblies. Improved throughput and computational efficiency than existing methods will help better economically utilize emerging long read sequencing technologies.
Song, Jiangning; Yuan, Zheng; Tan, Hao; Huber, Thomas; Burrage, Kevin
2007-12-01
Disulfide bonds are primary covalent crosslinks between two cysteine residues in proteins that play critical roles in stabilizing the protein structures and are commonly found in extracy-toplasmatic or secreted proteins. In protein folding prediction, the localization of disulfide bonds can greatly reduce the search in conformational space. Therefore, there is a great need to develop computational methods capable of accurately predicting disulfide connectivity patterns in proteins that could have potentially important applications. We have developed a novel method to predict disulfide connectivity patterns from protein primary sequence, using a support vector regression (SVR) approach based on multiple sequence feature vectors and predicted secondary structure by the PSIPRED program. The results indicate that our method could achieve a prediction accuracy of 74.4% and 77.9%, respectively, when averaged on proteins with two to five disulfide bridges using 4-fold cross-validation, measured on the protein and cysteine pair on a well-defined non-homologous dataset. We assessed the effects of different sequence encoding schemes on the prediction performance of disulfide connectivity. It has been shown that the sequence encoding scheme based on multiple sequence feature vectors coupled with predicted secondary structure can significantly improve the prediction accuracy, thus enabling our method to outperform most of other currently available predictors. Our work provides a complementary approach to the current algorithms that should be useful in computationally assigning disulfide connectivity patterns and helps in the annotation of protein sequences generated by large-scale whole-genome projects. The prediction web server and Supplementary Material are accessible at http://foo.maths.uq.edu.au/~huber/disulfide
Secondary Structure Predictions for Long RNA Sequences Based on Inversion Excursions and MapReduce.
Yehdego, Daniel T; Zhang, Boyu; Kodimala, Vikram K R; Johnson, Kyle L; Taufer, Michela; Leung, Ming-Ying
2013-05-01
Secondary structures of ribonucleic acid (RNA) molecules play important roles in many biological processes including gene expression and regulation. Experimental observations and computing limitations suggest that we can approach the secondary structure prediction problem for long RNA sequences by segmenting them into shorter chunks, predicting the secondary structures of each chunk individually using existing prediction programs, and then assembling the results to give the structure of the original sequence. The selection of cutting points is a crucial component of the segmenting step. Noting that stem-loops and pseudoknots always contain an inversion, i.e., a stretch of nucleotides followed closely by its inverse complementary sequence, we developed two cutting methods for segmenting long RNA sequences based on inversion excursions: the centered and optimized method. Each step of searching for inversions, chunking, and predictions can be performed in parallel. In this paper we use a MapReduce framework, i.e., Hadoop, to extensively explore meaningful inversion stem lengths and gap sizes for the segmentation and identify correlations between chunking methods and prediction accuracy. We show that for a set of long RNA sequences in the RFAM database, whose secondary structures are known to contain pseudoknots, our approach predicts secondary structures more accurately than methods that do not segment the sequence, when the latter predictions are possible computationally. We also show that, as sequences exceed certain lengths, some programs cannot computationally predict pseudoknots while our chunking methods can. Overall, our predicted structures still retain the accuracy level of the original prediction programs when compared with known experimental secondary structure.
NASA Astrophysics Data System (ADS)
Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao
2015-02-01
In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.
Automatic detection of pelvic lymph nodes using multiple MR sequences
NASA Astrophysics Data System (ADS)
Yan, Michelle; Lu, Yue; Lu, Renzhi; Requardt, Martin; Moeller, Thomas; Takahashi, Satoru; Barentsz, Jelle
2007-03-01
A system for automatic detection of pelvic lymph nodes is developed by incorporating complementary information extracted from multiple MR sequences. A single MR sequence lacks sufficient diagnostic information for lymph node localization and staging. Correct diagnosis often requires input from multiple complementary sequences which makes manual detection of lymph nodes very labor intensive. Small lymph nodes are often missed even by highly-trained radiologists. The proposed system is aimed at assisting radiologists in finding lymph nodes faster and more accurately. To the best of our knowledge, this is the first such system reported in the literature. A 3-dimensional (3D) MR angiography (MRA) image is employed for extracting blood vessels that serve as a guide in searching for pelvic lymph nodes. Segmentation, shape and location analysis of potential lymph nodes are then performed using a high resolution 3D T1-weighted VIBE (T1-vibe) MR sequence acquired by Siemens 3T scanner. An optional contrast-agent enhanced MR image, such as post ferumoxtran-10 T2*-weighted MEDIC sequence, can also be incorporated to further improve detection accuracy of malignant nodes. The system outputs a list of potential lymph node locations that are overlaid onto the corresponding MR sequences and presents them to users with associated confidence levels as well as their sizes and lengths in each axis. Preliminary studies demonstrates the feasibility of automatic lymph node detection and scenarios in which this system may be used to assist radiologists in diagnosis and reporting.
Transcription and translation in an RNA world
Taylor, William R
2006-01-01
The RNA world hypothesis requires a ribozyme that was an RNA-directed RNA polymerase (ribopolymerase). If such a replicase makes a reverse complementary copy of any sequence (including itself), in a simple RNA world, there is no mechanism to prevent self-hybridization. It is proposed that this can be avoided through the synthesis of a parallel complementary copy. The logical consequences of this are pursued and developed in a computer simulation, where the behaviour of the parallel copy is compared to the conventional reverse complementary copy. It is found that the parallel copy is more efficient at higher temperatures (up to 90°C). A model for the ribopolymerase, based on the core of the large subunit (LSU) of the ribosome, is described. The geometry of a potential active site for this ribopolymerase suggests that it contained a cavity (now occupied by the aminoacyl-tRNA) and that an amino acid binding in this might have ‘poisoned’ the ribopolymerase by cross-reacting with the nucleoside-triphosphate before polymerization could occur. Based on a similarity to the active site components of the class-I tRNA synthetase enzymes, it is proposed that the amino acid could become attached to the nascent RNA transcript producing a variety of aminoacylated tRNA-like products. Using base-pairing interactions, some of these molecules might cross-link two ribopolymerases, giving rise to a precursor of the modern ribosome. A hybrid dimer, half polymerase and half proto-ribosome, could account for mRNA translocation before the advent of protein elongation factors. PMID:17008216
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Saunders, K; Lucy, A; Stanley, J
1992-01-01
The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192
Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali
2016-10-01
The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.
Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same
Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.
1999-01-19
The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.
Xia, Jiaqi; Peng, Zhenling; Qi, Dawei; Mu, Hongbo; Yang, Jianyi
2017-03-15
Protein fold classification is a critical step in protein structure prediction. There are two possible ways to classify protein folds. One is through template-based fold assignment and the other is ab-initio prediction using machine learning algorithms. Combination of both solutions to improve the prediction accuracy was never explored before. We developed two algorithms, HH-fold and SVM-fold for protein fold classification. HH-fold is a template-based fold assignment algorithm using the HHsearch program. SVM-fold is a support vector machine-based ab-initio classification algorithm, in which a comprehensive set of features are extracted from three complementary sequence profiles. These two algorithms are then combined, resulting to the ensemble approach TA-fold. We performed a comprehensive assessment for the proposed methods by comparing with ab-initio methods and template-based threading methods on six benchmark datasets. An accuracy of 0.799 was achieved by TA-fold on the DD dataset that consists of proteins from 27 folds. This represents improvement of 5.4-11.7% over ab-initio methods. After updating this dataset to include more proteins in the same folds, the accuracy increased to 0.971. In addition, TA-fold achieved >0.9 accuracy on a large dataset consisting of 6451 proteins from 184 folds. Experiments on the LE dataset show that TA-fold consistently outperforms other threading methods at the family, superfamily and fold levels. The success of TA-fold is attributed to the combination of template-based fold assignment and ab-initio classification using features from complementary sequence profiles that contain rich evolution information. http://yanglab.nankai.edu.cn/TA-fold/. yangjy@nankai.edu.cn or mhb-506@163.com. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Understanding the mechanisms of protein-DNA interactions
NASA Astrophysics Data System (ADS)
Lavery, Richard
2004-03-01
Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.
NASA Astrophysics Data System (ADS)
Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia
2016-10-01
In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.
Pyrosequencing for Microbial Identification and Characterization
Cummings, Patrick J.; Ahmed, Ray; Durocher, Jeffrey A.; Jessen, Adam; Vardi, Tamar; Obom, Kristina M.
2013-01-01
Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns. PMID:23995536
Pyrosequencing for microbial identification and characterization.
Cummings, Patrick J; Ahmed, Ray; Durocher, Jeffrey A; Jessen, Adam; Vardi, Tamar; Obom, Kristina M
2013-08-22
Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.
2014-01-01
Background Leptotrombidium pallidum and Leptotrombidium scutellare are the major vector mites for Orientia tsutsugamushi, the causative agent of scrub typhus. Before these organisms can be subjected to whole-genome sequencing, it is necessary to estimate their genome sizes to obtain basic information for establishing the strategies that should be used for genome sequencing and assembly. Method The genome sizes of L. pallidum and L. scutellare were estimated by a method based on quantitative real-time PCR. In addition, a k-mer analysis of the whole-genome sequences obtained through Illumina sequencing was conducted to verify the mutual compatibility and reliability of the results. Results The genome sizes estimated using qPCR were 191 ± 7 Mb for L. pallidum and 262 ± 13 Mb for L. scutellare. The k-mer analysis-based genome lengths were estimated to be 175 Mb for L. pallidum and 286 Mb for L. scutellare. The estimates from these two independent methods were mutually complementary and within a similar range to those of other Acariform mites. Conclusions The estimation method based on qPCR appears to be a useful alternative when the standard methods, such as flow cytometry, are impractical. The relatively small estimated genome sizes should facilitate whole-genome analysis, which could contribute to our understanding of Arachnida genome evolution and provide key information for scrub typhus prevention and mite vector competence. PMID:24947244
An Evidence-Based Course in Complementary Medicines
Hughes, Jeff
2012-01-01
Objective. To evaluate the impact of an evidence-based course in complementary medicines on the attitudes, knowledge, and professional practice behavior of undergraduate pharmacy students. Design. A required 12-week evidence-based complementary medicine course was designed and introduced into the third-year undergraduate pharmacy curriculum. The course included a combination of traditional lectures, interactive tutorial sessions, and a range of formal assessments. Assessment. Pre- and post-course survey instruments were administered to assess changes in students’ attitudes, perceptions, knowledge, and the likelihood they would recommend the use of complementary medicines in a pharmacy practice environment. Conclusion. Completion of a required evidence-based complementary medicines course resulted in a positive change in pharmacy students’ perceptions of the value of various complementary medicines as well as in their willingness to recommend them, and provided students with the required knowledge to make patient-centered recommendations for use of complementary medicines in a professional pharmacy practice setting. These findings support the need for greater evidence-based complementary medicine education within pharmacy curricula to meet consumer demand and to align with pharmacists’ professional responsibilities. PMID:23275665
Molecular sequence data of hepatitis B virus and genetic diversity after vaccination.
van Ballegooijen, W Marijn; van Houdt, Robin; Bruisten, Sylvia M; Boot, Hein J; Coutinho, Roel A; Wallinga, Jacco
2009-12-15
The effect of vaccination programs on transmission of infectious disease is usually assessed by monitoring programs that rely on notifications of symptomatic illness. For monitoring of infectious diseases with a high proportion of asymptomatic cases or a low reporting rate, molecular sequence data combined with modern coalescent-based techniques offer a complementary tool to assess transmission. Here, the authors investigate the added value of using viral sequence data to monitor a vaccination program that was started in 1998 and was targeted against hepatitis B virus in men who have sex with men in Amsterdam, the Netherlands. The incidence in this target group, as estimated from the notifications of acute infections with hepatitis B virus, was low; therefore, there was insufficient power to show a significant change in incidence. In contrast, the genetic diversity, as estimated from the viral sequence collected from the target group, revealed a marked decrease after vaccination was introduced. Taken together, the findings suggest that introduction of vaccination coincided with a change in the target group toward behavior with a higher risk of infection. The authors argue that molecular sequence data provide a powerful additional monitoring instrument, next to conventional case registration, for assessing the impact of vaccination.
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
A sequence-based hybrid predictor for identifying conformationally ambivalent regions in proteins.
Liu, Yu-Cheng; Yang, Meng-Han; Lin, Win-Li; Huang, Chien-Kang; Oyang, Yen-Jen
2009-12-03
Proteins are dynamic macromolecules which may undergo conformational transitions upon changes in environment. As it has been observed in laboratories that protein flexibility is correlated to essential biological functions, scientists have been designing various types of predictors for identifying structurally flexible regions in proteins. In this respect, there are two major categories of predictors. One category of predictors attempts to identify conformationally flexible regions through analysis of protein tertiary structures. Another category of predictors works completely based on analysis of the polypeptide sequences. As the availability of protein tertiary structures is generally limited, the design of predictors that work completely based on sequence information is crucial for advances of molecular biology research. In this article, we propose a novel approach to design a sequence-based predictor for identifying conformationally ambivalent regions in proteins. The novelty in the design stems from incorporating two classifiers based on two distinctive supervised learning algorithms that provide complementary prediction powers. Experimental results show that the overall performance delivered by the hybrid predictor proposed in this article is superior to the performance delivered by the existing predictors. Furthermore, the case study presented in this article demonstrates that the proposed hybrid predictor is capable of providing the biologists with valuable clues about the functional sites in a protein chain. The proposed hybrid predictor provides the users with two optional modes, namely, the high-sensitivity mode and the high-specificity mode. The experimental results with an independent testing data set show that the proposed hybrid predictor is capable of delivering sensitivity of 0.710 and specificity of 0.608 under the high-sensitivity mode, while delivering sensitivity of 0.451 and specificity of 0.787 under the high-specificity mode. Though experimental results show that the hybrid approach designed to exploit the complementary prediction powers of distinctive supervised learning algorithms works more effectively than conventional approaches, there exists a large room for further improvement with respect to the achieved performance. In this respect, it is of interest to investigate the effects of exploiting additional physiochemical properties that are related to conformational ambivalence. Furthermore, it is of interest to investigate the effects of incorporating lately-developed machine learning approaches, e.g. the random forest design and the multi-stage design. As conformational transition plays a key role in carrying out several essential types of biological functions, the design of more advanced predictors for identifying conformationally ambivalent regions in proteins deserves our continuous attention.
Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong
2010-01-01
Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.
İnce, İkbal Agah; Pijlman, Gorben P; Vlak, Just M; van Oers, Monique M
2017-11-01
Previously, we observed that the transcripts of Invertebrate iridescent virus 6 (IIV6) are not polyadenylated, in line with the absence of canonical poly(A) motifs (AATAAA) downstream of the open reading frames (ORFs) in the genome. Here, we determined the 3' ends of the transcripts of fifty-four IIV6 virion protein genes in infected Drosophila Schneider 2 (S2) cells. By using ligation-based amplification of cDNA ends (LACE) it was shown that the IIV6 mRNAs often ended with a CAUUA motif. In silico analysis showed that the 3'-untranslated regions of IIV6 genes have the ability to form hairpin structures (22-56 nt in length) and that for about half of all IIV6 genes these 3' sequences contained complementary TAATG and CATTA motifs. We also show that a hairpin in the 3' flanking region with conserved sequence motifs is a conserved feature in invertebrate-infecting iridoviruses (genus Iridovirus and Chloriridovirus). Copyright © 2017 Elsevier Inc. All rights reserved.
Mechanism of foreign DNA selection in a bacterial adaptive immune system
Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.
2012-01-01
Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690
Shoja, Yalda; Kermanpur, Ahmad; Karimzadeh, Fathallah
2018-08-15
In this present work we made a novel, fast, selective and sensitive electrochemical genobiosensor to detection of EGFR exon 21 point mutation based on two step electropolymerization of Ni(II)-oxytetracycline conducting metallopolymer nanoparticles (Ni-OTC NPs) on the surface of pencil graphite electrode (PGE) which was modified by reduced graphene oxide/carboxyl functionalized ordered mesoporous carbon (rGO/f-OMC) nanocomposite. ssDNA capture probe with amine groups at the5' end which applied as recognition element was immobilized on the rGO/f-OMC/PGE surface via the strong amide bond. Ni-OTC metallopolymer NPs were electropolymerized to rGO/ssDNA-OMC/PGE surface and then hybridization fallows through the peak current change in differential pulse voltammetry (DPV) using Ni-OTC NPs as a redox label. The biosensor was characterized by field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), FT-IR spectroscopy, energy dispersive X-ray spectroscopy (EDX), cyclic voltammetry and Nitrogen adsorption-desorption analysis. The Ni-OTC current response verified only the complementary sequence indicating a significant reduction current signal in comparison to single point mismatched and non-complementary and sequences. Under optimal conditions, the prepared biosensor showed long-term stability (21 days) with a wide linear range from 0.1 µM to 3 µM with high sensitivity (0.0188 mA/µM) and low detection limit (120 nM). Copyright © 2018 Elsevier B.V. All rights reserved.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.
Cui, Chenghua; Shu, Wei; Li, Peining
2016-01-01
Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c
HLA genotyping by next-generation sequencing of complementary DNA.
Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya
2017-11-28
Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.
Exploration of the relationship between topology and designability of conformations
NASA Astrophysics Data System (ADS)
Leelananda, Sumudu P.; Towfic, Fadi; Jernigan, Robert L.; Kloczkowski, Andrzej
2011-06-01
Protein structures are evolutionarily more conserved than sequences, and sequences with very low sequence identity frequently share the same fold. This leads to the concept of protein designability. Some folds are more designable and lots of sequences can assume that fold. Elucidating the relationship between protein sequence and the three-dimensional (3D) structure that the sequence folds into is an important problem in computational structural biology. Lattice models have been utilized in numerous studies to model protein folds and predict the designability of certain folds. In this study, all possible compact conformations within a set of two-dimensional and 3D lattice spaces are explored. Complementary interaction graphs are then generated for each conformation and are described using a set of graph features. The full HP sequence space for each lattice model is generated and contact energies are calculated by threading each sequence onto all the possible conformations. Unique conformation giving minimum energy is identified for each sequence and the number of sequences folding to each conformation (designability) is obtained. Machine learning algorithms are used to predict the designability of each conformation. We find that the highly designable structures can be distinguished from other non-designable conformations based on certain graphical geometric features of the interactions. This finding confirms the fact that the topology of a conformation is an important determinant of the extent of its designability and suggests that the interactions themselves are important for determining the designability.
Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.
Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R
2018-03-25
The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook
2014-09-03
A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less
Detection of bacterial 16S rRNA using a molecular beacon-based X sensor
Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.
2012-01-01
We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
McWilliams, D; Callahan, R C; Boime, I
1977-01-01
A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681
Contour Tracking in Echocardiographic Sequences via Sparse Representation and Dictionary Learning
Huang, Xiaojie; Dione, Donald P.; Compas, Colin B.; Papademetris, Xenophon; Lin, Ben A.; Bregasi, Alda; Sinusas, Albert J.; Staib, Lawrence H.; Duncan, James S.
2013-01-01
This paper presents a dynamical appearance model based on sparse representation and dictionary learning for tracking both endocardial and epicardial contours of the left ventricle in echocardiographic sequences. Instead of learning offline spatiotemporal priors from databases, we exploit the inherent spatiotemporal coherence of individual data to constraint cardiac contour estimation. The contour tracker is initialized with a manual tracing of the first frame. It employs multiscale sparse representation of local image appearance and learns online multiscale appearance dictionaries in a boosting framework as the image sequence is segmented frame-by-frame sequentially. The weights of multiscale appearance dictionaries are optimized automatically. Our region-based level set segmentation integrates a spectrum of complementary multilevel information including intensity, multiscale local appearance, and dynamical shape prediction. The approach is validated on twenty-six 4D canine echocardiographic images acquired from both healthy and post-infarct canines. The segmentation results agree well with expert manual tracings. The ejection fraction estimates also show good agreement with manual results. Advantages of our approach are demonstrated by comparisons with a conventional pure intensity model, a registration-based contour tracker, and a state-of-the-art database-dependent offline dynamical shape model. We also demonstrate the feasibility of clinical application by applying the method to four 4D human data sets. PMID:24292554
Yanik, Mert; Ponnam, Surya Prakash Goud; Wimmer, Tobias; Trimborn, Lennart; Müller, Carina; Gambert, Isabel; Ginsberg, Johanna; Janise, Annabella; Domicke, Janina; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut
2018-06-01
Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs
Lee, Alex H. F.; Kool, Eric T.
