Sample records for complementary binding sites

  1. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Structural correlates of affinity in fetal versus adult endplate nicotinic receptors

    NASA Astrophysics Data System (ADS)

    Nayak, Tapan Kumar; Chakraborty, Srirupa; Zheng, Wenjun; Auerbach, Anthony

    2016-04-01

    Adult-type nicotinic acetylcholine receptors (AChRs) mediate signalling at mature neuromuscular junctions and fetal-type AChRs are necessary for proper synapse development. Each AChR has two neurotransmitter binding sites located at the interface of a principal and a complementary subunit. Although all agonist binding sites have the same core of five aromatic amino acids, the fetal site has ~30-fold higher affinity for the neurotransmitter ACh. Here we use molecular dynamics simulations of adult versus fetal homology models to identify complementary-subunit residues near the core that influence affinity, and use single-channel electrophysiology to corroborate the results. Four residues in combination determine adult versus fetal affinity. Simulations suggest that at lower-affinity sites, one of these unsettles the core directly and the others (in loop E) increase backbone flexibility to unlock a key, complementary tryptophan from the core. Swapping only four amino acids is necessary and sufficient to exchange function between adult and fetal AChRs.

  3. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  4. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  5. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  6. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  7. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  8. Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

    PubMed

    Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

    1989-01-01

    A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

  9. Modal gating of muscle nicotinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Vij, Ridhima

    Many ion channels exhibit multiple patterns of kinetic activity in single-channel currents. This behavior is rare in WT mouse muscle nicotinic acetylcholine receptors (AChRs), where A2C↔A2O gating events are well-described by single exponentials. Also, single-channel open probability (PO) is essentially homogeneous at a given agonist concentration in the WT receptors. Here I report that perturbations of almost all the residues in loop C (alpha188-alpha199, at the agonist binding site) generate heterogeneity in PO ('modes'). Such unsettled activity was apparent with an alanine substitution at all positions in loop C (except alphaY190 and alphaY198) and with different side chain substitutions at alphaP197 for both adult- and fetal-type AChRs. I used single channel electrophysiology along with site-directed mutagenesis to study modal gating in AChRs consequent to mutations/deletions in loop C. The multiple patterns of kinetic activity arose from the difference in agonist affinity rather than in intrinsic AChR gating. Out of the four different agonists used to study the modal behavior, acetylcholine (ACh) showed a higher degree of kinetic heterogeneity compared to others. The time constant for switching between modes was long (~mins), suggesting that they arise from alternative, stable protein conformations. By studying AChRs having only 1 functional binding site, I attempted to find the source of the affinity difference, which was traced mainly to the alphadelta agonist site. Affinity at the neurotransmitter binding site is mainly determined by a core of five aromatic residues (alphaY93, alphaW149, alphaY190, alphaY198 and deltaW57). Phenylalanine substitutions at all aromatic residues except alphaY93 resulted in elimination of modes. Modes were also eliminated by alanine mutation at deltaW57 on the complementary side but not at other aromatics. Also, by substituting four gamma subunit residues into the delta subunit on the complementary beta sheet, I found that modes were reduced. Based on our results, we propose that WT loop C has an important role in determining resting affinity, in part by making stable interactions with the complementary surface of the alphadelta binding pocket. We suggest a possible structural basis for the fluctuations caused by loop C perturbations and propose that at the alphadelta agonist binding site, both loop C and the complementary subunit surface can adopt alternative conformations and interact with each other with respect to the aromatic core, to cause the variations in affinity.

  10. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  11. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  12. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  13. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  14. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  15. Receptor-ligand binding sites and virtual screening.

    PubMed

    Hattotuwagama, Channa K; Davies, Matthew N; Flower, Darren R

    2006-01-01

    Within the pharmaceutical industry, the ultimate source of continuing profitability is the unremitting process of drug discovery. To be profitable, drugs must be marketable: legally novel, safe and relatively free of side effects, efficacious, and ideally inexpensive to produce. While drug discovery was once typified by a haphazard and empirical process, it is now increasingly driven by both knowledge of the receptor-mediated basis of disease and how drug molecules interact with receptors and the wider physiome. Medicinal chemistry postulates that to understand a congeneric ligand series, or set thereof, is to understand the nature and requirements of a ligand binding site. Likewise, structural molecular biology posits that to understand a binding site is to understand the nature of ligands bound therein. Reality sits somewhere between these extremes, yet subsumes them both. Complementary to rules of ligand design, arising through decades of medicinal chemistry, structural biology and computational chemistry are able to elucidate the nature of binding site-ligand interactions, facilitating, at both pragmatic and conceptual levels, the drug discovery process.

  16. Computational design of environmental sensors for the potent opioid fentanyl

    DOE PAGES

    Bick, Matthew J.; Greisen, Per J.; Morey, Kevin J.; ...

    2017-09-19

    Here, we describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We also use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment.

  17. Computational design of environmental sensors for the potent opioid fentanyl

    PubMed Central

    Morey, Kevin J; Antunes, Mauricio S; La, David; Sankaran, Banumathi; Reymond, Luc; Johnsson, Kai; Medford, June I

    2017-01-01

    We describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment. PMID:28925919

  18. Computational design of environmental sensors for the potent opioid fentanyl

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bick, Matthew J.; Greisen, Per J.; Morey, Kevin J.

    Here, we describe the computational design of proteins that bind the potent analgesic fentanyl. Our approach employs a fast docking algorithm to find shape complementary ligand placement in protein scaffolds, followed by design of the surrounding residues to optimize binding affinity. Co-crystal structures of the highest affinity binder reveal a highly preorganized binding site, and an overall architecture and ligand placement in close agreement with the design model. We also use the designs to generate plant sensors for fentanyl by coupling ligand binding to design stability. The method should be generally useful for detecting toxic hydrophobic compounds in the environment.

  19. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Pretargeted Molecular Imaging and Radioimmunotherapy

    PubMed Central

    Goldenberg, David M.; Chang, Chien-Hsing; Rossi, Edmund A.; J, William; McBride; Sharkey, Robert M.

    2012-01-01

    Pretargeting is a multi-step process that first has an unlabeled bispecific antibody (bsMAb) localize within a tumor by virtue of its anti-tumor binding site(s) before administering a small, fast-clearing radiolabeled compound that then attaches to the other portion of the bsMAb. The compound's rapid clearance significantly reduces radiation exposure outside of the tumor and its small size permits speedy delivery to the tumor, creating excellent tumor/nontumor ratios in less than 1 hour. Haptens that bind to an anti-hapten antibody, biotin that binds to streptavidin, or an oligonucleotide binding to a complementary oligonucleotide sequence have all been radiolabeled for use by pretargeting. This review will focus on a highly flexible anti-hapten bsMAb platform that has been used to target a variety of radionuclides to image (SPECT and PET) as well as treat tumors. PMID:22737190

  1. Structural basis for cargo binding and autoinhibition of Bicaudal-D1 by a parallel coiled-coil with homotypic registry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terawaki, Shin-ichi, E-mail: terawaki@gunma-u.ac.jp; SPring-8 Center, RIKEN, 1-1-1 Koto, Sayo-cho, Sayo-gun, Hyogo 679-5148; Yoshikane, Asuka

    Bicaudal-D1 (BICD1) is an α-helical coiled-coil protein mediating the attachment of specific cargo to cytoplasmic dynein. It plays an essential role in minus end-directed intracellular transport along microtubules. The third C-terminal coiled-coil region of BICD1 (BICD1 CC3) has an important role in cargo sorting, including intracellular vesicles associating with the small GTPase Rab6 and the nuclear pore complex Ran binding protein 2 (RanBP2), and inhibiting the association with cytoplasmic dynein by binding to the first N-terminal coiled-coil region (CC1). The crystal structure of BICD1 CC3 revealed a parallel homodimeric coiled-coil with asymmetry and complementary knobs-into-holes interactions, differing from Drosophila BicDmore » CC3. Furthermore, our binding study indicated that BICD1 CC3 possesses a binding surface for two distinct cargos, Rab6 and RanBP2, and that the CC1-binding site overlaps with the Rab6-binding site. These findings suggest a molecular basis for cargo recognition and autoinhibition of BICD proteins during dynein-dependent intracellular retrograde transport. - Highlights: • BICD1 CC3 is a parallel homodimeric coiled-coil with axial asymmetry. • The coiled-coil packing of BICD1 CC3 is adapted to the equivalent heptad position. • BICD1 CC3 has distinct binding sites for two classes of cargo, Rab6 and RanBP2. • The CC1-binding site of BICD1 CC3 overlaps with the Rab6-binding site.« less

  2. A Camelid-derived Antibody Fragment Targeting the Active Site of a Serine Protease Balances between Inhibitor and Substrate Behavior*

    PubMed Central

    Kromann-Hansen, Tobias; Oldenburg, Emil; Yung, Kristen Wing Yu; Ghassabeh, Gholamreza H.; Muyldermans, Serge; Declerck, Paul J.; Huang, Mingdong; Andreasen, Peter A.; Ngo, Jacky Chi Ki

    2016-01-01

    A peptide segment that binds the active site of a serine protease in a substrate-like manner may behave like an inhibitor or a substrate. However, there is sparse information on which factors determine the behavior a particular peptide segment will exhibit. Here, we describe the first x-ray crystal structure of a nanobody in complex with a serine protease. The nanobody displays a new type of interaction between an antibody and a serine protease as it inserts its complementary determining region-H3 loop into the active site of the protease in a substrate-like manner. The unique binding mechanism causes the nanobody to behave as a strong inhibitor as well as a poor substrate. Intriguingly, its substrate behavior is incomplete, as 30–40% of the nanobody remained intact and inhibitory after prolonged incubation with the protease. Biochemical analysis reveals that an intra-loop interaction network within the complementary determining region-H3 of the nanobody balances its inhibitor versus substrate behavior. Collectively, our results unveil molecular factors, which may be a general mechanism to determine the substrate versus inhibitor behavior of other protease inhibitors. PMID:27226628

  3. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  4. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    PubMed

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  5. RNA-programmed genome editing in human cells

    PubMed Central

    Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

    2013-01-01

    Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

  6. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  7. A Camelid-derived Antibody Fragment Targeting the Active Site of a Serine Protease Balances between Inhibitor and Substrate Behavior.

    PubMed

    Kromann-Hansen, Tobias; Oldenburg, Emil; Yung, Kristen Wing Yu; Ghassabeh, Gholamreza H; Muyldermans, Serge; Declerck, Paul J; Huang, Mingdong; Andreasen, Peter A; Ngo, Jacky Chi Ki

    2016-07-15

    A peptide segment that binds the active site of a serine protease in a substrate-like manner may behave like an inhibitor or a substrate. However, there is sparse information on which factors determine the behavior a particular peptide segment will exhibit. Here, we describe the first x-ray crystal structure of a nanobody in complex with a serine protease. The nanobody displays a new type of interaction between an antibody and a serine protease as it inserts its complementary determining region-H3 loop into the active site of the protease in a substrate-like manner. The unique binding mechanism causes the nanobody to behave as a strong inhibitor as well as a poor substrate. Intriguingly, its substrate behavior is incomplete, as 30-40% of the nanobody remained intact and inhibitory after prolonged incubation with the protease. Biochemical analysis reveals that an intra-loop interaction network within the complementary determining region-H3 of the nanobody balances its inhibitor versus substrate behavior. Collectively, our results unveil molecular factors, which may be a general mechanism to determine the substrate versus inhibitor behavior of other protease inhibitors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Recognizing metal and acid radical ion-binding sites by integrating ab initio modeling with template-based transferals.

    PubMed

    Hu, Xiuzhen; Dong, Qiwen; Yang, Jianyi; Zhang, Yang

    2016-11-01

    More than half of proteins require binding of metal and acid radical ions for their structure and function. Identification of the ion-binding locations is important for understanding the biological functions of proteins. Due to the small size and high versatility of the metal and acid radical ions, however, computational prediction of their binding sites remains difficult. We proposed a new ligand-specific approach devoted to the binding site prediction of 13 metal ions (Zn 2+ , Cu 2+ , Fe 2+ , Fe 3+ , Ca 2+ , Mg 2+ , Mn 2+ , Na + , K + ) and acid radical ion ligands (CO3 2- , NO2 - , SO4 2- , PO4 3- ) that are most frequently seen in protein databases. A sequence-based ab initio model is first trained on sequence profiles, where a modified AdaBoost algorithm is extended to balance binding and non-binding residue samples. A composite method IonCom is then developed to combine the ab initio model with multiple threading alignments for further improving the robustness of the binding site predictions. The pipeline was tested using 5-fold cross validations on a comprehensive set of 2,100 non-redundant proteins bound with 3,075 small ion ligands. Significant advantage was demonstrated compared with the state of the art ligand-binding methods including COACH and TargetS for high-accuracy ion-binding site identification. Detailed data analyses show that the major advantage of IonCom lies at the integration of complementary ab initio and template-based components. Ion-specific feature design and binding library selection also contribute to the improvement of small ion ligand binding predictions. http://zhanglab.ccmb.med.umich.edu/IonCom CONTACT: hxz@imut.edu.cn or zhng@umich.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

    PubMed Central

    Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

    2012-01-01

    Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

  10. Combined effects of a thymic peptide, thymopoietin and myasthenic patient sera in rat myotube culture.

    PubMed

    Eymard, B; Aimé, C; Cottin, C; Morel, E; Goldstein, G; Bach, J F; Berrih-Aknin, S

    1992-10-01

    We investigated in a rat myotube assay the combined effect of 26 myasthenic (MG) patient sera and a thymic peptide, thymopoietin (Tpo) which had previously been shown to bind Torpedo and human AChR and to compete with alpha-bungarotoxin (alpha-Bgt) binding. Cultures were first exposed to Tpo alone for 3 h (0.3, 7.5, 15 nM), then MG sera (5% final dilution) were added for an additional 18 h. Reduction in the amount of 125I-alpha-Bgt binding sites in the presence of various concentrations of Tpo were similar with control sera and in all the patients with low or undetectable anti-AChR Ab (11 cases). In cultures exposed to Tpo and sera with high anti-AChR Ab titre (15 cases), Tpo and anti-AChR Ab have an additive capacity to reduce the number of alpha-Bgt binding sites. The results are compatible with the hypothesis that anti-AChR Ab and Tpo could impair neuromuscular transmission by complementary mechanisms.

  11. Cysteine-rich secretory proteins (CRISP) and their role in mammalian fertilization.

    PubMed

    Cohen, Débora J; Maldera, Julieta A; Weigel Muñoz, Mariana; Ernesto, Juan I; Vasen, Gustavo; Cuasnicu, Patricia S

    2011-01-01

    Epididymal protein CRISPI is a member of the CRISP (Cysteine-RIch Secretory proteins) family and is involved in sperm-egg fusion through its interaction with complementary sites on the egg surface. Results from our laboratory have shown that this binding ability resides in a 12-amino-acid region corresponding to a highly conserved motif of the CRISP family, named Signature 2 (S2). In addition to this, our results revealed that CRISP1 could also be involved in the previous step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. As another approach to elucidate the participation of CRISP1 in fertilization, a mouse line containing a targeted disruption of CRISP1 was generated. Although CRISP1-deficient mice exhibited normal fertility, CRISP1-defficient sperm presented a decreased level of protein tyrosine phosphorylation during capacitation, and an impaired ability to fertilize both zona-intact and zona-free eggs in vitro, confirming the proposed roles for the protein in fertilization. Evidence obtained in our laboratory indicated that testicular CRISP2 would also be involved in sperm-egg fusion. Competition assays between CRISP1 and CRISP2, as well as the comparison of their corresponding S2 regions, suggest that both proteins bind to common complementary sites in the egg. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization.

  12. Hybrids of a Genetically Engineered Antibody and a Carbon Nanotube Transistor for Detection of Prostate Cancer Biomarkers

    PubMed Central

    Lerner, Mitchell B.; D’Souza, Jimson; Pazina, Tatiana; Dailey, Jennifer; Goldsmith, Brett R.; Robinson, Matthew K.; Johnson, A.T. Charlie

    2012-01-01

    We developed a novel detection method for osteopontin (OPN), a new biomarker for prostate cancer, by attaching a genetically engineered single chain variable fragment (scFv) protein with high binding affinity for OPN to a carbon nanotube field-effect transistor (NTFET). Chemical functionalization using diazonium salts is used to covalently attach scFv to NT-FETs, as confirmed by atomic force microscopy, while preserving the activity of the biological binding site for OPN. Electron transport measurements indicate that functionalized NT-FET may be used to detect the binding of OPN to the complementary scFv protein. A concentration-dependent increase in the source-drain current is observed in the regime of clinical significance, with a detection limit of approximately 30 fM. The scFv-NT hybrid devices exhibit selectivity for OPN over other control proteins. These devices respond to the presence of OPN in a background of concentrated bovine serum albumin, without loss of signal. Based on these observations, the detection mechanism is attributed to changes in scattering at scFv protein-occupied defect sites on the carbon nanotube sidewall. The functionalization procedure described here is expected to be generalizable to any antibody containing an accessible amine group, and to result in biosensors appropriate for detection of corresponding complementary proteins at fM concentrations. PMID:22575126

  13. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases

    PubMed Central

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-01-01

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding. DOI: http://dx.doi.org/10.7554/eLife.11835.001 PMID:27071344

  14. C. elegans microRNAs.

    PubMed

    Vella, Monica C; Slack, Frank J

    2005-09-21

    MicroRNAs (miRNAs) are small, non-coding regulatory RNAs found in many phyla that control such diverse events as development, metabolism, cell fate and cell death. They have also been implicated in human cancers. The C. elegans genome encodes hundreds of miRNAs, including the founding members of the miRNA family lin-4 and let-7. Despite the abundance of C. elegans miRNAs, few miRNA targets are known and little is known about the mechanism by which they function. However, C. elegans research continues to push the boundaries of discovery in this area. lin-4 and let-7 are the best understood miRNAs. They control the timing of adult cell fate determination in hypodermal cells by binding to partially complementary sites in the mRNA of key developmental regulators to repress protein expression. For example, lin-4 is predicted to bind to seven sites in the lin-14 3' untranslated region (UTR) to repress LIN-14, while let-7 is predicted to bind two let-7 complementary sites in the lin-41 3' UTR to down-regulate LIN-41. Two other miRNAs, lsy-6 and mir-273, control left-right asymmetry in neural development, and also target key developmental regulators for repression. Approximately one third of the C. elegans miRNAs are differentially expressed during development indicating a major role for miRNAs in C. elegans development. Given the remarkable conservation of developmental mechanism across phylogeny, many of the principles of miRNAs discovered in C. elegans are likely to be applicable to higher animals.

  15. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  16. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  17. Protein Allostery and Conformational Dynamics.

    PubMed

    Guo, Jingjing; Zhou, Huan-Xiang

    2016-06-08

    The functions of many proteins are regulated through allostery, whereby effector binding at a distal site changes the functional activity (e.g., substrate binding affinity or catalytic efficiency) at the active site. Most allosteric studies have focused on thermodynamic properties, in particular, substrate binding affinity. Changes in substrate binding affinity by allosteric effectors have generally been thought to be mediated by conformational transitions of the proteins or, alternatively, by changes in the broadness of the free energy basin of the protein conformational state without shifting the basin minimum position. When effector binding changes the free energy landscape of a protein in conformational space, the change affects not only thermodynamic properties but also dynamic properties, including the amplitudes of motions on different time scales and rates of conformational transitions. Here we assess the roles of conformational dynamics in allosteric regulation. Two cases are highlighted where NMR spectroscopy and molecular dynamics simulation have been used as complementary approaches to identify residues possibly involved in allosteric communication. Perspectives on contentious issues, for example, the relationship between picosecond-nanosecond local and microsecond-millisecond conformational exchange dynamics, are presented.

  18. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  19. BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.

    PubMed

    Fischer, Cornelia; Sauter, Margret; Dietrich, Petra

    2017-01-01

    Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.

  20. ITC-derived binding affinity may be biased due to titrant (nano)-aggregation. Binding of halogenated benzotriazoles to the catalytic domain of human protein kinase CK2

    PubMed Central

    Winiewska, Maria; Bugajska, Ewa

    2017-01-01

    The binding of four bromobenzotriazoles to the catalytic subunit of human protein kinase CK2 was assessed by two complementary methods: Microscale Thermophoresis (MST) and Isothermal Titration Calorimetry (ITC). New algorithm proposed for the global analysis of MST pseudo-titration data enabled reliable determination of binding affinities for two distinct sites, a relatively strong one with the Kd of the order of 100 nM and a substantially weaker one (Kd > 1 μM). The affinities for the strong binding site determined for the same protein-ligand systems using ITC were in most cases approximately 10-fold underestimated. The discrepancy was assigned directly to the kinetics of ligand nano-aggregates decay occurring upon injection of the concentrated ligand solution to the protein sample. The binding affinities determined in the reverse ITC experiment, in which ligands were titrated with a concentrated protein solution, agreed with the MST-derived data. Our analysis suggests that some ITC-derived Kd values, routinely reported together with PDB structures of protein-ligand complexes, may be biased due to the uncontrolled ligand (nano)-aggregation, which may occur even substantially below the solubility limit. PMID:28273138

  1. Fast photochemical oxidation of proteins (FPOP) maps the epitope of EGFR binding to adnectin.

    PubMed

    Yan, Yuetian; Chen, Guodong; Wei, Hui; Huang, Richard Y-C; Mo, Jingjie; Rempel, Don L; Tymiak, Adrienne A; Gross, Michael L

    2014-12-01

    Epitope mapping is an important tool for the development of monoclonal antibodies, mAbs, as therapeutic drugs. Recently, a class of therapeutic mAb alternatives, adnectins, has been developed as targeted biologics. They are derived from the 10th type III domain of human fibronectin ((10)Fn3). A common approach to map the epitope binding of these therapeutic proteins to their binding partners is X-ray crystallography. Although the crystal structure is known for Adnectin 1 binding to human epidermal growth factor receptor (EGFR), we seek to determine complementary binding in solution and to test the efficacy of footprinting for this purpose. As a relatively new tool in structural biology and complementary to X-ray crystallography, protein footprinting coupled with mass spectrometry is promising for protein-protein interaction studies. We report here the use of fast photochemical oxidation of proteins (FPOP) coupled with MS to map the epitope of EGFR-Adnectin 1 at both the peptide and amino-acid residue levels. The data correlate well with the previously determined epitopes from the crystal structure and are consistent with HDX MS data, which are presented in an accompanying paper. The FPOP-determined binding interface involves various amino-acid and peptide regions near the N terminus of EGFR. The outcome adds credibility to oxidative labeling by FPOP for epitope mapping and motivates more applications in the therapeutic protein area as a stand-alone method or in conjunction with X-ray crystallography, NMR, site-directed mutagenesis, and other orthogonal methods.

  2. Fast Photochemical Oxidation of Proteins (FPOP) Maps the Epitope of EGFR Binding to Adnectin

    NASA Astrophysics Data System (ADS)

    Yan, Yuetian; Chen, Guodong; Wei, Hui; Huang, Richard Y.-C.; Mo, Jingjie; Rempel, Don L.; Tymiak, Adrienne A.; Gross, Michael L.