2008-01-01
A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396
Passenger strand loading in overexpression experiments using microRNA mimics.
Søkilde, Rolf; Newie, Inga; Persson, Helena; Borg, Åke; Rovira, Carlos
2015-01-01
MicroRNAs (miRNAs) are important regulators of gene function and manipulation of miRNAs is a central component of basic research. Modulation of gene expression by miRNA gain-of-function can be based on different approaches including transfection with miRNA mimics; artificial, chemically modified miRNA-like small RNAs. These molecules are intended to mimic the function of a miRNA guide strand while bypassing the maturation steps of endogenous miRNAs. Due to easy accessibility through commercial providers this approach has gained popularity, and accuracy is often assumed without prior independent testing. Our in silico analysis of over-represented sequence motifs in microarray expression data and sequencing of AGO-associated small RNAs indicate, however, that miRNA mimics may be associated with considerable side-effects due to the unwanted activity of the miRNA mimic complementary strand.
Network-based function prediction and interactomics: the case for metabolic enzymes.
Janga, S C; Díaz-Mejía, J Javier; Moreno-Hagelsieb, G
2011-01-01
As sequencing technologies increase in power, determining the functions of unknown proteins encoded by the DNA sequences so produced becomes a major challenge. Functional annotation is commonly done on the basis of amino-acid sequence similarity alone. Long after sequence similarity becomes undetectable by pair-wise comparison, profile-based identification of homologs can often succeed due to the conservation of position-specific patterns, important for a protein's three dimensional folding and function. Nevertheless, prediction of protein function from homology-driven approaches is not without problems. Homologous proteins might evolve different functions and the power of homology detection has already started to reach its maximum. Computational methods for inferring protein function, which exploit the context of a protein in cellular networks, have come to be built on top of homology-based approaches. These network-based functional inference techniques provide both a first hand hint into a proteins' functional role and offer complementary insights to traditional methods for understanding the function of uncharacterized proteins. Most recent network-based approaches aim to integrate diverse kinds of functional interactions to boost both coverage and confidence level. These techniques not only promise to solve the moonlighting aspect of proteins by annotating proteins with multiple functions, but also increase our understanding on the interplay between different functional classes in a cell. In this article we review the state of the art in network-based function prediction and describe some of the underlying difficulties and successes. Given the volume of high-throughput data that is being reported the time is ripe to employ these network-based approaches, which can be used to unravel the functions of the uncharacterized proteins accumulating in the genomic databases. © 2010 Elsevier Inc. All rights reserved.
Modularity of Protein Folds as a Tool for Template-Free Modeling of Structures.
Vallat, Brinda; Madrid-Aliste, Carlos; Fiser, Andras
2015-08-01
Predicting the three-dimensional structure of proteins from their amino acid sequences remains a challenging problem in molecular biology. While the current structural coverage of proteins is almost exclusively provided by template-based techniques, the modeling of the rest of the protein sequences increasingly require template-free methods. However, template-free modeling methods are much less reliable and are usually applicable for smaller proteins, leaving much space for improvement. We present here a novel computational method that uses a library of supersecondary structure fragments, known as Smotifs, to model protein structures. The library of Smotifs has saturated over time, providing a theoretical foundation for efficient modeling. The method relies on weak sequence signals from remotely related protein structures to create a library of Smotif fragments specific to the target protein sequence. This Smotif library is exploited in a fragment assembly protocol to sample decoys, which are assessed by a composite scoring function. Since the Smotif fragments are larger in size compared to the ones used in other fragment-based methods, the proposed modeling algorithm, SmotifTF, can employ an exhaustive sampling during decoy assembly. SmotifTF successfully predicts the overall fold of the target proteins in about 50% of the test cases and performs competitively when compared to other state of the art prediction methods, especially when sequence signal to remote homologs is diminishing. Smotif-based modeling is complementary to current prediction methods and provides a promising direction in addressing the structure prediction problem, especially when targeting larger proteins for modeling.
Han, Kook; Tjaden, Brian; Lory, Stephen
2017-01-01
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Pancer, Katarzyna
2013-01-01
Many factors affect the risk of Legionella infection, such as the design, construction and maintenance of water distribution systems, the presence of individuals who may be exposed and their vulnerability to infection, and the degree of water system colonization and properties of Legionella strains. For epidemiological investigations, two properties of the Legionella strains are usually determined: serotyping and genotyping (sequence-based typing, SBT). In Poland, data regarding legionellosis are fragmentary, despite the fact that this has been a notifiable disease since 2002. The number of reported cases is very low; moreover, the main method of diagnosis is serological examination (delayed diagnosis and cheaper methods), and only single cases of LD were confirmed by culture of bacteria. Therefore, after 10 years of mandatory reporting of the Legionella spp. infection in Poland, the real epidemiological situation is still unknown; however, risk assessment should be carried out, especially in hospitals. In the presented study, comparison of the sequence types of 111 isolated L. pneumophila strains (from hospital water systems) with those present in the EWGLI SBT data was undertaken for complex risk analysis as a complementary element. In total, strains of L. pneumophila belonging to 12 out of 19 STs determined in the presented study were previously reported to the EWGLI SBT database (ST1, ST42, ST59, ST81, ST87, ST114, ST152, ST191, ST371, ST421, ST461, ST520). Among these strains, only 7 STs were previously reported in the amount of ≥10 (mainly ST1, ST42, ST81). Analysis of EWGLI data were carried out and, proportionally, the highest percentage of hospital-acquired strains (clinical and environmental) was found for ST 81, ST421 and ST152, but the largest number was for ST1. Based on the EWGLI data and the presented results, it was found that persistent colonization of HWS of 3 hospitals by strains belonging to ST42, ST1, ST87 indicated an increased risk of legionellosis, especially ST42.
DNA attachment to support structures
Balhorn, Rodney L.; Barry, Christopher H.
2002-01-01
Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).
Search and Discovery Strategies for Biotechnology: the Paradigm Shift
Bull, Alan T.; Ward, Alan C.; Goodfellow, Michael
2000-01-01
Profound changes are occurring in the strategies that biotechnology-based industries are deploying in the search for exploitable biology and to discover new products and develop new or improved processes. The advances that have been made in the past decade in areas such as combinatorial chemistry, combinatorial biosynthesis, metabolic pathway engineering, gene shuffling, and directed evolution of proteins have caused some companies to consider withdrawing from natural product screening. In this review we examine the paradigm shift from traditional biology to bioinformatics that is revolutionizing exploitable biology. We conclude that the reinvigorated means of detecting novel organisms, novel chemical structures, and novel biocatalytic activities will ensure that natural products will continue to be a primary resource for biotechnology. The paradigm shift has been driven by a convergence of complementary technologies, exemplified by DNA sequencing and amplification, genome sequencing and annotation, proteome analysis, and phenotypic inventorying, resulting in the establishment of huge databases that can be mined in order to generate useful knowledge such as the identity and characterization of organisms and the identity of biotechnology targets. Concurrently there have been major advances in understanding the extent of microbial diversity, how uncultured organisms might be grown, and how expression of the metabolic potential of microorganisms can be maximized. The integration of information from complementary databases presents a significant challenge. Such integration should facilitate answers to complex questions involving sequence, biochemical, physiological, taxonomic, and ecological information of the sort posed in exploitable biology. The paradigm shift which we discuss is not absolute in the sense that it will replace established microbiology; rather, it reinforces our view that innovative microbiology is essential for releasing the potential of microbial diversity for biotechnology penetration throughout industry. Various of these issues are considered with reference to deep-sea microbiology and biotechnology. PMID:10974127
Wang, Xuezhi; Huang, Xiaotao; Suvorova, Sofia; Moran, Bill
2018-01-01
Golay complementary waveforms can, in theory, yield radar returns of high range resolution with essentially zero sidelobes. In practice, when deployed conventionally, while high signal-to-noise ratios can be achieved for static target detection, significant range sidelobes are generated by target returns of nonzero Doppler causing unreliable detection. We consider signal processing techniques using Golay complementary waveforms to improve radar detection performance in scenarios involving multiple nonzero Doppler targets. A signal processing procedure based on an existing, so called, Binomial Design algorithm that alters the transmission order of Golay complementary waveforms and weights the returns is proposed in an attempt to achieve an enhanced illumination performance. The procedure applies one of three proposed waveform transmission ordering algorithms, followed by a pointwise nonlinear processor combining the outputs of the Binomial Design algorithm and one of the ordering algorithms. The computational complexity of the Binomial Design algorithm and the three ordering algorithms are compared, and a statistical analysis of the performance of the pointwise nonlinear processing is given. Estimation of the areas in the Delay–Doppler map occupied by significant range sidelobes for given targets are also discussed. Numerical simulations for the comparison of the performances of the Binomial Design algorithm and the three ordering algorithms are presented for both fixed and randomized target locations. The simulation results demonstrate that the proposed signal processing procedure has a better detection performance in terms of lower sidelobes and higher Doppler resolution in the presence of multiple nonzero Doppler targets compared to existing methods. PMID:29324708
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Mesomorphic phase transitions of 3F7HPhF studied by complementary methods
NASA Astrophysics Data System (ADS)
Deptuch, Aleksandra; Jaworska-Gołąb, Teresa; Marzec, Monika; Pociecha, Damian; Fitas, Jakub; Żurowska, Magdalena; Tykarska, Marzena; Hooper, James
2018-02-01
Physical properties and the phase sequence of (S)-4‧-(1-methylheptyloxycarbonyl)biphenyl-4-yl 4-[7-(2,2,3,3,4,4,4-heptafluorobutoxy) heptyl-1-oxy]-2-fluorobenzoate exhibiting the liquid crystalline paraelectric smectic A*, ferroelectric smectic C* and antiferroelectric smectic CA* phases were studied by complementary methods in the temperature range from -125 to 120 °C. Differential scanning calorimetry measurements together with polarizing optical microscopy provided the phase sequence, including the glass transition and a cold crystallization. X-ray diffraction was used to obtain the unit-cell parameters of the crystal phase, as well as the layer thickness and correlation length in the liquid crystalline smectic phases. The tilt angle was found to reach 45°, as determined from the measurements of the layer thickness and molecular modeling. Relaxation processes in the smectic phases and the fragility parameter were studied using frequency-domain dielectric spectroscopy.
Kits for Characterization of Chromosomal Inversions Using Probes
NASA Technical Reports Server (NTRS)
Ray, F. Andrew (Inventor)
2017-01-01
A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.
Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N
2018-02-01
Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.
Use of Complementary Health Practices in a Church-Based African American Cohort.
Escoto, Kamisha Hamilton; Milbury, Kathrin; Nguyen, Nga; Cho, Dalnim; Roberson, Crystal; Wetter, David; McNeill, Lorna H
2018-06-08
Few studies have examined the use of complementary health practices (e.g., mind/body practices and dietary supplements) among African Americans, particularly those who identify as being spiritual and/or religious. Furthermore, research on the health and health behavior profiles of such complementary health users is scant. The purpose of this study was to explore the use of complementary health practices and their lifestyle and health indicator correlates in a large, church-based African American population. Cross-sectional analysis of 1467 African American adults drawn from a church-based cohort study. Participants reported use of complementary health practices, lifestyle behaviors (e.g., diet and smoking status), and health indicators (e.g., physical health and medical problems). Multiple logistic regressions were conducted to examine associations between lifestyle variables, health indicators, and use of complementary health practices. Outcomes included prevalence of mind/body practices (e.g., meditation and Reiki) and dietary supplements (multivitamins) along with health indicator and lifestyle correlates of use. Use of complementary health practices was high; 40% reported using any mind/body practice and 50% reported using dietary supplements. Poorer physical health was associated with use of mind/body practices, while likelihood of meeting fruit and vegetable recommendations was significantly associated with dietary supplement use. Complementary health practices were used heavily in a church-based sample of African American adults. Poorer physical health was associated with use of complementary health practices, yet users also displayed health conscious behaviors. Given the high engagement in complementary health practices, it may be prudent to consider adapting complementary health approaches for use in wellness interventions targeting African Americans in faith-based settings.
Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.
1995-01-01
Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.
Hiding message into DNA sequence through DNA coding and chaotic maps.
Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman
2014-09-01
The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.
Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E.; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior. PMID:29659610
Rivera, Sinziana F; Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior.
McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R
2008-09-01
Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.
Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling
2017-12-04
The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.
Teng, Ye; Pramanik, Smritimoy; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Sugimoto, Naoki
2018-02-05
The trinucleotide repeat d(CXG) (X = A, C, G or T) is the most common sequence causing repeat expansion disorders. The formation of non-canonical structures, such as hairpin structures with X-X mismatches, has been proposed to affect gene expression and regulation, which are important in pathological studies of these devastating neurological diseases. However, little information is available regarding the thermodynamics of the repeat sequence under crowded cellular conditions where many non-canonical structures such as G-quadruplexes are highly stabilized, while duplexes are destabilised. In this study, we investigated the different stabilities of X-X mismatches in the context of internal d(CXG) self-complementary sequences in an environment with a high concentration of cosolutes to mimic the crowding conditions in cells. The stabilities of full-matched duplexes and duplexes with A-A, G-G, and T-T mismatched base pairs under molecular crowding conditions were notably decreased compared to under dilute conditions. However, the stability of the DNA duplex with a C-C mismatch base pair was only slightly destabilised. Investigating different stabilities of X-X mismatches in d(CXG) sequences is important for improving our understanding of the formation and transition of multiple non-canonical structures in trinucleotide repeat diseases, and may provide insights for pathological studies and drug development. Copyright © 2018 Elsevier Inc. All rights reserved.
[Guidelines for complementary feeding in healthy infants].
Romero-Velarde, Enrique; Villalpando-Carrión, Salvador; Pérez-Lizaur, Ana Berta; Iracheta-Gerez, Ma de la Luz; Alonso-Rivera, Carlos Gilberto; López-Navarrete, Gloria Elena; García-Contreras, Andrea; Ochoa-Ortiz, Erika; Zarate-Mondragón, Flora; López-Pérez, Gerardo Tiburcio; Chávez-Palencia, Clío; Guajardo-Jáquez, Manuel; Vázquez-Ortiz, Salvador; Pinzón-Navarro, Beatriz Adriana; Torres-Duarte, Karely Noemy; Vidal-Guzmán, José Domingo; Michel-Gómez, Pedro Luis; López-Contreras, Iris Nallely; Arroyo-Cruz, Liliana Verenice; Almada-Velasco, Pamela; Saltigeral-Simental, Patricia; Ríos-Aguirre, Alejandro; Domínguez-Pineda, Lorena; Rodríguez-González, Perla; Crabtree-Ramírez, Úrsula; Hernández-Rosiles, Vanessa; Pinacho-Velázquez, José Luis
A proper nutrition during the first two years of life is critical to reach the full potential of every human being; now, this period is recognized as a critical window for promoting optimal growth, development, and good health. Therefore, adequate feeding at this stage of life has an impact on health, nutritional status, growth and development of children; not only in the short term, but in the medium and long term. This paper provides recommendations on complementary feeding (CF) presented as questions or statements that are important for those who take care for children during this stage of life. For example: When to start complementary feedings: 4 or 6 months of age?; Exposure to potentially allergenic foods; Introduction of sweetened beverages; Use of artificial sweeteners and light products; Food introduction sequence; Food consistency changes according to neurological maturation; Number of days to test acceptance and tolerance to new foods; Amounts for each meal; Inadequate complementary feeding practices; Myths and realities of complementary feeding; Developmental milestones; Practice of "Baby Led Weaning" and practice of vegetarianism. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
Complementary and Alternative Medicine for Patients
... Ask about Your Treatment Research Complementary and Alternative Medicine for Patients Complementary and alternative medicine (CAM) is ... based on scientific evidence from research studies. Complementary medicine refers to treatments that are used with standard ...
Microfluidics-Based Lab-on-Chip Systems in DNA-Based Biosensing: An Overview
Dutse, Sabo Wada; Yusof, Nor Azah
2011-01-01
Microfluidics-based lab-on-chip (LOC) systems are an active research area that is revolutionising high-throughput sequencing for the fast, sensitive and accurate detection of a variety of pathogens. LOCs also serve as portable diagnostic tools. The devices provide optimum control of nanolitre volumes of fluids and integrate various bioassay operations that allow the devices to rapidly sense pathogenic threat agents for environmental monitoring. LOC systems, such as microfluidic biochips, offer advantages compared to conventional identification procedures that are tedious, expensive and time consuming. This paper aims to provide a broad overview of the need for devices that are easy to operate, sensitive, fast, portable and sufficiently reliable to be used as complementary tools for the control of pathogenic agents that damage the environment. PMID:22163925
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity
Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.
2016-01-01
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
A Sequence-Dependent DNA Condensation Induced by Prion Protein
2018-01-01
Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864
A Sequence-Dependent DNA Condensation Induced by Prion Protein.
Bera, Alakesh; Biring, Sajal
2018-01-01
Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization
NASA Astrophysics Data System (ADS)
James, Carrie Rae
Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use
Croteau, Rodney B.; Lange, Bernd M.
2001-01-01
A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.
Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.
Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I
2001-08-01
DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.
Wang, Yaru; Luo, Huiying; Huang, Huoqing; Shi, Pengjun; Bai, Yingguo; Yang, Peilong; Yao, Bin
2012-01-01
Background Efficient degradation of pectin in the rumen is necessary for plant-based feed utilization. The objective of this study was to characterize the diversity, abundance, and functions of pectinases from microorganisms in the sheep rumen. Methodology/Principal Findings A total of 103 unique fragments of polygalacturonase (PF00295) and pectate lyase (PF00544 and PF09492) genes were retrieved from microbial DNA in the rumen of a Small Tail Han sheep, and 66% of the sequences of these fragments had low identities (<65%) with known sequences. Phylogenetic tree building separated the PF00295, PF00544, and PF09492 sequences into five, three, and three clades, respectively. Cellulolytic and noncellulolytic Butyrivibrio, Prevotella, and Fibrobacter species were the major sources of the pectinases. The two most abundant pectate lyase genes were cloned, and their protein products, expressed in Escherichia coli, were characterized. Both enzymes probably act extracellularly as their nucleotide sequences contained signal sequences, and they had optimal activities at the ruminal physiological temperature and complementary pH-dependent activity profiles. Conclusion/Significance This study reveals the specificity, diversity, and abundance of pectinases in the rumen ecosystem and provides two additional ruminal pectinases for potential industrial use under physiological conditions. PMID:22815874
Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C
2016-08-01
As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.
Preparation of highly multiplexed small RNA sequencing libraries.
Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos
2017-08-01
MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.
Interspecific Plastome Recombination Reflects Ancient Reticulate Evolution in Picea (Pinaceae).
Sullivan, Alexis R; Schiffthaler, Bastian; Thompson, Stacey Lee; Street, Nathaniel R; Wang, Xiao-Ru
2017-07-01
Plastid sequences are a cornerstone in plant systematic studies and key aspects of their evolution, such as uniparental inheritance and absent recombination, are often treated as axioms. While exceptions to these assumptions can profoundly influence evolutionary inference, detecting them can require extensive sampling, abundant sequence data, and detailed testing. Using advancements in high-throughput sequencing, we analyzed the whole plastomes of 65 accessions of Picea, a genus of ∼35 coniferous forest tree species, to test for deviations from canonical plastome evolution. Using complementary hypothesis and data-driven tests, we found evidence for chimeric plastomes generated by interspecific hybridization and recombination in the clade comprising Norway spruce (P. abies) and 10 other species. Support for interspecific recombination remained after controlling for sequence saturation, positive selection, and potential alignment artifacts. These results reconcile previous conflicting plastid-based phylogenies and strengthen the mounting evidence of reticulate evolution in Picea. Given the relatively high frequency of hybridization and biparental plastid inheritance in plants, we suggest interspecific plastome recombination may be more widespread than currently appreciated and could underlie reported cases of discordant plastid phylogenies. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.
Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara
2017-01-01
Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.
VaDiR: an integrated approach to Variant Detection in RNA.
Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy
2018-02-01
Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.
NASA Technical Reports Server (NTRS)
Caillault, Jean-Pierre; Magnani, Loris
1990-01-01
The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.
Post-main-sequence planetary system evolution.
Veras, Dimitri
2016-02-01
The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries.