    2014-12-01

    Epitope mapping is an important tool for the development of monoclonal antibodies, mAbs, as therapeutic drugs. Recently, a class of therapeutic mAb alternatives, adnectins, has been developed as targeted biologics. They are derived from the 10th type III domain of human fibronectin (10Fn3). A common approach to map the epitope binding of these therapeutic proteins to their binding partners is X-ray crystallography. Although the crystal structure is known for Adnectin 1 binding to human epidermal growth factor receptor (EGFR), we seek to determine complementary binding in solution and to test the efficacy of footprinting for this purpose. As a relatively new tool in structural biology and complementary to X-ray crystallography, protein footprinting coupled with mass spectrometry is promising for protein-protein interaction studies. We report here the use of fast photochemical oxidation of proteins (FPOP) coupled with MS to map the epitope of EGFR-Adnectin 1 at both the peptide and amino-acid residue levels. The data correlate well with the previously determined epitopes from the crystal structure and are consistent with HDX MS data, which are presented in an accompanying paper. The FPOP-determined binding interface involves various amino-acid and peptide regions near the N terminus of EGFR. The outcome adds credibility to oxidative labeling by FPOP for epitope mapping and motivates more applications in the therapeutic protein area as a stand-alone method or in conjunction with X-ray crystallography, NMR, site-directed mutagenesis, and other orthogonal methods.

  3. Non-site-specific allosteric effect of oxygen on human hemoglobin under high oxygen partial pressure

    PubMed Central

    Takayanagi, Masayoshi; Kurisaki, Ikuo; Nagaoka, Masataka

    2014-01-01

    Protein allostery is essential for vital activities. Allosteric regulation of human hemoglobin (HbA) with two quaternary states T and R has been a paradigm of allosteric structural regulation of proteins. It is widely accepted that oxygen molecules (O2) act as a “site-specific” homotropic effector, or the successive O2 binding to the heme brings about the quaternary regulation. However, here we show that the site-specific allosteric effect is not necessarily only a unique mechanism of O2 allostery. Our simulation results revealed that the solution environment of high O2 partial pressure enhances the quaternary change from T to R without binding to the heme, suggesting an additional “non-site-specific” allosteric effect of O2. The latter effect should play a complementary role in the quaternary change by affecting the intersubunit contacts. This analysis must become a milestone in comprehensive understanding of the allosteric regulation of HbA from the molecular point of view. PMID:24710521

  4. Non-site-specific allosteric effect of oxygen on human hemoglobin under high oxygen partial pressure.

    PubMed

    Takayanagi, Masayoshi; Kurisaki, Ikuo; Nagaoka, Masataka

    2014-04-08

    Protein allostery is essential for vital activities. Allosteric regulation of human hemoglobin (HbA) with two quaternary states T and R has been a paradigm of allosteric structural regulation of proteins. It is widely accepted that oxygen molecules (O2) act as a "site-specific" homotropic effector, or the successive O2 binding to the heme brings about the quaternary regulation. However, here we show that the site-specific allosteric effect is not necessarily only a unique mechanism of O2 allostery. Our simulation results revealed that the solution environment of high O2 partial pressure enhances the quaternary change from T to R without binding to the heme, suggesting an additional "non-site-specific" allosteric effect of O2. The latter effect should play a complementary role in the quaternary change by affecting the intersubunit contacts. This analysis must become a milestone in comprehensive understanding of the allosteric regulation of HbA from the molecular point of view.

  5. Computational Design of Ligand Binding Proteins with High Affinity and Selectivity

    PubMed Central

    Dou, Jiayi; Doyle, Lindsey; Nelson, Jorgen W.; Schena, Alberto; Jankowski, Wojciech; Kalodimos, Charalampos G.; Johnsson, Kai; Stoddard, Barry L.; Baker, David

    2014-01-01

    The ability to design proteins with high affinity and selectivity for any given small molecule would have numerous applications in biosensing, diagnostics, and therapeutics, and is a rigorous test of our understanding of the physiochemical principles that govern molecular recognition phenomena. Attempts to design ligand binding proteins have met with little success, however, and the computational design of precise molecular recognition between proteins and small molecules remains an “unsolved problem”1. We describe a general method for the computational design of small molecule binding sites with pre-organized hydrogen bonding and hydrophobic interfaces and high overall shape complementary to the ligand, and use it to design protein binding sites for the steroid digoxigenin (DIG). Of 17 designs that were experimentally characterized, two bind DIG; the highest affinity design has the lowest predicted interaction energy and the most pre-organized binding site in the set. A comprehensive binding-fitness landscape of this design generated by library selection and deep sequencing was used to guide optimization of binding affinity to a picomolar level, and two X-ray co-crystal structures of optimized complexes show atomic level agreement with the design models. The designed binder has a high selectivity for DIG over the related steroids digitoxigenin, progesterone, and β-estradiol, which can be reprogrammed through the designed hydrogen-bonding interactions. Taken together, the binding fitness landscape, co-crystal structures, and thermodynamic binding parameters illustrate how increases in binding affinity can result from distal sequence changes that limit the protein ensemble to conformers making the most energetically favorable interactions with the ligand. The computational design method presented here should enable the development of a new generation of biosensors, therapeutics, and diagnostics. PMID:24005320

  6. Prediction and Dissection of Protein-RNA Interactions by Molecular Descriptors.

    PubMed

    Liu, Zhi-Ping; Chen, Luonan

    2016-01-01

    Protein-RNA interactions play crucial roles in numerous biological processes. However, detecting the interactions and binding sites between protein and RNA by traditional experiments is still time consuming and labor costing. Thus, it is of importance to develop bioinformatics methods for predicting protein-RNA interactions and binding sites. Accurate prediction of protein-RNA interactions and recognitions will highly benefit to decipher the interaction mechanisms between protein and RNA, as well as to improve the RNA-related protein engineering and drug design. In this work, we summarize the current bioinformatics strategies of predicting protein-RNA interactions and dissecting protein-RNA interaction mechanisms from local structure binding motifs. In particular, we focus on the feature-based machine learning methods, in which the molecular descriptors of protein and RNA are extracted and integrated as feature vectors of representing the interaction events and recognition residues. In addition, the available methods are classified and compared comprehensively. The molecular descriptors are expected to elucidate the binding mechanisms of protein-RNA interaction and reveal the functional implications from structural complementary perspective.

  7. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  8. Relationship between Hot Spot Residues and Ligand Binding Hot Spots in Protein-Protein Interfaces

    PubMed Central

    Zerbe, Brandon S.; Hall, David R.

    2013-01-01

    In the context of protein-protein interactions, the term “hot spot” refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening. PMID:22770357

  9. Relationship between hot spot residues and ligand binding hot spots in protein-protein interfaces.

    PubMed

    Zerbe, Brandon S; Hall, David R; Vajda, Sandor; Whitty, Adrian; Kozakov, Dima

    2012-08-27

    In the context of protein-protein interactions, the term "hot spot" refers to a residue or cluster of residues that makes a major contribution to the binding free energy, as determined by alanine scanning mutagenesis. In contrast, in pharmaceutical research, a hot spot is a site on a target protein that has high propensity for ligand binding and hence is potentially important for drug discovery. Here we examine the relationship between these two hot spot concepts by comparing alanine scanning data for a set of 15 proteins with results from mapping the protein surfaces for sites that can bind fragment-sized small molecules. We find the two types of hot spots are largely complementary; the residues protruding into hot spot regions identified by computational mapping or experimental fragment screening are almost always themselves hot spot residues as defined by alanine scanning experiments. Conversely, a residue that is found by alanine scanning to contribute little to binding rarely interacts with hot spot regions on the partner protein identified by fragment mapping. In spite of the strong correlation between the two hot spot concepts, they fundamentally differ, however. In particular, while identification of a hot spot by alanine scanning establishes the potential to generate substantial interaction energy with a binding partner, there are additional topological requirements to be a hot spot for small molecule binding. Hence, only a minority of hot spots identified by alanine scanning represent sites that are potentially useful for small inhibitor binding, and it is this subset that is identified by experimental or computational fragment screening.

  10. Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA

    PubMed Central

    2016-01-01

    An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results. PMID:27983843

  11. Computational Assessment of Potassium and Magnesium Ion Binding to a Buried Pocket in GTPase-Associating Center RNA.

    PubMed

    Hayatshahi, Hamed S; Roe, Daniel R; Galindo-Murillo, Rodrigo; Hall, Kathleen B; Cheatham, Thomas E

    2017-01-26

    An experimentally well-studied model of RNA tertiary structures is a 58mer rRNA fragment, known as GTPase-associating center (GAC) RNA, in which a highly negative pocket walled by phosphate oxygen atoms is stabilized by a chelated cation. Although such deep pockets with more than one direct phosphate to ion chelation site normally include magnesium, as shown in one GAC crystal structure, another GAC crystal structure and solution experiments suggest potassium at this site. Both crystal structures also depict two magnesium ions directly bound to the phosphate groups comprising this controversial pocket. Here, we used classical molecular dynamics simulations as well as umbrella sampling to investigate the possibility of binding of potassium versus magnesium inside the pocket and to better characterize the chelation of one of the binding magnesium ions outside the pocket. The results support the preference of the pocket to accommodate potassium rather than magnesium and suggest that one of the closely binding magnesium ions can only bind at high magnesium concentrations, such as might be present during crystallization. This work illustrates the complementary utility of molecular modeling approaches with atomic-level detail in resolving discrepancies between conflicting experimental results.

  12. Modulation by K+ Plus NH4+ of microsomal (Na+, K+)-ATPase activity in selected ontogenetic stages of the diadromous river shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae).

    PubMed

    Leone, Francisco A; Bezerra, Thais M S; Garçon, Daniela P; Lucena, Malson N; Pinto, Marcelo R; Fontes, Carlos F L; McNamara, John C

    2014-01-01

    We investigate the synergistic stimulation by K(+) plus NH4 (+) of (Na(+), K(+))-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na(+), K(+))-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K(+) and NH4 (+) binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na(+), K(+))-ATPase activity is stimulated synergistically by ≈ 50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na(+), K(+))-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K(+) and NH4 (+) of gill (Na(+), K(+))-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 (+) during ontogenetic development in M. amazonicum.

  13. Modulation By K+ Plus NH4 + of Microsomal (Na+, K+)-ATPase Activity in Selected Ontogenetic Stages of the Diadromous River Shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae)

    PubMed Central

    Leone, Francisco A.; Bezerra, Thais M. S.; Garçon, Daniela P.; Lucena, Malson N.; Pinto, Marcelo R.; Fontes, Carlos F. L.; McNamara, John C.

    2014-01-01

    We investigate the synergistic stimulation by K+ plus NH4 + of (Na+, K+)-ATPase activity in microsomal preparations of whole zoea I and decapodid III, and in juvenile and adult river shrimp gills. Modulation of (Na+, K+)-ATPase activity is ontogenetic stage-specific, and particularly distinct between juveniles and adults. Although both gill enzymes exhibit two different sites for K+ and NH4 + binding, in the juvenile enzyme, these two sites are equivalent: binding by both ions results in slightly stimulated activity compared to that of a single ionic species. In the adult enzyme, the sites are not equivalent: when one ion occupies its specific binding site, (Na+, K+)-ATPase activity is stimulated synergistically by ≈50% on binding of the complementary ion. Immunolocalization reveals the enzyme to be distributed predominantly throughout the intralamellar septum in the gill lamellae of juveniles and adults. Western blot analyses demonstrate a single immunoreactive band, suggesting a single (Na+, K+)-ATPase α-subunit isoform that is distributed into different density membrane fractions, independently of ontogenetic stage. We propose a model for the modulation by K+ and NH4 + of gill (Na+, K+)-ATPase activity. These findings suggest that the gill enzyme may be regulated by NH4 + during ontogenetic development in M. amazonicum. PMID:24586919

  14. Crystallographic analysis of CD40 recognition and signaling by human TRAF2

    PubMed Central

    McWhirter, Sarah M.; Pullen, Steven S.; Holton, James M.; Crute, James J.; Kehry, Marilyn R.; Alber, Tom

    1999-01-01

    Tumor necrosis factor receptor superfamily members convey signals that promote diverse cellular responses. Receptor trimerization by extracellular ligands initiates signaling by recruiting members of the tumor necrosis factor receptor-associated factor (TRAF) family of adapter proteins to the receptor cytoplasmic domains. We report the 2.4-Å crystal structure of a 22-kDa, receptor-binding fragment of TRAF2 complexed with a functionally defined peptide from the cytoplasmic domain of the CD40 receptor. TRAF2 forms a mushroom-shaped trimer consisting of a coiled coil and a unique β-sandwich domain. Both domains mediate trimerization. The CD40 peptide binds in an extended conformation with every side chain in contact with a complementary groove on the rim of each TRAF monomer. The spacing between the CD40 binding sites on TRAF2 supports an elegant signaling mechanism in which trimeric, extracellular ligands preorganize the receptors to simultaneously recognize three sites on the TRAF trimer. PMID:10411888

  15. Metallomics investigations on potential binding partners of methylmercury in tuna fish muscle tissue using complementary mass spectrometric techniques.

    PubMed

    Kutscher, Daniel J; Sanz-Medel, Alfredo; Bettmer, Jörg

    2012-08-01

    In this study, the binding behaviour of methylmercury (MeHg(+)) towards proteins is investigated. Free sulfhydryl groups in cysteine residues are known to be the most likely binding partners, due to the high affinity of mercury to sulphur. However, detailed knowledge about discrete binding sites in living organisms has been so far scarce. A metallomics approach using different methods like size-exclusion chromatography (SEC) and liquid chromatography (LC) coupled to inductively coupled plasma-mass spectrometry (ICP-MS) as well as complementary mass spectrometric techniques (electrospray ionisation-tandem mass spectrometry, ESI-MS/MS) are combined to sequence and identify possible target proteins or peptides after enzymatic digestion. Potential targets for MeHg(+) in tuna fish muscle tissue are investigated using the certified reference material CRM464 as a model tissue. Different extraction procedures appropriate for the extraction of proteins are evaluated for their efficiency using isotope dilution analysis for the determination of total Hg in the extracts. Due to the high chemical stability of the mercury-sulphur bond, the bioconjugate can be quantitatively extracted with a combination of tris(hydroxymethyl)aminomethane (TRIS) and sodium dodecyl sulphate (SDS). Using different separation techniques such as SEC and SDS-polyacrylamide gel electrophoresis (SDS-PAGE) it can be shown that major binding occurs to a high-molecular weight protein (M(w) > 200 kDa). A potential target protein, skeletal muscle myosin heavy chain, could be identified after tryptic digestion and capillary LC-ESI-MS/MS.

  16. In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

    PubMed Central

    Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

    2016-01-01

    Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

  17. Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

    PubMed Central

    Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

    2018-01-01

    Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

  18. Mouse SLLP1, a sperm lysozyme-like protein involved in sperm-egg binding and fertilization.

    PubMed

    Herrero, María Belén; Mandal, Arabinda; Digilio, Laura C; Coonrod, Scott A; Maier, Bernhard; Herr, John C

    2005-08-01

    This study demonstrates the retention of mouse sperm lysozyme-like protein (mSLLP1) in the equatorial segment of spermatozoa following the acrosome reaction and a role for mSLLP1 in sperm-egg binding and fertilization. Treatment of cumulus intact oocytes with either recmSLLP1 or its antiserum resulted in a significant (P < or = 0.05) inhibition of fertilization. Co-incubation of zona-free mouse oocytes with capacitated mouse spermatozoa in the presence of varying concentrations of anti-recmSLLP1 serum or recmSLLP1 also inhibited sperm-oolemma binding. A complete inhibition of binding and fusion of spermatozoa to the oocyte occurred at 12.5 muM concentration of recmSLLP1, while conventional chicken and human lysozymes did not block sperm-egg binding. mSLLP1 showed receptor sites in the perivitelline space as well as on the microvillar region of the egg plasma membrane. The retention of mSLLP1 in the equatorial segment of acrosome-reacted sperm, the inhibitory effects of both recmSLLP1 and antibodies to SLLP1 on in vitro fertilization with both cumulus intact and zona-free eggs, and the definition of complementary SLLP1-binding sites on the egg plasma membrane together support the hypothesis that a c lysozyme-like protein is involved in the binding of spermatozoa to the egg plasma membrane during fertilization.

  19. Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.

    PubMed

    Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu

    2017-11-10

    The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.

  20. Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

    PubMed Central

    Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

    1977-01-01

    DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

  1. Ligand Binding Site Detection by Local Structure Alignment and Its Performance Complementarity

    PubMed Central

    Lee, Hui Sun; Im, Wonpil

    2013-01-01

    Accurate determination of potential ligand binding sites (BS) is a key step for protein function characterization and structure-based drug design. Despite promising results of template-based BS prediction methods using global structure alignment (GSA), there is a room to improve the performance by properly incorporating local structure alignment (LSA) because BS are local structures and often similar for proteins with dissimilar global folds. We present a template-based ligand BS prediction method using G-LoSA, our LSA tool. A large benchmark set validation shows that G-LoSA predicts drug-like ligands’ positions in single-chain protein targets more precisely than TM-align, a GSA-based method, while the overall success rate of TM-align is better. G-LoSA is particularly efficient for accurate detection of local structures conserved across proteins with diverse global topologies. Recognizing the performance complementarity of G-LoSA to TM-align and a non-template geometry-based method, fpocket, a robust consensus scoring method, CMCS-BSP (Complementary Methods and Consensus Scoring for ligand Binding Site Prediction), is developed and shows improvement on prediction accuracy. The G-LoSA source code is freely available at http://im.bioinformatics.ku.edu/GLoSA. PMID:23957286

  2. Glutamine 57 at the complementary binding site face is a key determinant of morantel selectivity for {alpha}7 nicotinic receptors.

    PubMed

    Bartos, Mariana; Price, Kerry L; Lummis, Sarah C R; Bouzat, Cecilia

    2009-08-07

    Nicotinic receptors (AChRs) play key roles in synaptic transmission. We explored activation of neuronal alpha7 and mammalian muscle AChRs by morantel and oxantel. Our results revealed a novel action of morantel as a high efficacy and more potent agonist than ACh of alpha7 receptors. The EC(50) for activation by morantel of both alpha7 and alpha7-5HT(3A) receptors is 7-fold lower than that determined for ACh. The minimum morantel concentration required to activate alpha7-5HT(3A) channels is 6-fold lower than that of ACh, and activation episodes are more prolonged than in the presence of ACh. By contrast, oxantel is a weak agonist of alpha7 and alpha7-5HT(3A), and both drugs are very low efficacy agonists of muscle AChRs. The replacement of Gln(57) in alpha7 by glycine, which is found in the equivalent position of the muscle AChR, decreases the efficacy for activation and turns morantel into a partial agonist. The reverse mutation in the muscle AChR (epsilonG57Q) increases 7-fold the efficacy of morantel. The mutations do not affect activation by ACh or oxantel, indicating that this position is selective for morantel. In silico studies show that the tetrahydropyrimidinyl group, common to both drugs, is close to Trp(149) of the principal face of the binding site, whereas the other cyclic group is proximal to Gln(57) of the complementary face in morantel but not in oxantel. Thus, position 57 at the complementary face is a key determinant of the high selectivity of morantel for alpha7. These results provide new information for further progress in drug design.

  3. Identification of a group of Haemophilus influenzae penicillin-binding proteins that may have complementary physiological roles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Malouin, F.; Parr, T.R. Jr.; Bryan, L.E.

    (35S)penicillin bound to different Haemophilus influenzae proteins in assays performed at 20, 37, or 42{degrees}C. Penicillin-binding proteins 3a, 3b, 4, and 4' formed a group characterized by their affinity for moxalactam, cefotaxime, and piperacillin. Penicillin-binding protein 4' showed specific properties that may reflect its complementary role in septation.

  4. Reciprocal Expression of lin-41 and the microRNAs let-7 and mir-125 During Mouse Embryogenesis

    PubMed Central

    Schulman, Betsy R. Maller; Esquela-Kerscher, Aurora; Slack, Frank J.

    2008-01-01

    In C. elegans, heterochronic genes control the timing of cell fate determination during development. Two heterochronic genes, let-7 and lin-4, encode microRNAs (miRNAs) that down-regulate a third heterochronic gene lin-41 by binding to complementary sites in its 3’UTR. let-7 and lin-4 are conserved in mammals. Here we report the cloning and sequencing of mammalian lin-41 orthologs. We find that mouse and human lin-41 genes contain predicted conserved complementary sites for let-7 and the lin-4 ortholog, mir-125, in their 3’UTRs. Mouse lin-41 (Mlin-41) is temporally expressed in developing mouse embryos, most dramatically in the limb buds. Mlin-41 is down-regulated during mid-embryogenesis at the time when mouse let-7c and mir-125 RNA levels are up-regulated. Our results suggest that mammalian lin-41 is temporally regulated by miRNAs in order to direct key developmental events such as limb formation. PMID:16247770

  5. Effect of Dioxygen on Copper(II) Binding to α-Synuclein

    PubMed Central

    Lucas, Heather R.; Lee, Jennifer C.

    2010-01-01

    Using the fluorescent amino acid tryptophan (Trp), we have characterized the copper(II) binding of F4W α-synuclein in the presence and absence of dioxygen at neutral pH. Variations in Trp fluorescence indicate that copper(II) binding is enhanced by the presence of dioxygen, with the apparent dissociation constant (Kd(app)) changing from 100 nM (anaerobic) to 10 nM (aerobic). To investigate the possible role of methionine oxidation, complementary work focused on synthetic peptide models of the N-terminal Cu(II)-α-syn site, MDV(F/W) and M*DV(F/W), where M*= methionine sulfoxide. Furthermore, we employed circular dichroism (CD) spectroscopy to demonstrate that the phenyl-to-indole (F→W) substitution does not alter copper(II) binding properties and to confirm the 1:1 metal-peptide binding stoichiometry. CD comparisons also revealed that Met1 oxidation does not affect the copper-peptide conformation and further suggested the possible existence of a CuII-Trp/Phe (cation-π) interaction. PMID:20064662

  6. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  7. The impact of active site mutations of South African HIV PR on drug resistance: Insight from molecular dynamics simulations, binding free energy and per-residue footprints.

    PubMed

    Ahmed, Shaimaa M; Maguire, Glenn E M; Kruger, Hendrik G; Govender, Thirumala

    2014-04-01

    Molecular dynamics simulations and binding free energy calculations were used to provide an understanding of the impact of active site drug-resistant mutations of the South African HIV protease subtype C (C-SA HIV PR), V82A and V82F/I84V on drug resistance. Unique per-residue interaction energy 'footprints' were developed to map the overall drug-binding profiles for the wild type and mutants. Results confirmed that these mutations altered the overall binding landscape of the amino acid residues not only in the active site region but also in the flaps as well. Four FDA-approved drugs were investigated in this study; these include ritonavir (RTV), saquinavir (SQV), indinavir (IDV), and nelfinavir (NFV). Computational results compared against experimental findings were found to be complementary. Against the V82F/I84V variant, saquinavir, indinavir, and nelfinavir lose remarkable entropic contributions relative to both wild-type and V82A C-SA HIV PRs. The per-residue energy 'footprints' and the analysis of ligand-receptor interactions for the drug complexes with the wild type and mutants have also highlighted the nature of drug interactions. The data presented in this study will prove useful in the design of more potent inhibitors effective against drug-resistant HIV strains. © 2013 John Wiley & Sons A/S.

  8. Widespread long noncoding RNAs as endogenous target mimics for microRNAs in plants.

    PubMed

    Wu, Hua-Jun; Wang, Zhi-Min; Wang, Meng; Wang, Xiu-Jie

    2013-04-01

    Target mimicry is a recently identified regulatory mechanism for microRNA (miRNA) functions in plants in which the decoy RNAs bind to miRNAs via complementary sequences and therefore block the interaction between miRNAs and their authentic targets. Both endogenous decoy RNAs (miRNA target mimics) and engineered artificial RNAs can induce target mimicry effects. Yet until now, only the Induced by Phosphate Starvation1 RNA has been proven to be a functional endogenous microRNA target mimic (eTM). In this work, we developed a computational method and systematically identified intergenic or noncoding gene-originated eTMs for 20 conserved miRNAs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). The predicted miRNA binding sites were well conserved among eTMs of the same miRNA, whereas sequences outside of the binding sites varied a lot. We proved that the eTMs of miR160 and miR166 are functional target mimics and identified their roles in the regulation of plant development. The effectiveness of eTMs for three other miRNAs was also confirmed by transient agroinfiltration assay.

  9. IspE Inhibitors Identified by a Combination of In Silico and In Vitro High-Throughput Screening

    PubMed Central

    Tidten-Luksch, Naomi; Grimaldi, Raffaella; Torrie, Leah S.; Frearson, Julie A.; Hunter, William N.; Brenk, Ruth

    2012-01-01

    CDP-ME kinase (IspE) contributes to the non-mevalonate or deoxy-xylulose phosphate (DOXP) pathway for isoprenoid precursor biosynthesis found in many species of bacteria and apicomplexan parasites. IspE has been shown to be essential by genetic methods and since it is absent from humans it constitutes a promising target for antimicrobial drug development. Using in silico screening directed against the substrate binding site and in vitro high-throughput screening directed against both, the substrate and co-factor binding sites, non-substrate-like IspE inhibitors have been discovered and structure-activity relationships were derived. The best inhibitors in each series have high ligand efficiencies and favourable physico-chemical properties rendering them promising starting points for drug discovery. Putative binding modes of the ligands were suggested which are consistent with established structure-activity relationships. The applied screening methods were complementary in discovering hit compounds, and a comparison of both approaches highlights their strengths and weaknesses. It is noteworthy that compounds identified by virtual screening methods provided the controls for the biochemical screens. PMID:22563402

  10. C2 Domain of Protein Kinase Cα: Elucidation of the Membrane Docking Surface by Site-Directed Fluorescence and Spin Labeling†

    PubMed Central

    Kohout, Susy C.; Corbalán-García, Senena; Gómez-Fernández, Juan C.; Falke, Joseph J.

    2013-01-01

    The C2 domain is a conserved signaling motif that triggers membrane docking in a Ca2+-dependent manner, but the membrane docking surfaces of many C2 domains have not yet been identified. Two extreme models can be proposed for the docking of the protein kinase Cα (PKCα) C2 domain to membranes. In the parallel model, the membrane-docking surface includes the Ca2+ binding loops and an anion binding site on β-strands 3–4, such that the β-strands are oriented parallel to the membrane. In the perpendicular model, the docking surface is localized to the Ca2+ binding loops and the β-strands are oriented perpendicular to the membrane surface. The present study utilizes site-directed fluorescence and spin-labeling to map out the membrane docking surface of the PKCα C2 domain. Single cysteine residues were engineered into 18 locations scattered over all regions of the protein surface, and were used as attachment sites for spectroscopic probes. The environmentally sensitive fluorescein probe identified positions where Ca2+ activation or membrane docking trigger measurable fluorescence changes. Ca2+ binding was found to initiate a global conformational change, while membrane docking triggered the largest fluorescein environmental changes at labeling positions on the three Ca2+ binding loops (CBL), thereby localizing these loops to the membrane docking surface. Complementary EPR power saturation measurements were carried out using a nitroxide spin probe to determine a membrane depth parameter, Φ, for each spin-labeled mutant. Positive membrane depth parameters indicative of membrane insertion were found for three positions, all located on the Ca2+ binding loops: N189 on CBL 1, and both R249 and R252 on CBL 3. In addition, EPR power saturation revealed that five positions near the anion binding site are partially protected from collisions with an aqueous paramagnetic probe, indicating that the anion binding site lies at or near the surface of the headgroup layer. Together, the fluorescence and EPR results indicate that the Ca2+ first and third Ca2+ binding loops insert directly into the lipid headgroup region of the membrane, and that the anion binding site on β-strands 3–4 lies near the headgroups. The data support a model in which the β-strands are tilted toward the parallel orientation relative to the membrane surface. PMID:12564928

  11. Binding of pixantrone to DNA at CpA dinucleotide sequences and bulge structures.

    PubMed

    Konda, Shyam K; Wang, Haiqiang; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

    2015-06-07

    The binding of the anti-cancer drug pixantrone to three oligonucleotide sequences, d(TCATATGA)2, d(CCGAGAATTCCGG)2 {double bulge = DB} and the non-self complementary d(TACGATGAGTA) : d(TACCATCGTA) {single bulge = SB}, has been studied by NMR spectroscopy and molecular modelling. The upfield shifts observed for the aromatic resonances of pixantrone upon addition of the drug to each oligonucleotide confirmed the drug bound by intercalation. For the duplex sequence d(TCATATGA)2, NOEs were observed from the pixantrone aromatic H7/8 and aliphatic Ha/Hb protons to the H6/H8 and H1' protons of the C2, A3, T6 and G7 nucleotides, demonstrating that pixantrone preferentially binds at the symmetric CpA sites. However, weaker NOEs observed to various protons from the T4 and A5 residues indicated alternative minor binding sites. NOEs from the H7/H8 and Ha/Hb protons to both major (H6/H8) and minor groove (H1') protons indicated approximately equal proportions of intercalation was from the major and minor groove at the CpA sites. Intermolecular NOEs were observed between the H7/H8 and H4 protons of pixantrone and the A4H1' and G3H1' protons of the oligonucleotide that contains two symmetrically related bulge sites (DB), indicative of binding at the adenine bulge sites. For the oligonucleotide that only contains a single bulge site (SB), NOEs were observed from pixantrone protons to the SB G7H1', A8H1' and G9H1' protons, confirming that the drug bound selectively at the adenine bulge site. A molecular model of pixantrone-bound SB could be constructed with the drug bound from the minor groove at the A8pG9 site that was consistent with the observed NMR data. The results demonstrate that pixantrone preferentially intercalates at adenine bulge sites, compared to duplex DNA, and predominantly from the minor groove.

  12. Photoaffinity labelling and solubilization on the central 5-HT1A receptor binding site.

    PubMed

    Gozlan, H; Emerit, M B; el Mestikawy, S; Cossery, J M; Marquet, A; Besselievre, R; Hamon, M

    1987-01-01

    Two complementary approaches, covalent labelling and solubilization, have been used to study the biochemical properties of the central 5-HT1A receptor binding site. We have first designed a photoaffinity ligand containing the structure of 8-OH-DPAT, a potent and specific agonist of 5-HT1A sites. Thus, 8-methoxy-2[N-n-propyl,N-3-(2-nitro-4-azido-phenyl)- aminopropyl]aminotetralin or 8-methoxy-3'-NAP-amino-PAT, was found to displace, in the dark, [3H]8-OH-DPAT from 5-HT1A sites in rat hippocampal membranes with an IC50 of 6.6 nM. Under two cumulative UV irradiations (366 nm, for 20 min at 4 degrees C), 8-methoxy-3-'-NAP-amino-PAT (30 nM) blocked irreversibly 55-60% of 5-HT1A binding sites. This blockade was specific of 5-HT1A sites since the other serotoninergic sites, 5-HT1B, 5-HT2 and also the presynaptic 5-HT3 sites were not affected by the treatment. In addition, the binding of [3H]Spiperone and [3H]7-OH-DPAT to striatal dopamine sites remained unchanged under similar photolysis conditions. The tritiated derivative of the photoaffinity ligand (92 Ci/mmol) was then synthesized for the identification of the covalently bound protein(s). SDS-PAGE of solubilized membranes irradiated in the presence of 20 nM 3H-8-methoxy-3'-NAP-amino-PAT allowed the detection of a 63 kD protein whose labelling appeared specific. Thus, 3H-incorporation into the 63 kD band could be prevented by microM concentrations of 5-HT, 8-OH-DPAT and other selective 5-HT1A ligands such as isapirone. In contrast, the 5-HT2 antagonist ketanserin, norepinephrine and dopamine-related ligands (including 7-OH-DPAT) were ineffective. Direct solubilization of 5-HT1A receptor binding sites was also attempted from rat hippocampal membranes. The best results were obtained using CHAPS (10 mM) plus NaCl (0.2 M), which led to 50% recovery of 5-HT1A sites in the 100,000 g supernatant. The pharmacological properties and sensitivity to N-ethyl-maleimide and GppNHp of soluble sites appeared near identical to those of membrane-bound 5-HT1A sites.

  13. Molecular Characterization of Monoclonal Antibodies that Inhibit Acetylcholinesterase by Targeting the Peripheral Site and Backdoor Region

    PubMed Central

    Essono, Sosthène; Mondielli, Grégoire; Lamourette, Patricia; Boquet, Didier; Grassi, Jacques; Marchot, Pascale

    2013-01-01

    The inhibition properties and target sites of monoclonal antibodies (mAbs) Elec403, Elec408 and Elec410, generated against Electrophorus electricus acetylcholinesterase (AChE), have been defined previously using biochemical and mutagenesis approaches. Elec403 and Elec410, which bind competitively with each other and with the peptidic toxin inhibitor fasciculin, are directed toward distinctive albeit overlapping epitopes located at the AChE peripheral anionic site, which surrounds the entrance of the active site gorge. Elec408, which is not competitive with the other two mAbs nor fasciculin, targets a second epitope located in the backdoor region, distant from the gorge entrance. To characterize the molecular determinants dictating their binding site specificity, we cloned and sequenced the mAbs; generated antigen-binding fragments (Fab) retaining the parental inhibition properties; and explored their structure-function relationships using complementary x-ray crystallography, homology modeling and flexible docking approaches. Hypermutation of one Elec403 complementarity-determining region suggests occurrence of antigen-driven selection towards recognition of the AChE peripheral site. Comparative analysis of the 1.9Å-resolution structure of Fab408 and of theoretical models of its Fab403 and Fab410 congeners evidences distinctive surface topographies and anisotropic repartitions of charges, consistent with their respective target sites and inhibition properties. Finally, a validated, data-driven docking model of the Fab403-AChE complex suggests a mode of binding at the PAS that fully correlates with the functional data. This comprehensive study documents the molecular peculiarities of Fab403 and Fab410, as the largest peptidic inhibitors directed towards the peripheral site, and those of Fab408, as the first inhibitor directed toward the backdoor region of an AChE and a unique template for the design of new, specific modulators of AChE catalysis. PMID:24146971

  14. Convergent transmission of RNAi guide-target mismatch information across Argonaute internal allosteric network.

    PubMed

    Joseph, Thomas T; Osman, Roman

    2012-01-01

    In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand "seed region" have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways.

  15. Convergent Transmission of RNAi Guide-Target Mismatch Information across Argonaute Internal Allosteric Network

    PubMed Central

    Joseph, Thomas T.; Osman, Roman

    2012-01-01

    In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways. PMID:23028290

  16. Targeting human breast cancer cells by an oncolytic adenovirus using microRNA-targeting strategy.

    PubMed

    Shayestehpour, Mohammad; Moghim, Sharareh; Salimi, Vahid; Jalilvand, Somayeh; Yavarian, Jila; Romani, Bizhan; Mokhtari-Azad, Talat

    2017-08-15

    MicroRNA-targeting strategy is a promising approach that enables oncolytic viruses to replicate in tumor cells but not in normal cells. In this study, we targeted adenoviral replication toward breast cancer cells by inserting ten complementary binding sites for miR-145-5p downstream of E1A gene. In addition, we evaluated the effect of increasing miR-145 binding sites on inhibition of virus replication. Ad5-control and adenoviruses carrying five or ten copies of miR145-5p target sites (Ad5-5miR145T, Ad5-10miR145T) were generated and inoculated into MDA-MB-453, BT-20, MCF-7 breast cancer cell lines and human mammary epithelial cells (HMEpC). Titer of Ad5-10miR145T in HMEpC was significantly lower than Ad5-control titer. Difference between the titer of these two viruses at 12, 24, 36, and 48h after infection was 1.25, 2.96, 3.06, and 3.77 log TCID 50 . No significant difference was observed between the titer of both adenoviruses in MDA-MB-453, BT-20 and MCF-7 cells. The infectious titer of adenovirus containing 10 miR-145 binding sites in HMEpC cells at 24, 36, and 48h post-infection was 1.7, 2.08, and 4-fold, respectively, lower than the titer of adenovirus carrying 5 miR-145 targets. Our results suggest that miR-145-targeting strategy provides selectivity for adenovirus replication in breast cancer cells. Increasing the number of miRNA binding sites within the adenoviral genome confers more selectivity for viral replication in cancer cells. Copyright © 2017. Published by Elsevier B.V.

  17. One Primer To Rule Them All: Universal Primer That Adds BBa_B0034 Ribosomal Binding Site to Any Coding Standard 10 BioBrick

    PubMed Central

    2015-01-01

    Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097

  18. Reassessment of Piwi binding to the genome and Piwi impact on RNA polymerase II distribution.

    PubMed

    Lin, Haifan; Chen, Mengjie; Kundaje, Anshul; Valouev, Anton; Yin, Hang; Liu, Na; Neuenkirchen, Nils; Zhong, Mei; Snyder, Michael

    2015-03-23

    Drosophila Piwi was reported by Huang et al. (2013) to be guided by piRNAs to piRNA-complementary sites in the genome, which then recruits heterochromatin protein 1a and histone methyltransferase Su(Var)3-9 to the sites. Among additional findings, Huang et al. (2013) also reported Piwi binding sites in the genome and the reduction of RNA polymerase II in euchromatin but its increase in pericentric regions in piwi mutants. Marinov et al. (2015) disputed the validity of the Huang et al. bioinformatic pipeline that led to the last two claims. Here we report our independent reanalysis of the data using current bioinformatic methods. Our reanalysis agrees with Marinov et al. (2015) that Piwi's genomic targets still remain to be identified but confirms the Huang et al. claim that Piwi influences RNA polymerase II distribution in the genome. This Matters Arising Response addresses the Marinov et al. (2015) Matters Arising, published concurrently in this issue of Developmental Cell. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Interactions of oxytetracycline with a smectite clay: a spectroscopic study with molecular simulations.

    PubMed

    Aristilde, Ludmilla; Marichal, Claire; Miéhé-Brendlé, Jocelyne; Lanson, Bruno; Charlet, Laurent

    2010-10-15

    Binding of antibiotics to clay minerals can decrease both their physical and biological availability in soils. To elucidate the binding mechanisms of tetracycline antibiotics on smectite clays as a function of pH, we probed the interactions of oxytetracycline (OTC) with Na-montmorillonite (MONT) using X-ray diffraction (XRD), infrared (IR), and solid-state nuclear magnetic resonance (NMR) spectroscopies, and Monte Carlo molecular simulations. The XRD patterns demonstrate the presence of OTC in the MONT interlayer space at acidic pH whereas complexation of OTC by external basal and edge sites seems to prevail at pH 8. At both pH, the (1)H-(13)C NMR profile indicates restricted mobility of the adsorbed OTC species; and, -CH(3) deformation and C-N stretching IR vibration bands confirm a binding mechanism involving the protonated dimethylamino group of OTC. Changes in the (23)Na NMR environments are consistent with cation-exchange and cation complexation reactions at the different sites of adsorption. Molecular simulations indicate that MONT interlayer spacing and structural charge localization dictate favorable binding conformations of the intercalated OTC, facilitating multiple interactions in agreement with the spectroscopic data. Our results present complementary insights into the mechanisms of adsorption of TETs on smectites important for their retention in natural and engineered soil environments.

  20. Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.

    PubMed

    Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S

    2008-01-01

    Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.

  1. Structure and function of APH(4)-Ia, a hygromycin B resistance enzyme.

    PubMed

    Stogios, Peter J; Shakya, Tushar; Evdokimova, Elena; Savchenko, Alexei; Wright, Gerard D

    2011-01-21

    The aminoglycoside phosphotransferase (APH) APH(4)-Ia is one of two enzymes responsible for bacterial resistance to the atypical aminoglycoside antibiotic hygromycin B (hygB). The crystal structure of APH(4)-Ia enzyme was solved in complex with hygB at 1.95 Å resolution. The APH(4)-Ia structure adapts a general two-lobe architecture shared by other APH enzymes and eukaryotic kinases, with the active site located at the interdomain cavity. The enzyme forms an extended hydrogen bond network with hygB primarily through polar and acidic side chain groups. Individual alanine substitutions of seven residues involved in hygB binding did not have significant effect on APH(4)-Ia enzymatic activity, indicating that the binding affinity is spread across a distributed network. hygB appeared as the only substrate recognized by APH(4)-Ia among the panel of 14 aminoglycoside compounds. Analysis of the active site architecture and the interaction with the hygB molecule demonstrated several unique features supporting such restricted substrate specificity. Primarily the APH(4)-Ia substrate-binding site contains a cluster of hydrophobic residues that provides a complementary surface to the twisted structure of the substrate. Similar to APH(2″) enzymes, the APH(4)-Ia is able to utilize either ATP or GTP for phosphoryl transfer. The defined structural features of APH(4)-Ia interactions with hygB and the promiscuity in regard to ATP or GTP binding could be exploited for the design of novel aminoglycoside antibiotics or inhibitors of this enzyme.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stogios, Peter J.; Shakya, Tushar; Evdokimova, Elena

    The aminoglycoside phosphotransferase (APH) APH(4)-Ia is one of two enzymes responsible for bacterial resistance to the atypical aminoglycoside antibiotic hygromycin B (hygB). The crystal structure of APH(4)-Ia enzyme was solved in complex with hygB at 1.95 {angstrom} resolution. The APH(4)-Ia structure adapts a general two-lobe architecture shared by other APH enzymes and eukaryotic kinases, with the active site located at the interdomain cavity. The enzyme forms an extended hydrogen bond network with hygB primarily through polar and acidic side chain groups. Individual alanine substitutions of seven residues involved in hygB binding did not have significant effect on APH(4)-Ia enzymatic activity,more » indicating that the binding affinity is spread across a distributed network. hygB appeared as the only substrate recognized by APH(4)-Ia among the panel of 14 aminoglycoside compounds. Analysis of the active site architecture and the interaction with the hygB molecule demonstrated several unique features supporting such restricted substrate specificity. Primarily the APH(4)-Ia substrate-binding site contains a cluster of hydrophobic residues that provides a complementary surface to the twisted structure of the substrate. Similar to APH(2{double_prime}) enzymes, the APH(4)-Ia is able to utilize either ATP or GTP for phosphoryl transfer. The defined structural features of APH(4)-Ia interactions with hygB and the promiscuity in regard to ATP or GTP binding could be exploited for the design of novel aminoglycoside antibiotics or inhibitors of this enzyme.« less

  3. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  4. Pheromone induction of agglutination in Saccharomyces cerevisiae a cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terrance, K.; Lipke, P.N.

    1987-10-01

    a-Agglutinin, the cell surface sexual agglutinin of yeast a cells, was assayed by its ability to bind its complementary agglutinin, ..cap alpha..-agglutinin. The specific binding of /sup 125/I-..cap alpha..-agglutinin to a cells treated with the sex pheromone ..cap alpha..-factor was 2 to 2.5 times that of binding to a cells not treated with ..cap alpha..-factor. Competition with unlabeled ..cap alpha..-agglutinin revealed that the increased binding was due to increased cell surface expression of a-agglutinin, with no apparent change in the binding constant. The increase in site number was similar to the increase in cellular agglutinability. Increased expression of a-agglutinin followedmore » the same kinetics as the increase in cellular agglutinability, with a 10-min lag followed by a 15- to 20-min response time. Induction kinetics were similar in cells in phases G1 and G2 of the cell cycle. Maximal expression levels were similar in cells treated with excess pheromone and in cells exposed to pheromone after destruction of constitutively expressed a-agglutinin.« less

  5. Scan for Motifs: a webserver for the analysis of post-transcriptional regulatory elements in the 3' untranslated regions (3' UTRs) of mRNAs.

    PubMed

    Biswas, Ambarish; Brown, Chris M

    2014-06-08

    Gene expression in vertebrate cells may be controlled post-transcriptionally through regulatory elements in mRNAs. These are usually located in the untranslated regions (UTRs) of mRNA sequences, particularly the 3'UTRs. Scan for Motifs (SFM) simplifies the process of identifying a wide range of regulatory elements on alignments of vertebrate 3'UTRs. SFM includes identification of both RNA Binding Protein (RBP) sites and targets of miRNAs. In addition to searching pre-computed alignments, the tool provides users the flexibility to search their own sequences or alignments. The regulatory elements may be filtered by expected value cutoffs and are cross-referenced back to their respective sources and literature. The output is an interactive graphical representation, highlighting potential regulatory elements and overlaps between them. The output also provides simple statistics and links to related resources for complementary analyses. The overall process is intuitive and fast. As SFM is a free web-application, the user does not need to install any software or databases. Visualisation of the binding sites of different classes of effectors that bind to 3'UTRs will facilitate the study of regulatory elements in 3' UTRs.

  6. Conformational analysis of the Streptococcus pneumoniae hyaluronate lyase and characterization of its hyaluronan-specific carbohydrate-binding module.

    PubMed

    Suits, Michael D L; Pluvinage, Benjamin; Law, Adrienne; Liu, Yan; Palma, Angelina S; Chai, Wengang; Feizi, Ten; Boraston, Alisdair B

    2014-09-26

    For a subset of pathogenic microorganisms, including Streptococcus pneumoniae, the recognition and degradation of host hyaluronan contributes to bacterial spreading through the extracellular matrix and enhancing access to host cell surfaces. The hyaluronate lyase (Hyl) presented on the surface of S. pneumoniae performs this role. Using glycan microarray screening, affinity electrophoresis, and isothermal titration calorimetry we show that the N-terminal module of Hyl is a hyaluronan-specific carbohydrate-binding module (CBM) and the founding member of CBM family 70. The 1.2 Å resolution x-ray crystal structure of CBM70 revealed it to have a β-sandwich fold, similar to other CBMs. The electrostatic properties of the binding site, which was identified by site-directed mutagenesis, are distinct from other CBMs and complementary to its acidic ligand, hyaluronan. Dynamic light scattering and solution small angle x-ray scattering revealed the full-length Hyl protein to exist as a monomer/dimer mixture in solution. Through a detailed analysis of the small angle x-ray scattering data, we report the pseudoatomic solution structures of the monomer and dimer forms of the full-length multimodular Hyl. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Widespread Long Noncoding RNAs as Endogenous Target Mimics for MicroRNAs in Plants1[W

    PubMed Central

    Wu, Hua-Jun; Wang, Zhi-Min; Wang, Meng; Wang, Xiu-Jie

    2013-01-01

    Target mimicry is a recently identified regulatory mechanism for microRNA (miRNA) functions in plants in which the decoy RNAs bind to miRNAs via complementary sequences and therefore block the interaction between miRNAs and their authentic targets. Both endogenous decoy RNAs (miRNA target mimics) and engineered artificial RNAs can induce target mimicry effects. Yet until now, only the Induced by Phosphate Starvation1 RNA has been proven to be a functional endogenous microRNA target mimic (eTM). In this work, we developed a computational method and systematically identified intergenic or noncoding gene-originated eTMs for 20 conserved miRNAs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). The predicted miRNA binding sites were well conserved among eTMs of the same miRNA, whereas sequences outside of the binding sites varied a lot. We proved that the eTMs of miR160 and miR166 are functional target mimics and identified their roles in the regulation of plant development. The effectiveness of eTMs for three other miRNAs was also confirmed by transient agroinfiltration assay. PMID:23429259

  8. Biogenic and Synthetic Peptides with Oppositely Charged Amino Acids as Binding Sites for Mineralization.

    PubMed

    Lemloh, Marie-Louise; Altintoprak, Klara; Wege, Christina; Weiss, Ingrid M; Rothenstein, Dirk

    2017-01-28

    Proteins regulate diverse biological processes by the specific interaction with, e.g., nucleic acids, proteins and inorganic molecules. The generation of inorganic hybrid materials, such as shell formation in mollusks, is a protein-controlled mineralization process. Moreover, inorganic-binding peptides are attractive for the bioinspired mineralization of non-natural inorganic functional materials for technical applications. However, it is still challenging to identify mineral-binding peptide motifs from biological systems as well as for technical systems. Here, three complementary approaches were combined to analyze protein motifs consisting of alternating positively and negatively charged amino acids: (i) the screening of natural biomineralization proteins; (ii) the selection of inorganic-binding peptides derived from phage display; and (iii) the mineralization of tobacco mosaic virus (TMV)-based templates. A respective peptide motif displayed on the TMV surface had a major impact on the SiO₂ mineralization. In addition, similar motifs were found in zinc oxide- and zirconia-binding peptides indicating a general binding feature. The comparative analysis presented here raises new questions regarding whether or not there is a common design principle based on acidic and basic amino acids for peptides interacting with minerals.