Inversions and Gene Order Shuffling in Anopheles gambiae and A. funestus
NASA Astrophysics Data System (ADS)
Sharakhov, Igor V.; Serazin, Andrew C.; Grushko, Olga G.; Dana, Ali; Lobo, Neil; Hillenmeyer, Maureen E.; Westerman, Richard; Romero-Severson, Jeanne; Costantini, Carlo; Sagnon, N'Fale; Collins, Frank H.; Besansky, Nora J.
2002-10-01
In tropical Africa, Anopheles funestus is one of the three most important malaria vectors. We physically mapped 157 A. funestus complementary DNAs (cDNAs) to the polytene chromosomes of this species. Sequences of the cDNAs were mapped in silico to the A. gambiae genome as part of a comparative genomic study of synteny, gene order, and sequence conservation between A. funestus and A. gambiae. These species are in the same subgenus and diverged about as recently as humans and chimpanzees. Despite nearly perfect preservation of synteny, we found substantial shuffling of gene order along corresponding chromosome arms. Since the divergence of these species, at least 70 chromosomal inversions have been fixed, the highest rate of rearrangement of any eukaryote studied to date. The high incidence of paracentric inversions and limited colinearity suggests that locating genes in one anopheline species based on gene order in another may be limited to closely related taxa.
Selection and characterization of a DNA aptamer to crystal violet.
Chen, Yang; Wang, Jine; Zhang, Yajie; Xu, Lijun; Gao, Tian; Wang, Bing; Pei, Renjun
2018-06-13
Aptamers are short single-stranded DNA or RNA, which can be selected in vitro by systematic evolution of ligands by exponential enrichment (SELEX). In order to develop novel light-up probes to substitute G-quadruplex (G4), we selected a DNA aptamer for crystal violet (CV), a triphenylmethane light-up dye, by a modified affinity chromatography-based SELEX. The ssDNA pool was first coupled on streptavidin-coated agarose beads through a biotin labeled complementary oligonucleotide, and then the aptamer sequences would be released from agarose beads by CV affinity. This method is simple, straightforward and effective. The aptamer sequence with a low micromolar dissociation constant (Kd) and good specificity was achieved after 11 rounds of selection. The light-up properties of the CV-aptamer were also investigated, and the CV showed dramatic fluorescence enhancement. The CV-aptamer pair could be further used as a novel light-up fluorescent probe to design biosensors.
Spatial methods for deriving crop rotation history
NASA Astrophysics Data System (ADS)
Mueller-Warrant, George W.; Trippe, Kristin M.; Whittaker, Gerald W.; Anderson, Nicole P.; Sullivan, Clare S.
2017-08-01
Benefits of converting 11 years of remote sensing classification data into cropping history of agricultural fields included measuring lengths of rotation cycles and identifying specific sequences of intervening crops grown between final years of old grass seed stands and establishment of new ones. Spatial and non-spatial methods were complementary. Individual-year classification errors were often correctable in spreadsheet-based non-spatial analysis, whereas their presence in spatial data generally led to exclusion of fields from further analysis. Markov-model testing of non-spatial data revealed that year-to-year cropping sequences did not match average frequencies for transitions among crops grown in western Oregon, implying that rotations into new grass seed stands were influenced by growers' desires to achieve specific objectives. Moran's I spatial analysis of length of time between consecutive grass seed stands revealed that clustering of fields was relatively uncommon, with high and low value clusters only accounting for 7.1 and 6.2% of fields.
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Evaluating the protein coding potential of exonized transposable element sequences
Piriyapongsa, Jittima; Rutledge, Mark T; Patel, Sanil; Borodovsky, Mark; Jordan, I King
2007-01-01
Background Transposable element (TE) sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS) and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM) approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently exonized but unlikely to encode protein sequences. Conclusion The exaptation of the numerous TE sequences found in exons as bona fide protein coding sequences may prove to be far less common than has been suggested by the analysis of complete genomes. We hypothesize that many exonized TE sequences actually function as post-transcriptional regulators of gene expression, rather than coding sequences, which may act through a variety of double stranded RNA related regulatory pathways. Indeed, their relatively high copy numbers and similarity to sequences dispersed throughout the genome suggests that exonized TE sequences could serve as master regulators with a wide scope of regulatory influence. Reviewers: This article was reviewed by Itai Yanai, Kateryna D. Makova, Melissa Wilson (nominated by Kateryna D. Makova) and Cedric Feschotte (nominated by John M. Logsdon Jr.). PMID:18036258
Accelerating calculations of RNA secondary structure partition functions using GPUs
2013-01-01
Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434
Ryan, Niamh M; Lihm, Jayon; Kramer, Melissa; McCarthy, Shane; Morris, Stewart W; Arnau-Soler, Aleix; Davies, Gail; Duff, Barbara; Ghiban, Elena; Hayward, Caroline; Deary, Ian J; Blackwood, Douglas H R; Lawrie, Stephen M; McIntosh, Andrew M; Evans, Kathryn L; Porteous, David J; McCombie, W Richard; Thomson, Pippa A
2018-06-07
Psychiatric disorders are a group of genetically related diseases with highly polygenic architectures. Genome-wide association analyses have made substantial progress towards understanding the genetic architecture of these disorders. More recently, exome- and whole-genome sequencing of cases and families have identified rare, high penetrant variants that provide direct functional insight. There remains, however, a gap in the heritability explained by these complementary approaches. To understand how multiple genetic variants combine to modify both severity and penetrance of a highly penetrant variant, we sequenced 48 whole genomes from a family with a high loading of psychiatric disorder linked to a balanced chromosomal translocation. The (1;11)(q42;q14.3) translocation directly disrupts three genes: DISC1, DISC2, DISC1FP and has been linked to multiple brain imaging and neurocognitive outcomes in the family. Using DNA sequence-level linkage analysis, functional annotation and population-based association, we identified common and rare variants in GRM5 (minor allele frequency (MAF) > 0.05), PDE4D (MAF > 0.2) and CNTN5 (MAF < 0.01) that may help explain the individual differences in phenotypic expression in the family. We suggest that whole-genome sequencing in large families will improve the understanding of the combined effects of the rare and common sequence variation underlying psychiatric phenotypes.
García-Martinez, Gonzalo; Bustabad, Enrique Alonso; Perrot, Hubert; Gabrielli, Claude; Bucur, Bogdan; Lazerges, Mathieu; Rose, Daniel; Rodriguez-Pardo, Loreto; Fariña, Jose; Compère, Chantal; Vives, Antonio Arnau
2011-01-01
This work deals with the design of a high sensitivity DNA sequence detector using a 50 MHz quartz crystal microbalance (QCM) electronic oscillator circuit. The oscillator circuitry is based on Miller topology, which is able to work in damping media. Calibration and experimental study of frequency noise are carried out, finding that the designed sensor has a resolution of 7.1 ng/cm(2) in dynamic conditions (with circulation of liquid). Then the oscillator is proved as DNA biosensor. Results show that the system is able to detect the presence of complementary target DNAs in a solution with high selectivity and sensitivity. DNA target concentrations higher of 50 ng/mL can be detected.
Dedkov, V S
2009-01-01
The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.
Towards fully automated structure-based function prediction in structural genomics: a case study.
Watson, James D; Sanderson, Steve; Ezersky, Alexandra; Savchenko, Alexei; Edwards, Aled; Orengo, Christine; Joachimiak, Andrzej; Laskowski, Roman A; Thornton, Janet M
2007-04-13
As the global Structural Genomics projects have picked up pace, the number of structures annotated in the Protein Data Bank as hypothetical protein or unknown function has grown significantly. A major challenge now involves the development of computational methods to assign functions to these proteins accurately and automatically. As part of the Midwest Center for Structural Genomics (MCSG) we have developed a fully automated functional analysis server, ProFunc, which performs a battery of analyses on a submitted structure. The analyses combine a number of sequence-based and structure-based methods to identify functional clues. After the first stage of the Protein Structure Initiative (PSI), we review the success of the pipeline and the importance of structure-based function prediction. As a dataset, we have chosen all structures solved by the MCSG during the 5 years of the first PSI. Our analysis suggests that two of the structure-based methods are particularly successful and provide examples of local similarity that is difficult to identify using current sequence-based methods. No one method is successful in all cases, so, through the use of a number of complementary sequence and structural approaches, the ProFunc server increases the chances that at least one method will find a significant hit that can help elucidate function. Manual assessment of the results is a time-consuming process and subject to individual interpretation and human error. We present a method based on the Gene Ontology (GO) schema using GO-slims that can allow the automated assessment of hits with a success rate approaching that of expert manual assessment.
Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.
miR-ID: A novel, circularization-based platform for detection of microRNAs
Kumar, Pavan; Johnston, Brian H.; Kazakov, Sergei A.
2011-01-01
MicroRNAs (miRNAs) are important regulators of gene expression and have great potential as biomarkers, prognostic indicators, and therapeutic targets. Determining the expression patterns of these molecules is essential for elucidating their biogenesis, regulation, relation to disease, and response to therapy. Although PCR-based assays are commonly used for expression profiling of miRNAs, the small size, sequence heterogeneity, and (in some cases) end modifications of miRNAs constrain the performance of existing PCR methods. Here we introduce miR-ID, a novel method that avoids these constraints while providing superior sensitivity and sequence specificity at a lower cost. It also has the unique ability to differentiate unmodified small RNAs from those carrying 2′-OMe groups at their 3′-ends while detecting both forms. miR-ID is comprised of the following steps: (1) circularization of the miRNA by a ligase; (2) reverse transcription of the circularized miRNA (RTC), producing tandem repeats of a DNA sequence complementary to the miRNA; and (3) qPCR amplification of segments of this multimeric cDNA using 5′-overlapping primers and a nonspecific dye such as SYBR Green. No chemically modified probes (e.g., TaqMan) or primers (e.g., LNA) are required. The circular RNA and multimeric cDNA templates provide unmatched flexibility in the positioning of primers, which may include straddling the boundaries between these repetitive miRNA sequences. miR-ID is based on new findings that are themselves of general interest, including reverse transcription of small RNA circles and the use of 5′-overlapping primers for detection of repetitive sequences by qPCR. PMID:21169480
Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining
2014-01-01
Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551
Solid phase sequencing of biopolymers
Cantor, Charles; Koster, Hubert
2010-09-28
This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.
Guan, Xiaoyan; Brownstein, Naomi C; Young, Nicolas L; Marshall, Alan G
2017-01-30
Bottom-up tandem mass spectrometry (MS/MS) is regularly used in proteomics to identify proteins from a sequence database. De novo sequencing is also available for sequencing peptides with relatively short sequence lengths. We recently showed that paired Lys-C and Lys-N proteases produce peptides of identical mass and similar retention time, but different tandem mass spectra. Such parallel experiments provide complementary information, and allow for up to 100% MS/MS sequence coverage. Here, we report digestion by paired Lys-C and Lys-N proteases of a seven-protein mixture: human hemoglobin alpha, bovine carbonic anhydrase 2, horse skeletal muscle myoglobin, hen egg white lysozyme, bovine pancreatic ribonuclease, bovine rhodanese, and bovine serum albumin, followed by reversed-phase nanoflow liquid chromatography, collision-induced dissociation, and 14.5 T Fourier transform ion cyclotron resonance mass spectrometry. Matched pairs of product peptide ions of equal precursor mass and similar retention times from each digestion are compared, leveraging single-residue transposed information with independent interferences to confidently identify fragment ion types, residues, and peptides. Selected pairs of product ion mass spectra for de novo sequenced protein segments from each member of the mixture are presented. Pairs of the transposed product ions as well as complementary information from the parallel experiments allow for both high MS/MS coverage for long peptide sequences and high confidence in the amino acid identification. Moreover, the parallel experiments in the de novo sequencing reduce false-positive matches of product ions from the single-residue transposed peptides from the same segment, and thereby further improve the confidence in protein identification. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice
Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P
2015-01-01
Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951
Hughes, J M
1996-06-21
The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.
Cheng, Yiming; Perocchi, Fabiana
2015-07-01
ProtPhylo is a web-based tool to identify proteins that are functionally linked to either a phenotype or a protein of interest based on co-evolution. ProtPhylo infers functional associations by comparing protein phylogenetic profiles (co-occurrence patterns of orthology relationships) for more than 9.7 million non-redundant protein sequences from all three domains of life. Users can query any of 2048 fully sequenced organisms, including 1678 bacteria, 255 eukaryotes and 115 archaea. In addition, they can tailor ProtPhylo to a particular kind of biological question by choosing among four main orthology inference methods based either on pair-wise sequence comparisons (One-way Best Hits and Best Reciprocal Hits) or clustering of orthologous proteins across multiple species (OrthoMCL and eggNOG). Next, ProtPhylo ranks phylogenetic neighbors of query proteins or phenotypic properties using the Hamming distance as a measure of similarity between pairs of phylogenetic profiles. Candidate hits can be easily and flexibly prioritized by complementary clues on subcellular localization, known protein-protein interactions, membrane spanning regions and protein domains. The resulting protein list can be quickly exported into a csv text file for further analyses. ProtPhylo is freely available at http://www.protphylo.org. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Pedersen, Mikkel Winther; Ginolhac, Aurélien; Orlando, Ludovic; Olsen, Jesper; Andersen, Kenneth; Holm, Jakob; Funder, Svend; Willerslev, Eske; Kjær, Kurt H.
2013-09-01
We use 2nd generation sequencing technology on sedimentary ancient DNA (sedaDNA) from a lake in South Greenland to reconstruct the local floristic history around a low-arctic lake and compare the results with those previously obtained from pollen and macrofossils in the same lake. Thirty-eight of thirty-nine samples from the core yielded putative DNA sequences. Using a multiple assignment strategy on the trnL g-h DNA barcode, consisting of two different phylogenetic and one sequence similarity assignment approaches, thirteen families of plants were identified, of which two (Scrophulariaceae and Asparagaceae) are absent from the pollen and macrofossil records. An age model for the sediment based on twelve radiocarbon dates establishes a chronology and shows that the lake record dates back to 10,650 cal yr BP. Our results suggest that sedaDNA analysis from lake sediments, although taxonomically less detailed than pollen and macrofossil analyses can be a complementary tool for establishing the composition of both terrestrial and aquatic local plant communities and a method for identifying additional taxa.
Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu
2014-06-01
The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.
DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR
A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...
Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.
1991-02-01
Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides
Structure, sequence and expression of the hepatitis delta (δ) viral genome
NASA Astrophysics Data System (ADS)
Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael
1986-10-01
Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.
Post-main-sequence planetary system evolution
Veras, Dimitri
2016-01-01
The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326
Equine infectious anemia virus in naturally infected horses from the Brazilian Pantanal.
Cursino, Andreia Elisa; Vilela, Ana Paula Pessoa; Franco-Luiz, Ana Paula Moreira; de Oliveira, Jaquelline Germano; Nogueira, Márcia Furlan; Júnior, João Pessoa Araújo; de Aguiar, Daniel Moura; Kroon, Erna Geessien
2018-05-11
Equine infectious anemia (EIA) has a worldwide distribution, and is widespread in Brazil. The Brazilian Pantanal presents with high prevalence comprising equine performance and indirectly the livestock industry, since the horses are used for cattle management. Although EIA is routinely diagnosed by the agar gel immunodiffusion test (AGID), this serological assay has some limitations, so PCR-based detection methods have the potential to overcome these limitations and act as complementary tests to those currently used. Considering the limited number of equine infectious anemia virus (EIAV) sequences which are available in public databases and the great genome variability, studies of EIAV detection and characterization molecular remain important. In this study we detected EIAV proviral DNA from 23 peripheral blood mononuclear cell (PBMCs) samples of naturally infected horses from Brazilian Pantanal using a semi-nested-PCR (sn-PCR). The serological profile of the animals was also evaluated by AGID and ELISA for gp90 and p26. Furthermore, the EIAV PCR amplified DNA was sequenced and phylogenetically analyzed. Here we describe the first EIAV sequences of the 5' LTR of the tat gene in naturally infected horses from Brazil, which presented with 91% similarity to EIAV reference sequences. The Brazilian EIAV sequences also presented variable nucleotide similarities among themselves, ranging from 93,5% to 100%. Phylogenetic analysis showed that Brazilian EIAV sequences grouped in a separate clade relative to other reference sequences. Thus this molecular detection and characterization may provide information about EIAV circulation in Brazilian territories and improve phylogenetic inferences.
Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A
2017-01-01
We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion
Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko
2011-01-01
Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143
Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R
1999-07-30
A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.
Simplified Microarray Technique for Identifying mRNA in Rare Samples
NASA Technical Reports Server (NTRS)
Almeida, Eduardo; Kadambi, Geeta
2007-01-01
Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.
NASA Astrophysics Data System (ADS)
Oswald, Helmut; Mueller-Jones, Kay; Builtjes, Jan; Fleck, Eckart
1998-07-01
The developments in information technologies -- computer hardware, networking and storage media -- has led to expectations that these advances make it possible to replace 35 mm film completely by digital techniques in the catheter laboratory. Besides the role of an archival medium, cine film is used as the major image review and exchange medium in cardiology. None of the today technologies can fulfill completely the requirements to replace cine film. One of the major drawbacks of cine film is the single access in time and location. For the four catheter laboratories in our institutions we have designed a complementary concept combining the CD-R, also called CD-medical, as a single patient storage and exchange medium, and a digital archive for on-line access and image review of selected frames or short sequences on adequate medical workstations. The image data from various modalities as well as all digital documents regarding to a patient are part of an electronic patient record. The access, the processing and the display of documents is supported by an integrated medical application.
I-TASSER: fully automated protein structure prediction in CASP8.
Zhang, Yang
2009-01-01
The I-TASSER algorithm for 3D protein structure prediction was tested in CASP8, with the procedure fully automated in both the Server and Human sections. The quality of the server models is close to that of human ones but the human predictions incorporate more diverse templates from other servers which improve the human predictions in some of the distant homology targets. For the first time, the sequence-based contact predictions from machine learning techniques are found helpful for both template-based modeling (TBM) and template-free modeling (FM). In TBM, although the accuracy of the sequence based contact predictions is on average lower than that from template-based ones, the novel contacts in the sequence-based predictions, which are complementary to the threading templates in the weakly or unaligned regions, are important to improve the global and local packing in these regions. Moreover, the newly developed atomic structural refinement algorithm was tested in CASP8 and found to improve the hydrogen-bonding networks and the overall TM-score, which is mainly due to its ability of removing steric clashes so that the models can be generated from cluster centroids. Nevertheless, one of the major issues of the I-TASSER pipeline is the model selection where the best models could not be appropriately recognized when the correct templates are detected only by the minority of the threading algorithms. There are also problems related with domain-splitting and mirror image recognition which mainly influences the performance of I-TASSER modeling in the FM-based structure predictions. Copyright 2009 Wiley-Liss, Inc.
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit
2018-01-01
Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.
Swingley, Wesley D.; Meyer-Dombard, D’Arcy R.; Shock, Everett L.; Alsop, Eric B.; Falenski, Heinz D.; Havig, Jeff R.; Raymond, Jason
2012-01-01
We have constructed a conceptual model of biogeochemical cycles and metabolic and microbial community shifts within a hot spring ecosystem via coordinated analysis of the “Bison Pool” (BP) Environmental Genome and a complementary contextual geochemical dataset of ∼75 geochemical parameters. 2,321 16S rRNA clones and 470 megabases of environmental sequence data were produced from biofilms at five sites along the outflow of BP, an alkaline hot spring in Sentinel Meadow (Lower Geyser Basin) of Yellowstone National Park. This channel acts as a >22 m gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of biologically important chemical species, such as those containing nitrogen and sulfur. Microbial life at BP transitions from a 92°C chemotrophic streamer biofilm community in the BP source pool to a 56°C phototrophic mat community. We improved automated annotation of the BP environmental genomes using BLAST-based Markov clustering. We have also assigned environmental genome sequences to individual microbial community members by complementing traditional homology-based assignment with nucleotide word-usage algorithms, allowing more than 70% of all reads to be assigned to source organisms. This assignment yields high genome coverage in dominant community members, facilitating reconstruction of nearly complete metabolic profiles and in-depth analysis of the relation between geochemical and metabolic changes along the outflow. We show that changes in environmental conditions and energy availability are associated with dramatic shifts in microbial communities and metabolic function. We have also identified an organism constituting a novel phylum in a metabolic “transition” community, located physically between the chemotroph- and phototroph-dominated sites. The complementary analysis of biogeochemical and environmental genomic data from BP has allowed us to build ecosystem-based conceptual models for this hot spring, reconstructing whole metabolic networks in order to illuminate community roles in shaping and responding to geochemical variability. PMID:22675512
Ahour, F; Shamsi, A
2017-09-01
Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11 M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.