  9. Peptide-nucleic acids (PNAs) with pyrimido[4,5-d]pyrimidine-2,4,5,7-(1H,3H,6H,8H)-tetraone (PPT) as a universal base: their synthesis and binding affinity for oligodeoxyribonucleotides.

    PubMed

    Hirano, Taisuke; Kuroda, Kenji; Kataoka, Masanori; Hayakawa, Yoshihiro

    2009-07-21

    Peptide-nucleic acids (PNAs) including pyrimido[4,5-d]pyrimidine-2,4,5,7-(1H,3H,6H,8H)-tetraone (PPT) as a nucleobase were synthesized, and their binding affinity for the complementary oligodeoxyribonucleotides was investigated. We found that PNAs with one or two PPT(s) and natural nucleobases (i.e., adenine, cytosine, guanine, or thymine) have excellent binding affinity for oligodeoxyribonucleotides with complementary bases at the positions facing the natural nucleobases, and with adenine, cytosine, guanine, and thymine at the positions opposite PPT in PNAs. The binding affinity of the PPT-containing PNA is higher than or comparable to that of a PNA consisting of all complementary natural nucleobases, viz. a PNA with a suitable natural nucleobase in place of PPT in the PPT-containing PNA. Consequently, it was concluded that PPT serves as a useful universal base that can recognize all natural nucleobases.

  10. G quadruplex RNA structures in PSD-95 mRNA: potential regulators of miR-125a seed binding site accessibility.

    PubMed

    Stefanovic, Snezana; Bassell, Gary J; Mihailescu, Mihaela Rita

    2015-01-01

    Fragile X syndrome (FXS) is the most common inherited form of intellectual disability caused by the CGG trinucleotide expansion in the 3'-untranslated region of the FMR1 gene on the X chromosome, that silences the expression of the Fragile X mental retardation protein (FMRP). FMRP has been shown to bind to a G-rich region within the PSD-95 mRNA which encodes for the postsynaptic density protein 95 (PSD-95), and together with the microRNA miR-125a, to play an important role in the reversible inhibition of the PSD-95 mRNA translation in neurons. The loss of FMRP in Fmr1 KO mice disables this translation control in the production of the PSD-95 protein. Interestingly, the miR-125a binding site on PSD-95 mRNA is embedded in the G-rich region bound by FMRP and postulated to adopt one or more G quadruplex structures. In this study, we have used different biophysical techniques to validate and characterize the formation of parallel G quadruplex structures and binding of miR-125a to its complementary sequence located within the 3' UTR of PSD-95 mRNA. Our results indicate that the PSD-95 mRNA G-rich region folds into alternate G quadruplex conformations that coexist in equilibrium. miR-125a forms a stable complex with PSD-95 mRNA, as evident by characteristic Watson-Crick base-pairing that coexists with one of the G quadruplex forms, suggesting a novel mechanism for G quadruplex structures to regulate the access of miR-125a to its binding site. © 2014 Stefanovic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. G quadruplex RNA structures in PSD-95 mRNA: potential regulators of miR-125a seed binding site accessibility

    PubMed Central

    Stefanovic, Snezana; Bassell, Gary J.

    2015-01-01

    Fragile X syndrome (FXS) is the most common inherited form of intellectual disability caused by the CGG trinucleotide expansion in the 3′-untranslated region of the FMR1 gene on the X chromosome, that silences the expression of the Fragile X mental retardation protein (FMRP). FMRP has been shown to bind to a G-rich region within the PSD-95 mRNA which encodes for the postsynaptic density protein 95 (PSD-95), and together with the microRNA miR-125a, to play an important role in the reversible inhibition of the PSD-95 mRNA translation in neurons. The loss of FMRP in Fmr1 KO mice disables this translation control in the production of the PSD-95 protein. Interestingly, the miR-125a binding site on PSD-95 mRNA is embedded in the G-rich region bound by FMRP and postulated to adopt one or more G quadruplex structures. In this study, we have used different biophysical techniques to validate and characterize the formation of parallel G quadruplex structures and binding of miR-125a to its complementary sequence located within the 3′ UTR of PSD-95 mRNA. Our results indicate that the PSD-95 mRNA G-rich region folds into alternate G quadruplex conformations that coexist in equilibrium. miR-125a forms a stable complex with PSD-95 mRNA, as evident by characteristic Watson–Crick base-pairing that coexists with one of the G quadruplex forms, suggesting a novel mechanism for G quadruplex structures to regulate the access of miR-125a to its binding site. PMID:25406362

  12. Prokaryotic Argonautes - variations on the RNA interference theme.

    PubMed

    van der Oost, John; Swarts, Daan C; Jore, Matthijs M

    2014-04-15

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

  13. Prokaryotic Argonautes - variations on the RNA interference theme

    PubMed Central

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  14. Modulation of Conformational Equilibria in the S-Adenosylmethionine (SAM) II Riboswitch by SAM, Mg(2+), and Trimethylamine N-Oxide.

    PubMed

    McPhie, Peter; Brown, Patrick; Chen, Bin; Dayie, Theodore K; Minton, Allen P

    2016-09-13

    The dependence of the conformation of the S-adenosylmethionine (SAM) II riboswitch on the concentration of added Mg(2+) ions and SAM, individually and in mixtures, was monitored by circular dichroism (CD) spectroscopy and by measurement of the diffusion coefficient. The results are analyzed in the context of two complementary quantitative models, both of which are consistent with a single underlying physical model. Magnesium binding sites in the open state have an affinity on average higher than the affinity of those in the compact state, but formation of the compact state is accompanied by an increase in the number of binding sites. Consequently, at low Mg(2+) concentrations, Mg(2+) binds preferentially to the open state, favoring its formation, but at high concentrations, Mg(2+) binds preferentially to the compact state. The affinity of the riboswitch for SAM increases drastically with an increased level of binding of Mg(2+) to the compact pseudoknot conformation. The effect of increasing concentrations of trimethylamine N-oxide (TMAO), a well-studied molecular crowding agent, on the conformation of the riboswitch and its affinity for SAM were also monitored by CD spectroscopy and measurement of diffusion. In the absence of added Mg(2+), high concentrations of TMAO were found to induce a conformational change compatible with the formation of the pseudoknot form but have only a small effect on the affinity of the RNA for SAM.

  15. Sampling and energy evaluation challenges in ligand binding protein design

    PubMed Central

    Dou, Jiayi; Doyle, Lindsey; Jr. Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L.

    2017-01-01

    Abstract The steroid hormone 17α‐hydroxylprogesterone (17‐OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17‐OHP containing an extended, nonpolar, shape‐complementary binding pocket for the four‐ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17‐OHP with micromolar affinity. A co‐crystal structure of one of the designs revealed that 17‐OHP is rotated 180° around a pseudo‐two‐fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same “flipped” orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two‐fold symmetry of the molecule. PMID:28980354

  16. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  17. Molecular Features of the Copper Binding Sites in the Octarepeat Domain of the Prion Protein†

    PubMed Central

    Burns, Colin S.; Aronoff-Spencer, Eliah; Dunham, Christine M.; Lario, Paula; Avdievich, Nikolai I.; Antholine, William E.; Olmstead, Marilyn M.; Vrielink, Alice; Gerfen, Gary J.; Peisach, Jack; Scott, William G.; Millhauser, Glenn L.

    2010-01-01

    Recent evidence suggests that the prion protein (PrP) is a copper binding protein. The N-terminal region of human PrP contains four sequential copies of the highly conserved octarepeat sequence PHGGGWGQ spanning residues 60–91. This region selectively binds Cu2+ in vivo. In a previous study using peptide design, EPR, and CD spectroscopy, we showed that the HGGGW segment within each octarepeat comprises the fundamental Cu2+ binding unit [Aronoff-Spencer et al. (2000) Biochemistry 40, 13760–13771]. Here we present the first atomic resolution view of the copper binding site within an octarepeat. The crystal structure of HGGGW in a complex with Cu2+ reveals equatorial coordination by the histidine imidazole, two deprotonated glycine amides, and a glycine carbonyl, along with an axial water bridging to the Trp indole. Companion S-band EPR, X-band ESEEM, and HYSCORE experiments performed on a library of 15N-labeled peptides indicate that the structure of the copper binding site in HGGGW and PHGGGWGQ in solution is consistent with that of the crystal structure. Moreover, EPR performed on PrP(23–28, 57–91) and an 15N-labeled analogue demonstrates that the identified structure is maintained in the full PrP octarepeat domain. It has been shown that copper stimulates PrP endocytosis. The identified Gly–Cu linkage is unstable below pH ≈6.5 and thus suggests a pH-dependent molecular mechanism by which PrP detects Cu2+ in the extracellular matrix or releases PrP-bound Cu2+ within the endosome. The structure also reveals an unusual complementary interaction between copper-structured HGGGW units that may facilitate molecular recognition between prion proteins, thereby suggesting a mechanism for transmembrane signaling and perhaps conversion to the pathogenic form. PMID:11900542

  18. X-ray Crystal Structure of Aristolochene Synthase from Aspergillus terreus and Evolution of Templates for the Cyclization of Farnesyl Diphosphate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shishova,E.; Di Costanzo, L.; Cane, D.

    2007-01-01

    Aristolochene synthase from Aspergillus terreus catalyzes the cyclization of the universal sesquiterpene precursor, farnesyl diphosphate, to form the bicyclic hydrocarbon aristolochene. The 2.2 {angstrom} resolution X-ray crystal structure of aristolochene synthase reveals a tetrameric quaternary structure in which each subunit adopts the {alpha}-helical class I terpene synthase fold with the active site in the 'open', solvent-exposed conformation. Intriguingly, the 2.15 {angstrom} resolution crystal structure of the complex with Mg{sup 2+}{sub 3}-pyrophosphate reveals ligand binding only to tetramer subunit D, which is stabilized in the 'closed' conformation required for catalysis. Tetramer assembly may hinder conformational changes required for the transition frommore » the inactive open conformation to the active closed conformation, thereby accounting for the attenuation of catalytic activity with an increase in enzyme concentration. In both conformations, but especially in the closed conformation, the active site contour is highly complementary in shape to that of aristolochene, and a catalytic function is proposed for the pyrophosphate anion based on its orientation with regard to the presumed binding mode of aristolochene. A similar active site contour is conserved in aristolochene synthase from Penicillium roqueforti despite the substantial divergent evolution of these two enzymes, while strikingly different active site contours are found in the sesquiterpene cyclases 5-epi-aristolochene synthase and trichodiene synthase. Thus, the terpenoid cyclase active site plays a critical role as a template in binding the flexible polyisoprenoid substrate in the proper conformation for catalysis. Across the greater family of terpenoid cyclases, this template is highly evolvable within a conserved {alpha}-helical fold for the synthesis of terpene natural products of diverse structure and stereochemistry.« less

  19. Structure-based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists.

    EPA Science Inventory

    The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...

  20. Structure-Based Understanding of Binding Affinity and Mode of Estrogen Receptor α Agonists and Antagonists

    EPA Science Inventory

    The flexible hydrophobic ligand binding pocket (LBP) of estrogen receptor α (ERα) allows the binding of a wide variety of endocrine disruptors. Upon ligand binding, the LBP reshapes around the contours of the ligand and stabilizes the complex by complementary hydrophobic interact...

  1. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  2. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  3. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  4. Anti-idiotypic antibodies that protect cells against the action of diphtheria toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rolf, J.M.; Gaudin, H.M.; Tirrell, S.M.

    1989-03-01

    An anti-idiotypic serum prepared against the combining site (idiotype) of specific anti-diphtheria toxoid antibodies was characterized with respect to its interaction with highly diphtheria toxin-sensitive Vero cells. Although the anti-idiotypic serum protected Vero cells against the cytotoxic action of diphtheria toxin, it did not prevent the binding of /sup 125/I-labeled diphtheria toxin to the cells but did inhibit the internalization and degradation of /sup 125/I-labeled toxin. This anti-idiotypic serum immunoprecipitated a cell-surface protein from radiolabeled Vero cells with an apparent Mr of approximately 15,000. These results are consistent with the hypothesis that the anti-idiotypic serum contains antibodies that carry anmore » internal image of an internalization site on the toxin and that a cell-surface protein involved in toxin internalization possesses a complementary site recognized by both the toxin and the anti-idiotypic antibodies.« less

  5. A Fragment-Based Ligand Screen Against Part of a Large Protein Machine: The ND1 Domains of the AAA+ ATPase p97/VCP.

    PubMed

    Chimenti, Michael S; Bulfer, Stacie L; Neitz, R Jeffrey; Renslo, Adam R; Jacobson, Matthew P; James, Thomas L; Arkin, Michelle R; Kelly, Mark J S

    2015-07-01

    The ubiquitous AAA+ ATPase p97 functions as a dynamic molecular machine driving several cellular processes. It is essential in regulating protein homeostasis, and it represents a potential drug target for cancer, particularly when there is a greater reliance on the endoplasmic reticulum-associated protein degradation pathway and ubiquitin-proteasome pathway to degrade an overabundance of secreted proteins. Here, we report a case study for using fragment-based ligand design approaches against this large and dynamic hexamer, which has multiple potential binding sites for small molecules. A screen of a fragment library was conducted by surface plasmon resonance (SPR) and followed up by nuclear magnetic resonance (NMR), two complementary biophysical techniques. Virtual screening was also carried out to examine possible binding sites for the experimental hits and evaluate the potential utility of fragment docking for this target. Out of this effort, 13 fragments were discovered that showed reversible binding with affinities between 140 µM and 1 mM, binding stoichiometries of 1:1 or 2:1, and good ligand efficiencies. Structural data for fragment-protein interactions were obtained with residue-specific [U-(2)H] (13)CH3-methyl-labeling NMR strategies, and these data were compared to poses from docking. The combination of virtual screening, SPR, and NMR enabled us to find and validate a number of interesting fragment hits and allowed us to gain an understanding of the structural nature of fragment binding. © 2015 Society for Laboratory Automation and Screening.

  6. Sampling and energy evaluation challenges in ligand binding protein design.

    PubMed

    Dou, Jiayi; Doyle, Lindsey; Jr Greisen, Per; Schena, Alberto; Park, Hahnbeom; Johnsson, Kai; Stoddard, Barry L; Baker, David

    2017-12-01

    The steroid hormone 17α-hydroxylprogesterone (17-OHP) is a biomarker for congenital adrenal hyperplasia and hence there is considerable interest in development of sensors for this compound. We used computational protein design to generate protein models with binding sites for 17-OHP containing an extended, nonpolar, shape-complementary binding pocket for the four-ring core of the compound, and hydrogen bonding residues at the base of the pocket to interact with carbonyl and hydroxyl groups at the more polar end of the ligand. Eight of 16 designed proteins experimentally tested bind 17-OHP with micromolar affinity. A co-crystal structure of one of the designs revealed that 17-OHP is rotated 180° around a pseudo-two-fold axis in the compound and displays multiple binding modes within the pocket, while still interacting with all of the designed residues in the engineered site. Subsequent rounds of mutagenesis and binding selection improved the ligand affinity to nanomolar range, while appearing to constrain the ligand to a single bound conformation that maintains the same "flipped" orientation relative to the original design. We trace the discrepancy in the design calculations to two sources: first, a failure to model subtle backbone changes which alter the distribution of sidechain rotameric states and second, an underestimation of the energetic cost of desolvating the carbonyl and hydroxyl groups of the ligand. The difference between design model and crystal structure thus arises from both sampling limitations and energy function inaccuracies that are exacerbated by the near two-fold symmetry of the molecule. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  7. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  8. Molecular mechanisms involved in gamete interaction: evidence for the participation of cysteine-rich secretory proteins (CRISP) in sperm-egg fusion.

    PubMed

    Da Ros, V; Busso, D; Cohen, D J; Maldera, J; Goldweic, N; Cuasnicu, P S

    2007-01-01

    Epididymal protein DE and testicular protein Tpx-1 are two cysteine-rich secretory proteins also known as CRISP-1 and CRISP-2, respectively. DE/ CRISP-1 is localised on the equatorial segment of acrosome-reacted sperm and participates in rat gamete fusion through its binding to egg-complementary sites. Recent results using bacterially-expressed recombinant fragments of DE as well as synthetic peptides revealed that the ability of DE to bind to the egg surface and inhibit gamete fusion resides in a region of 12 amino acids corresponding to an evolutionary conserved motif of the CRISP family (Signature 2). Given the high degree of homology between DE/CRISP-1 and Tpx-1/CRISP-2, we also explored the potential participation of the testicular intra-acrosomal protein in gamete fusion. Results showing the ability of recombinant Tpx-1 to bind to the surface of rat eggs (evaluated by indirect immunofluorescence) and to significantly inhibit zona-free egg penetration, support the participation of this protein in gamete fusion through its interaction with egg-binding sites. Interestingly, rat Tpx-1 exhibits only two substitutions in Signature 2 when compared to this region in DE. Together, these results provide evidence for the involvement of both epididymal DE/CRISP-1 and testicular Tpx-1/CRISP-2 in gamete fusion suggesting the existence of a functional cooperation between homologue molecules as a mechanism to ensure the success of fertilisation.

  9. APADB: a database for alternative polyadenylation and microRNA regulation events

    PubMed Central

    Müller, Sören; Rycak, Lukas; Afonso-Grunz, Fabian; Winter, Peter; Zawada, Adam M.; Damrath, Ewa; Scheider, Jessica; Schmäh, Juliane; Koch, Ina; Kahl, Günter; Rotter, Björn

    2014-01-01

    Alternative polyadenylation (APA) is a widespread mechanism that contributes to the sophisticated dynamics of gene regulation. Approximately 50% of all protein-coding human genes harbor multiple polyadenylation (PA) sites; their selective and combinatorial use gives rise to transcript variants with differing length of their 3′ untranslated region (3′UTR). Shortened variants escape UTR-mediated regulation by microRNAs (miRNAs), especially in cancer, where global 3′UTR shortening accelerates disease progression, dedifferentiation and proliferation. Here we present APADB, a database of vertebrate PA sites determined by 3′ end sequencing, using massive analysis of complementary DNA ends. APADB provides (A)PA sites for coding and non-coding transcripts of human, mouse and chicken genes. For human and mouse, several tissue types, including different cancer specimens, are available. APADB records the loss of predicted miRNA binding sites and visualizes next-generation sequencing reads that support each PA site in a genome browser. The database tables can either be browsed according to organism and tissue or alternatively searched for a gene of interest. APADB is the largest database of APA in human, chicken and mouse. The stored information provides experimental evidence for thousands of PA sites and APA events. APADB combines 3′ end sequencing data with prediction algorithms of miRNA binding sites, allowing to further improve prediction algorithms. Current databases lack correct information about 3′UTR lengths, especially for chicken, and APADB provides necessary information to close this gap. Database URL: http://tools.genxpro.net/apadb/ PMID:25052703

  10. Bioconjugation of Oligodeoxynucleotides Carrying 1,4-Dicarbonyl Groups via Reductive Amination with Lysine Residues.

    PubMed

    Yang, Bo; Jinnouchi, Akiko; Usui, Kazuteru; Katayama, Tsutomu; Fujii, Masayuki; Suemune, Hiroshi; Aso, Mariko

    2015-08-19

    We evaluated the efficacy of bioconjugation of oligodeoxynucleotides (ODNs) containing 1,4-dicarbonyl groups, a C4'-oxidized abasic site (OAS), and a newly designed 2'-methoxy analogue, via reductive amination with lysine residues. Dicarbonyls, aldehyde and ketone at C1- and C4-positions of deoxyribose in the ring-opened form of OAS allowed efficient reaction with amines. Kinetic studies indicated that reductive amination of OAS-containing ODNs with a proximal amine on the complementary strand proceeded 10 times faster than the corresponding reaction of an ODN containing an abasic site with C1-aldehyde. Efficient reductive amination between the DNA-binding domain of Escherichia coli DnaA protein and ODNs carrying OAS in the DnaA-binding sequence proceeded at the lysine residue in proximity to the phosphate group at the 5'-position of the OAS, in contrast to unsuccessful conjugation with abasic site ODNs, even though they have similar aldehydes. Theoretical calculation indicated that the C1-aldehyde of OAS was more accessible to the target lysine than that of the abasic site. These results demonstrate the potential utility of cross-linking strategies that use dicarbonyl-containing ODNs for the study of protein-nucleic acid interactions. Conjugation with a lysine-containing peptide that lacked specific affinity for ODN was also successful, further highlighting the advantages of 1,4-dicarbonyls.

  11. Crystal structure of an avian influenza polymerase PA[subscript N] reveals an endonuclease active site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yuan, Puwei; Bartlam, Mark; Lou, Zhiyong

    2009-11-10

    The heterotrimeric influenza virus polymerase, containing the PA, PB1 and PB2 proteins, catalyses viral RNA replication and transcription in the nucleus of infected cells. PB1 holds the polymerase active site and reportedly harbours endonuclease activity, whereas PB2 is responsible for cap binding. The PA amino terminus is understood to be the major functional part of the PA protein and has been implicated in several roles, including endonuclease and protease activities as well as viral RNA/complementary RNA promoter binding. Here we report the 2.2 angstrom (A) crystal structure of the N-terminal 197 residues of PA, termed PA(N), from an avian influenzamore » H5N1 virus. The PA(N) structure has an alpha/beta architecture and reveals a bound magnesium ion coordinated by a motif similar to the (P)DX(N)(D/E)XK motif characteristic of many endonucleases. Structural comparisons and mutagenesis analysis of the motif identified in PA(N) provide further evidence that PA(N) holds an endonuclease active site. Furthermore, functional analysis with in vivo ribonucleoprotein reconstitution and direct in vitro endonuclease assays strongly suggest that PA(N) holds the endonuclease active site and has critical roles in endonuclease activity of the influenza virus polymerase, rather than PB1. The high conservation of this endonuclease active site among influenza strains indicates that PA(N) is an important target for the design of new anti-influenza therapeutics.« less

  12. Click Chemistry Mediated Functionalization of Vertical Nanowires for Biological Applications.

    PubMed

    Vutti, Surendra; Schoffelen, Sanne; Bolinsson, Jessica; Buch-Månson, Nina; Bovet, Nicolas; Nygård, Jesper; Martinez, Karen L; Meldal, Morten

    2016-01-11

    Semiconductor nanowires (NWs) are gaining significant importance in various biological applications, such as biosensing and drug delivery. Efficient and controlled immobilization of biomolecules on the NW surface is crucial for many of these applications. Here, we present for the first time the use of the Cu(I) -catalyzed alkyne-azide cycloaddition and its strain-promoted variant for the covalent functionalization of vertical NWs with peptides and proteins. The potential of the approach was demonstrated in two complementary applications of measuring enzyme activity and protein binding, which is of general interest for biological studies. The attachment of a peptide substrate provided NW arrays for the detection of protease activity. In addition, green fluorescent protein was immobilized in a site-specific manner and recognized by antibody binding to demonstrate the proof-of-concept for the use of covalently modified NWs for diagnostic purposes using minute amounts of material. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Computer-aided structure-affinity relationships in a set of piperazine and 3,8-diazabicyclo[3.2.1]octane derivatives binding to the μ-opioid receptor

    NASA Astrophysics Data System (ADS)

    Barlocco, Daniela; Cignarella, Giorgio; Greco, Giovanni; Novellino, Ettore

    1993-10-01

    Molecular modeling studies were carried out on a set of piperazine and 3,8-diazabicyclo[3.2.1]octane derivatives with the aim to highlight the main factors modulating their affinity for the μ-opioid receptor. Structure-affinity relationships were developed with the aid of molecular mechanics and semiempirical quantum-mechanics methods. According to our proposed pharmacodynamic model, the binding to the μ-receptor is promoted by the following physico-chemical features: the presence of hydrocarbon fragments on the nitrogen ring frame capable of interacting with one of two hypothesized hydrophobic receptor pockets; a `correct' orientation of an N-propionyl side chain so as to avoid a sterically hindered region of the receptor; the possibility of accepting a hydrogen bond from a receptor site complementary to the morphine phenol oxygen.