Park, Eonyoung; Maquat, Lynne E.
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777
The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Ruiying; Zheng, Han; Preamplume, Gan
The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of amore » noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.« less
Mikshis, N I; Kashtanova, T N; Kutyrev, V V
2015-01-01
Nucleotide sequence analysis of several genes responsible for the anthrax pathogen definitive properties--motility and penicillinase activity--determined a chromosomal locus promising for interspecies differentiation. We demonstrated that the gene fliC encoding flagellin synthesis contains extended region, distinguishing B. anthracis strains from the majority of non-pathogenic and opportunistic bacilli. A novel method for the anthrax pathogen indication and identification based on determination of the differences in the chromosomal genes fliC and hom2 structure was suggested. A total of 60 strains of different Bacillus spp. (B. anthracis, B. cereus, B. thuringiensis, B. mycoides, B. megaterium, B. subtilis, etc.) were tested using two chromosomal DNA targets. The algorithm developed in this work permits to detect the pathogenic microorganism and reliably differentiate it from other Bacillus spp. representatives. The introduction of primers complementary to specific sequences of pXO1 and pXQ2 plasmids into the multiplex PCR makes it possible to receive additional information on proposed virulence of the isolate.
Shum, Bennett O V; Henner, Ilya; Belluoccio, Daniele; Hinchcliffe, Marcus J
2017-07-01
The sensitivity and specificity of next-generation sequencing laboratory developed tests (LDTs) are typically determined by an analyte-specific approach. Analyte-specific validations use disease-specific controls to assess an LDT's ability to detect known pathogenic variants. Alternatively, a methods-based approach can be used for LDT technical validations. Methods-focused validations do not use disease-specific controls but use benchmark reference DNA that contains known variants (benign, variants of unknown significance, and pathogenic) to assess variant calling accuracy of a next-generation sequencing workflow. Recently, four whole-genome reference materials (RMs) from the National Institute of Standards and Technology (NIST) were released to standardize methods-based validations of next-generation sequencing panels across laboratories. We provide a practical method for using NIST RMs to validate multigene panels. We analyzed the utility of RMs in validating a novel newborn screening test that targets 70 genes, called NEO1. Despite the NIST RM variant truth set originating from multiple sequencing platforms, replicates, and library types, we discovered a 5.2% false-negative variant detection rate in the RM truth set genes that were assessed in our validation. We developed a strategy using complementary non-RM controls to demonstrate 99.6% sensitivity of the NEO1 test in detecting variants. Our findings have implications for laboratories or proficiency testing organizations using whole-genome NIST RMs for testing. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
Zhang, Peng; Liu, Hui; Li, Xiaocheng; Ma, Suzhen; Men, Shuai; Wei, Heng; Cui, Jingjing; Wang, Hongning
2017-01-15
The harm of Salmonella typhimurium (S. typhimurium) to public health mainly by the consumption of contaminated agricultural products or water stresses an urgent need for rapid detection methods to help control the spread of S. typhimurium. In this work, an intelligently designed sensor system took creative advantage of triple trigger sequences-regenerated strand displacement amplification and self-protective hairpin template-generated-scaffolded silver nanoclusters (AgNCs) for the first time. In the presence of live S. typhimurium, single-stranded trigger sequences were released from aptamer-trigger sequences complex, initiating a branch migration to open the hairpin template I containing complementary scaffolds of AgNCs. Then the first strand displacement amplification was induced to produce numerous scaffolds of AgNCs and reporter strands which initiated a branch migration to open the hairpin template II containing complementary scaffolds of AgNCs. Then the second strand displacement amplification was induced to generate numerous scaffolds of AgNCs and trigger sequences which initiated the third branch migration and strand displacement amplification to produce numerous scaffolds of AgNCs and reporter strands in succession. Cyclically, the reproduction of the trigger sequences and cascade successive production of scaffolds were achieved successfully, forming highly fluorescent AgNCs, thus providing significantly enhanced fluorescent signals to achieve ultrasensitive detection of live S. typhimurium down to 50 CFU/mL with a linear range from 10 2 to 10 7 CFU/mL. It is the first report on a fluorescent biosensor for detecting viable S. typhimurium directly, which can distinguish from heat denatured S. typhimurium. And it develops a new strategy to generate the DNA-scaffolds for forming AgNCs. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhang, Zhaoyang; Chen, Niancao; Li, Shihui; Battig, Mark R; Wang, Yong
2012-09-26
The ability to regulate cell-material interactions is important in various applications such as regenerative medicine and cell separation. This study successfully demonstrates that the binding states of cells on a hydrogel surface can be programmed by using hybridized aptamers and triggering complementary sequences (CSs). In the absence of the triggering CSs, the aptamers exhibit a stable, hybridized state in the hydrogel for cell-type-specific catch. In the presence of the triggering CSs, the aptamers are transformed into a new hybridized state that leads to the rapid dissociation of the aptamers from the hydrogel. As a result, the cells are released from the hydrogel. The entire procedure of cell catch and release during the transformation of the aptamers is biocompatible and does not involve any factor destructive to either the cells or the hydrogel. Thus, the programmable hydrogel is regenerable and can be applied to a new round of cell catch and release when needed.
NASA Astrophysics Data System (ADS)
Reuther, James F.; Dees, Justine L.; Kolesnichenko, Igor V.; Hernandez, Erik T.; Ukraintsev, Dmitri V.; Guduru, Rusheel; Whiteley, Marvin; Anslyn, Eric V.
2018-01-01
Naturally occurring peptides and proteins often use dynamic disulfide bonds to impart defined tertiary/quaternary structures for the formation of binding pockets with uniform size and function. Although peptide synthesis and modification are well established, controlling quaternary structure formation remains a significant challenge. Here, we report the facile incorporation of aryl aldehyde and acyl hydrazide functionalities into peptide oligomers via solid-phase copper-catalysed azide-alkyne cycloaddition (SP-CuAAC) click reactions. When mixed, these complementary functional groups rapidly react in aqueous media at neutral pH to form peptide-peptide intermolecular macrocycles with highly tunable ring sizes. Moreover, sequence-specific figure-of-eight, dumbbell-shaped, zipper-like and multi-loop quaternary structures were formed selectively. Controlling the proportions of reacting peptides with mismatched numbers of complementary reactive groups results in the formation of higher-molecular-weight sequence-defined ladder polymers. This also amplified antimicrobial effectiveness in select cases. This strategy represents a general approach to the creation of complex abiotic peptide quaternary structures.
Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J
1994-08-16
We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.
Westhof, E; Sundaralingam, M
1980-01-01
The non-self-complementary dinucleoside monophosphate cytidylyl-3',5'-adenosine (CpA) forms a base-paired parallel-chain dimer with an intercalated proflavine. The dimer complex possesses a right-handed helical twist. The dimer helix has an irregular girth with a neutral adenine-adenine (A-A) pair, hydrogen-bonded through the N6 and N7 sites (C1'...C1' separation of 10.97 A), and a triply hydrogen-bonded protonated cytosine-cytosine (C-C) pair with a proton shared between the base N3 sites (Cl'...Cl' separation of 9.59 A). The torsion angles of the sugar-phosphate backbone are within their most preferred ranges and the sugar puckering sequence (5' leads to 3') is C3'-endo, C2'-endo. There is also a second proflavine molecule sandwiched between CpA dimers on the 21-axis. Both proflavines are necessarily disordered, being on dyad axis, and this suggests possible insights into the dynamics of intercalation of planar drugs. This structure shows that intercalation of planar drugs in nucleic acids may not be restricted to antiparallel complementary Watson-Crick pairing regions and provides additional mechanisms for acridine mutagenesis. PMID:6929524
Aggregating and Predicting Sequence Labels from Crowd Annotations
Nguyen, An T.; Wallace, Byron C.; Li, Junyi Jessy; Nenkova, Ani; Lease, Matthew
2017-01-01
Despite sequences being core to NLP, scant work has considered how to handle noisy sequence labels from multiple annotators for the same text. Given such annotations, we consider two complementary tasks: (1) aggregating sequential crowd labels to infer a best single set of consensus annotations; and (2) using crowd annotations as training data for a model that can predict sequences in unannotated text. For aggregation, we propose a novel Hidden Markov Model variant. To predict sequences in unannotated text, we propose a neural approach using Long Short Term Memory. We evaluate a suite of methods across two different applications and text genres: Named-Entity Recognition in news articles and Information Extraction from biomedical abstracts. Results show improvement over strong baselines. Our source code and data are available online1. PMID:29093611
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
Inoue, Akira; Mizushima, Tsunekazu; Wu, Xin; Okuzaki, Daisuke; Kambara, Nanami; Ishikawa, Sho; Wang, Jiaqi; Qian, Yamin; Hirose, Haruka; Yokoyama, Yuhki; Ikeshima, Ryo; Hiraki, Masayuki; Miyoshi, Norikatsu; Takahashi, Hidekazu; Haraguchi, Naotsugu; Hata, Taishi; Matsuda, Chu; Doki, Yuichiro; Mori, Masaki; Yamamoto, Hirofumi
2018-05-01
We previously demonstrated that miR-29b-3p is a hopeful miRNA-based therapy against colorectal cancer. In this study, we aimed to clarify a value of miR-29b-1-5p as a next-generation treatment, especially for KRAS -mutant colorectal cancer. RT-PCR assay showed that the expression of miR-29b-3p was high, and its partner strand, miR-29b-1-5p, level was only negligible in clinical colorectal cancer samples. Mimic-miR-29b-1-5p significantly inhibited proliferation of KRAS -mutant colorectal cancer cell lines DLD1 and SW480 and KRAS wild-type HT29 cells. Proliferative activity was further examined by either miR-29b-1-5p strand or its opposite complementary sequence because miR-29b-1-5p is a passenger miRNA and may have no physiologic function. We found that completely opposite complementary strand to miR-29b-1-5p, but not miR-29b-1-5p, possessed a potent antitumor effect and named this byproduct miRNA sequence "MIRTX." MIRTX directly targeted the 3'-UTR of CXCR2 and PIK3R1 mRNA and suppressed the NF-κB signaling pathway in KRAS -mutated colorectal cancer cells. MIRTX induced apoptosis in DLD1 with downregulation of antiapoptotic BCL2, BCL-xL, and MCL1 and upregulation of cleaved caspase-3 and cleaved PARP. In mouse xenograft models, systemic administration of MIRTX using a super carbonate apatite as a delivery vehicle significantly inhibited tumor growth of DLD1 and HT29 cells without any particular toxicities. In conclusion, these findings indicate that inhibition of NF-κB signaling by this novel miRNA-based therapeutic could be a promising treatment against refractory KRAS -mutant colorectal cancer and KRAS wild-type colorectal cancer. Mol Cancer Ther; 17(5); 977-87. ©2018 AACR . ©2018 American Association for Cancer Research.
Kumar, Rakesh; Mandal, B; Geetanjali, A S; Jain, R K; Jaiwal, P K
2010-08-01
Watermelon bud necrosis virus (WBNV), a member of the genus Tospovirus, family Bunyaviridae is an important viral pathogen in watermelon cultivation in India. The complete genome sequence properties of WBNV are not available. In the present study, the complete M RNA sequence and the genome organisation of a WBNV isolate infecting watermelon in Delhi (WBNV-wDel) were determined. The M RNA was 4,794 nucleotides (nt) long and potentially coded for a movement protein (NSm) of 34.22 kDa (307 amino acids) on the viral sense strand and a Gn/Gc glycoprotein precursor of 127.15 kDa (1,121 amino acids) on the complementary strand. The two open reading frames were separated by an intergenic region of 402 nt. The 5' and 3' untranslated regions were 55 and 47 nt long, respectively, containing complementary termini typical of tospoviruses. WBNV-wDel was most closely related (79.1% identity) to Groundnut bud necrosis virus, an important tospovirus that occurs in several crops in India, and was different (63.3-75.2% identity) from the other cucurbit-infecting tospoviruses known to occur in Taiwan and Japan. Sequence analysis of NSm and Gn/Gc revealed phylogenetic incongruence between WBNV-wDel and another isolate originating from central India (WBNV-Wm-Som isolate). The Wm-Som isolate showed evolutionary divergence from the wDel isolate in the Gn/Gc protein (74.6% identity) potentially due to recombination with the other tospoviruses that are known to occur in India. This is the first report of a comparison of complete sequences of M RNA of WBNV.
Figueroa-Montiel, Andrea; Ramos, Marco A; Mares, Rosa E; Dueñas, Salvador; Pimienta, Genaro; Ortiz, Ernesto; Possani, Lourival D; Licea-Navarro, Alexei F
2016-01-01
Small peptides isolated from the venom of the marine snails belonging to the genus Conus have been largely studied because of their therapeutic value. These peptides can be classified in two groups. The largest one is composed by peptides rich in disulfide bonds, and referred to as conotoxins. Despite the importance of conotoxins given their pharmacology value, little is known about the protein disulfide isomerase (PDI) enzymes that are required to catalyze their correct folding. To discover the PDIs that may participate in the folding and structural maturation of conotoxins, the transcriptomes of the venom duct of four different species of Conus from the peninsula of Baja California (Mexico) were assembled. Complementary DNA (cDNA) libraries were constructed for each species and sequenced using a Genome Analyzer Illumina platform. The raw RNA-seq data was converted into transcript sequences using Trinity, a de novo assembler that allows the grouping of reads into contigs without a reference genome. An N50 value of 605 was established as a reference for future assemblies of Conus transcriptomes using this software. Transdecoder was used to extract likely coding sequences from Trinity transcripts, and PDI-specific sequence motif "APWCGHCK" was used to capture potential PDIs. An in silico analysis was performed to characterize the group of PDI protein sequences encoded by the duct-transcriptome of each species. The computational approach entailed a structural homology characterization, based on the presence of functional Thioredoxin-like domains. Four different PDI families were characterized, which are constituted by a total of 41 different gene sequences. The sequences had an average of 65% identity with other PDIs. Using MODELLER 9.14, the homology-based three-dimensional structure prediction of a subset of the sequences reported, showed the expected thioredoxin fold which was confirmed by a "simulated annealing" method.
2016-12-01
based complementary filter developed at the Naval Postgraduate School, is developed. The performance of a consumer-grade nine-degrees-of-freedom IMU...measurement unit, complementary filter , gait phase detection, zero velocity update, MEMS, IMU, AHRS, GPS denied, distributed sensor, virtual sensor...algorithm and quaternion-based complementary filter developed at the Naval Postgraduate School, is developed. The performance of a consumer-grade nine
Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription
Beerens, Nancy; Kjems, Jørgen
2010-01-01
Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859
Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.
1999-01-01
A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.
Croteau, Rodney Bruce; Crock, John E.
2005-01-25
A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.
The Construction of Impossibility: A Logic-Based Analysis of Conjuring Tricks
Smith, Wally; Dignum, Frank; Sonenberg, Liz
2016-01-01
Psychologists and cognitive scientists have long drawn insights and evidence from stage magic about human perceptual and attentional errors. We present a complementary analysis of conjuring tricks that seeks to understand the experience of impossibility that they produce. Our account is first motivated by insights about the constructional aspects of conjuring drawn from magicians' instructional texts. A view is then presented of the logical nature of impossibility as an unresolvable contradiction between a perception-supported belief about a situation and a memory-supported expectation. We argue that this condition of impossibility is constructed not simply through misperceptions and misattentions, but rather it is an outcome of a trick's whole structure of events. This structure is conceptualized as two parallel event sequences: an effect sequence that the spectator is intended to believe; and a method sequence that the magician understands as happening. We illustrate the value of this approach through an analysis of a simple close-up trick, Martin Gardner's Turnabout. A formalism called propositional dynamic logic is used to describe some of its logical aspects. This elucidates the nature and importance of the relationship between a trick's effect sequence and its method sequence, characterized by the careful arrangement of four evidence relationships: similarity, perceptual equivalence, structural equivalence, and congruence. The analysis further identifies two characteristics of magical apparatus that enable the construction of apparent impossibility: substitutable elements and stable occlusion. PMID:27378959
Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P
2017-03-01
Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.
Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.
1993-01-01
Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \
Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V
2015-01-01
Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.
Saeed, Isaam; Tang, Sen-Lin; Halgamuge, Saman K.
2012-01-01
An approach to infer the unknown microbial population structure within a metagenome is to cluster nucleotide sequences based on common patterns in base composition, otherwise referred to as binning. When functional roles are assigned to the identified populations, a deeper understanding of microbial communities can be attained, more so than gene-centric approaches that explore overall functionality. In this study, we propose an unsupervised, model-based binning method with two clustering tiers, which uses a novel transformation of the oligonucleotide frequency-derived error gradient and GC content to generate coarse groups at the first tier of clustering; and tetranucleotide frequency to refine these groups at the secondary clustering tier. The proposed method has a demonstrated improvement over PhyloPythia, S-GSOM, TACOA and TaxSOM on all three benchmarks that were used for evaluation in this study. The proposed method is then applied to a pyrosequenced metagenomic library of mud volcano sediment sampled in southwestern Taiwan, with the inferred population structure validated against complementary sequencing of 16S ribosomal RNA marker genes. Finally, the proposed method was further validated against four publicly available metagenomes, including a highly complex Antarctic whale-fall bone sample, which was previously assumed to be too complex for binning prior to functional analysis. PMID:22180538
Cryptic Hepatitis B and E in Patients With Acute Hepatitis of Unknown Etiology.
Ganova-Raeva, Lilia; Punkova, Lili; Campo, David S; Dimitrova, Zoya; Skums, Pavel; Vu, Nga H; Dat, Do T; Dalton, Harry R; Khudyakov, Yury
2015-12-15
Up to 30% of acute viral hepatitis has no known etiology. To determine the disease etiology in patients with acute hepatitis of unknown etiology (HUE), serum specimens were obtained from 38 patients residing in the United Kingdom and Vietnam and from 26 healthy US blood donors. All specimens tested negative for known viral infections causing hepatitis, using commercially available serological and nucleic acid assays. Specimens were processed by sequence-independent complementary DNA amplification and next-generation sequencing (NGS). Sufficient material for individual NGS libraries was obtained from 12 HUE cases and 26 blood donors; the remaining HUE cases were sequenced as a pool. Read mapping was done by targeted and de novo assembly. Sequences from hepatitis B virus (HBV) were detected in 7 individuals with HUE (58.3%) and the pooled library, and hepatitis E virus (HEV) was detected in 2 individuals with HUE (16.7%) and the pooled library. Both HEV-positive cases were coinfected with HBV. HBV sequences belonged to genotypes A, D, or G, and HEV sequences belonged to genotype 3. No known hepatotropic viruses were detected in the tested normal human sera. NGS-based detection of HBV and HEV infections is more sensitive than using commercially available assays. HBV and HEV may be cryptically associated with HUE. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
pico-PLAZA, a genome database of microbial photosynthetic eukaryotes.
Vandepoele, Klaas; Van Bel, Michiel; Richard, Guilhem; Van Landeghem, Sofie; Verhelst, Bram; Moreau, Hervé; Van de Peer, Yves; Grimsley, Nigel; Piganeau, Gwenael
2013-08-01
With the advent of next generation genome sequencing, the number of sequenced algal genomes and transcriptomes is rapidly growing. Although a few genome portals exist to browse individual genome sequences, exploring complete genome information from multiple species for the analysis of user-defined sequences or gene lists remains a major challenge. pico-PLAZA is a web-based resource (http://bioinformatics.psb.ugent.be/pico-plaza/) for algal genomics that combines different data types with intuitive tools to explore genomic diversity, perform integrative evolutionary sequence analysis and study gene functions. Apart from homologous gene families, multiple sequence alignments, phylogenetic trees, Gene Ontology, InterPro and text-mining functional annotations, different interactive viewers are available to study genome organization using gene collinearity and synteny information. Different search functions, documentation pages, export functions and an extensive glossary are available to guide non-expert scientists. To illustrate the versatility of the platform, different case studies are presented demonstrating how pico-PLAZA can be used to functionally characterize large-scale EST/RNA-Seq data sets and to perform environmental genomics. Functional enrichments analysis of 16 Phaeodactylum tricornutum transcriptome libraries offers a molecular view on diatom adaptation to different environments of ecological relevance. Furthermore, we show how complementary genomic data sources can easily be combined to identify marker genes to study the diversity and distribution of algal species, for example in metagenomes, or to quantify intraspecific diversity from environmental strains. © 2013 John Wiley & Sons Ltd and Society for Applied Microbiology.
Wang, Fenglei; Liu, Huijuan; Wan, Yi; Li, Jing; Chen, Yu; Zheng, Jusheng; Huang, Tao; Li, Duo
2017-03-23
Age of complementary foods introduction is associated with childhood anemia, but the ideal age for the introduction of complementary foods to infants is a continuing topic of debate. We examined the longitudinal association between complementary foods introduction age and risk of anemia in 18,446 children from the Jiaxing Birth Cohort, who had detailed complementary feeding records at 3 and 6 months of age and had hemoglobin concentrations measured at 4-6 years. Early introduction of complementary foods at 3-6 months of age was significantly associated with a higher risk of anemia (odds ratio = 1.14; 95% confidence interval: 1.01-1.28) and a lower hemoglobin concentration of -0.84 g/L (95% confidence interval: -1.33 to -0.35) in children aged 4-6 years, compared with those fed complementary foods starting at 6 months of age. When it comes to the specific type of complementary foods, early introduction of all plant-based foods was associated with increased anemia risks and lower hemoglobin concentrations, while early introduction of most animal-based foods was not. These findings may be informative regarding the appropriate time to introduce complementary foods in infants.
DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA
Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo
1971-01-01
The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808
Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan
2012-04-20
In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.
Solid phase sequencing of double-stranded nucleic acids
Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.
2002-01-01
This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.
Induction of vitellogenin (VTG) in oviparous animals has been proposed as a sensitive indicator of invironmental contaminants that activate the estrogen receptor. In the present study, a sensitive ribonuclease protection assay (RPA) for VTG messenger RNA (mRNA) was developed for ...
Comparative study of switchgrass cultivars using RNA sequencing technology
USDA-ARS?s Scientific Manuscript database
Switchgrass (Panicum virgatum L.) is a C4 perennial grass, identified as a promising bioenergy crop. Switchgrass exists in two ecotypes, upland and lowland, which are heterotic, or genetically complementary to each other. The objectives of this study are to assess the potential of SNP markers as a b...
USDA-ARS?s Scientific Manuscript database
A genome-wide association study (GWAS) is the foremost strategy used for finding genes that control human diseases and agriculturally important traits, but it often reports false positives. In contrast, its complementary method, linkage analysis, provides direct genetic confirmation, but with limite...
Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner
USDA-ARS?s Scientific Manuscript database
A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...
Signatures of selection among sex-determining alleles of the honey bee.
Hasselmann, Martin; Beye, Martin
2004-04-06
Patterns of DNA polymorphisms are a primary tool for dissecting signatures of selection; however, the underlying selective forces are poorly understood for most genes. A classical example of diversifying selection is the complementary sex-determining locus that is found in the very large insect order Hymenoptera (bees, wasps, ants, and sawflies). The gene responsible for sex determination, the complementary sex determiner (csd), has been most recently identified in the honey bee. Females are heterozygous at this locus. Males result when there is only one functional allele present, as a result of either homozygosity (fertilized eggs) or, more commonly, hemizygosity (unfertilized eggs). The homozygotes, diploid males, do not reproduce and have zero fitness, which implies positive selection in favor of rare alleles. Large differences in csd cDNA sequences within and between four populations were found that fall into two major groups, types I and II. Type I consists of several allelic lineages that were maintained over an extended period, an indication of balancing selection. Diversifying selection has operated on several confined parts of the protein, as shown by an excess of nonsynonymous differences. Elevated sequence differences indicate another selected part near a repeat region. These findings have general implications about the understanding of both the function of the multiallelic mechanism and the adaptive processes on the level of nucleotide sequences. Moreover, the first csd sequence data are a notable basis for the avoidance of diploid males in bee selection programs by allele-assisted breeding.
Design of Decorated Self-Assembling Peptide Hydrogels as Architecture for Mesenchymal Stem Cells
Zamuner, Annj; Cavo, Marta; Scaglione, Silvia; Messina, Grazia Maria Lucia; Russo, Teresa; Gloria, Antonio; Marletta, Giovanni; Dettin, Monica
2016-01-01
Hydrogels from self-assembling ionic complementary peptides have been receiving a lot of interest from the scientific community as mimetic of the extracellular matrix that can offer three-dimensional supports for cell growth or can become vehicles for the delivery of stem cells, drugs or bioactive proteins. In order to develop a 3D “architecture” for mesenchymal stem cells, we propose the introduction in the hydrogel of conjugates obtained by chemoselective ligation between a ionic-complementary self-assembling peptide (called EAK) and three different bioactive molecules: an adhesive sequence with 4 Glycine-Arginine-Glycine-Aspartic Acid-Serine-Proline (GRGDSP) motifs per chain, an adhesive peptide mapped on h-Vitronectin and the growth factor Insulin-like Growth Factor-1 (IGF-1). The mesenchymal stem cell adhesion assays showed a significant increase in adhesion and proliferation for the hydrogels decorated with each of the synthesized conjugates; moreover, such functionalized 3D hydrogels support cell spreading and elongation, validating the use of this class of self-assembly peptides-based material as very promising 3D model scaffolds for cell cultures, at variance of the less realistic 2D ones. Furthermore, small amplitude oscillatory shear tests showed that the presence of IGF-1-conjugate did not alter significantly the viscoelastic properties of the hydrogels even though differences were observed in the nanoscale structure of the scaffolds obtained by changing their composition, ranging from long, well-defined fibers for conjugates with adhesion sequences to the compact and dense film for the IGF-1-conjugate. PMID:28773852
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Hoy, M.S.; Kelly, K.; Rodriguez, R.J.
2010-01-01
A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.
De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria
2013-01-01
Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541
Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs
Shen, Xiulong; Corey, David R
2018-01-01
Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946
Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J
2013-07-25
A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.
Optimizing the specificity of nucleic acid hybridization.
Zhang, David Yu; Chen, Sherry Xi; Yin, Peng
2012-01-22
The specific hybridization of complementary sequences is an essential property of nucleic acids, enabling diverse biological and biotechnological reactions and functions. However, the specificity of nucleic acid hybridization is compromised for long strands, except near the melting temperature. Here, we analytically derived the thermodynamic properties of a hybridization probe that would enable near-optimal single-base discrimination and perform robustly across diverse temperature, salt and concentration conditions. We rationally designed 'toehold exchange' probes that approximate these properties, and comprehensively tested them against five different DNA targets and 55 spurious analogues with energetically representative single-base changes (replacements, deletions and insertions). These probes produced discrimination factors between 3 and 100+ (median, 26). Without retuning, our probes function robustly from 10 °C to 37 °C, from 1 mM Mg(2+) to 47 mM Mg(2+), and with nucleic acid concentrations from 1 nM to 5 µM. Experiments with RNA also showed effective single-base change discrimination.
Characterizing protein domain associations by Small-molecule ligand binding
Li, Qingliang; Cheng, Tiejun; Wang, Yanli; Bryant, Stephen H.
2012-01-01
Background Protein domains are evolutionarily conserved building blocks for protein structure and function, which are conventionally identified based on protein sequence or structure similarity. Small molecule binding domains are of great importance for the recognition of small molecules in biological systems and drug development. Many small molecules, including drugs, have been increasingly identified to bind to multiple targets, leading to promiscuous interactions with protein domains. Thus, a large scale characterization of the protein domains and their associations with respect to small-molecule binding is of particular interest to system biology research, drug target identification, as well as drug repurposing. Methods We compiled a collection of 13,822 physical interactions of small molecules and protein domains derived from the Protein Data Bank (PDB) structures. Based on the chemical similarity of these small molecules, we characterized pairwise associations of the protein domains and further investigated their global associations from a network point of view. Results We found that protein domains, despite lack of similarity in sequence and structure, were comprehensively associated through binding the same or similar small-molecule ligands. Moreover, we identified modules in the domain network that consisted of closely related protein domains by sharing similar biochemical mechanisms, being involved in relevant biological pathways, or being regulated by the same cognate cofactors. Conclusions A novel protein domain relationship was identified in the context of small-molecule binding, which is complementary to those identified by traditional sequence-based or structure-based approaches. The protein domain network constructed in the present study provides a novel perspective for chemogenomic study and network pharmacology, as well as target identification for drug repurposing. PMID:23745168
Chloroplast DNA codon use: evidence for selection at the psb A locus based on tRNA availability.
Morton, B R
1993-09-01
Codon use in the three sequenced chloroplast genomes (Marchantia, Oryza, and Nicotiana) is examined. The chloroplast has a bias in that codons NNA and NNT are favored over synonymous NNC and NNG codons. This appears to be a consequence of an overall high A + T content of the genome. This pattern of codon use is not followed by the psb A gene of all three genomes and other psb A sequences examined. In this gene, the codon use favors NNC over NNT for twofold degenerate amino acids. In each case the only tRNA coded by the genome is complementary to the NNC codon. This codon use is similar to the codon use by chloroplast genes examined from Chlamydomonas reinhardtii. Since psb A is the major translation product of the chloroplast, this suggests that selection is acting on the codon use of this gene to adapt codons to tRNA availability, as previously suggested for unicellular organisms.
Sudheera, Y; Vishnu Vardhan, G P; Hema, M; Krishna Reddy, M; Sreenivasulu, P
2014-01-01
A virus isolate associated with yellow mosaic disease was purified from commercially cultivated jasmine (Jasminum sambac) from Andhra Pradesh, India and it contained flexuous filamentous particles of ~720 × 13 nm. The denatured purified virus had single major polypeptide of molecular weight 32 kDa. Complementary DNA representing 1678 nucleotides (nt) of the 3' terminus of viral RNA was cloned and sequenced. Comparisons of complete coat protein (CP) gene nucleotide and amino acid sequences of the present virus isolate with certain reported potyviruses revealed 86.1 and 92.7 % identity, respectively with jasmine potyvirus T (JaVT) reported from Taiwan and less than 70 % with other potyviruses. Based on the phylogenetic analysis of 3' UTR and CP gene, the present virus isolate was identified as an isolate of JaVT that belongs to the genus Potyvirus and the name Jasmine yellow mosaic virus-Andhra Pradesh (JaYMV-AP) is proposed.
An AAA-DDD triply hydrogen-bonded complex easily accessible for supramolecular polymers.
Han, Yi-Fei; Chen, Wen-Qiang; Wang, Hong-Bo; Yuan, Ying-Xue; Wu, Na-Na; Song, Xiang-Zhi; Yang, Lan
2014-12-15
For a complementary hydrogen-bonded complex, when every hydrogen-bond acceptor is on one side and every hydrogen-bond donor is on the other, all secondary interactions are attractive and the complex is highly stable. AAA-DDD (A=acceptor, D=donor) is considered to be the most stable among triply hydrogen-bonded sequences. The easily synthesized and further derivatized AAA-DDD system is very desirable for hydrogen-bonded functional materials. In this case, AAA and DDD, starting from 4-methoxybenzaldehyde, were synthesized with the Hantzsch pyridine synthesis and Friedländer annulation reaction. The association constant determined by fluorescence titration in chloroform at room temperature is 2.09×10(7) M(-1) . The AAA and DDD components are not coplanar, but form a V shape in the solid state. Supramolecular polymers based on AAA-DDD triply hydrogen bonded have also been developed. This work may make AAA-DDD triply hydrogen-bonded sequences easily accessible for stimuli-responsive materials. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Le, Binh Huy; Seo, Young Jun
2018-01-25
We have developed a gold nanoparticle (AuNP)-based CTG repeat probing system displaying high quenching capability and combined it with isothermal amplification for the detection of miRNA 146a. This method of using a AuNP-based CTG repeat probing system with isothermal amplification allowed the highly sensitive (14 aM) and selective detection of miRNA 146a. A AuNP-based CTG repeat probing system having a hairpin structure and a dT F fluorophore exhibited highly efficient quenching because the CTG repeat-based stable hairpin structure imposed a close distance between the AuNP and the dT F residue. A small amount of miRNA 146a induced multiple copies of the CAG repeat sequence during rolling circle amplification; the AuNP-based CTG repeat probing system then bound to the complementary multiple-copy CAG repeat sequence, thereby inducing a structural change from a hairpin to a linear structure with amplified fluorescence. This AuNP-based CTG probing system combined with isothermal amplification could also discriminate target miRNA 146a from one- and two-base-mismatched miRNAs (ORN 1 and ORN 2, respectively). This simple AuNP-based CTG probing system, combined with isothermal amplification to induce a highly sensitive change in fluorescence, allows the detection of miRNA 146a with high sensitivity (14 aM) and selectivity. Copyright © 2017 Elsevier B.V. All rights reserved.
Zheng, Xiasheng; Zhang, Peng; Liao, Baosheng; Li, Jing; Liu, Xingyun; Shi, Yuhua; Cheng, Jinle; Lai, Zhitian; Xu, Jiang; Chen, Shilin
2017-01-01
Herbal medicine is a major component of complementary and alternative medicine, contributing significantly to the health of many people and communities. Quality control of herbal medicine is crucial to ensure that it is safe and sound for use. Here, we investigated a comprehensive quality evaluation system for a classic herbal medicine, Danggui Buxue Formula, by applying genetic-based and analytical chemistry approaches to authenticate and evaluate the quality of its samples. For authenticity, we successfully applied two novel technologies, third-generation sequencing and PCR-DGGE (denaturing gradient gel electrophoresis), to analyze the ingredient composition of the tested samples. For quality evaluation, we used high performance liquid chromatography assays to determine the content of chemical markers to help estimate the dosage relationship between its two raw materials, plant roots of Huangqi and Danggui. A series of surveys were then conducted against several exogenous contaminations, aiming to further access the efficacy and safety of the samples. In conclusion, the quality evaluation system demonstrated here can potentially address the authenticity, quality, and safety of herbal medicines, thus providing novel insight for enhancing their overall quality control. Highlight: We established a comprehensive quality evaluation system for herbal medicine, by combining two genetic-based approaches third-generation sequencing and DGGE (denaturing gradient gel electrophoresis) with analytical chemistry approaches to achieve the authentication and quality connotation of the samples. PMID:28955365
Zheng, Xiasheng; Zhang, Peng; Liao, Baosheng; Li, Jing; Liu, Xingyun; Shi, Yuhua; Cheng, Jinle; Lai, Zhitian; Xu, Jiang; Chen, Shilin
2017-01-01
Herbal medicine is a major component of complementary and alternative medicine, contributing significantly to the health of many people and communities. Quality control of herbal medicine is crucial to ensure that it is safe and sound for use. Here, we investigated a comprehensive quality evaluation system for a classic herbal medicine, Danggui Buxue Formula, by applying genetic-based and analytical chemistry approaches to authenticate and evaluate the quality of its samples. For authenticity, we successfully applied two novel technologies, third-generation sequencing and PCR-DGGE (denaturing gradient gel electrophoresis), to analyze the ingredient composition of the tested samples. For quality evaluation, we used high performance liquid chromatography assays to determine the content of chemical markers to help estimate the dosage relationship between its two raw materials, plant roots of Huangqi and Danggui. A series of surveys were then conducted against several exogenous contaminations, aiming to further access the efficacy and safety of the samples. In conclusion, the quality evaluation system demonstrated here can potentially address the authenticity, quality, and safety of herbal medicines, thus providing novel insight for enhancing their overall quality control. Highlight : We established a comprehensive quality evaluation system for herbal medicine, by combining two genetic-based approaches third-generation sequencing and DGGE (denaturing gradient gel electrophoresis) with analytical chemistry approaches to achieve the authentication and quality connotation of the samples.
Chowdhury, Shomeek; Zhang, Jian; Kurgan, Lukasz
2018-05-28
Deciphering a complete landscape of protein-RNA interactions in the human proteome remains an elusive challenge. We computationally elucidate RNA binding proteins (RBPs) using an approach that complements previous efforts. We employ two modern complementary sequence-based methods that provide accurate predictions from the structured and the intrinsically disordered sequences, even in the absence of sequence similarity to the known RBPs. We generate and analyze putative RNA binding residues on the whole proteome scale. Using a conservative setting that ensures low, 5% false positive rate, we identify 1511 putative RBPs that include 281 known RBPs and 166 RBPs that were previously predicted. We empirically demonstrate that these overlaps are statistically significant. We also validate the putative RBPs based on two major hallmarks of their RNA binding residues: high levels of evolutionary conservation and enrichment in charged amino acids. Moreover, we show that the novel RBPs are significantly under-annotated functionally which coincides with the fact that they were not yet found to interact with RNAs. We provide two examples of our novel putative RBPs for which there is recent evidence of their interactions with RNAs. The dataset of novel putative RBPs and RNA binding residues for the future hypothesis generation is provided in the Supporting Information. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
No evidence for MHC class II-based non-random mating at the gametic haplotype in Atlantic salmon.
Promerová, M; Alavioon, G; Tusso, S; Burri, R; Immler, S
2017-06-01
Genes of the major histocompatibility complex (MHC) are a likely target of mate choice because of their role in inbreeding avoidance and potential benefits for offspring immunocompetence. Evidence for female choice for complementary MHC alleles among competing males exists both for the pre- and the postmating stages. However, it remains unclear whether the latter may involve non-random fusion of gametes depending on gametic haplotypes resulting in transmission ratio distortion or non-random sequence divergence among fused gametes. We tested whether non-random gametic fusion of MHC-II haplotypes occurs in Atlantic salmon Salmo salar. We performed in vitro fertilizations that excluded interindividual sperm competition using a split family design with large clutch sample sizes to test for a possible role of the gametic haplotype in mate choice. We sequenced two MHC-II loci in 50 embryos per clutch to assess allelic frequencies and sequence divergence. We found no evidence for transmission ratio distortion at two linked MHC-II loci, nor for non-random gamete fusion with respect to MHC-II alleles. Our findings suggest that the gametic MHC-II haplotypes play no role in gamete association in Atlantic salmon and that earlier findings of MHC-based mate choice most likely reflect choice among diploid genotypes. We discuss possible explanations for these findings and how they differ from findings in mammals.
A new age in functional genomics using CRISPR/Cas9 in arrayed library screening.
Agrotis, Alexander; Ketteler, Robin
2015-01-01
CRISPR technology has rapidly changed the face of biological research, such that precise genome editing has now become routine for many labs within several years of its initial development. What makes CRISPR/Cas9 so revolutionary is the ability to target a protein (Cas9) to an exact genomic locus, through designing a specific short complementary nucleotide sequence, that together with a common scaffold sequence, constitute the guide RNA bridging the protein and the DNA. Wild-type Cas9 cleaves both DNA strands at its target sequence, but this protein can also be modified to exert many other functions. For instance, by attaching an activation domain to catalytically inactive Cas9 and targeting a promoter region, it is possible to stimulate the expression of a specific endogenous gene. In principle, any genomic region can be targeted, and recent efforts have successfully generated pooled guide RNA libraries for coding and regulatory regions of human, mouse and Drosophila genomes with high coverage, thus facilitating functional phenotypic screening. In this review, we will highlight recent developments in the area of CRISPR-based functional genomics and discuss potential future directions, with a special focus on mammalian cell systems and arrayed library screening.
Miller, Webb; Hayes, Vanessa M.; Ratan, Aakrosh; Petersen, Desiree C.; Wittekindt, Nicola E.; Miller, Jason; Walenz, Brian; Knight, James; Qi, Ji; Zhao, Fangqing; Wang, Qingyu; Bedoya-Reina, Oscar C.; Katiyar, Neerja; Tomsho, Lynn P.; Kasson, Lindsay McClellan; Hardie, Rae-Anne; Woodbridge, Paula; Tindall, Elizabeth A.; Bertelsen, Mads Frost; Dixon, Dale; Pyecroft, Stephen; Helgen, Kristofer M.; Lesk, Arthur M.; Pringle, Thomas H.; Patterson, Nick; Zhang, Yu; Kreiss, Alexandre; Woods, Gregory M.; Jones, Menna E.; Schuster, Stephan C.
2011-01-01
The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction because of a contagious cancer known as Devil Facial Tumor Disease. The inability to mount an immune response and to reject these tumors might be caused by a lack of genetic diversity within a dwindling population. Here we report a whole-genome analysis of two animals originating from extreme northwest and southeast Tasmania, the maximal geographic spread, together with the genome from a tumor taken from one of them. A 3.3-Gb de novo assembly of the sequence data from two complementary next-generation sequencing platforms was used to identify 1 million polymorphic genomic positions, roughly one-quarter of the number observed between two genetically distant human genomes. Analysis of 14 complete mitochondrial genomes from current and museum specimens, as well as mitochondrial and nuclear SNP markers in 175 animals, suggests that the observed low genetic diversity in today's population preceded the Devil Facial Tumor Disease disease outbreak by at least 100 y. Using a genetically characterized breeding stock based on the genome sequence will enable preservation of the extant genetic diversity in future Tasmanian devil populations. PMID:21709235
Genome scale transcriptomics of baculovirus-insect interactions.