  14. Circular RNAs: Unexpected outputs of many protein-coding genes

    PubMed Central

    Wilusz, Jeremy E.

    2017-01-01

    ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

  15. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  16. SERS and MD simulation studies of a kinase inhibitor demonstrate the emergence of a potential drug discovery tool.

    PubMed

    Karthigeyan, Dhanasekaran; Siddhanta, Soumik; Kishore, Annavarapu Hari; Perumal, Sathya S R R; Ågren, Hans; Sudevan, Surabhi; Bhat, Akshay V; Balasubramanyam, Karanam; Subbegowda, Rangappa Kanchugarakoppal; Kundu, Tapas K; Narayana, Chandrabhas

    2014-07-22

    We demonstrate the use of surface-enhanced Raman spectroscopy (SERS) as an excellent tool for identifying the binding site of small molecules on a therapeutically important protein. As an example, we show the specific binding of the common antihypertension drug felodipine to the oncogenic Aurora A kinase protein via hydrogen bonding interactions with Tyr-212 residue to specifically inhibit its activity. Based on SERS studies, molecular docking, molecular dynamics simulation, biochemical assays, and point mutation-based validation, we demonstrate the surface-binding mode of this molecule in two similar hydrophobic pockets in the Aurora A kinase. These binding pockets comprise the same unique hydrophobic patches that may aid in distinguishing human Aurora A versus human Aurora B kinase in vivo. The application of SERS to identify the specific interactions between small molecules and therapeutically important proteins by differentiating competitive and noncompetitive inhibition demonstrates its ability as a complementary technique. We also present felodipine as a specific inhibitor for oncogenic Aurora A kinase. Felodipine retards the rate of tumor progression in a xenografted nude mice model. This study reveals a potential surface pocket that may be useful for developing small molecules by selectively targeting the Aurora family kinases.

  17. Transcription and translation in an RNA world

    PubMed Central

    Taylor, William R

    2006-01-01

    The RNA world hypothesis requires a ribozyme that was an RNA-directed RNA polymerase (ribopolymerase). If such a replicase makes a reverse complementary copy of any sequence (including itself), in a simple RNA world, there is no mechanism to prevent self-hybridization. It is proposed that this can be avoided through the synthesis of a parallel complementary copy. The logical consequences of this are pursued and developed in a computer simulation, where the behaviour of the parallel copy is compared to the conventional reverse complementary copy. It is found that the parallel copy is more efficient at higher temperatures (up to 90°C). A model for the ribopolymerase, based on the core of the large subunit (LSU) of the ribosome, is described. The geometry of a potential active site for this ribopolymerase suggests that it contained a cavity (now occupied by the aminoacyl-tRNA) and that an amino acid binding in this might have ‘poisoned’ the ribopolymerase by cross-reacting with the nucleoside-triphosphate before polymerization could occur. Based on a similarity to the active site components of the class-I tRNA synthetase enzymes, it is proposed that the amino acid could become attached to the nascent RNA transcript producing a variety of aminoacylated tRNA-like products. Using base-pairing interactions, some of these molecules might cross-link two ribopolymerases, giving rise to a precursor of the modern ribosome. A hybrid dimer, half polymerase and half proto-ribosome, could account for mRNA translocation before the advent of protein elongation factors. PMID:17008216

  18. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  19. Staufen-mediated mRNA decay

    PubMed Central

    Park, Eonyoung; Maquat, Lynne E.

    2013-01-01

    Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base-pairing of 3'UTR sequences or by intermolecular base-pairing of 3'UTR sequences with a long noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Since both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1, SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. PMID:23681777

  20. Mutations altering the cleavage specificity of a homing endonuclease

    PubMed Central

    Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

    2002-01-01

    The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

  1. Structural Characterization of a Thrombin-Aptamer Complex by High Resolution Native Top-Down Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jiang; Loo, Rachel R. Ogorzalek; Loo, Joseph A.

    2017-09-01

    Native mass spectrometry (MS) with electrospray ionization (ESI) has evolved as an invaluable tool for the characterization of intact native proteins and non-covalently bound protein complexes. Here we report the structural characterization by high resolution native top-down MS of human thrombin and its complex with the Bock thrombin binding aptamer (TBA), a 15-nucleotide DNA with high specificity and affinity for thrombin. Accurate mass measurements revealed that the predominant form of native human α-thrombin contains a glycosylation mass of 2205 Da, corresponding to a sialylated symmetric biantennary oligosaccharide structure without fucosylation. Native MS showed that thrombin and TBA predominantly form a 1:1 complex under near physiological conditions (pH 6.8, 200 mM NH4OAc), but the binding stoichiometry is influenced by the solution ionic strength. In 20 mM ammonium acetate solution, up to two TBAs were bound to thrombin, whereas increasing the solution ionic strength destabilized the thrombin-TBA complex and 1 M NH4OAc nearly completely dissociated the complex. This observation is consistent with the mediation of thrombin-aptamer binding through electrostatic interactions and it is further consistent with the human thrombin structure that contains two anion binding sites on the surface. Electron capture dissociation (ECD) top-down MS of the thrombin-TBA complex performed with a high resolution 15 Tesla Fourier transform ion cyclotron resonance (FTICR) mass spectrometer showed the primary binding site to be at exosite I located near the N-terminal sequence of the heavy chain, consistent with crystallographic data. High resolution native top-down MS is complementary to traditional structural biology methods for structurally characterizing native proteins and protein-DNA complexes. [Figure not available: see fulltext.

  2. Analysis of NFU-1 metallocofactor binding-site substitutions-impacts on iron-sulfur cluster coordination and protein structure and function.

    PubMed

    Wesley, Nathaniel A; Wachnowsky, Christine; Fidai, Insiya; Cowan, J A

    2017-11-01

    Iron-sulfur (Fe/S) clusters are ancient prosthetic groups found in numerous metalloproteins and are conserved across all kingdoms of life due to their diverse, yet essential functional roles. Genetic mutations to a specific subset of mitochondrial Fe/S cluster delivery proteins are broadly categorized as disease-related under multiple mitochondrial dysfunction syndrome (MMDS), with symptoms indicative of a general failure of the metabolic system. Multiple mitochondrial dysfunction syndrome 1 (MMDS1) arises as a result of the missense mutation in NFU1, an Fe/S cluster scaffold protein, which substitutes a glycine near the Fe/S cluster-binding pocket to a cysteine (p.Gly208Cys). This substitution has been shown to promote protein dimerization such that cluster delivery to NFU1 is blocked, preventing downstream cluster trafficking. However, the possibility of this additional cysteine, located adjacent to the cluster-binding site, serving as an Fe/S cluster ligand has not yet been explored. To fully understand the consequences of this Gly208Cys replacement, complementary substitutions at the Fe/S cluster-binding pocket for native and Gly208Cys NFU1 were made, along with six other variants. Herein, we report the results of an investigation on the effect of these substitutions on both cluster coordination and NFU1 structure and function. The data suggest that the G208C substitution does not contribute to cluster binding. Rather, replacement of the glycine at position 208 changes the oligomerization state as a result of global structural alterations that result in the downstream effects manifest as MMDS1, but does not perturb the coordination chemistry of the Fe-S cluster. © 2017 Federation of European Biochemical Societies.

  3. The Innate Immune Database (IIDB)

    PubMed Central

    Korb, Martin; Rust, Aistair G; Thorsson, Vesteinn; Battail, Christophe; Li, Bin; Hwang, Daehee; Kennedy, Kathleen A; Roach, Jared C; Rosenberger, Carrie M; Gilchrist, Mark; Zak, Daniel; Johnson, Carrie; Marzolf, Bruz; Aderem, Alan; Shmulevich, Ilya; Bolouri, Hamid

    2008-01-01

    Background As part of a National Institute of Allergy and Infectious Diseases funded collaborative project, we have performed over 150 microarray experiments measuring the response of C57/BL6 mouse bone marrow macrophages to toll-like receptor stimuli. These microarray expression profiles are available freely from our project web site . Here, we report the development of a database of computationally predicted transcription factor binding sites and related genomic features for a set of over 2000 murine immune genes of interest. Our database, which includes microarray co-expression clusters and a host of web-based query, analysis and visualization facilities, is available freely via the internet. It provides a broad resource to the research community, and a stepping stone towards the delineation of the network of transcriptional regulatory interactions underlying the integrated response of macrophages to pathogens. Description We constructed a database indexed on genes and annotations of the immediate surrounding genomic regions. To facilitate both gene-specific and systems biology oriented research, our database provides the means to analyze individual genes or an entire genomic locus. Although our focus to-date has been on mammalian toll-like receptor signaling pathways, our database structure is not limited to this subject, and is intended to be broadly applicable to immunology. By focusing on selected immune-active genes, we were able to perform computationally intensive expression and sequence analyses that would currently be prohibitive if applied to the entire genome. Using six complementary computational algorithms and methodologies, we identified transcription factor binding sites based on the Position Weight Matrices available in TRANSFAC. For one example transcription factor (ATF3) for which experimental data is available, over 50% of our predicted binding sites coincide with genome-wide chromatin immnuopreciptation (ChIP-chip) results. Our database can be interrogated via a web interface. Genomic annotations and binding site predictions can be automatically viewed with a customized version of the Argo genome browser. Conclusion We present the Innate Immune Database (IIDB) as a community resource for immunologists interested in gene regulatory systems underlying innate responses to pathogens. The database website can be freely accessed at . PMID:18321385

  4. A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

    2010-01-01

    Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

  5. Molecular determinants of ligand binding modes in the histamine H(4) receptor: linking ligand-based three-dimensional quantitative structure-activity relationship (3D-QSAR) models to in silico guided receptor mutagenesis studies.

    PubMed

    Istyastono, Enade P; Nijmeijer, Saskia; Lim, Herman D; van de Stolpe, Andrea; Roumen, Luc; Kooistra, Albert J; Vischer, Henry F; de Esch, Iwan J P; Leurs, Rob; de Graaf, Chris

    2011-12-08

    The histamine H(4) receptor (H(4)R) is a G protein-coupled receptor (GPCR) that plays an important role in inflammation. Similar to the homologous histamine H(3) receptor (H(3)R), two acidic residues in the H(4)R binding pocket, D(3.32) and E(5.46), act as essential hydrogen bond acceptors of positively ionizable hydrogen bond donors in H(4)R ligands. Given the symmetric distribution of these complementary pharmacophore features in H(4)R and its ligands, different alternative ligand binding mode hypotheses have been proposed. The current study focuses on the elucidation of the molecular determinants of H(4)R-ligand binding modes by combining (3D) quantitative structure-activity relationship (QSAR), protein homology modeling, molecular dynamics simulations, and site-directed mutagenesis studies. We have designed and synthesized a series of clobenpropit (N-(4-chlorobenzyl)-S-[3-(4(5)-imidazolyl)propyl]isothiourea) derivatives to investigate H(4)R-ligand interactions and ligand binding orientations. Interestingly, our studies indicate that clobenpropit (2) itself can bind to H(4)R in two distinct binding modes, while the addition of a cyclohexyl group to the clobenpropit isothiourea moiety allows VUF5228 (5) to adopt only one specific binding mode in the H(4)R binding pocket. Our ligand-steered, experimentally supported protein modeling method gives new insights into ligand recognition by H(4)R and can be used as a general approach to elucidate the structure of protein-ligand complexes.

  6. Transterm: a database to aid the analysis of regulatory sequences in mRNAs

    PubMed Central

    Jacobs, Grant H.; Chen, Augustine; Stevens, Stewart G.; Stockwell, Peter A.; Black, Michael A.; Tate, Warren P.; Brown, Chris M.

    2009-01-01

    Messenger RNAs, in addition to coding for proteins, may contain regulatory elements that affect how the protein is translated. These include protein and microRNA-binding sites. Transterm (http://mRNA.otago.ac.nz/Transterm.html) is a database of regions and elements that affect translation with two major unique components. The first is integrated results of analysis of general features that affect translation (initiation, elongation, termination) for species or strains in Genbank, processed through a standard pipeline. The second is curated descriptions of experimentally determined regulatory elements that function as translational control elements in mRNAs. Transterm focuses on protein binding sites, particularly those in 3′-untranslated regions (3′-UTR). For this release the interface has been extensively updated based on user feedback. The data is now accessible by strain rather than species, for example there are 10 Escherichia coli strains (genomes) analysed separately. In addition to providing a repository of data, the database also provides tools for users to query their own mRNA sequences. Users can search sequences for Transterm or user defined regulatory elements, including protein or miRNA targets. Transterm also provides a central core of links to related resources for complementary analyses. PMID:18984623

  7. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  8. Recombinant Collagen Engineered to Bind to Discoidin Domain Receptor Functions as a Receptor Inhibitor*

    PubMed Central

    An, Bo; Abbonante, Vittorio; Xu, Huifang; Gavriilidou, Despoina; Yoshizumi, Ayumi; Bihan, Dominique; Farndale, Richard W.; Kaplan, David L.; Balduini, Alessandra; Leitinger, Birgit; Brodsky, Barbara

    2016-01-01

    A bacterial collagen-like protein Scl2 has been developed as a recombinant collagen model system to host human collagen ligand-binding sequences, with the goal of generating biomaterials with selective collagen bioactivities. Defined binding sites in human collagen for integrins, fibronectin, heparin, and MMP-1 have been introduced into the triple-helical domain of the bacterial collagen and led to the expected biological activities. The modular insertion of activities is extended here to the discoidin domain receptors (DDRs), which are collagen-activated receptor tyrosine kinases. Insertion of the DDR-binding sequence from human collagen III into bacterial collagen led to specific receptor binding. However, even at the highest testable concentrations, the construct was unable to stimulate DDR autophosphorylation. The recombinant collagen expressed in Escherichia coli does not contain hydroxyproline (Hyp), and complementary synthetic peptide studies showed that replacement of Hyp by Pro at the critical Gly-Val-Met-Gly-Phe-Hyp position decreased the DDR-binding affinity and consequently required a higher concentration for the induction of receptor activation. The ability of the recombinant bacterial collagen to bind the DDRs without inducing kinase activation suggested it could interfere with the interactions between animal collagen and the DDRs, and such an inhibitory role was confirmed in vitro and with a cell migration assay. This study illustrates that recombinant collagen can complement synthetic peptides in investigating structure-activity relationships, and this system has the potential for the introduction or inhibition of specific biological activities. PMID:26702058

  9. The DNA binding site specificity and antiproliferative property of ternary Pt(II) and Zn(II) complexes of phenanthroline and N,N'-ethylenediaminediacetic acid.

    PubMed

    Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto

    2013-03-14

    The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].

  10. Fluorometric aptasensing of the neonicotinoid insecticide acetamiprid by using multiple complementary strands and gold nanoparticles.

    PubMed

    Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad

    2018-04-29

    A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.

  11. On the binding determinants of the glutamate agonist with the glutamate receptor ligand binding domain.

    PubMed

    Speranskiy, Kirill; Kurnikova, Maria

    2005-08-30

    Ionotropic glutamate receptors (GluRs) are ligand-gated membrane channel proteins found in the central neural system that mediate a fast excitatory response of neurons. In this paper, we report theoretical analysis of the ligand-protein interactions in the binding pocket of the S1S2 (ligand binding) domain of the GluR2 receptor in the closed conformation. By utilizing several theoretical methods ranging from continuum electrostatics to all-atom molecular dynamics simulations and quantum chemical calculations, we were able to characterize in detail glutamate agonist binding to the wild-type and E705D mutant proteins. A theoretical model of the protein-ligand interactions is validated via direct comparison of theoretical and Fourier transform infrared spectroscopy (FTIR) measured frequency shifts of the ligand's carboxylate group vibrations [Jayaraman et al. (2000) Biochemistry 39, 8693-8697; Cheng et al. (2002) Biochemistry 41, 1602-1608]. A detailed picture of the interactions in the binding site is inferred by analyzing contributions to vibrational frequencies produced by protein residues forming the ligand-binding pocket. The role of mobility and hydrogen-bonding network of water in the ligand-binding pocket and the contribution of protein residues exposed in the binding pocket to the binding and selectivity of the ligand are discussed. It is demonstrated that the molecular surface of the protein in the ligand-free state has mainly positive electrostatic potential attractive to the negatively charged ligand, and the potential produced by the protein in the ligand-binding pocket in the closed state is complementary to the distribution of the electrostatic potential produced by the ligand itself. Such charge complementarity ensures specificity to the unique charge distribution of the ligand.

  12. Decorin and biglycan retain LDL in disease-prone valvular and aortic subendothelial intimal matrix

    PubMed Central

    Neufeld, Edward B.; Zadrozny, Leah M.; Phillips, Darci; Aponte, Angel; Yu, Zu-Xi; Balaban, Robert S.

    2014-01-01

    Objective Subendothelial LDL retention by intimal matrix proteoglycans is an initial step in atherosclerosis and calcific aortic valve disease. Herein, we identify decorin and biglycan as the proteoglycans that preferentially retain LDL in intimal matrix at disease-prone sites in normal valve and vessel wall. Methods The porcine aortic valve and renal artery ostial diverter, initiation sites of calcific valve disease and renal atherosclerosis, respectively, from normal non-diseased animals were used as models in these studies. Results Fluorescent human LDL was selectively retained on the lesion-prone collagen/proteoglycan-enriched aortic surface of the valve, where the elastic lamina is depleted, as previously observed in lesion-prone sites in the renal ostium. iTRAQ mass spectrometry of valve and diverter protein extracts identified decorin and biglycan as the major subendothelial intimal matrix proteoglycans electrostatically retained on human LDL affinity columns. Decorin levels correlated with LDL binding in lesion-prone sites in both tissues. Collagen binding to LDL was shown to be proteoglycan-mediated. All known basement membrane proteoglycans bound LDL suggesting they may modulate LDL uptake into the subendothelial matrix. The association of purified decorin with human LDL in an in vitro microassay was blocked by serum albumin and heparin suggesting anti-atherogenic roles for these proteins in vivo. Conclusions LDL electrostatic interactions with decorin and biglycan in the valve leaflets and vascular wall is a major source of LDL retention. The complementary electrostatic sites on LDL or these proteoglycans may provide a novel therapeutic target for preventing one of the earliest events in these cardiovascular diseases. PMID:24529131

  13. Pivoting between calmodulin lobes triggered by calcium in the Kv7.2/calmodulin complex.

    PubMed

    Alaimo, Alessandro; Alberdi, Araitz; Gomis-Perez, Carolina; Fernández-Orth, Juncal; Bernardo-Seisdedos, Ganeko; Malo, Covadonga; Millet, Oscar; Areso, Pilar; Villarroel, Alvaro

    2014-01-01

    Kv7.2 (KCNQ2) is the principal molecular component of the slow voltage gated M-channel, which strongly influences neuronal excitability. Calmodulin (CaM) binds to two intracellular C-terminal segments of Kv7.2 channels, helices A and B, and it is required for exit from the endoplasmic reticulum. However, the molecular mechanisms by which CaM controls channel trafficking are currently unknown. Here we used two complementary approaches to explore the molecular events underlying the association between CaM and Kv7.2 and their regulation by Ca(2+). First, we performed a fluorometric assay using dansylated calmodulin (D-CaM) to characterize the interaction of its individual lobes to the Kv7.2 CaM binding site (Q2AB). Second, we explored the association of Q2AB with CaM by NMR spectroscopy, using (15)N-labeled CaM as a reporter. The combined data highlight the interdependency of the N- and C-lobes of CaM in the interaction with Q2AB, suggesting that when CaM binds Ca(2+) the binding interface pivots between the N-lobe whose interactions are dominated by helix B and the C-lobe where the predominant interaction is with helix A. In addition, Ca(2+) makes CaM binding to Q2AB more difficult and, reciprocally, the channel weakens the association of CaM with Ca(2+).

  14. Allosteric regulation in NMDA receptors revealed by the genetically encoded photo-cross-linkers

    PubMed Central

    Tian, Meilin; Ye, Shixin

    2016-01-01

    Allostery is essential to neuronal receptor function, but its transient nature poses a challenge for characterization. The N-terminal domains (NTDs) distinct from ligand binding domains are a major locus for allosteric regulation of NMDA receptors (NMDARs), where different modulatory binding sites have been observed. The inhibitor ifenprodil, and related phenylethanoamine compounds specifically targeting GluN1/GluN2B NMDARs have neuroprotective activity. However, whether they use differential structural pathways than the endogenous inhibitor Zn2+ for regulation is unknown. We applied genetically encoded unnatural amino acids (Uaas) and monitored the functional changes in living cells with photo-cross-linkers specifically incorporated at the ifenprodil binding interface between GluN1 and GluN2B subunits. We report constraining the NTD domain movement, by a light induced crosslinking bond that introduces minimal perturbation to the ligand binding, specifically impedes the transduction of ifenprodil but not Zn2+ inhibition. Subtle distance changes reveal interfacial flexibility and NTD rearrangements in the presence of modulators. Our results present a much richer dynamic picture of allostery than conventional approaches targeting the same interface, and highlight key residues that determine functional and subtype specificity of NMDARs. The light-sensitive mutant neuronal receptors provide complementary tools to the photo-switchable ligands for opto-neuropharmacology. PMID:27713495

  15. Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

    PubMed

    Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

    2013-02-01

    The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

  16. Modeling covalent-modifier drugs.

    PubMed

    Awoonor-Williams, Ernest; Walsh, Andrew G; Rowley, Christopher N

    2017-11-01

    In this review, we present a summary of how computer modeling has been used in the development of covalent-modifier drugs. Covalent-modifier drugs bind by forming a chemical bond with their target. This covalent binding can improve the selectivity of the drug for a target with complementary reactivity and result in increased binding affinities due to the strength of the covalent bond formed. In some cases, this results in irreversible inhibition of the target, but some targeted covalent inhibitor (TCI) drugs bind covalently but reversibly. Computer modeling is widely used in drug discovery, but different computational methods must be used to model covalent modifiers because of the chemical bonds formed. Structural and bioinformatic analysis has identified sites of modification that could yield selectivity for a chosen target. Docking methods, which are used to rank binding poses of large sets of inhibitors, have been augmented to support the formation of protein-ligand bonds and are now capable of predicting the binding pose of covalent modifiers accurately. The pK a 's of amino acids can be calculated in order to assess their reactivity towards electrophiles. QM/MM methods have been used to model the reaction mechanisms of covalent modification. The continued development of these tools will allow computation to aid in the development of new covalent-modifier drugs. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing

    PubMed Central

    Jones, Christopher P.; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

    2013-01-01

    The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNALys3. Host cell tRNALys is selectively packaged into HIV-1 through a specific interaction between the major tRNALys-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNALys3 is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNALys and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNALys3 in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNALys to increase the efficiency of tRNALys3 annealing to viral RNA. PMID:23264568

  18. Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

    PubMed

    Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

    1998-05-01

    Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

  19. A new configurational bias scheme for sampling supramolecular structures

    NASA Astrophysics Data System (ADS)

    De Gernier, Robin; Curk, Tine; Dubacheva, Galina V.; Richter, Ralf P.; Mognetti, Bortolo M.

    2014-12-01

    We present a new simulation scheme which allows an efficient sampling of reconfigurable supramolecular structures made of polymeric constructs functionalized by reactive binding sites. The algorithm is based on the configurational bias scheme of Siepmann and Frenkel and is powered by the possibility of changing the topology of the supramolecular network by a non-local Monte Carlo algorithm. Such a plan is accomplished by a multi-scale modelling that merges coarse-grained simulations, describing the typical polymer conformations, with experimental results accounting for free energy terms involved in the reactions of the active sites. We test the new algorithm for a system of DNA coated colloids for which we compute the hybridisation free energy cost associated to the binding of tethered single stranded DNAs terminated by short sequences of complementary nucleotides. In order to demonstrate the versatility of our method, we also consider polymers functionalized by receptors that bind a surface decorated by ligands. In particular, we compute the density of states of adsorbed polymers as a function of the number of ligand-receptor complexes formed. Such a quantity can be used to study the conformational properties of adsorbed polymers useful when engineering adsorption with tailored properties. We successfully compare the results with the predictions of a mean field theory. We believe that the proposed method will be a useful tool to investigate supramolecular structures resulting from direct interactions between functionalized polymers for which efficient numerical methodologies of investigation are still lacking.

  20. Self-Assembly of Octopus Nanoparticles into Pre-Programmed Finite Clusters

    NASA Astrophysics Data System (ADS)

    Halverson, Jonathan; Tkachenko, Alexei

    2012-02-01

    The precise control of the spatial arrangement of nanoparticles (NP) is often required to take full advantage of their novel optical and electronic properties. NPs have been shown to self-assemble into crystalline structures using either patchy surface regions or complementary DNA strands to direct the assembly. Due to a lack of specificity of the interactions these methods lead to only a limited number of structures. An emerging approach is to bind ssDNA at specific sites on the particle surface making so-called octopus NPs. Using octopus NPs we investigate the inverse problem of the self-assembly of finite clusters. That is, for a given target cluster (e.g., arranging the NPs on the vertices of a dodecahedron) what are the minimum number of complementary DNA strands needed for the robust self-assembly of the cluster from an initially homogeneous NP solution? Based on the results of Brownian dynamics simulations we have compiled a set of design rules for various target clusters including cubes, pyramids, dodecahedrons and truncated icosahedrons. Our approach leads to control over the kinetic pathway and has demonstrated nearly perfect yield of the target.

  1. mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay

    PubMed Central

    Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.

    2013-01-01

    We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942

  2. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    PubMed

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the regulatory role of estrogen in neurodevelopment.

  3. Site-directed DNA crosslinking of large multisubunit protein-DNA complexes.

    PubMed

    Persinger, Jim; Bartholomew, Blaine

    2009-01-01

    Several methods have been developed to site-specifically incorporate photoreactive nucleotide analogs into DNA for the purpose of identifying the proteins and their domains that are in contact with particular regions of DNA. The synthesis of several deoxynucleotide analogs that have a photoreactive group tethered to the nucleotide base and the incorporation of these analogs into DNA are described. In a second approach, oligonucleotide with a photoreactive group attached to the phosphate backbone is chemically synthesized. The photoreactive oligonucleotide is then enzymatically incorporated into DNA by annealing it to a complementary DNA template and extending with DNA polymerase. Both approaches have been effectively used to map protein-DNA interactions in large multisubunit complexes such as the eukaryotic transcription or ATP-dependent chromatin remodeling complexes. Not only do these techniques map the binding sites of the various subunits in these complexes, but when coupled with peptide mapping also determine the protein domain that is in close proximity to the different DNA sites. The strength of these techniques is the ability to scan a large number of potential sites by making combinations of different DNA probes and is facilitated by using an immobilized DNA template for synthesis.

  4. Computational design and elaboration of a de novo heterotetrameric alpha-helical protein that selectively binds an emissive abiological (porphinato)zinc chromophore.

    PubMed

    Fry, H Christopher; Lehmann, Andreas; Saven, Jeffery G; DeGrado, William F; Therien, Michael J

    2010-03-24

    The first example of a computationally de novo designed protein that binds an emissive abiological chromophore is presented, in which a sophisticated level of cofactor discrimination is pre-engineered. This heterotetrameric, C(2)-symmetric bundle, A(His):B(Thr), uniquely binds (5,15-di[(4-carboxymethyleneoxy)phenyl]porphinato)zinc [(DPP)Zn] via histidine coordination and complementary noncovalent interactions. The A(2)B(2) heterotetrameric protein reflects ligand-directed elements of both positive and negative design, including hydrogen bonds to second-shell ligands. Experimental support for the appropriate formulation of [(DPP)Zn:A(His):B(Thr)](2) is provided by UV/visible and circular dichroism spectroscopies, size exclusion chromatography, and analytical ultracentrifugation. Time-resolved transient absorption and fluorescence spectroscopic data reveal classic excited-state singlet and triplet PZn photophysics for the A(His):B(Thr):(DPP)Zn protein (k(fluorescence) = 4 x 10(8) s(-1); tau(triplet) = 5 ms). The A(2)B(2) apoprotein has immeasurably low binding affinities for related [porphinato]metal chromophores that include a (DPP)Fe(III) cofactor and the zinc metal ion hemin derivative [(PPIX)Zn], underscoring the exquisite active-site binding discrimination realized in this computationally designed protein. Importantly, elements of design in the A(His):B(Thr) protein ensure that interactions within the tetra-alpha-helical bundle are such that only the heterotetramer is stable in solution; corresponding homomeric bundles present unfavorable ligand-binding environments and thus preclude protein structural rearrangements that could lead to binding of (porphinato)iron cofactors.

  5. Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

    PubMed

    Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

    2014-10-17

    Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

  6. Study of goldfish (Carassius auratus) growth hormone structure-function relationship by domain swapping.

    PubMed

    Chan, Y H; Cheng, C H K; Chan, K M

    2007-03-01

    Using goldfish as a model, the structure-function relationship of goldfish growth hormone was studied using the strategy of homologous domain swapping. Chimeric mutants were constructed by exchanging homologous regions between goldfish growth hormone (gfGH II) and goldfish prolactin (gfPRL) with their cloned complementary DNAs. Six mutants, with their domain-swapped, were generated to have different combinations of three target regions, including the helix a, helix d and the large section in between these helices (possess the helices b, c and other random coiled regions). After expression in E. coli and refolding, these mutants were characterized by using competitive receptor binding assay (RRA) and growth hormone responding promoter activation assay. The different activity profiles of mutants in Spi 2.1 gene promoter assays from that in RRA shows that, for gfGH, receptor binding dose not confer receptor signal activations. When either helices a or d of gfGH was maintained with other helices replaced by their gfPRL counterparts, both receptor binding and hence gene activation activities are reduced. In mutants with helices b and c in gfGH maintained, containing the gfGH middle section, and helices a and d swapped with gfPRL, the had reduced RRA activities but the promoter activation activities retained. In conclusion, as in the case of human GH, the gfGH molecule possesses two functional sites: one of them is composed of discontinuous epitopes located on the target regions of this study and is for receptor binding; another site is located on the middle section of the molecule that helices a and d are not involved, and it is for activation of GH receptor and intracellular signals.

  7. Staufen-mediated mRNA decay.

    PubMed

    Park, Eonyoung; Maquat, Lynne E

    2013-01-01

    Staufen1 (STAU1)-mediated mRNA decay (SMD) is an mRNA degradation process in mammalian cells that is mediated by the binding of STAU1 to a STAU1-binding site (SBS) within the 3'-untranslated region (3'-UTR) of target mRNAs. During SMD, STAU1, a double-stranded (ds) RNA-binding protein, recognizes dsRNA structures formed either by intramolecular base pairing of 3'-UTR sequences or by intermolecular base pairing of 3'-UTR sequences with a long-noncoding RNA (lncRNA) via partially complementary Alu elements. Recently, STAU2, a paralog of STAU1, has also been reported to mediate SMD. Both STAU1 and STAU2 interact directly with the ATP-dependent RNA helicase UPF1, a key SMD factor, enhancing its helicase activity to promote effective SMD. Moreover, STAU1 and STAU2 form homodimeric and heterodimeric interactions via domain-swapping. Because both SMD and the mechanistically related nonsense-mediated mRNA decay (NMD) employ UPF1; SMD and NMD are competitive pathways. Competition contributes to cellular differentiation processes, such as myogenesis and adipogenesis, placing SMD at the heart of various physiologically important mechanisms. Copyright © 2013 John Wiley & Sons, Ltd.

  8. Using Cryo-EM to Map Small Ligands on Dynamic Metabolic Enzymes: Studies with Glutamate Dehydrogenase

    PubMed Central

    Borgnia, Mario J.; Banerjee, Soojay; Merk, Alan; Matthies, Doreen; Bartesaghi, Alberto; Rao, Prashant; Pierson, Jason; Earl, Lesley A.; Falconieri, Veronica

    2016-01-01

    Cryo-electron microscopy (cryo-EM) methods are now being used to determine structures at near-atomic resolution and have great promise in molecular pharmacology, especially in the context of mapping the binding of small-molecule ligands to protein complexes that display conformational flexibility. We illustrate this here using glutamate dehydrogenase (GDH), a 336-kDa metabolic enzyme that catalyzes the oxidative deamination of glutamate. Dysregulation of GDH leads to a variety of metabolic and neurologic disorders. Here, we report near-atomic resolution cryo-EM structures, at resolutions ranging from 3.2 Å to 3.6 Å for GDH complexes, including complexes for which crystal structures are not available. We show that the binding of the coenzyme NADH alone or in concert with GTP results in a binary mixture in which the enzyme is in either an “open” or “closed” state. Whereas the structure of NADH in the active site is similar between the open and closed states, it is unexpectedly different at the regulatory site. Our studies thus demonstrate that even in instances when there is considerable structural information available from X-ray crystallography, cryo-EM methods can provide useful complementary insights into regulatory mechanisms for dynamic protein complexes. PMID:27036132

  9. Conformational analysis of HAMLET, the folding variant of human alpha-lactalbumin associated with apoptosis.

    PubMed

    Casbarra, Annarita; Birolo, Leila; Infusini, Giuseppe; Dal Piaz, Fabrizio; Svensson, Malin; Pucci, Piero; Svanborg, Catharina; Marino, Gennaro

    2004-05-01

    A combination of hydrogen/deuterium (H/D) exchange and limited proteolysis experiments coupled to mass spectrometry analysis was used to depict the conformation in solution of HAMLET, the folding variant of human alpha-lactalbumin, complexed to oleic acid, that induces apoptosis in tumor and immature cells. Although near- and far-UV CD and fluorescence spectroscopy were not able to discriminate between HAMLET and apo-alpha-lactalbumin, H/D exchange experiments clearly showed that they correspond to two distinct conformational states, with HAMLET incorporating a greater number of deuterium atoms than the apo and holo forms. Complementary proteolysis experiments revealed that HAMLET and apo are both accessible to proteases in the beta-domain but showed substantial differences in accessibility to proteases at specific sites. The overall results indicated that the conformational changes associated with the release of Ca2+ are not sufficient to induce the HAMLET conformation. Metal depletion might represent the first event to produce a partial unfolding in the beta-domain of alpha-lactalbumin, but some more unfolding is needed to generate the active conformation HAMLET, very likely allowing the protein to bind the C18:1 fatty acid moiety. On the basis of these data, a putative binding site of the oleic acid, which stabilizes the HAMLET conformation, is proposed.

  10. An Aromatic Sensor with Aversion to Damaged Strands Confers Versatility to DNA Repair

    PubMed Central

    Maillard, Olivier; Solyom, Szilvia; Naegeli, Hanspeter

    2007-01-01

    It was not known how xeroderma pigmentosum group C (XPC) protein, the primary initiator of global nucleotide excision repair, achieves its outstanding substrate versatility. Here, we analyzed the molecular pathology of a unique Trp690Ser substitution, which is the only reported missense mutation in xeroderma patients mapping to the evolutionary conserved region of XPC protein. The function of this critical residue and neighboring conserved aromatics was tested by site-directed mutagenesis followed by screening for excision activity and DNA binding. This comparison demonstrated that Trp690 and Phe733 drive the preferential recruitment of XPC protein to repair substrates by mediating an exquisite affinity for single-stranded sites. Such a dual deployment of aromatic side chains is the distinctive feature of functional oligonucleotide/oligosaccharide-binding folds and, indeed, sequence homologies with replication protein A and breast cancer susceptibility 2 protein indicate that XPC displays a monomeric variant of this recurrent interaction motif. An aversion to associate with damaged oligonucleotides implies that XPC protein avoids direct contacts with base adducts. These results reveal for the first time, to our knowledge, an entirely inverted mechanism of substrate recognition that relies on the detection of single-stranded configurations in the undamaged complementary sequence of the double helix. PMID:17355181

  11. Expression analysis of a novel pyridoxal kinase messenger RNA splice variant, PKL, in oil rape suffering abiotic stress and phytohormones.

    PubMed

    Yu, Shunwu; Luo, Lijun

    2008-12-01

    Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.

  12. Two complementary fluorimetric assays for the determination of aminoquinoline binding and uptake by human erythrocytes in vitro.

    PubMed

    Basilico, Nicoletta; Cortelezzi, Lucia; Serpellini, Chiara; Taramelli, Donatella; Omodeo-Salè, Fausta; Salè, Fausta

    2009-02-15

    We provide two simple low-cost and low-tech procedures to measure with good precision and accuracy the binding and internalization into human erythrocytes of chloroquine and other aminoquinolines. The methods are based on the high fluorescence of the quinoline ring and are complementary. Method A evaluates residual drugs in the supernatants of treated erythrocytes, whereas method B quantifies the total uptake by whole cells and the fraction bound to the membranes. Drug uptake is dose dependent and related to the number of erythrocytes. These assays could be useful when studying the cell interaction of quinoline-type compounds not available in the radioactive form.

  13. Thermometric sensing of nitrofurantoin by noncovalently imprinted polymers containing two complementary functional monomers.

    PubMed

    Athikomrattanakul, Umporn; Gajovic-Eichelmann, Nenad; Scheller, Frieder W

    2011-10-15

    Molecularly imprinted polymers (MIPs) for nitrofurantoin (NFT) recognition addressing in parallel of two complementary functional groups were created using a noncovalent imprinting approach. Specific tailor-made functional monomers were synthesized: a diaminopyridine derivative as the receptor for the imide residue and three (thio)urea derivatives for the interaction with the nitro group of NFT. A significantly improved binding of NFT to the new MIPs was revealed from the imprinting factor, efficiency of binding, affinity constants and maximum binding number as compared to previously reported MIPs, which addressed either the imide or the nitro residue. Substances possessing only one functionality (either the imide group or nitro group) showed significantly weaker binding to the new imprinted polymers than NFT. However, the compounds lacking both functionalities binds extremely weak to all imprinted polymers. The new imprinted polymers were applied in a flow-through thermistor in organic solvent for the first time. The MIP-thermistor allows the detection of NFT down to a concentration of 5 μM in acetonitrile + 0.2% dimethyl sulfoxide (DMSO). The imprinting factor of 3.91 at 0.1 mM of NFT as obtained by thermistor measurements is well comparable to the value obtained by batch binding experiments. © 2011 American Chemical Society

  14. Amino Acid Requirements for MDA5 and LGP2 Recognition by Paramyxovirus V Proteins: a Single Arginine Distinguishes MDA5 from RIG-I

    PubMed Central

    Rodriguez, Kenny R.

    2013-01-01

    Paramyxovirus V proteins bind to MDA5 (melanoma differentiation-associated gene 5) and LGP2 (laboratory of genetics and physiology gene 2) but not RIG-I (retinoic acid-inducible gene I). The results demonstrate MDA5 R806 is essential for inhibition by diverse V proteins. Complementary substitution for the analogous RIG-I L714 confers V protein recognition. The analogous LGP2 R455 is required for recognition by measles V protein, but not other V proteins. These findings indicate that paramyxoviruses use a single amino acid to distinguish MDA5 from RIG-I and have evolved distinct contact sites for LGP2 interference. PMID:23269789

  15. Structural basis for microRNA targeting

    DOE PAGES

    Schirle, Nicole T.; Sheu-Gruttadauria, Jessica; MacRae, Ian J.

    2014-10-31

    MicroRNAs (miRNAs) control expression of thousands of genes in plants and animals. miRNAs function by guiding Argonaute proteins to complementary sites in messenger RNAs (mRNAs) targeted for repression. In this paper, we determined crystal structures of human Argonaute-2 (Ago2) bound to a defined guide RNA with and without target RNAs representing miRNA recognition sites. These structures suggest a stepwise mechanism, in which Ago2 primarily exposes guide nucleotides (nt) 2 to 5 for initial target pairing. Pairing to nt 2 to 5 promotes conformational changes that expose nt 2 to 8 and 13 to 16 for further target recognition. Interactions withmore » the guide-target minor groove allow Ago2 to interrogate target RNAs in a sequence-independent manner, whereas an adenosine binding-pocket opposite guide nt 1 further facilitates target recognition. Spurious slicing of miRNA targets is avoided through an inhibitory coordination of one catalytic magnesium ion. Finally, these results explain the conserved nucleotide-pairing patterns in animal miRNA target sites first observed over two decades ago.« less

  16. Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.

    2008-01-20

    DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less

  17. Carbohydrate–Aromatic Interactions in Proteins

    PubMed Central

    2015-01-01

    Protein–carbohydrate interactions play pivotal roles in health and disease. However, defining and manipulating these interactions has been hindered by an incomplete understanding of the underlying fundamental forces. To elucidate common and discriminating features in carbohydrate recognition, we have analyzed quantitatively X-ray crystal structures of proteins with noncovalently bound carbohydrates. Within the carbohydrate-binding pockets, aliphatic hydrophobic residues are disfavored, whereas aromatic side chains are enriched. The greatest preference is for tryptophan with an increased prevalence of 9-fold. Variations in the spatial orientation of amino acids around different monosaccharides indicate specific carbohydrate C–H bonds interact preferentially with aromatic residues. These preferences are consistent with the electronic properties of both the carbohydrate C–H bonds and the aromatic residues. Those carbohydrates that present patches of electropositive saccharide C–H bonds engage more often in CH−π interactions involving electron-rich aromatic partners. These electronic effects are also manifested when carbohydrate–aromatic interactions are monitored in solution: NMR analysis indicates that indole favorably binds to electron-poor C–H bonds of model carbohydrates, and a clear linear free energy relationships with substituted indoles supports the importance of complementary electronic effects in driving protein–carbohydrate interactions. Together, our data indicate that electrostatic and electronic complementarity between carbohydrates and aromatic residues play key roles in driving protein–carbohydrate complexation. Moreover, these weak noncovalent interactions influence which saccharide residues bind to proteins, and how they are positioned within carbohydrate-binding sites. PMID:26561965

  18. Carbohydrate-Aromatic Interactions in Proteins.

    PubMed

    Hudson, Kieran L; Bartlett, Gail J; Diehl, Roger C; Agirre, Jon; Gallagher, Timothy; Kiessling, Laura L; Woolfson, Derek N

    2015-12-09

    Protein-carbohydrate interactions play pivotal roles in health and disease. However, defining and manipulating these interactions has been hindered by an incomplete understanding of the underlying fundamental forces. To elucidate common and discriminating features in carbohydrate recognition, we have analyzed quantitatively X-ray crystal structures of proteins with noncovalently bound carbohydrates. Within the carbohydrate-binding pockets, aliphatic hydrophobic residues are disfavored, whereas aromatic side chains are enriched. The greatest preference is for tryptophan with an increased prevalence of 9-fold. Variations in the spatial orientation of amino acids around different monosaccharides indicate specific carbohydrate C-H bonds interact preferentially with aromatic residues. These preferences are consistent with the electronic properties of both the carbohydrate C-H bonds and the aromatic residues. Those carbohydrates that present patches of electropositive saccharide C-H bonds engage more often in CH-π interactions involving electron-rich aromatic partners. These electronic effects are also manifested when carbohydrate-aromatic interactions are monitored in solution: NMR analysis indicates that indole favorably binds to electron-poor C-H bonds of model carbohydrates, and a clear linear free energy relationships with substituted indoles supports the importance of complementary electronic effects in driving protein-carbohydrate interactions. Together, our data indicate that electrostatic and electronic complementarity between carbohydrates and aromatic residues play key roles in driving protein-carbohydrate complexation. Moreover, these weak noncovalent interactions influence which saccharide residues bind to proteins, and how they are positioned within carbohydrate-binding sites.

  19. An Integrated Phosphoproteomics Work Flow Reveals Extensive Network Regulation in Early Lysophosphatidic Acid Signaling*

    PubMed Central

    Schreiber, Thiemo B.; Mäusbacher, Nina; Kéri, György; Cox, Jürgen; Daub, Henrik

    2010-01-01

    Lysophosphatidic acid (LPA) induces a variety of cellular signaling pathways through the activation of its cognate G protein-coupled receptors. To investigate early LPA responses and assess the contribution of epidermal growth factor (EGF) receptor transactivation in LPA signaling, we performed phosphoproteomics analyses of both total cell lysate and protein kinase-enriched fractions as complementary strategies to monitor phosphorylation changes in A498 kidney carcinoma cells. Our integrated work flow enabled the identification and quantification of more than 5,300 phosphorylation sites of which 224 were consistently regulated by LPA. In addition to induced phosphorylation events, we also obtained evidence for early dephosphorylation reactions due to rapid phosphatase regulation upon LPA treatment. Phosphorylation changes induced by direct heparin-binding EGF-like growth factor-mediated EGF receptor activation were typically weaker and only detected on a subset of LPA-regulated sites, indicating signal integration among EGF receptor transactivation and other LPA-triggered pathways. Our results reveal rapid phosphoregulation of many proteins not yet implicated in G protein-coupled receptor signaling and point to various additional mechanisms by which LPA might regulate cell survival and migration as well as gene transcription on the molecular level. Moreover, our phosphoproteomics analysis of both total lysate and kinase-enriched fractions provided highly complementary parts of the LPA-regulated signaling network and thus represents a useful and generic strategy toward comprehensive signaling studies on a system-wide level. PMID:20071362

  20. Solution NMR structure of a designed metalloprotein and complementary molecular dynamics refinement.

    PubMed

    Calhoun, Jennifer R; Liu, Weixia; Spiegel, Katrin; Dal Peraro, Matteo; Klein, Michael L; Valentine, Kathleen G; Wand, A Joshua; DeGrado, William F

    2008-02-01

    We report the solution NMR structure of a designed dimetal-binding protein, di-Zn(II) DFsc, along with a secondary refinement step employing molecular dynamics techniques. Calculation of the initial NMR structural ensemble by standard methods led to distortions in the metal-ligand geometries at the active site. Unrestrained molecular dynamics using a nonbonded force field for the metal shell, followed by quantum mechanical/molecular mechanical dynamics of DFsc, were used to relax local frustrations at the dimetal site that were apparent in the initial NMR structure and provide a more realistic description of the structure. The MD model is consistent with NMR restraints, and in good agreement with the structural and functional properties expected for DF proteins. This work demonstrates that NMR structures of metalloproteins can be further refined using classical and first-principles molecular dynamics methods in the presence of explicit solvent to provide otherwise unavailable insight into the geometry of the metal center.

  1. High-resolution inelastic neutron scattering and neutron powder diffraction study of the adsorption of dihydrogen by the Cu(II) metal-organic framework material HKUST-1

    NASA Astrophysics Data System (ADS)

    Callear, Samantha K.; Ramirez-Cuesta, Anibal J.; David, William I. F.; Millange, Franck; Walton, Richard I.