Nguyen, Quan; Nielsen, Lars K; Reid, Steven
2013-11-12
Baculovirus-insect cell technologies are applied in the production of complex proteins, veterinary and human vaccines, gene delivery vectors' and biopesticides. Better understanding of how baculoviruses and insect cells interact would facilitate baculovirus-based production. While complete genomic sequences are available for over 58 baculovirus species, little insect genomic information is known. The release of the Bombyx mori and Plutella xylostella genomes, the accumulation of EST sequences for several Lepidopteran species, and especially the availability of two genome-scale analysis tools, namely oligonucleotide microarrays and next generation sequencing (NGS), have facilitated expression studies to generate a rich picture of insect gene responses to baculovirus infections. This review presents current knowledge on the interaction dynamics of the baculovirus-insect system' which is relatively well studied in relation to nucleocapsid transportation, apoptosis, and heat shock responses, but is still poorly understood regarding responses involved in pro-survival pathways, DNA damage pathways, protein degradation, translation, signaling pathways, RNAi pathways, and importantly metabolic pathways for energy, nucleotide and amino acid production. We discuss how the two genome-scale transcriptomic tools can be applied for studying such pathways and suggest that proteomics and metabolomics can produce complementary findings to transcriptomic studies.
Transterm: a database to aid the analysis of regulatory sequences in mRNAs
Jacobs, Grant H.; Chen, Augustine; Stevens, Stewart G.; Stockwell, Peter A.; Black, Michael A.; Tate, Warren P.; Brown, Chris M.
2009-01-01
Messenger RNAs, in addition to coding for proteins, may contain regulatory elements that affect how the protein is translated. These include protein and microRNA-binding sites. Transterm (http://mRNA.otago.ac.nz/Transterm.html) is a database of regions and elements that affect translation with two major unique components. The first is integrated results of analysis of general features that affect translation (initiation, elongation, termination) for species or strains in Genbank, processed through a standard pipeline. The second is curated descriptions of experimentally determined regulatory elements that function as translational control elements in mRNAs. Transterm focuses on protein binding sites, particularly those in 3′-untranslated regions (3′-UTR). For this release the interface has been extensively updated based on user feedback. The data is now accessible by strain rather than species, for example there are 10 Escherichia coli strains (genomes) analysed separately. In addition to providing a repository of data, the database also provides tools for users to query their own mRNA sequences. Users can search sequences for Transterm or user defined regulatory elements, including protein or miRNA targets. Transterm also provides a central core of links to related resources for complementary analyses. PMID:18984623
Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D
2011-03-07
For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.
Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.
Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B
1991-01-01
A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797
... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... and gemcitabine in patients with advanced solid tumors. Evidence-Based Complementary and Alternative Medicine. 2013;2013:964592. National ...
... Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on complementary and integrative practices and a ... 495. Holland S, Silberstein SD, Freitag F, et al. Evidence-based guideline update: NSAIDs and other complementary treatments for ...
Templeman, Kate; Robinson, Anske; McKenna, Lisa
2016-09-01
The aim of this study was to identify Australian medical students' complementary medicine information needs. Thirty medical students from 10 medical education faculties across Australian universities were recruited. Data were generated using in-depth semi-structured interviews and constructivist grounded theory method was used to analyze and construct data. Students sought complementary medicine information from a range of inadequate sources, such as pharmacological texts, Internet searches, peer-reviewed medical journals, and drug databases. The students identified that many complementary medicine resources may not be regarded as objective, reliable, differentiated, or comprehensive, leaving much that medical education needs to address. Most students sought succinct, easily accessible, evidence-based information to inform safe and appropriate clinical decisions about complementary medicines. A number of preferred resources were identified that can be recommended and actively promoted to medical students. Therefore, specific, evidence-based complementary medicine databases and secondary resources should be subscribed and recommended to medical schools and students, to assist meeting professional responsibilities regarding complementary medicines. These findings may help inform the development of appropriate medical information resources regarding complementary medicines. © 2016 John Wiley & Sons Australia, Ltd.
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
A Guide to the PLAZA 3.0 Plant Comparative Genomic Database.
Vandepoele, Klaas
2017-01-01
PLAZA 3.0 is an online resource for comparative genomics and offers a versatile platform to study gene functions and gene families or to analyze genome organization and evolution in the green plant lineage. Starting from genome sequence information for over 35 plant species, precomputed comparative genomic data sets cover homologous gene families, multiple sequence alignments, phylogenetic trees, and genomic colinearity information within and between species. Complementary functional data sets, a Workbench, and interactive visualization tools are available through a user-friendly web interface, making PLAZA an excellent starting point to translate sequence or omics data sets into biological knowledge. PLAZA is available at http://bioinformatics.psb.ugent.be/plaza/ .
Discovering complementary colors from the perspective of steam education
NASA Astrophysics Data System (ADS)
Karabey, Burak; Yigit Koyunkaya, Melike; Enginoglu, Turan; Yurumezoglu, Kemal
2018-05-01
This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of complementary colors accessible to all through practical applications and provides a multidisciplinary, integrated and innovative technique of teaching the subject of colors, which could be used to teach complementary colors.
Enhancing the performance of coherent OTDR systems with polarization diversity complementary codes.
Dorize, Christian; Awwad, Elie
2018-05-14
Monitoring the optical phase change in a fiber enables a wide range of applications where fast phase variations are induced by acoustic signals or by vibrations in general. However, the quality of the estimated fiber response strongly depends on the method used to modulate the light sent to the fiber and capture the variations of the optical field. In this paper, we show that distributed optical fiber sensing systems can advantageously exploit techniques from the telecommunication domain, as those used in coherent optical transmission, to enhance their performance in detecting mechanical events, while jointly offering a simpler setup than widespread pulse-cloning or spectral-sweep based schemes with acousto-optic modulators. We periodically capture an overall fiber Jones matrix estimate thanks to a novel probing technique using two mutually orthogonal complementary (Golay) pairs of binary sequences applied simultaneously in phase and quadrature on two orthogonal polarization states. A perfect channel response estimation of the sensor array is achieved, subject to conditions detailed in the paper, thus enhancing the sensitivity and bandwidth of coherent ϕ-OTDR systems. High sensitivity, linear response, and bandwidth coverage up to 18 kHz are demonstrated with a sensor array composed of 10 fiber Bragg gratings (FBGs).
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Enhancing the performance of coherent OTDR systems with polarization diversity complementary codes
NASA Astrophysics Data System (ADS)
Dorize, Christian; Awwad, Elie
2018-05-01
Monitoring the optical phase change in a fiber enables a wide range of applications where fast phase variations are induced by acoustic signals or vibrations in general. However, the quality of the estimated fiber response strongly depends on the method used to modulate the light sent to the fiber and capture the variations of the optical field. In this paper, we show that distributed optical fiber sensing systems can advantageously exploit techniques from the telecommunication domain, as those used in coherent optical transmission, to enhance their performance in detecting mechanical events, while jointly offering a simpler setup than widespread pulse-cloning or spectral-sweep based schemes with acousto-optic modulators. We periodically capture an overall fiber Jones matrix estimate thanks to a novel probing technique using two mutually orthogonal complementary (Golay) pairs of binary sequences applied simultaneously in phase and quadrature on two orthogonal polarization states. A perfect channel response estimation of the sensor array is achieved, subject to conditions detailed in the paper, thus enhancing the sensitivity and bandwidth of coherent phase-OTDR systems. High sensitivity, linear response, and bandwidth coverage up to 18 kHz are demonstrated with a sensor array composed of 10 fiber Bragg gratings (FBGs).
DOT National Transportation Integrated Search
2017-05-01
The IEEE 802.11ad waveform can be used for automotive radar by exploiting the Golay complementary sequences in the preamble of a frame. The performance of radar, however, is limited by the preamble structure. In this paper, we propose an adaptive pre...
Miller, Paul S.; Ts'o, Paul O.P.
1999-06-15
A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid and includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional.
Greenberg, Jay R.; Perry, Robert P.
1971-01-01
The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767
Topological Interaction by Entanglement of DNA
NASA Astrophysics Data System (ADS)
Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul
2012-02-01
We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.
Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang
2018-01-01
Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .
Multiple primary cancers of breast and cervix uteri: An epidemiological approach to analysis
Prior, P.; Waterhouse, J. A. H.
1981-01-01
Index sites of breast and cervix uteri were selected from populationbased data held at the West Midlands and Birmingham Regional Cancer Registry, and the expected numbers of second primary cancers in cervix and breast were computed (sequence analyses). In the breast series (17,756 patients) a small deficit of cervical tumours was observed (O = 16, E = 2·119, O/E = 0·76, P > 0·05), while in the cervix series (4817 patients) a small excess of breast tumours was found (O = 29, E = 23·38, O/E = 1·24, P > 0·05) over a period of 15 years. A theoretical statement of the combined risk of the 2 tumours occurring in the same individual of a general population was developed and was compared with the practical approach of summing the sequence analyses (complementary analysis). Complementary analysis indicated that there was no excess of women with the 2 primary tumours (O = 45, E = 44·57, O/E = 1·01) and that cancers of the breast and cervix uteri are not aetiologically related. PMID:7248147
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
Wu, Yabei; Lu, Huanzhang; Zhao, Fei; Zhang, Zhiyong
2016-01-01
Shape serves as an important additional feature for space target classification, which is complementary to those made available. Since different shapes lead to different projection functions, the projection property can be regarded as one kind of shape feature. In this work, the problem of estimating the projection function from the infrared signature of the object is addressed. We show that the projection function of any rotationally symmetric object can be approximately represented as a linear combination of some base functions. Based on this fact, the signal model of the emissivity-area product sequence is constructed, which is a particular mathematical function of the linear coefficients and micro-motion parameters. Then, the least square estimator is proposed to estimate the projection function and micro-motion parameters jointly. Experiments validate the effectiveness of the proposed method. PMID:27763500
Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila
2017-05-08
In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7 M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10 M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bateman, J.B.; Kojis, T.; Heinzmann, C.
1993-09-01
Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less
Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2
De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.
2013-01-01
SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
Theory and modeling of particles with DNA-mediated interactions
NASA Astrophysics Data System (ADS)
Licata, Nicholas A.
2008-05-01
In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua
2017-07-19
A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
High Throughput T Epitope Mapping and Vaccine Development
Li Pira, Giuseppina; Ivaldi, Federico; Moretti, Paolo; Manca, Fabrizio
2010-01-01
Mapping of antigenic peptide sequences from proteins of relevant pathogens recognized by T helper (Th) and by cytolytic T lymphocytes (CTL) is crucial for vaccine development. In fact, mapping of T-cell epitopes provides useful information for the design of peptide-based vaccines and of peptide libraries to monitor specific cellular immunity in protected individuals, patients and vaccinees. Nevertheless, epitope mapping is a challenging task. In fact, large panels of overlapping peptides need to be tested with lymphocytes to identify the sequences that induce a T-cell response. Since numerous peptide panels from antigenic proteins are to be screened, lymphocytes available from human subjects are a limiting factor. To overcome this limitation, high throughput (HTP) approaches based on miniaturization and automation of T-cell assays are needed. Here we consider the most recent applications of the HTP approach to T epitope mapping. The alternative or complementary use of in silico prediction and experimental epitope definition is discussed in the context of the recent literature. The currently used methods are described with special reference to the possibility of applying the HTP concept to make epitope mapping an easier procedure in terms of time, workload, reagents, cells and overall cost. PMID:20617148
Park, Eonyoung; Maquat, Lynne E
2013-01-01
Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.
Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho
2016-01-01
Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479
Functions of the 3′ and 5′ genome RNA regions of members of the genus Flavivirus
Brinton, Margo A.; Basu, Mausumi
2015-01-01
The positive sense genomes of members of the genus Flavivirus in the family Flaviviridae are ~11 kb nts in length and have a 5′ type I cap but no 3′ poly A. The 5′ and 3′ terminal regions contain short conserved sequences that are proposed to be repeated remnants of an ancient sequence. However, the functions of most of these conserved sequences have not yet been determined. The terminal regions of the genome also contain multiple conserved RNA structures. Functional data for many of these structures has been obtained. Three sets of complementary 3′ and 5′ terminal region sequences, some of which are located in conserved RNA structures, interact to form a panhandle structure that is required for initiation of minus strand RNA synthesis with the 5′ terminal structure functioning as the promoter. How the switch from the terminal RNA structure base pairing to the long distance RNA-RNA interaction is triggered and regulated is not well understood but evidence suggests involvement of a cell protein binding to three sites on the 3′ terminal RNA structures and a cis-acting metastable 3′ RNA element in the 3′ terminal structure. Cell proteins may also be involved in facilitating exponential replication of nascent genomic RNA within replication vesicles at later times of infection cycle. Other conserved RNA structures and/or sequences in the 5′ and 3′ terminal regions have been proposed to regulate genome translation. Additional functions of the 5′ and 3′ terminal sequences have also been reported. PMID:25683510
Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel
2010-01-01
The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585
NASA Astrophysics Data System (ADS)
Lee, Jooran; Choi, Sunyoung; Bae, Seon Joo; Yoon, Seok Min; Choi, Joon Sig; Yoon, Minjoong
2013-10-01
Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes.Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes. Electronic supplementary information (ESI) available: Synthesis of APTES-modified ZnO nanowires, DNA functionalization and spectroscopic measurements with additional fluorescence image ad fluorescence decay times, cell culture, injection of a single nanowire into living cells, subcellular imaging and determination of cytotoxicity. See DOI: 10.1039/c3nr03042c
Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B
1987-01-01
The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979
Detection of signals in mRNAs that influence translation.
Brown, Chris M; Jacobs, Grant; Stockwell, Peter; Schreiber, Mark
2003-01-01
Genome sequencing efforts mean that we now have extensive data from a wide range of organisms to study. Understanding the differing natures of the biology of these organisms is an important aim of genome analysis. We are interested in signals that affect translation of mRNAs. Some signals in the mRNA influence how efficiently it is translated into protein. Previous studies have indicated that many important signals are located around the initiation and termination codons. We have developed tools described here to extract the relevant sequence regions from GenBank. To create databases organised by species, or higher taxonomic groupings (eg planta), a program was developed to dynamically view and edit the taxonomy database. Data from relevant species were then extracted using our Genbank feature table parser. We analysed all available sequences, particularly those from complete genomes. Patterns were then identified using information theory. The software is available from http://transterm.otago.ac.nz. Patterns around the initiation codons for most of the organisms fall into two groups, containing the previously known Shine-Dalgarno and Kozaks efficiency signals. However, we have identified several organisms that appear to utilise novel systems. Our analysis indicates that some organisms with extremely high GC% genomes do not have a strong dependence on base pairing ribosome binding sites, as the complementary sequence is absent from many genes.
Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.
2001-01-01
cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.
2013-01-01
Background Besides the development of comprehensive tools for high-throughput 16S ribosomal RNA amplicon sequence analysis, there exists a growing need for protocols emphasizing alternative phylogenetic markers such as those representing eukaryotic organisms. Results Here we introduce CloVR-ITS, an automated pipeline for comparative analysis of internal transcribed spacer (ITS) pyrosequences amplified from metagenomic DNA isolates and representing fungal species. This pipeline performs a variety of steps similar to those commonly used for 16S rRNA amplicon sequence analysis, including preprocessing for quality, chimera detection, clustering of sequences into operational taxonomic units (OTUs), taxonomic assignment (at class, order, family, genus, and species levels) and statistical analysis of sample groups of interest based on user-provided information. Using ITS amplicon pyrosequencing data from a previous human gastric fluid study, we demonstrate the utility of CloVR-ITS for fungal microbiota analysis and provide runtime and cost examples, including analysis of extremely large datasets on the cloud. We show that the largest fractions of reads from the stomach fluid samples were assigned to Dothideomycetes, Saccharomycetes, Agaricomycetes and Sordariomycetes but that all samples were dominated by sequences that could not be taxonomically classified. Representatives of the Candida genus were identified in all samples, most notably C. quercitrusa, while sequence reads assigned to the Aspergillus genus were only identified in a subset of samples. CloVR-ITS is made available as a pre-installed, automated, and portable software pipeline for cloud-friendly execution as part of the CloVR virtual machine package (http://clovr.org). Conclusion The CloVR-ITS pipeline provides fungal microbiota analysis that can be complementary to bacterial 16S rRNA and total metagenome sequence analysis allowing for more comprehensive studies of environmental and host-associated microbial communities. PMID:24451270
Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr
2014-04-01
Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H
2005-01-01
To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.
Capturing the Temporal Sequence of Interaction in Young Siblings
Steele, Fiona; Jenkins, Jennifer
2015-01-01
We explored whether young children exhibit subtypes of behavioral sequences during sibling interaction. Ten-minute, free-play observations of over 300 sibling dyads were coded for positivity, negativity and disengagement. The data were analyzed using growth mixture modeling (GMM). Younger (18-month-old) children’s temporal behavioral sequences showed a harmonious (53%) and a casual (47%) class. Older (approximately four-year-old) children’s behavior was more differentiated revealing a harmonious (25%), a deteriorating (31%), a recovery (22%) and a casual (22%) class. A more positive maternal affective climate was associated with more positive patterns. Siblings’ sequential behavioral patterns tended to be complementary rather than reciprocal in nature. The study illustrates a novel use of GMM and makes a theoretical contribution by showing that young children exhibit distinct types of temporal behavioral sequences that are related to parenting processes. PMID:25996957
RNA-Seq analysis and transcriptome assembly for blackberry (Rubus sp. Var. Lochness) fruit.
Garcia-Seco, Daniel; Zhang, Yang; Gutierrez-Mañero, Francisco J; Martin, Cathie; Ramos-Solano, Beatriz
2015-01-22
There is an increasing interest in berries, especially blackberries in the diet, because of recent reports of their health benefits due to their high content of flavonoids. A broad range of genomic tools are available for other Rosaceae species but these tools are still lacking in the Rubus genus, thus limiting gene discovery and the breeding of improved varieties. De novo RNA-seq of ripe blackberries grown under field conditions was performed using Illumina Hiseq 2000. Almost 9 billion nucleotide bases were sequenced in total. Following assembly, 42,062 consensus sequences were detected. For functional annotation, 33,040 (NR), 32,762 (NT), 21,932 (Swiss-Prot), 20,134 (KEGG), 13,676 (COG), 24,168 (GO) consensus sequences were annotated using different databases; in total 34,552 annotated sequences were identified. For protein prediction analysis, the number of coding DNA sequences (CDS) that mapped to the protein database was 32,540. Non redundant (NR), annotation showed that 25,418 genes (73.5%) has the highest similarity with Fragaria vesca subspecies vesca. Reanalysis was undertaken by aligning the reads with this reference genome for a deeper analysis of the transcriptome. We demonstrated that de novo assembly, using Trinity and later annotation with Blast using different databases, were complementary to alignment to the reference sequence using SOAPaligner/SOAP2. The Fragaria reference genome belongs to a species in the same family as blackberry (Rosaceae) but to a different genus. Since blackberries are tetraploids, the possibility of artefactual gene chimeras resulting from mis-assembly was tested with one of the genes sequenced by RNAseq, Chalcone Synthase (CHS). cDNAs encoding this protein were cloned and sequenced. Primers designed to the assembled sequences accurately distinguished different contigs, at least for chalcone synthase genes. We prepared and analysed transcriptome data from ripe blackberries, for which prior genomic information was limited. This new sequence information will improve the knowledge of this important and healthy fruit, providing an invaluable new tool for biological research.
Georgiev, O; Birnstiel, M L
1985-01-01
Analysis of cDNA sequences obtained from the small nuclear RNA U7 has previously suggested specific contacts, by base pairing, between the conserved stem-loop structure and CAAGAAAGA sequence of the histone pre-mRNA and the 5'-terminal sequence of the U7 RNA during RNA processing. In order to test some aspects of the model we have created a series of linker scan, deletion and insertion mutants of the 3' terminus of a sea urchin H3 histone gene and have injected mutant DNAs or in vitro synthesized precursors into frog oocyte nuclei for interpretation. We find that, in addition to the stem-loop structure of the mRNA, the CAAGAAAGA spacer transcript within the histone pre-mRNA is required absolutely for RNA processing, as predicted from our model. Spacer sequences immediately downstream of the CAAGAAAGA motif are not complementary to U7 RNA. Nevertheless, they are necessary for obtaining a maximal rate of RNA processing, as is the ACCA sequence coding for the 3' terminus of the mature mRNA. An increase of distance between the mRNA palindrome and the CAAGAAAGA by as little as six nucleotides abolishes all processing. It may, therefore, be useful to regard both these sequence motifs as part of one and the same RNA processing signal with narrowly defined topologies. Interestingly, U7 RNA-dependent 3' processing of histone pre-mRNA can occur in RNA injection experiments only when the in vitro synthesized pre-mRNA contains sequence extensions well beyond the region of sequence complementarities to the U7 RNA. In addition to directing 3' processing the terminal mRNA sequences may have a role in histone mRNA stabilization in the cytoplasmic compartment. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2410259
A multi-model approach to nucleic acid-based drug development.
Gautherot, Isabelle; Sodoyer, Regís
2004-01-01
With the advent of functional genomics and the shift of interest towards sequence-based therapeutics, the past decades have witnessed intense research efforts on nucleic acid-mediated gene regulation technologies. Today, RNA interference is emerging as a groundbreaking discovery, holding promise for development of genetic modulators of unprecedented potency. Twenty-five years after the discovery of antisense RNA and ribozymes, gene control therapeutics are still facing developmental difficulties, with only one US FDA-approved antisense drug currently available in the clinic. Limited predictability of target site selection models is recognized as one major stumbling block that is shared by all of the so-called complementary technologies, slowing the progress towards a commercial product. Currently employed in vitro systems for target site selection include RNAse H-based mapping, antisense oligonucleotide microarrays, and functional screening approaches using libraries of catalysts with randomized target-binding arms to identify optimal ribozyme/DNAzyme cleavage sites. Individually, each strategy has its drawbacks from a drug development perspective. Utilization of message-modulating sequences as therapeutic agents requires that their action on a given target transcript meets criteria of potency and selectivity in the natural physiological environment. In addition to sequence-dependent characteristics, other factors will influence annealing reactions and duplex stability, as well as nucleic acid-mediated catalysis. Parallel consideration of physiological selection systems thus appears essential for screening for nucleic acid compounds proposed for therapeutic applications. Cellular message-targeting studies face issues relating to efficient nucleic acid delivery and appropriate analysis of response. For reliability and simplicity, prokaryotic systems can provide a rapid and cost-effective means of studying message targeting under pseudo-cellular conditions, but such approaches also have limitations. To streamline nucleic acid drug discovery, we propose a multi-model strategy integrating high-throughput-adapted bacterial screening, followed by reporter-based and/or natural cellular models and potentially also in vitro assays for characterization of the most promising candidate sequences, before final in vivo testing.
Miller, P.S.; Ts'o, P.O.P.
1999-06-15
A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid is provided. It includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional. 16 figs.
High-density, microsphere-based fiber optic DNA microarrays.
Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R
2003-05-01
A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.
DISSECTING THE GENETICS OF HUMAN HIGH MYOPIA: A MOLECULAR BIOLOGIC APPROACH
Young, Terri L
2004-01-01
ABSTRACT Purpose Despite the plethora of experimental myopia animal studies that demonstrate biochemical factor changes in various eye tissues, and limited human studies utilizing pharmacologic agents to thwart axial elongation, we have little knowledge of the basic physiology that drives myopic development. Identifying the implicated genes for myopia susceptibility will provide a fundamental molecular understanding of how myopia occurs and may lead to directed physiologic (ie, pharmacologic, gene therapy) interventions. The purpose of this proposal is to describe the results of positional candidate gene screening of selected genes within the autosomal dominant high-grade myopia-2 locus (MYP2) on chromosome 18p11.31. Methods A physical map of a contracted MYP2 interval was compiled, and gene expression studies in ocular tissues using complementary DNA library screens, microarray matches, and reverse-transcription techniques aided in prioritizing gene selection for screening. The TGIF, EMLIN-2, MLCB, and CLUL1 genes were screened in DNA samples from unrelated controls and in high-myopia affected and unaffected family members from the original seven MYP2 pedigrees. All candidate genes were screened by direct base pair sequence analysis. Results Consistent segregation of a gene sequence alteration (polymorphism) with myopia was not demonstrated in any of the seven families. Novel single nucleotide polymorphisms were found. Conclusion The positional candidate genes TGIF, EMLIN-2, MLCB, and CLUL1 are not associated with MYP2-linked high-grade myopia. Base change polymorphisms discovered with base sequence screening of these genes were submitted to an Internet database. Other genes that also map within the interval are currently undergoing mutation screening. PMID:15747770
Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R
2016-04-01
Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.
NASA Astrophysics Data System (ADS)
Różycka, Anna; Deptuch, Aleksandra; Jaworska-Gołąb, Teresa; Węgłowska, Dorota; Marzec, Monika
2018-02-01
Physical properties of a new ferroelectric liquid crystal have been studied by complementary methods: differential scanning calorimetry, polarizing optical microscopy, dielectric and X-ray diffraction. It was found that next to enantiotropic ferroelectric smectic C* phase, the monotropic smectic phase appears at cooling. X-ray diffraction measurements allowed to identify this phase as hexatic tilted smectic. Temperature dependence of spontaneous polarization, tilt angle of molecules and switching time were found in both liquid crystalline phases at cooling. Based on the dielectric results, the dielectric processes were identified as Goldstone mode in the smectic C* phase, whereas as the bond-orientation-like phason and the bulk domain mode in the monotropic hexatic tilted smectic phase.
Inhibition of Human Immunodeficiency Virus Replication by Antisense Oligodeoxynucleotides
NASA Astrophysics Data System (ADS)
Goodchild, John; Agrawal, Sudhir; Civeira, Maria P.; Sarin, Prem S.; Sun, Daisy; Zamecnik, Paul C.
1988-08-01
Twenty different target sites within human immunodeficiency virus (HIV) RNA were selected for studies of inhibition of HIV replication by antisense oligonucleotides. Target sites were selected based on their potential capacity to block recognition functions during viral replication. Antisense oligomers complementary to sites within or near the sequence repeated at the ends of retrovirus RNA (R region) and to certain splice sites were most effective. The effect of antisense oligomer length on inhibiting virus replication was also investigated, and preliminary toxicity studies in mice show that these compounds are toxic only at high levels. The results indicate potential usefulness for these oligomers in the treatment of patients with acquired immunodeficiency syndrome (AIDS) and AIDS-related complex either alone or in combination with other drugs.
Deep sequencing methods for protein engineering and design.
Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A
2017-08-01
The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.
Characterizing genomic alterations in cancer by complementary functional associations.
Kim, Jong Wook; Botvinnik, Olga B; Abudayyeh, Omar; Birger, Chet; Rosenbluh, Joseph; Shrestha, Yashaswi; Abazeed, Mohamed E; Hammerman, Peter S; DiCara, Daniel; Konieczkowski, David J; Johannessen, Cory M; Liberzon, Arthur; Alizad-Rahvar, Amir Reza; Alexe, Gabriela; Aguirre, Andrew; Ghandi, Mahmoud; Greulich, Heidi; Vazquez, Francisca; Weir, Barbara A; Van Allen, Eliezer M; Tsherniak, Aviad; Shao, Diane D; Zack, Travis I; Noble, Michael; Getz, Gad; Beroukhim, Rameen; Garraway, Levi A; Ardakani, Masoud; Romualdi, Chiara; Sales, Gabriele; Barbie, David A; Boehm, Jesse S; Hahn, William C; Mesirov, Jill P; Tamayo, Pablo
2016-05-01
Systematic efforts to sequence the cancer genome have identified large numbers of mutations and copy number alterations in human cancers. However, elucidating the functional consequences of these variants, and their interactions to drive or maintain oncogenic states, remains a challenge in cancer research. We developed REVEALER, a computational method that identifies combinations of mutually exclusive genomic alterations correlated with functional phenotypes, such as the activation or gene dependency of oncogenic pathways or sensitivity to a drug treatment. We used REVEALER to uncover complementary genomic alterations associated with the transcriptional activation of β-catenin and NRF2, MEK-inhibitor sensitivity, and KRAS dependency. REVEALER successfully identified both known and new associations, demonstrating the power of combining functional profiles with extensive characterization of genomic alterations in cancer genomes.
Guizard, Sébastien; Piégu, Benoît; Arensburger, Peter; Guillou, Florian; Bigot, Yves
2016-08-19
The program RepeatMasker and the database Repbase-ISB are part of the most widely used strategy for annotating repeats in animal genomes. They have been used to show that avian genomes have a lower repeat content (8-12 %) than the sequenced genomes of many vertebrate species (30-55 %). However, the efficiency of such a library-based strategies is dependent on the quality and completeness of the sequences in the database that is used. An alternative to these library based methods are methods that identify repeats de novo. These alternative methods have existed for a least a decade and may be more powerful than the library based methods. We have used an annotation strategy involving several complementary de novo tools to determine the repeat content of the model genome galGal4 (1.04 Gbp), including identifying simple sequence repeats (SSRs), tandem repeats and transposable elements (TEs). We annotated over one Gbp. of the galGal4 genome and showed that it is composed of approximately 19 % SSRs and TEs repeats. Furthermore, we estimate that the actual genome of the red jungle fowl contains about 31-35 % repeats. We find that library-based methods tend to overestimate TE diversity. These results have a major impact on the current understanding of repeats distributions throughout chromosomes in the red jungle fowl. Our results are a proof of concept of the reliability of using de novo tools to annotate repeats in large animal genomes. They have also revealed issues that will need to be resolved in order to develop gold-standard methodologies for annotating repeats in eukaryote genomes.
Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K
2013-10-15
Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.
Discovering Complementary Colors from the Perspective of STEAM Education
ERIC Educational Resources Information Center
Karabey, Burak; Koyunkaya, Melike Yigit; Enginoglu, Turan; Yurumezoglu, Kemal
2018-01-01
This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of…
Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.
Mello-Sampayo, T
1973-01-01
Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.
What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?
NASA Astrophysics Data System (ADS)
Liebovitch, Larry
1998-03-01
The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.
Gain-Scheduled Complementary Filter Design for a MEMS Based Attitude and Heading Reference System
Yoo, Tae Suk; Hong, Sung Kyung; Yoon, Hyok Min; Park, Sungsu
2011-01-01
This paper describes a robust and simple algorithm for an attitude and heading reference system (AHRS) based on low-cost MEMS inertial and magnetic sensors. The proposed approach relies on a gain-scheduled complementary filter, augmented by an acceleration-based switching architecture to yield robust performance, even when the vehicle is subject to strong accelerations. Experimental results are provided for a road captive test during which the vehicle dynamics are in high-acceleration mode and the performance of the proposed filter is evaluated against the output from a conventional linear complementary filter. PMID:22163824
FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes
Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena
2017-01-01
Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678
Yang, Jian-Yi; Peng, Zhen-Ling; Yu, Zu-Guo; Zhang, Rui-Jie; Anh, Vo; Wang, Desheng
2009-04-21
In this paper, we intend to predict protein structural classes (alpha, beta, alpha+beta, or alpha/beta) for low-homology data sets. Two data sets were used widely, 1189 (containing 1092 proteins) and 25PDB (containing 1673 proteins) with sequence homology being 40% and 25%, respectively. We propose to decompose the chaos game representation of proteins into two kinds of time series. Then, a novel and powerful nonlinear analysis technique, recurrence quantification analysis (RQA), is applied to analyze these time series. For a given protein sequence, a total of 16 characteristic parameters can be calculated with RQA, which are treated as feature representation of protein sequences. Based on such feature representation, the structural class for each protein is predicted with Fisher's linear discriminant algorithm. The jackknife test is used to test and compare our method with other existing methods. The overall accuracies with step-by-step procedure are 65.8% and 64.2% for 1189 and 25PDB data sets, respectively. With one-against-others procedure used widely, we compare our method with five other existing methods. Especially, the overall accuracies of our method are 6.3% and 4.1% higher for the two data sets, respectively. Furthermore, only 16 parameters are used in our method, which is less than that used by other methods. This suggests that the current method may play a complementary role to the existing methods and is promising to perform the prediction of protein structural classes.
Cospeciation of Psyllids and Their Primary Prokaryotic Endosymbionts
Thao, MyLo L.; Moran, Nancy A.; Abbot, Patrick; Brennan, Eric B.; Burckhardt, Daniel H.; Baumann, Paul
2000-01-01
Psyllids are plant sap-feeding insects that harbor prokaryotic endosymbionts in specialized cells within the body cavity. Four-kilobase DNA fragments containing 16S and 23S ribosomal DNA (rDNA) were amplified from the primary (P) endosymbiont of 32 species of psyllids representing three psyllid families and eight subfamilies. In addition, 0.54-kb fragments of the psyllid nuclear gene wingless were also amplified from 26 species. Phylogenetic trees derived from 16S-23S rDNA and from the host wingless gene are very similar, and tests of compatibility of the data sets show no significant conflict between host and endosymbiont phylogenies. This result is consistent with a single infection of a shared psyllid ancestor and subsequent cospeciation of the host and the endosymbiont. In addition, the phylogenies based on DNA sequences generally agreed with psyllid taxonomy based on morphology. The 3′ end of the 16S rDNA of the P endosymbionts differs from that of other members of the domain Bacteria in the lack of a sequence complementary to the mRNA ribosome binding site. The rate of sequence change in the 16S-23S rDNA of the psyllid P endosymbiont was considerably higher than that of other bacteria, including other fast-evolving insect endosymbionts. The lineage consisting of the P endosymbionts of psyllids was given the designation Candidatus Carsonella (gen. nov.) with a single species, Candidatus Carsonella ruddii (sp. nov.). PMID:10877784
O'Flaherty, Brigid M; Li, Yan; Tao, Ying; Paden, Clinton R; Queen, Krista; Zhang, Jing; Dinwiddie, Darrell L; Gross, Stephen M; Schroth, Gary P; Tong, Suxiang
2018-06-01
Next generation sequencing (NGS) technologies have revolutionized the genomics field and are becoming more commonplace for identification of human infectious diseases. However, due to the low abundance of viral nucleic acids (NAs) in relation to host, viral identification using direct NGS technologies often lacks sufficient sensitivity. Here, we describe an approach based on two complementary enrichment strategies that significantly improves the sensitivity of NGS-based virus identification. To start, we developed two sets of DNA probes to enrich virus NAs associated with respiratory diseases. The first set of probes spans the genomes, allowing for identification of known viruses and full genome sequencing, while the second set targets regions conserved among viral families or genera, providing the ability to detect both known and potentially novel members of those virus groups. Efficiency of enrichment was assessed by NGS testing reference virus and clinical samples with known infection. We show significant improvement in viral identification using enriched NGS compared to unenriched NGS. Without enrichment, we observed an average of 0.3% targeted viral reads per sample. However, after enrichment, 50%-99% of the reads per sample were the targeted viral reads for both the reference isolates and clinical specimens using both probe sets. Importantly, dramatic improvements on genome coverage were also observed following virus-specific probe enrichment. The methods described here provide improved sensitivity for virus identification by NGS, allowing for a more comprehensive analysis of disease etiology. © 2018 O'Flaherty et al.; Published by Cold Spring Harbor Laboratory Press.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich
1999-01-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.
Use of continuous/contiguous stacking hybridization as a diagnostic tool
Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.
1999-06-01
A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.
Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties
Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.
2011-01-01
We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909
Trends in Fetal Medicine: A 10-Year Bibliometric Analysis of Prenatal Diagnosis
Dhombres, Ferdinand; Bodenreider, Olivier
2018-01-01
The objective is to automatically identify trends in Fetal Medicine over the past 10 years through a bibliometric analysis of articles published in Prenatal Diagnosis, using text mining techniques. We processed 2,423 full-text articles published in Prenatal Diagnosis between 2006 and 2015. We extracted salient terms, calculated their frequencies over time, and established evolution profiles for terms, from which we derived falling, stable, and rising trends. We identified 618 terms with a falling trend, 2,142 stable terms, and 839 terms with a rising trend. Terms with increasing frequencies include those related to statistics and medical study design. The most recent of these terms reflect the new opportunities of next- generation sequencing. Many terms related to cytogenetics exhibit a falling trend. A bibliometric analysis based on text mining effectively supports identification of trends over time. This scalable approach is complementary to analyses based on metadata or expert opinion. PMID:29295220
Detection of underground pipeline based on Golay waveform design
NASA Astrophysics Data System (ADS)
Dai, Jingjing; Xu, Dazhuan
2017-08-01
The detection of underground pipeline is an important problem in the development of the city, but the research about it is not mature at present. In this paper, based on the principle of waveform design in wireless communication, we design an acoustic signal detection system to detect the location of underground pipelines. According to the principle of acoustic localization, we chose DSP-F28335 as the development board, and use DA and AD module as the master control chip. The DA module uses complementary Golay sequence as emission signal. The AD module acquisiting data synchronously, so that the echo signals which containing position information of the target is recovered through the signal processing. The test result shows that the method in this paper can not only calculate the sound velocity of the soil, but also can locate the location of underground pipelines accurately.
Brégeon, Damien; Doetsch, Paul W
2004-11-01
Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.
Quantiprot - a Python package for quantitative analysis of protein sequences.
Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold
2017-07-17
The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.
The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity
Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.
2015-01-01
Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, ncCADD and ncGWAVA, and find both scores are significantly predictive of human dosage sensitive genes and appear to carry information beyond conservation, as assessed by ncGERP. These results highlight that the intolerance of noncoding sequence stretches in the human genome can provide a critical complementary tool to other genome annotation approaches to help identify the parts of the human genome increasingly likely to harbor mutations that influence risk of disease. PMID:26332131
Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z
2013-04-02
U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.
[Complementary and alternative medicine in oncology].
Hübner, J
2013-06-01
Complementary and alternative medicine are frequently used by cancer patients. The main benefit of complementary medicine is that it gives patients the chance to become active. Complementary therapy can reduce the side effects of conventional therapy. However, we have to give due consideration to side effects and interactions: the latter being able to reduce the effectiveness of cancer therapy and so to jeopardise the success of therapy. Therefore, complementary therapy should be managed by the oncologist. It is based on a common concept of cancerogenesis with conventional therapy. Complement therapy can be assessed in studies. Alternative medicine in contrast rejects common rules of evidence-based medicine. It starts from its own concepts of cancerogenesis, which is often in line with the thinking of lay persons. Alternative medicine is offered as either "alternative" to recommended cancer treatment or is used at the same time but without due regard for the interactions. Alternative medicine is a high risk to patients. In the following two parts of the article, the most important complementary and alternative therapies cancer patients use nowadays are presented and assessed according to published evidence.
Levett, K M; Smith, C A; Bensoussan, A; Dahlen, H G
2016-09-01
to gain insight into the experiences of women, partners and midwives who participated in the Complementary Therapies for Labour and Birth Study, an evidence based complementary medicine (CM) antenatal education course. qualitative in-depth interviews and a focus group as part of the Complementary Therapies for Labour and Birth Study. thirteen low risk primiparous women and seven partners who had participated in the study group of a randomised controlled trial of the complementary therapies for labour and birth study, and 12 midwives caring for these women. The trial was conducted at two public hospitals, and through the Western Sydney University in Sydney, Australia. the Complementary Therapies for Labour and Birth (CTLB) protocol, based on the She Births® course and the Acupressure for labour and birth protocol, incorporated six evidence-based complementary medicine (CM) techniques; acupressure, relaxation, visualisation, breathing, massage, yoga techniques and incorporated facilitated partner support. Randomisation to the trial occurred at 24-36 weeks' gestation, and participants attended a two-day antenatal education programme, plus standard care, or standard care alone. the overarching theme identified in the qualitative data was making sense of labour and birth. Women used information about normal birth physiology from the course to make sense of labour, and to utilise the CM techniques to support normal birth and reduce interventions in labour. Women's, partners' and midwives' experience of the course and its use during birth gave rise to supporting themes such as: working for normal; having a toolkit; and finding what works. the Complementary Therapies for Labour and Birth Study provided women and their partners with knowledge to understand the physiology of normal labour and birth and enabled them to use evidence-based CM tools to support birth and reduce interventions. the Complementary Therapies for Labour and Birth Study introduces concepts of what constitutes normal birth and provides skills to support women, partners and midwives. It appears to be an effective form of antenatal education that supports normal birth, and maternity services need to consider how they can reform current antenatal education in line with this evidence. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong
2013-05-07
We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.