    2013-12-01

    We present new high-resolution inelastic neutron scattering (INS) spectra (measured using the TOSCA and MARI instruments at ISIS) and powder neutron diffraction data (measured on the diffractometer WISH at ISIS) from the interaction of the prototypical metal-organic framework HKUST-1 with various dosages of dihydrogen gas. The INS spectra show direct evidence for the sequential occupation of various distinct sites for dihydrogen in the metal-organic framework, whose population is adjusted during increasing loading of the guest. The superior resolution of TOSCA reveals subtle features in the spectra, not previously reported, including evidence for split signals, while complementary spectra recorded on MARI present full information in energy and momentum transfer. The analysis of the powder neutron patterns using the Rietveld method shows a consistent picture, allowing the crystallographic indenisation of binding sites for dihydrogen, thus building a comprehensive picture of the interaction of the guest with the nanoporous host.

  2. Structural Basis for NADH/NAD+ Redox Sensing by a Rex Family Repressor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLaughlin, K.J.; Soares, A.; Strain-Damerell, C. M.

    2010-05-28

    Nicotinamide adenine dinucleotides have emerged as key signals of the cellular redox state. Yet the structural basis for allosteric gene regulation by the ratio of reduced NADH to oxidized NAD{sup +} is poorly understood. A key sensor among Gram-positive bacteria, Rex represses alternative respiratory gene expression until a limited oxygen supply elevates the intracellular NADH:NAD{sup +} ratio. Here we investigate the molecular mechanism for NADH/NAD{sup +} sensing among Rex family members by determining structures of Thermus aquaticus Rex bound to (1) NAD{sup +}, (2) DNA operator, and (3) without ligand. Comparison with the Rex/NADH complex reveals that NADH releases Rexmore » from the DNA site following a 40{sup o} closure between the dimeric subunits. Complementary site-directed mutagenesis experiments implicate highly conserved residues in NAD-responsive DNA-binding activity. These rare views of a redox sensor in action establish a means for slight differences in the nicotinamide charge, pucker, and orientation to signal the redox state of the cell.« less

  3. Ground Characterization Studies in Canakkale Pilot Site of LIQUEFACT Project

    NASA Astrophysics Data System (ADS)

    Ozcep, F.; Oztoprak, S.; Aysal, N.; Bozbey, I.; Tezel, O.; Ozer, C.; Sargin, S.; Bekin, E.; Almasraf, M.; Cengiz Cinku, M.; Ozdemir, K.

    2017-12-01

    The our aim is to outline the ground characterisation studies in Canakkale test site. Study is based on the EU H2020 LIQUEFACT project entitled "Liquefact: Assessment and mitigation of liquefaction potential across Europe: a holistic approach to protect structures / infrastructures for improved resilience to earthquake-induced liquefaction disasters". Objectives and extent of ground characterization for Canakkale test site includes pre-existing soil investigation studies and complementary field studies. There were several SPT and geophysical tests carried out in the study area. Within the context of the complementary tests, six (6) study areas in the test site were chosen and complementary tests were carried out in these areas. In these areas, additional boreholes were opened and SPT tests were performed. It was decided that additional CPT (CPTU and SCPT) and Marchetti Dilatometer (DMT) tests should be carried out within the scope of the complementary testing. Seismic refraction, MASW and micro tremor measurements had been carried out in pre-existing studies. Shear wave velocities obtained from MASW measurements were evaluated to the most rigorous level. These tests were downhole seismic, PS-logging, seismic refraction, 2D-ReMi, MASW, micro tremor (H/V Nakamura method), 2D resistivity and resonance acoustic profiling (RAP). RAP is a new technique which will be explained briefly in the relevant section. Dynamic soil properties had not been measured in pre-existing studies, therefore these properties were investigated within the scope of the complementary tests. Selection of specific experimental tests of the complementary campaign was based on cost-benefit considerations Within the context of complementary field studies, dynamic soil properties were measured using resonant column and cyclic direct shear tests. Several sieve analyses and Atterberg Limits tests which were documented in the pre-existing studies were evaluated. In the complementary study carried out, additional sieve analyses and Atterberg Limit tests were carried out. It was aimed to make some correlations between geophysical measurements and other field measurements; such as SPT, blow count values.

  4. Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

    ERIC Educational Resources Information Center

    Mascotti, David P.; Waner, Mark J.

    2010-01-01

    A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

  5. A human transcription factor in search mode.

    PubMed

    Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

    2016-01-08

    Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Functional balance between neuraminidase and haemagglutinin in influenza viruses.

    PubMed

    Gaymard, A; Le Briand, N; Frobert, E; Lina, B; Escuret, V

    2016-12-01

    Seasonal influenza A and B viruses are important human pathogens responsible for significant morbidity and mortality worldwide. In addition, influenza A zoonotic viruses are a constant pandemic threat. These viruses present two major surface glycoproteins: the haemagglutinin (HA) and the neuraminidase (NA). These two glycoproteins both recognize the sialic acid and have complementary activities, the HA binds the sialic acid through its receptor-binding site, the NA is a receptor-destroying enzyme that cleaves α2-3 and α2-6-linked sialic acids. Therefore, the functional HA/NA balance is a critical factor for a good viral fitness and plays a major role in overcoming the host barrier and the efficiency of sustained human-to-human transmission. Although the two glycoproteins are in constant evolution, the HA/NA balance seems to remain stable in human viruses because an optimal balance is required to maintain good viral fitness. Understanding the evolution of influenza viruses requires an in-depth exploration of the HA/NA balance. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  7. Structure and transport mechanism of the sodium/proton antiporter MjNhaP1

    PubMed Central

    Paulino, Cristina; Wöhlert, David; Kapotova, Ekaterina; Yildiz, Özkan; Kühlbrandt, Werner

    2014-01-01

    Sodium/proton antiporters are essential for sodium and pH homeostasis and play a major role in human health and disease. We determined the structures of the archaeal sodium/proton antiporter MjNhaP1 in two complementary states. The inward-open state was obtained by x-ray crystallography in the presence of sodium at pH 8, where the transporter is highly active. The outward-open state was obtained by electron crystallography without sodium at pH 4, where MjNhaP1 is inactive. Comparison of both structures reveals a 7° tilt of the 6 helix bundle. 22Na+ uptake measurements indicate non-cooperative transport with an activity maximum at pH 7.5. We conclude that binding of a Na+ ion from the outside induces helix movements that close the extracellular cavity, open the cytoplasmic funnel, and result in a ∼5 Å vertical relocation of the ion binding site to release the substrate ion into the cytoplasm. DOI: http://dx.doi.org/10.7554/eLife.03583.001 PMID:25426803

  8. Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

    PubMed Central

    Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

    2007-01-01

    Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

  9. Small RNA-mediated repair of UV-induced DNA lesions by the DNA DAMAGE-BINDING PROTEIN 2 and ARGONAUTE 1

    PubMed Central

    Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean

    2017-01-01

    As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites. PMID:28325872

  10. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  11. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  12. Final Technical Report: Targeting DOE-Relevant Ions with Supramolecular Strategies, DE-SC0010555

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman-James, Kristin

    The effectiveness of three popular supramolecular strategies to selectively target negatively charged ions (anions) was evaluated. Ions of interest included oxo anions, particularly sulfate, that hamper nuclear waste remediation. Three objectives were pursued using a simple building block strategies and by strategically placing anion-binding sites at appropriate positions on organic host molecules. The goal of the first objective was to assess the influence of secondary, tertiary and quaternized amines on binding tetrahedral anions using mixed amide/amine macrocyclic and urea/amine hosts containing aromatic or heteroaromatic spacers. Objective 2 focused on the design of ion pair hosts, using mixed macrocyclic anion hostsmore » joined through polyether linkages. Objective 3 was to explore the synthesis of new metal-linked extended macrocyclic frameworks to leverage anion binding. Key findings were that smaller 24-membered macrocycles provided the most complementary binding for sulfate ion and mixed urea/amine chelates showed enhanced binding over amide corollaries in addition to being highly selective for SO 4 2- in the presence of small quantities of water. In addition to obtaining prototype metal-linked macrocyclic anion hosts, a new dipincer ligand was designed that can be used to link macrocyclic or other supramolecular hosts in extended frameworks. When the tetraamide-based pincers are bound to two metal ions, an interesting phenomenon occurs. Upon deprotonation of the amides, two new protons appear between adjacent carbonyl pairs on the ligand, which may modify the chemistry, and metal-metal interactions in the complexes. Gel formation occurred for some of these extended hosts, and the physical properties are currently under investigation. The new tetracarboxamide-based pincers can also provide basic frameworks for double macrocycles capable of binding ion pairs as well as for binding metal ions and exploring intermetallic interactions through the pyrazine π system. Additionally appendages capable of influencing solvation effects can be introduced, and a number of other potential applications can be realized in areas such as soft materials chemistry, catalysis, sensing, and proton switches, the latter for binding and release of targeted guests. These findings provide a better foundation for understanding the selective binding of anions by targeted placement of hydrogen binding sites, and the strengths and weaknesses of various functional groups, that will allow for more the design of more effective anion sequestering agents. Our design strategy also used simple, cost-effective building blocks for host synthesis to allow for scale-up should real-world applications be forthcoming.« less

  13. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  14. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  15. Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

    PubMed Central

    2014-01-01

    Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

  16. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  17. Second-generation supramolecular dendrimer with a defined structure due to orthogonal binding.

    PubMed

    Eckelmann, Jens; Dethlefs, Christiane; Brammer, Stefan; Doğan, Ahmet; Uphoff, Andreas; Lüning, Ulrich

    2012-07-02

    A second-generation supramolecular dendrimer has been prepared by orthogonal multiple hydrogen bonding. In the first (inner) recognition domain, the interaction of one bis-isocyanuric acid (25) with two branching units (21) that carry complementary Hamilton receptors has been exploited. In the second (outer) generation, the two ADDA (A=hydrogen-bond acceptor, D=donor) receptors of each branching unit (21) have bound complementary DAAD units (4). The problem of limited solubility of the building blocks has been overcome by the introduction of branched ethylhexyl residues and by the use of flexible alkylene or oligo(ethylene glycol) linking chains. The orthogonal binding of the two hydrogen-bonding pairs was elucidated by chemical induced shift NMR titrations, which proved that the two pairs, isocyanuric acid with the Hamilton receptor and ADDA with DAAD, bind preferentially. The formation of the supramolecular self-assembled 1:2:4 dendrimer with a molecular weight of 5065 g mol(-1) was investigated by diffusion NMR spectroscopy. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

    PubMed

    Naimuddin, Mohammed; Kubo, Tai

    2011-12-01

    We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Structural Insights into the HIV-1 Minus-strand Strong-stop DNA*

    PubMed Central

    Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

    2016-01-01

    An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3′-end of the genomic RNA with the complementary r region at the 3′-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). PMID:26668324

  20. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2015-01-01

    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

  1. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  2. Gas Sensors Based on Molecular Imprinting Technology.

    PubMed

    Zhang, Yumin; Zhang, Jin; Liu, Qingju

    2017-07-04

    Molecular imprinting technology (MIT); often described as a method of designing a material to remember a target molecular structure (template); is a technique for the creation of molecularly imprinted polymers (MIPs) with custom-made binding sites complementary to the target molecules in shape; size and functional groups. MIT has been successfully applied to analyze; separate and detect macromolecular organic compounds. Furthermore; it has been increasingly applied in assays of biological macromolecules. Owing to its unique features of structure specificity; predictability; recognition and universal application; there has been exploration of the possible application of MIPs in the field of highly selective gas sensors. In this present study; we outline the recent advances in gas sensors based on MIT; classify and introduce the existing molecularly imprinted gas sensors; summarize their advantages and disadvantages; and analyze further research directions.

  3. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  4. Prevention of cross-talk in conserved regulatory systems: identification of specificity determinants in RNA-binding anti-termination proteins of the BglG family

    PubMed Central

    Hübner, Sebastian; Declerck, Nathalie; Diethmaier, Christine; Le Coq, Dominique; Aymerich, Stephane; Stülke, Jörg

    2011-01-01

    Each family of signal transduction systems requires specificity determinants that link individual signals to the correct regulatory output. In Bacillus subtilis, a family of four anti-terminator proteins controls the expression of genes for the utilisation of alternative sugars. These regulatory systems contain the anti-terminator proteins and a RNA structure, the RNA anti-terminator (RAT) that is bound by the anti-terminator proteins. We have studied three of these proteins (SacT, SacY, and LicT) to understand how they can transmit a specific signal in spite of their strong structural homology. A screen for random mutations that render SacT capable to bind a RNA structure recognized by LicT only revealed a substitution (P26S) at one of the few non-conserved residues that are in contact with the RNA. We have randomly modified this position in SacT together with another non-conserved RNA-contacting residue (Q31). Surprisingly, the mutant proteins could bind all RAT structures that are present in B. subtilis. In a complementary approach, reciprocal amino acid exchanges have been introduced in LicT and SacY at non-conserved positions of the RNA-binding site. This analysis revealed the key role of an arginine side-chain for both the high affinity and specificity of LicT for its cognate RAT. Introduction of this Arg at the equivalent position of SacY (A26) increased the RNA binding in vitro but also resulted in a relaxed specificity. Altogether our results suggest that this family of anti-termination proteins has evolved to reach a compromise between RNA binding efficacy and specific interaction with individual target sequences. PMID:21278164

  5. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

    1990-09-01

    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  6. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  7. An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

    ERIC Educational Resources Information Center

    John, Nancy J.; Firestone, Gary L.

    1987-01-01

    Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

  8. Mechanism of preferential packaging of negative sense genomic RNA by viral nucleoproteins in Crimean-Congo hemorrhagic Fever virus.

    PubMed

    Dayer, Mohammad Reza; Dayer, Mohammad Saaid; Rezatofighi, Seyedeh Elham

    2015-04-01

    The Crimean-Congo Hemorrhagic Fever (CCHF) is an infectious disease of high virulence and mortality caused by a negative sense RNA nairovirus. The genomic RNA of CCHFV is enwrapped by its nucleoprotein. Positively charged residues on CCHFV nucleoprotein provide multiple binding sites to facilitate genomic RNA encapsidation. In the present work, we investigated the mechanism underlying preferential packaging of the negative sense genomic RNA by CCHFV nucleoprotein in the presence of host cell RNAs during viral assembly. The work included genome sequence analyses for different families of negative and positive sense RNA viruses, using serial docking experiments and molecular dynamic simulations. Our results indicated that the main determinant parameter of the nucleoprotein binding affinity for negative sense RNA is the ratio of purine/pyrimidine in the RNA molecule. A negative sense RNA with a purine/pyrimidine ratio (>1) higher than that of a positive sense RNA (<1) exhibits higher affinity for the nucleoprotein. Our calculations revealed that a negative sense RNA expresses about 0.5 kJ/mol higher binding energy per nucleotide compared to a positive sense RNA. This energy difference produces a binding energy high enough to make the negative sense RNA, the preferred substrate for packaging by CCHFV nucleoprotein in the presence of cellular or complementary positive sense RNAs. The outcome of this study may contribute to ongoing researches on other viral diseases caused by negative sense RNA viruses such as Ebola virus which poses a security threat to all humanity.

  9. Mechanism of Mediator recruitment by tandem Gcn4 activation domains and three Gal11 activator-binding domains.

    PubMed

    Herbig, Eric; Warfield, Linda; Fish, Lisa; Fishburn, James; Knutson, Bruce A; Moorefield, Beth; Pacheco, Derek; Hahn, Steven

    2010-05-01

    Targets of the tandem Gcn4 acidic activation domains in transcription preinitiation complexes were identified by site-specific cross-linking. The individual Gcn4 activation domains cross-link to three common targets, Gal11/Med15, Taf12, and Tra1, which are subunits of four conserved coactivator complexes, Mediator, SAGA, TFIID, and NuA4. The Gcn4 N-terminal activation domain also cross-links to the Mediator subunit Sin4/Med16. The contribution of the two Gcn4 activation domains to transcription was gene specific and varied from synergistic to less than additive. Gcn4-dependent genes had a requirement for Gal11 ranging from 10-fold dependence to complete Gal11 independence, while the Gcn4-Taf12 interaction did not significantly contribute to the expression of any gene studied. Complementary methods identified three conserved Gal11 activator-binding domains that bind each Gcn4 activation domain with micromolar affinity. These Gal11 activator-binding domains contribute additively to transcription activation and Mediator recruitment at Gcn4- and Gal11-dependent genes. Although we found that the conserved Gal11 KIX domain contributes to Gal11 function, we found no evidence of specific Gcn4-KIX interaction and conclude that the Gal11 KIX domain does not function by specific interaction with Gcn4. Our combined results show gene-specific coactivator requirements, a surprising redundancy in activator-target interactions, and an activator-coactivator interaction mediated by multiple low-affinity protein-protein interactions.

  10. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  11. Crystal structure of a 3B3 variant - A broadly neutralizing HIV-1 scFv antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clark, K. Reed; Walsh, Scott T.R.; NCH)

    2009-12-10

    We present the crystal structure determination of an anti-HIV-1 gp120 single-chain variable fragment antibody variant, 3B3, at 2.5 {angstrom} resolution. This 3B3 variant was derived from the b12 antibody, using phage display and site-directed mutagenesis of the variable heavy chain (V{sub H}) complementary-determining regions (CDRs). 3B3 exhibits enhanced binding affinity and neutralization activity against several cross-clade primary isolates of HIV-1 by interaction with the recessed CD4-binding site on the gp120 envelope protein. Comparison with the structures of the unbound and bound forms of b12, the 3B3 structure closely resembles these structures with minimal differences with two notable exceptions. First, theremore » is a reorientation of the CDR-H3 of the V{sub H} domain where the primary sequences evolved from b12 to 3B3. The structural changes in CDR-H3 of 3B3, in light of the b12-gp120 complex structure, allow for positioning an additional Trp side chain in the binding interface with gp120. Finally, the second region of structural change involves two peptide bond flips in CDR-L3 of the variable light (VL) domain triggered by a point mutation in CDR-H3 of Q100eY resulting in changes in the intramolecular hydrogen bonding patterning between the VL and VH domains. Thus, the enhanced binding affinities and neutralization capabilities of 3B3 relative to b12 probably result from higher hydrophobic driving potential by burying more aromatic residues at the 3B3-gp120 interface and by indirect stabilization of intramolecular contacts of the core framework residues between the VL and VH domains possibly through more favorable entropic effect through the expulsion of water.« less

  12. The 2.2 A resolution structure of the O(H) blood-group-specific lectin I from Ulex europaeus.

    PubMed

    Audette, G F; Vandonselaar, M; Delbaere, L T

    2000-12-01

    The tertiary and quaternary structure of the lectin I from Ulex europaeus (UE-I) has been determined to 2.2 A resolution. UE-I is a dimeric metalloglycoprotein that binds the H-type 2 human blood group determinant [alpha-L-Fucalpha(1-->2)-beta-D-Galbeta(1-->4)-beta-D-Glc NAcalpha-]. Nine changes from the published amino acid sequence were necessary to account for the electron density. The quaternary structural organization of UE-I is that of the most commonly occurring legume lectin dimer. The tertiary structure of the monomeric subunits is similar to that in the conventional lectin subunit; however, some structural differences are noted. These differences include a four-stranded anti-parallel "S" sheet in UE-I versus the five-stranded S sheet in other lectin monomers. The Ala residue of the Ala-Asp cis-peptide bond present in the carbohydrate-binding site of the conventional lectin monomer is replaced with a Thr in the UE-I structure. Also, a novel disulfide bridge linking Cys115 and Cys150 is present. There are two metallic ions, one calcium and the other manganese, per subunit. N-linked oligosaccharides are at residues 23 and 111 of each subunit. One molecule of R-2-methyl-2, 4-pentanediol (R-MPD) is present in a shallow depression on the surface of each subunit. In order to examine the binding of the H-type 2 blood group determinant by UE-I, its beta-methyl glycoside (H-type 2-OMe) was docked into the binding site of R-MPD. The epitope previously identified for H-type 2-OMe by chemical mapping proved, with only minor adjustment of amino acid residues, to be complementary to the shallow cavity occupied by R-MPD in the structure. Several key interactions have been proposed between the H-type 2-OMe and UE-I. Copyright 2000 Academic Press.

  13. IsoCleft Finder – a web-based tool for the detection and analysis of protein binding-site geometric and chemical similarities

    PubMed Central

    Najmanovich, Rafael

    2013-01-01

    IsoCleft Finder is a web-based tool for the detection of local geometric and chemical similarities between potential small-molecule binding cavities and a non-redundant dataset of ligand-bound known small-molecule binding-sites. The non-redundant dataset developed as part of this study is composed of 7339 entries representing unique Pfam/PDB-ligand (hetero group code) combinations with known levels of cognate ligand similarity. The query cavity can be uploaded by the user or detected automatically by the system using existing PDB entries as well as user-provided structures in PDB format. In all cases, the user can refine the definition of the cavity interactively via a browser-based Jmol 3D molecular visualization interface. Furthermore, users can restrict the search to a subset of the dataset using a cognate-similarity threshold. Local structural similarities are detected using the IsoCleft software and ranked according to two criteria (number of atoms in common and Tanimoto score of local structural similarity) and the associated Z-score and p-value measures of statistical significance. The results, including predicted ligands, target proteins, similarity scores, number of atoms in common, etc., are shown in a powerful interactive graphical interface. This interface permits the visualization of target ligands superimposed on the query cavity and additionally provides a table of pairwise ligand topological similarities. Similarities between top scoring ligands serve as an additional tool to judge the quality of the results obtained. We present several examples where IsoCleft Finder provides useful functional information. IsoCleft Finder results are complementary to existing approaches for the prediction of protein function from structure, rational drug design and x-ray crystallography. IsoCleft Finder can be found at: http://bcb.med.usherbrooke.ca/isocleftfinder. PMID:24555058

  14. A systematic quantitative approach to rational drug design and discovery of novel human carbonic anhydrase IX inhibitors.

    PubMed

    Sethi, Kalyan K; Verma, Saurabh M

    2014-08-01

    Drug design involves the design of small molecules that are complementary in shape and charge to the biomolecular target with which they interact and therefore will bind to it. Three-dimensional quantitative structure-activity relationship (3D-QSAR) studies were performed for a series of carbonic anhydrase IX inhibitors using comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) techniques with the help of SYBYL 7.1 software. The large set of 36 different aromatic/heterocyclic sulfamates carbonic anhydrase (CA, EC 4.2.1.1) inhibitors, such as hCA IX, was chosen for this study. The conventional ligand-based 3D-QSAR studies were performed based on the low energy conformations employing database alignment rule. The ligand-based model gave q(2) values 0.802 and 0.829 and r(2) values 1.000 and 0.994 for CoMFA and CoMSIA, respectively, and the predictive ability of the model was validated. The predicted r(2) values are 0.999 and 0.502 for CoMFA and CoMSIA, respectively. SEA (steric, electrostatic, hydrogen bond acceptor) of CoMSIA has the significant contribution for the model development. The docking of inhibitors into hCA IX active site using Glide XP (Schrödinger) software revealed the vital interactions and binding conformation of the inhibitors. The CoMFA and CoMSIA field contour maps are well in agreement with the structural characteristics of the binding pocket of hCA IX active site, which suggests that the information rendered by 3D-QSAR models and the docking interactions can provide guidelines for the development of improved hCA IX inhibitors as leads for various types of metastatic cancers including those of cervical, renal, breast and head and neck origin.

  15. Interaction between two discontiguous chain segments from the beta-sheet of Escherichia coli thioredoxin suggests an initiation site for folding.