Kerr-Phillips, Thomas E; Aydemir, Nihan; Chan, Eddie Wai Chi; Barker, David; Malmström, Jenny; Plesse, Cedric; Travas-Sejdic, Jadranka
2018-02-15
A highly selective, label-free sensor for the non-Hodgkin lymphoma gene, with an aM detection limit, utilizing electrochemical impedance spectroscopy (EIS) is presented. The sensor consists of a conducting electrospun fibre mat, surface-grafted with poly(acrylic acid) (PAA) brushes and a conducting polymer sensing element with covalently attached oligonucleotide probes. The sensor was fabricated from electrospun NBR rubber, embedded with poly(3,4-ethylenedioxythiophene) (PEDOT), followed by grafting poly(acrylic acid) brushes and then electrochemically polymerizing a conducting polymer monomer with ssDNA probe sequence pre-attached. The resulting non-Hodgkin lymphoma gene sensor showed a detection limit of 1aM (1 × 10 -18 mol/L), more than 400 folds lower compared to a thin-film analogue. The sensor presented extraordinary selectivity, with only 1%, 2.7% and 4.6% of the signal recorded for the fully non-complimentary, T-A and G-C base mismatch oligonucleotide sequences, respectively. We suggest that such greatly enhanced selectivity is due to the presence of negatively charged carboxylic acid moieties from PAA grafts that electrostatically repel the non-complementary and mismatch DNA sequences, overcoming the non-specific binding. Copyright © 2017 Elsevier B.V. All rights reserved.
Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred
2007-03-01
We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.
Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming
2003-12-01
A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.
HIVsirDB: a database of HIV inhibiting siRNAs.
Tyagi, Atul; Ahmed, Firoz; Thakur, Nishant; Sharma, Arun; Raghava, Gajendra P S; Kumar, Manoj
2011-01-01
Human immunodeficiency virus (HIV) is responsible for millions of deaths every year. The current treatment involves the use of multiple antiretroviral agents that may harm patients due to their toxic nature. RNA interference (RNAi) is a potent candidate for the future treatment of HIV, uses short interfering RNA (siRNA/shRNA) for silencing HIV genes. In this study, attempts have been made to create a database HIVsirDB of siRNAs responsible for silencing HIV genes. HIVsirDB is a manually curated database of HIV inhibiting siRNAs that provides comprehensive information about each siRNA or shRNA. Information was collected and compiled from literature and public resources. This database contains around 750 siRNAs that includes 75 partially complementary siRNAs differing by one or more bases with the target sites and over 100 escape mutant sequences. HIVsirDB structure contains sixteen fields including siRNA sequence, HIV strain, targeted genome region, efficacy and conservation of target sequences. In order to facilitate user, many tools have been integrated in this database that includes; i) siRNAmap for mapping siRNAs on target sequence, ii) HIVsirblast for BLAST search against database, iii) siRNAalign for aligning siRNAs. HIVsirDB is a freely accessible database of siRNAs which can silence or degrade HIV genes. It covers 26 types of HIV strains and 28 cell types. This database will be very useful for developing models for predicting efficacy of HIV inhibiting siRNAs. In summary this is a useful resource for researchers working in the field of siRNA based HIV therapy. HIVsirDB database is accessible at http://crdd.osdd.net/raghava/hivsir/.
Resolving Evolutionary Relationships in Closely Related Species with Whole-Genome Sequencing Data
Nater, Alexander; Burri, Reto; Kawakami, Takeshi; Smeds, Linnéa; Ellegren, Hans
2015-01-01
Using genetic data to resolve the evolutionary relationships of species is of major interest in evolutionary and systematic biology. However, reconstructing the sequence of speciation events, the so-called species tree, in closely related and potentially hybridizing species is very challenging. Processes such as incomplete lineage sorting and interspecific gene flow result in local gene genealogies that differ in their topology from the species tree, and analyses of few loci with a single sequence per species are likely to produce conflicting or even misleading results. To study these phenomena on a full phylogenomic scale, we use whole-genome sequence data from 200 individuals of four black-and-white flycatcher species with so far unresolved phylogenetic relationships to infer gene tree topologies and visualize genome-wide patterns of gene tree incongruence. Using phylogenetic analysis in nonoverlapping 10-kb windows, we show that gene tree topologies are extremely diverse and change on a very small physical scale. Moreover, we find strong evidence for gene flow among flycatcher species, with distinct patterns of reduced introgression on the Z chromosome. To resolve species relationships on the background of widespread gene tree incongruence, we used four complementary coalescent-based methods for species tree reconstruction, including complex modeling approaches that incorporate post-divergence gene flow among species. This allowed us to infer the most likely species tree with high confidence. Based on this finding, we show that regions of reduced effective population size, which have been suggested as particularly useful for species tree inference, can produce positively misleading species tree topologies. Our findings disclose the pitfalls of using loci potentially under selection as phylogenetic markers and highlight the potential of modeling approaches to disentangle species relationships in systems with large effective population sizes and post-divergence gene flow. PMID:26187295
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
SxtA gene sequence analysis of dinoflagellate Alexandrium minutum
NASA Astrophysics Data System (ADS)
Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd
2015-09-01
The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.
Blue light photoreceptors and methods of using the same
Cashmore, Anthony Robert; Ahmad, Margaret; Lin, Chentao
1998-01-01
The invention features a substantially pure preparation of a nucleic acid encoding a HY4 or a HY4-related gene. The invention further features transgenic plants encoding a HY4 gene having a shorter stem than substantially homozygous wild type nontransgenic plants; and, transgenic plants comprising complementary HY4 sequences having a longer stem than substantially homozygous wild type nontransgenic plants.
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
The Role of CRISPR-Cas Systems in Virulence of Pathogenic Bacteria
Staals, Raymond H. J.; Endtz, Hubert P.; van Baarlen, Peter; van der Oost, John
2014-01-01
SUMMARY Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular. PMID:24600041
Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J
1990-01-01
Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608
The role of CRISPR-Cas systems in virulence of pathogenic bacteria.
Louwen, Rogier; Staals, Raymond H J; Endtz, Hubert P; van Baarlen, Peter; van der Oost, John
2014-03-01
Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular.
Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura
2003-10-01
Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.
Degradation of Serotonin N-Acetyltransferase, a Circadian Regulator, by the N-end Rule Pathway.
Wadas, Brandon; Borjigin, Jimo; Huang, Zheping; Oh, Jang-Hyun; Hwang, Cheol-Sang; Varshavsky, Alexander
2016-08-12
Serotonin N-acetyltransferase (AANAT) converts serotonin to N-acetylserotonin (NAS), a distinct biological regulator and the immediate precursor of melatonin, a circulating hormone that influences circadian processes, including sleep. N-terminal sequences of AANAT enzymes vary among vertebrates. Mechanisms that regulate the levels of AANAT are incompletely understood. Previous findings were consistent with the possibility that AANAT may be controlled through its degradation by the N-end rule pathway. By expressing the rat and human AANATs and their mutants not only in mammalian cells but also in the yeast Saccharomyces cerevisiae, and by taking advantage of yeast genetics, we show here that two "complementary" forms of rat AANAT are targeted for degradation by two "complementary" branches of the N-end rule pathway. Specifically, the N(α)-terminally acetylated (Nt-acetylated) Ac-AANAT is destroyed through the recognition of its Nt-acetylated N-terminal Met residue by the Ac/N-end rule pathway, whereas the non-Nt-acetylated AANAT is targeted by the Arg/N-end rule pathway, which recognizes the unacetylated N-terminal Met-Leu sequence of rat AANAT. We also show, by constructing lysine-to-arginine mutants of rat AANAT, that its degradation is mediated by polyubiquitylation of its Lys residue(s). Human AANAT, whose N-terminal sequence differs from that of rodent AANATs, is longer-lived than its rat counterpart and appears to be refractory to degradation by the N-end rule pathway. Together, these and related results indicate both a major involvement of the N-end rule pathway in the control of rodent AANATs and substantial differences in the regulation of rodent and human AANATs that stem from differences in their N-terminal sequences. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Neji, Radhouene; Phinikaridou, Alkystis; Whitaker, John; Botnar, René M.; Prieto, Claudia
2017-01-01
Purpose To develop a 3D whole‐heart Bright‐blood and black‐blOOd phase SensiTive (BOOST) inversion recovery sequence for simultaneous noncontrast enhanced coronary lumen and thrombus/hemorrhage visualization. Methods The proposed sequence alternates the acquisition of two bright‐blood datasets preceded by different preparatory pulses to obtain variations in blood/myocardium contrast, which then are combined in a phase‐sensitive inversion recovery (PSIR)‐like reconstruction to obtain a third, coregistered, black‐blood dataset. The bright‐blood datasets are used for both visualization of the coronary lumen and motion estimation, whereas the complementary black‐blood dataset potentially allows for thrombus/hemorrhage visualization. Furthermore, integration with 2D image‐based navigation enables 100% scan efficiency and predictable scan times. The proposed sequence was compared to conventional coronary MR angiography (CMRA) and PSIR sequences in a standardized phantom and in healthy subjects. Feasibility for thrombus depiction was tested ex vivo. Results With BOOST, the coronary lumen is visualized with significantly higher (P < 0.05) contrast‐to‐noise ratio and vessel sharpness when compared to conventional CMRA. Furthermore, BOOST showed effective blood signal suppression as well as feasibility for thrombus visualization ex vivo. Conclusion A new PSIR sequence for noncontrast enhanced simultaneous coronary lumen and thrombus/hemorrhage detection was developed. The sequence provided improved coronary lumen depiction and showed potential for thrombus visualization. Magn Reson Med 79:1460–1472, 2018. © 2017 International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:28722267
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A
2014-03-06
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
Efficient Implementation of a Symbol Timing Estimator for Broadband PLC.
Nombela, Francisco; García, Enrique; Mateos, Raúl; Hernández, Álvaro
2015-08-21
Broadband Power Line Communications (PLC) have taken advantage of the research advances in multi-carrier modulations to mitigate frequency selective fading, and their adoption opens up a myriad of applications in the field of sensory and automation systems, multimedia connectivity or smart spaces. Nonetheless, the use of these multi-carrier modulations, such as Wavelet-OFDM, requires a highly accurate symbol timing estimation for reliably recovering of transmitted data. Furthermore, the PLC channel presents some particularities that prevent the direct use of previous synchronization algorithms proposed in wireless communication systems. Therefore more research effort should be involved in the design and implementation of novel and robust synchronization algorithms for PLC, thus enabling real-time synchronization. This paper proposes a symbol timing estimator for broadband PLC based on cross-correlation with multilevel complementary sequences or Zadoff-Chu sequences and its efficient implementation in a FPGA; the obtained results show a 90% of success rate in symbol timing estimation for a certain PLC channel model and a reduced resource consumption for its implementation in a Xilinx Kyntex FPGA.
Lunar anorthosite 60025, the petrogenesis of lunar anorthosites, and the composition of the moon
NASA Technical Reports Server (NTRS)
Ryder, G.
1982-01-01
The mineral chemistry of the lunar anorthosite 60025 is investigated, and a model for the differentiation of the moon is proposed based on these findings. Among other results, it is concluded that 60025 is a mixture of pieces from a related sequence of anorthosites, and that this sequence was generated by near-perfect accumulate growth during strong fractional crystallization. The parent liquid of the most primitive anorthosite was saturated with olivine, plagioclase, pigeonite, and chromite, and evolved to one saturated with plagioclase, pigeonite, high-Ca clinopyroxene, and ilmenite. The steep slope of anorthosites on an Mg (mafics) vs. Ab (plagioclase) diagram is a result of the very low alkali content of the magma and of the original magma ocean. The bulk moon had low Al2O3, a sub-chondritic Ca/Al ratio, and REE abundances and patterns which were probably close to chondritic. In addition, mare basalt sources were found to be too magnesian and some contain too much high Ca clinopyroxene to be directly or simply complementary to a floated anorthosite crust.
Mondal, Bhairab; N, Bhavanashri; Ramlal, Shylaja; Kingston, Joseph
2018-02-14
In the present study, a colorimetric DNAzymes biosensor strategy was devised in combination with immunomagnetic separation for rapid and easy detection of enterotoxin B harboring Staphylococcus aureus from food and clinical samples. The method employs immunocapture of S. aureus and amplification of seb gene by DNAzyme complementary sequence integrated forward primer and with specific reverse primer. The DNAzyme sequence integrated dsDNA PCR products when treated with hemin and TMB (3,3',5,5'-tetramethylbenzidine) in the presence of H 2 O 2 produce colorimetric signal. A linear relationship of optical signal with the initial template of seb was obtained which could be monitored by visually or spectrophotrometrically for qualitative and quantitative detection. The limit of detection for the assay was approximately 10 2 CFU/mL of seb gene harboring target. This method is convenient compared to gel based and ELISA systems. Further, spiking studies and analysis on natural samples emphasized the robustness and applicability of developed method. Altogether, the established assay could be a reliable alternative, low-cost, viable detection tool for the routine investigation of seb from food and clinical sources.
DNA interrogation by the CRISPR RNA-guided endonuclease Cas9
NASA Astrophysics Data System (ADS)
Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.
2014-03-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Comparing the effects of music and exercise with music for older adults with insomnia.
Huang, Chiung-Yu; Chang, En-Ting; Lai, Hui-Ling
2016-11-01
To examine the effects of a soothing music intervention before bedtime and a treadmill brisk walking exercise combined with music in the evening on sleep quality of sedentary older adults with chronic insomnia. There is evidence to support the use of complementary interventions to improve sleep. They are rarely applied in Taiwanese elderly population. Using a crossover controlled trial, 38 participants aged 50 to 75 years were randomly assigned to a music intervention/brisk walking sequence or a brisk walking/music intervention sequence. Each participant completed two intervention sessions (separated by 1 week). Each intervention lasted 30 min. An actigraph extended with electroencephalography (EEG) and questionnaires were used to assess the sleep quality. Both interventions exhibited beneficial effects on subjective sleep quality in adults with insomnia. Also listening to soothing music before bedtime significantly shortened the wake time after sleep onset measured by EEG, compared with brisk walking in the evening. The interventions applied in this study could be applied as the evidence-based nursing interventions for insomnia older adults. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Hyer, M. W.; Cooper, D. E.; Cohen, D.
1985-01-01
The effects of a uniform temperature change on the stresses and deformations of composite tubes are investigated. The accuracy of an approximate solution based on the principle of complementary virtual work is determined. Interest centers on tube response away from the ends and so a planar elasticity approach is used. For the approximate solution a piecewise linear variation of stresses with the radial coordinate is assumed. The results from the approximate solution are compared with the elasticity solution. The stress predictions agree well, particularly peak interlaminar stresses. Surprisingly, the axial deformations also agree well. This, despite the fact that the deformations predicted by the approximate solution do not satisfy the interface displacement continuity conditions required by the elasticity solution. The study shows that the axial thermal expansion coefficient of tubes with a specific number of axial and circumferential layers depends on the stacking sequence. This is in contrast to classical lamination theory which predicts the expansion to be independent of the stacking arrangement. As expected, the sign and magnitude of the peak interlaminar stresses depends on stacking sequence.
Arbab, Mandana; Sherwood, Richard I
2016-08-17
CRISPR/Cas9-gene editing has emerged as a revolutionary technology to easily modify specific genomic loci by designing complementary sgRNA sequences and introducing these into cells along with Cas9. Self-cloning CRISPR/Cas9 (scCRISPR) uses a self-cleaving palindromic sgRNA plasmid (sgPal) that recombines with short PCR-amplified site-specific sgRNA sequences within the target cell by homologous recombination to circumvent the process of sgRNA plasmid construction. Through this mechanism, scCRISPR enables gene editing within 2 hr once sgRNA oligos are available, with high efficiency equivalent to conventional sgRNA targeting: >90% gene knockout in both mouse and human embryonic stem cells and cancer cell lines. Furthermore, using PCR-based addition of short homology arms, we achieve efficient site-specific knock-in of transgenes such as GFP without traditional plasmid cloning or genome-integrated selection cassette (2% to 4% knock-in rate). The methods in this paper describe the most rapid and efficient means of CRISPR gene editing. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics
2012-01-01
Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761
A metamaterial terahertz modulator based on complementary planar double-split-ring resonator
NASA Astrophysics Data System (ADS)
Wang, Chang-hui; Kuang, Deng-feng; Chang, Sheng-jiang; Lin, Lie
2013-07-01
A metamaterial based on complementary planar double-split-ring resonator (DSRR) structure is presented and demonstrated, which can optically tune the transmission of the terahertz (THz) wave. Unlike the traditional DSRR metamaterials, the DSRR discussed in this paper consists of two split rings connected by two bridges. Numerical simulations with the finite-difference time-domain (FDTD) method reveal that the transmission spectra of the original and the complementary metamaterials are both in good agreement with Babinet's principle. Then by increasing the carrier density of the intrinsic GaAs substrate, the magnetic response of the complementary special DSRR metamaterial can be weakened or even turned off. This metamaterial structure is promised to be a narrow-band THz modulator with response time of several nanoseconds.
Ramos, Vitor M C; Castelo-Branco, Raquel; Leão, Pedro N; Martins, Joana; Carvalhal-Gomes, Sinda; Sobrinho da Silva, Frederico; Mendonça Filho, João G; Vasconcelos, Vitor M
2017-01-01
Microbial mats are complex, micro-scale ecosystems that can be found in a wide range of environments. In the top layer of photosynthetic mats from hypersaline environments, a large diversity of cyanobacteria typically predominates. With the aim of strengthening the knowledge on the cyanobacterial diversity present in the coastal lagoon system of Araruama (state of Rio de Janeiro, Brazil), we have characterized three mat samples by means of a polyphasic approach. We have used morphological and molecular data obtained by culture-dependent and -independent methods. Moreover, we have compared different classification methodologies and discussed the outcomes, challenges, and pitfalls of these methods. Overall, we show that Araruama's lagoons harbor a high cyanobacterial diversity. Thirty-six unique morphospecies could be differentiated, which increases by more than 15% the number of morphospecies and genera already reported for the entire Araruama system. Morphology-based data were compared with the 16S rRNA gene phylogeny derived from isolate sequences and environmental sequences obtained by PCR-DGGE and pyrosequencing. Most of the 48 phylotypes could be associated with the observed morphospecies at the order level. More than one third of the sequences demonstrated to be closely affiliated (best BLAST hit results of ≥99%) with cyanobacteria from ecologically similar habitats. Some sequences had no close relatives in the public databases, including one from an isolate, being placed as "loner" sequences within different orders. This hints at hidden cyanobacterial diversity in the mats of the Araruama system, while reinforcing the relevance of using complementary approaches to study cyanobacterial diversity.
Ramos, Vitor M. C.; Castelo-Branco, Raquel; Leão, Pedro N.; Martins, Joana; Carvalhal-Gomes, Sinda; Sobrinho da Silva, Frederico; Mendonça Filho, João G.; Vasconcelos, Vitor M.
2017-01-01
Microbial mats are complex, micro-scale ecosystems that can be found in a wide range of environments. In the top layer of photosynthetic mats from hypersaline environments, a large diversity of cyanobacteria typically predominates. With the aim of strengthening the knowledge on the cyanobacterial diversity present in the coastal lagoon system of Araruama (state of Rio de Janeiro, Brazil), we have characterized three mat samples by means of a polyphasic approach. We have used morphological and molecular data obtained by culture-dependent and -independent methods. Moreover, we have compared different classification methodologies and discussed the outcomes, challenges, and pitfalls of these methods. Overall, we show that Araruama's lagoons harbor a high cyanobacterial diversity. Thirty-six unique morphospecies could be differentiated, which increases by more than 15% the number of morphospecies and genera already reported for the entire Araruama system. Morphology-based data were compared with the 16S rRNA gene phylogeny derived from isolate sequences and environmental sequences obtained by PCR-DGGE and pyrosequencing. Most of the 48 phylotypes could be associated with the observed morphospecies at the order level. More than one third of the sequences demonstrated to be closely affiliated (best BLAST hit results of ≥99%) with cyanobacteria from ecologically similar habitats. Some sequences had no close relatives in the public databases, including one from an isolate, being placed as “loner” sequences within different orders. This hints at hidden cyanobacterial diversity in the mats of the Araruama system, while reinforcing the relevance of using complementary approaches to study cyanobacterial diversity. PMID:28713360