    PubMed

    Tasayco, M L; Fuchs, J; Yang, X M; Dyalram, D; Georgescu, R E

    2000-09-05

    The approach of comparing folding and folding/binding processes is exquisitely poised to narrow down the regions of the sequence that drive protein folding. We have dissected the small single alpha/beta domain of oxidized Escherichia coli thioredoxin (Trx) into three complementary fragments (N, residues 1-37; M, residues 38-73; and C, residues 74-108) to study them in isolation and upon recombination by far-UV CD and NMR spectroscopy. The isolated fragments show a minimum of ellipticity of ca. 197 nm in their far-UV CD spectra without concentration dependence, chemical shifts of H(alpha) that are close to the random coil values, and no medium- and long-range NOE connectivities in their three-dimensional NMR spectra. These fragments behave as disordered monomers. Only the far-UV CD spectra of binary or ternary mixtures that contain N- and C-fragments are different from the sum of their individual spectra, which is indicative of folding and/or binding of these fragments. Indeed, the cross-peaks corresponding to the rather hydrophobic beta(2) and beta(4) regions of the beta-sheet of Trx disappear from the (1)H-(15)N HSQC spectra of isolated labeled N- and C-fragments, respectively, upon addition of the unlabeled complementary fragments. The disappearing cross-peaks indicate interactions between the beta(2) and beta(4) regions, and their reappearance at lower temperatures indicates unfolding and/or dissociation of heteromers that are predominantly held by hydrophobic forces. Our results argue that the folding of Trx begins by zippering two discontiguous and rather hydrophobic chain segments (beta(2) and beta(4)) corresponding to neighboring strands of the native beta-sheet.

  16. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  17. Revealing the role of the product metal in DNA polymerase β catalysis

    PubMed Central

    Freudenthal, Bret D.; Beard, William A.; Pedersen, Lee G.; Wilson, Samuel H.

    2017-01-01

    Abstract DNA polymerases catalyze a metal-dependent nucleotidyl transferase reaction during extension of a DNA strand using the complementary strand as a template. The reaction has long been considered to require two magnesium ions. Recently, a third active site magnesium ion was identified in some DNA polymerase product crystallographic structures, but its role is not known. Using quantum mechanical/ molecular mechanical calculations of polymerase β, we find that a third magnesium ion positioned near the newly identified product metal site does not alter the activation barrier for the chemical reaction indicating that it does not have a role in the forward reaction. This is consistent with time-lapse crystallographic structures following insertion of Sp-dCTPαS. Although sulfur substitution deters product metal binding, this has only a minimal effect on the rate of the forward reaction. Surprisingly, monovalent sodium or ammonium ions, positioned in the product metal site, lowered the activation barrier. These calculations highlight the impact that an active site water network can have on the energetics of the forward reaction and how metals or enzyme side chains may interact with the network to modulate the reaction barrier. These results also are discussed in the context of earlier findings indicating that magnesium at the product metal position blocks the reverse pyrophosphorolysis reaction. PMID:28108654

  18. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  19. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  20. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  1. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  2. Massage Therapy for Health Purposes

    MedlinePlus

    ... Web site: www.nih.gov/health/clinicaltrials/ Cochrane Database of Systematic Reviews The Cochrane Database of Systematic ... Licensed Complementary and Alternative Healthcare Professions. Seattle, WA: Academic Consortium for Complementary and Alternative Health Care; 2009. ...

  3. Identity Projects in Complementary and Mainstream Schools: The Views of Albanian and Bulgarian Students in England

    ERIC Educational Resources Information Center

    Tereshchenko, Antonina; Archer, Louise

    2015-01-01

    This paper contributes to the literature on complementary schools as sites of learning and social and cultural identification. We draw on a small-scale multi-method qualitative study conducted in Albanian and Bulgarian community schools in London to explore the agendas of "new" Eastern European complementary schools with respect to…

  4. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  5. Activation of p115-RhoGEF Requires Direct Association of G[alpha subscript 13] and the Dbl Homology Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Zhe; Guo, Liang; Hadas, Jana

    2012-09-05

    RGS-containing RhoGEFs (RGS-RhoGEFs) represent a direct link between the G{sub 12} class of heterotrimeric G proteins and the monomeric GTPases. In addition to the canonical Dbl homology (DH) and pleckstrin homology domains that carry out the guanine nucleotide exchange factor (GEF) activity toward RhoA, these RhoGEFs also possess RGS homology (RH) domains that interact with activated {alpha} subunits of G{sub 12} and G{sub 13}. Although the GEF activity of p115-RhoGEF (p115), an RGS-RhoGEF, can be stimulated by G{alpha}{sub 13}, the exact mechanism of the stimulation has remained unclear. Using combined studies with small angle x-ray scattering, biochemistry, and mutagenesis, wemore » identify an additional binding site for activated G{alpha}{sub 13} in the DH domain of p115. Small angle x-ray scattering reveals that the helical domain of G{alpha}{sub 13} docks onto the DH domain, opposite to the surface of DH that binds RhoA. Mutation of a single tryptophan residue in the {alpha}3b helix of DH reduces binding to activated G{alpha}{sub 13} and ablates the stimulation of p115 by G{alpha}{sub 13}. Complementary mutations at the predicted DH-binding site in the {alpha}B-{alpha}C loop of the helical domain of G{alpha}{sub 13} also affect stimulation of p115 by G{alpha}{sub 13}. Although the GAP activity of p115 is not required for stimulation by G{alpha}{sub 13}, two hydrophobic motifs in RH outside of the consensus RGS box are critical for this process. Therefore, the binding of G{alpha}{sub 13} to the RH domain facilitates direct association of G{alpha}{sub 13} to the DH domain to regulate its exchange activity. This study provides new insight into the mechanism of regulation of the RGS-RhoGEF and broadens our understanding of G protein signaling.« less

  6. Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons

    NASA Astrophysics Data System (ADS)

    Baghaee Ravari, Soodeh

    G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).

  7. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  8. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  9. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  11. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  12. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  13. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  14. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  15. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  16. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  17. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  18. Isothermal titration calorimetry study of the interaction of sweeteners with fullerenols as an artificial sweet taste receptor model.

    PubMed

    Chen, Zhong-Xiu; Guo, Gang-Min; Deng, Shao-Ping

    2009-04-08

    A fullerenol-based synthetic sweetness receptor model, consisting of polyhydroxy groups for potential hydrogen bond donor along with a spherical hydrophobic center, was proposed according to the widely accepted sweetness hypothesis. An isothermal titration calorimetry (ITC) technique was used to study mimetic interaction of this sweet receptor model with a series of sweeteners having increasing sweetness intensity. The results showed that ITC is an effective method to provide thorough and precise characterization of the energies of molecular complex formation. Binding of all of the studied sweeteners with fullerenols was found through two sets of site models. More heat was released from sweeter synthetic compounds binding with fullerenols than from less sweet carbohydrates. The results imply that hydrogen bond formation is necessary for the sweeteners to bind to the fullerenol receptor in the first stage, whereas hydrophobic effect and conformation changes that lead to favorable entropy changes occur in most cases. The preliminary results of this study help to cover the lack of information about the thermodynamic basis of understanding of the initiation of the sweet sensation. It also adds complementary physicochemical measurements available for comparison with the sweetness hypothesis. On the other hand, a correlation between the thermodynamic parameters and sweetness intensity has been made as well, which exhibits potential as a useful tool in sensory analysis.

  19. miRTar2GO: a novel rule-based model learning method for cell line specific microRNA target prediction that integrates Ago2 CLIP-Seq and validated microRNA-target interaction data.

    PubMed

    Ahadi, Alireza; Sablok, Gaurav; Hutvagner, Gyorgy

    2017-04-07

    MicroRNAs (miRNAs) are ∼19-22 nucleotides (nt) long regulatory RNAs that regulate gene expression by recognizing and binding to complementary sequences on mRNAs. The key step in revealing the function of a miRNA, is the identification of miRNA target genes. Recent biochemical advances including PAR-CLIP and HITS-CLIP allow for improved miRNA target predictions and are widely used to validate miRNA targets. Here, we present miRTar2GO, which is a model, trained on the common rules of miRNA-target interactions, Argonaute (Ago) CLIP-Seq data and experimentally validated miRNA target interactions. miRTar2GO is designed to predict miRNA target sites using more relaxed miRNA-target binding characteristics. More importantly, miRTar2GO allows for the prediction of cell-type specific miRNA targets. We have evaluated miRTar2GO against other widely used miRNA target prediction algorithms and demonstrated that miRTar2GO produced significantly higher F1 and G scores. Target predictions, binding specifications, results of the pathway analysis and gene ontology enrichment of miRNA targets are freely available at http://www.mirtar2go.org. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Curcumin Inhibits Tau Aggregation and Disintegrates Preformed Tau Filaments in vitro.

    PubMed

    Rane, Jitendra Subhash; Bhaumik, Prasenjit; Panda, Dulal

    2017-01-01

    The pathological aggregation of tau is a common feature of most of the neuronal disorders including frontotemporal dementia, Parkinson's disease, and Alzheimer's disease. The inhibition of tau aggregation is considered to be one of the important strategies for treating these neurodegenerative diseases. Curcumin, a natural polyphenolic molecule, has been reported to have neuroprotective ability. In this work, curcumin was found to bind to adult tau and fetal tau with a dissociation constant of 3.3±0.4 and 8±1 μM, respectively. Molecular docking studies indicated a putative binding site of curcumin in the microtubule-binding region of tau. Using several complementary techniques, including dynamic light scattering, thioflavin S fluorescence, 90° light scattering, electron microscopy, and atomic force microscopy, curcumin was found to inhibit the aggregation of tau. The dynamic light scattering analysis and atomic force microscopic images revealed that curcumin inhibits the oligomerization of tau. Curcumin also disintegrated preformed tau oligomers. Using Far-UV circular dichroism, curcumin was found to inhibit the β-sheets formation in tau indicating that curcumin inhibits an initial step of tau aggregation. In addition, curcumin inhibited tau fibril formation. Furthermore, the effect of curcumin on the preformed tau filaments was analyzed by atomic force microscopy, transmission electron microscopy, and 90° light scattering. Curcumin treatment disintegrated preformed tau filaments. The results indicated that curcumin inhibited the oligomerization of tau and could disaggregate tau filaments.

  1. Testing Electrostatic Complementarity in Enzyme Catalysis: Hydrogen Bonding in the Ketosteroid Isomerase Oxyanion Hole

    PubMed Central

    Kraut, Daniel A; Sigala, Paul A; Pybus, Brandon; Liu, Corey W; Ringe, Dagmar; Petsko, Gregory A

    2006-01-01

    A longstanding proposal in enzymology is that enzymes are electrostatically and geometrically complementary to the transition states of the reactions they catalyze and that this complementarity contributes to catalysis. Experimental evaluation of this contribution, however, has been difficult. We have systematically dissected the potential contribution to catalysis from electrostatic complementarity in ketosteroid isomerase. Phenolates, analogs of the transition state and reaction intermediate, bind and accept two hydrogen bonds in an active site oxyanion hole. The binding of substituted phenolates of constant molecular shape but increasing p K a models the charge accumulation in the oxyanion hole during the enzymatic reaction. As charge localization increases, the NMR chemical shifts of protons involved in oxyanion hole hydrogen bonds increase by 0.50–0.76 ppm/p K a unit, suggesting a bond shortening of ˜0.02 Å/p K a unit. Nevertheless, there is little change in binding affinity across a series of substituted phenolates (ΔΔG = −0.2 kcal/mol/p K a unit). The small effect of increased charge localization on affinity occurs despite the shortening of the hydrogen bonds and a large favorable change in binding enthalpy (ΔΔH = −2.0 kcal/mol/p K a unit). This shallow dependence of binding affinity suggests that electrostatic complementarity in the oxyanion hole makes at most a modest contribution to catalysis of ˜300-fold. We propose that geometrical complementarity between the oxyanion hole hydrogen-bond donors and the transition state oxyanion provides a significant catalytic contribution, and suggest that KSI, like other enzymes, achieves its catalytic prowess through a combination of modest contributions from several mechanisms rather than from a single dominant contribution. PMID:16602823

  2. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  3. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  4. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  5. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.

  6. Complementary Phosphorylation Sites in the Adaptor Protein SLP-76 Promote Synergistic Activation of Natural Killer Cells

    PubMed Central

    Kim, Hun Sik; Long, Eric O.

    2013-01-01

    The cytotoxic effects of natural killer (NK) cells and their ability to secrete cytokines require the induction of synergistic signals from co-activation receptors, such as CD314 (NKG2D) and CD244 (2B4), which bind to ligands expressed on target cells. Synergy is required to overcome inhibition of the guanine nucleotide exchange factor (GEF) Vav1, a central regulator of NK cell activation, by the E3 ubiquitin ligase c-Cbl. However, the molecular basis for this synergy is unknown. Here, we showed that the adaptor protein Src homology 2 (SH2) domain–containing leukocyte phosphoprotein of 76 kD (SLP-76) was required for this synergy, and that distinct tyrosine residues in SLP-76 were phosphorylated by each receptor of a synergistic pair. Selective phosphorylation of tyrosine 113 or tyrosine 128 in SLP-76, each of which enables binding of SLP-76 to Vav1, was unique to receptors that stimulate ligand-dependent target cell killing, because antibody-dependent stimulation by Fc receptor CD16 promoted phosphorylation at both sites. Knockdown and reconstitution experiments with SLP-76 showed the distinct role of each tyrosine in the synergistic mobilization of Ca2+, revealing an unexpected degree of selectivity in the phosphorylation of SLP-76 by NK cell co-activation receptors. Together, these data suggest that complementation of separate phospho-tyrosine targets in SLP-76 forms the basis of synergistic NK cell activation. PMID:22786724

  7. Complementary phosphorylation sites in the adaptor protein SLP-76 promote synergistic activation of natural killer cells.

    PubMed

    Kim, Hun Sik; Long, Eric O

    2012-07-10

    The cytotoxic effects of natural killer (NK) cells and their ability to secrete cytokines require synergistic signals from specific pairs of co-activation receptors, such as CD314 (also known as NKG2D) and CD244 (2B4), which bind to distinct ligands present on target cells. These signals are required to overcome inhibition mediated by the E3 ubiquitin ligase c-Cbl of the guanine nucleotide exchange factor Vav1, which promotes activation of NK cells. Here, we showed that the adaptor protein SLP-76 (Src homology 2 domain-containing leukocyte phosphoprotein of 76 kilodaltons) was required for this synergy and that distinct tyrosine residues in SLP-76 were phosphorylated by each member of a pair of synergistic receptors. Selective phosphorylation of tyrosine 113 or tyrosine 128 in SLP-76 enabled binding of SLP-76 to Vav1. Selective phosphorylation of SLP-76 at these residues was restricted to receptors that stimulated ligand-dependent target cell killing; antibody-dependent stimulation of the Fc receptor CD16 promoted phosphorylation at both sites. Knockdown and reconstitution experiments with SLP-76 mutant proteins showed the distinct role of each tyrosine in the synergistic mobilization of Ca2+, revealing an unexpected degree of selectivity in the phosphorylation of SLP-76 by NK cell co-activation receptors. Together, these data suggest that combined phosphorylation of separate tyrosine residues in SLP-76 forms the basis of synergistic NK cell activation.

  8. The CD44-initiated pathway of T-cell extravasation uses VLA-4 but not LFA-1 for firm adhesion

    PubMed Central

    Siegelman, Mark H.; Stanescu, Diana; Estess, Pila

    2000-01-01

    Leukocytes extravasate from the blood in response to physiologic or pathologic demands by means of complementary ligand interactions between leukocytes and endothelial cells. The multistep model of leukocyte extravasation involves an initial transient interaction (“rolling” adhesion), followed by secondary (firm) adhesion. We recently showed that binding of CD44 on activated T lymphocytes to endothelial hyaluronan (HA) mediates a primary adhesive interaction under shear stress, permitting extravasation at sites of inflammation. The mechanism for subsequent firm adhesion has not been elucidated. Here we demonstrate that the integrin VLA-4 is used in secondary adhesion after CD44-mediated primary adhesion of human and mouse T cells in vitro, and by mouse T cells in an in vivo model. We show that clonal cell lines and polyclonally activated normal T cells roll under physiologic shear forces on hyaluronate and require VCAM-1, but not ICAM-1, as ligand for subsequent firm adhesion. This firm adhesion is also VLA-4 dependent, as shown by antibody inhibition. Moreover, in vivo short-term homing experiments in a model dependent on CD44 and HA demonstrate that superantigen-activated T cells require VLA-4, but not LFA-1, for entry into an inflamed peritoneal site. Thus, extravasation of activated T cells initiated by CD44 binding to HA depends upon VLA-4–mediated firm adhesion, which may explain the frequent association of these adhesion receptors with diverse chronic inflammatory processes. PMID:10712440

  9. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Identification of potential glutaminyl cyclase inhibitors from lead-like libraries by in silico and in vitro fragment-based screening.

    PubMed

    Szaszkó, Mária; Hajdú, István; Flachner, Beáta; Dobi, Krisztina; Magyar, Csaba; Simon, István; Lőrincz, Zsolt; Kapui, Zoltán; Pázmány, Tamás; Cseh, Sándor; Dormán, György

    2017-02-01

    A glutaminyl cyclase (QC) fragment library was in silico selected by disconnection of the structure of known QC inhibitors and by lead-like 2D virtual screening of the same set. The resulting fragment library (204 compounds) was acquired from commercial suppliers and pre-screened by differential scanning fluorimetry followed by functional in vitro assays. In this way, 10 fragment hits were identified ([Formula: see text]5 % hit rate, best inhibitory activity: 16 [Formula: see text]). The in vitro hits were then docked to the active site of QC, and the best scoring compounds were analyzed for binding interactions. Two fragments bound to different regions in a complementary manner, and thus, linking those fragments offered a rational strategy to generate novel QC inhibitors. Based on the structure of the virtual linked fragment, a 77-membered QC target focused library was selected from vendor databases and docked to the active site of QC. A PubChem search confirmed that the best scoring analogues are novel, potential QC inhibitors.

  11. Epoxide Hydrolase Conformational Heterogeneity for the Resolution of Bulky Pharmacologically Relevant Epoxide Substrates.

    PubMed

    Serrano-Hervás, Eila; Casadevall, Guillem; Garcia-Borràs, Marc; Feixas, Ferran; Osuna, Sílvia

    2018-04-06

    The conformational landscape of Bacillus megaterium epoxide hydrolase (BmEH) and how it is altered by mutations that confer the enzyme the ability to accept bulky epoxide substrates has been investigated. Extensive molecular dynamics (MD) simulations coupled to active site volume calculations have unveiled relevant features of the enzyme conformational dynamics and function. Our long-timescale MD simulations identify key conformational states not previously observed by means of X-ray crystallography and short MD simulations that present the loop containing one of the catalytic residues, Asp239, in a wide-open conformation, which is likely involved in the binding of the epoxide substrate. Introduction of mutations M145S and F128A dramatically alters the conformational landscape of the enzyme. These singly mutated variants can accept bulky epoxide substrates due to the disorder induced by mutation in the α-helix containing the catalytic Tyr144 and some parts of the lid domain. These changes impact the enzyme active site, which is substantially wider and more complementary to the bulky pharmacologically relevant epoxide substrates. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Versatile control of the submolecular motion of di(acylamino)pyridine-based [2]rotaxanes† †Electronic supplementary information (ESI) available: Experimental procedures, spectroscopic and mass spectrometry data for all new compounds, electrochemical studies, and full crystallographic details of 1c and 2b. CCDC 1051908 and 1051909. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c5sc00790a Click here for additional data file. Click here for additional data file.

    PubMed Central

    Martinez-Cuezva, Alberto; Pastor, Aurelia; Cioncoloni, Giacomo; Orenes, Raul-Angel; Alajarin, Mateo; Symes, Mark D.

    2015-01-01

    A cyclic network of chemical reactions has been conceived for exchanging the dynamic behaviour of di(acylamino)pyridine-based rotaxanes and surrogates. X-ray diffraction studies revealed the intercomponent interactions in these interlocked compounds and were consistent with those found in solution by dynamic NMR experiments. This particular binding site was incorporated into a molecular shuttle enabled for accessing two states with an outstanding positional discrimination through chemical manipulation. Furthermore, the ability of the di(acylamino)pyridine domain to associate with external binders with a complementary array of HB donor and acceptor sites was exploited for the advance of an unprecedented electrochemical switch operating through a reversible anion radical recognition process. PMID:28706682

  13. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  14. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  15. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE PAGES

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

    2008-01-01

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  16. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  17. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  18. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  19. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  20. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  1. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  2. LRRK2 kinase activity regulates synaptic vesicle trafficking and neurotransmitter release through modulation of LRRK2 macro-molecular complex

    PubMed Central

    Cirnaru, Maria D.; Marte, Antonella; Belluzzi, Elisa; Russo, Isabella; Gabrielli, Martina; Longo, Francesco; Arcuri, Ludovico; Murru, Luca; Bubacco, Luigi; Matteoli, Michela; Fedele, Ernesto; Sala, Carlo; Passafaro, Maria; Morari, Michele; Greggio, Elisa; Onofri, Franco; Piccoli, Giovanni

    2014-01-01

    Mutations in Leucine-rich repeat kinase 2 gene (LRRK2) are associated with familial and sporadic Parkinson's disease (PD). LRRK2 is a complex protein that consists of multiple domains executing several functions, including GTP hydrolysis, kinase activity, and protein binding. Robust evidence suggests that LRRK2 acts at the synaptic site as a molecular hub connecting synaptic vesicles to cytoskeletal elements via a complex panel of protein-protein interactions. Here we investigated the impact of pharmacological inhibition of LRRK2 kinase activity on synaptic function. Acute treatment with LRRK2 inhibitors reduced the frequency of spontaneous currents, the rate of synaptic vesicle trafficking and the release of neurotransmitter from isolated synaptosomes. The investigation of complementary models lacking LRRK2 expression allowed us to exclude potential off-side effects of kinase inhibitors on synaptic functions. Next we studied whether kinase inhibition affects LRRK2 heterologous interactions. We found that the binding among LRRK2, presynaptic proteins and synaptic vesicles is affected by kinase inhibition. Our results suggest that LRRK2 kinase activity influences synaptic vesicle release via modulation of LRRK2 macro-molecular complex. PMID:24904275

  3. Inferring the microscopic surface energy of protein-protein interfaces from mutation data.

    PubMed

    Moal, Iain H; Dapkūnas, Justas; Fernández-Recio, Juan

    2015-04-01

    Mutations at protein-protein recognition sites alter binding strength by altering the chemical nature of the interacting surfaces. We present a simple surface energy model, parameterized with empirical ΔΔG values, yielding mean energies of -48 cal mol(-1) Å(-2) for interactions between hydrophobic surfaces, -51 to -80 cal mol(-1) Å(-2) for surfaces of complementary charge, and 66-83 cal mol(-1) Å(-2) for electrostatically repelling surfaces, relative to the aqueous phase. This places the mean energy of hydrophobic surface burial at -24 cal mol(-1) Å(-2) . Despite neglecting configurational entropy and intramolecular changes, the model correlates with empirical binding free energies of a functionally diverse set of rigid-body interactions (r = 0.66). When used to rerank docking poses, it can place near-native solutions in the top 10 for 37% of the complexes evaluated, and 82% in the top 100. The method shows that hydrophobic burial is the driving force for protein association, accounting for 50-95% of the cohesive energy. The model is available open-source from http://life.bsc.es/pid/web/surface_energy/ and via the CCharpPPI web server http://life.bsc.es/pid/ccharppi/. © 2015 Wiley Periodicals, Inc.

  4. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  5. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  6. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  7. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  8. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  9. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  10. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  11. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  12. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  13. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  14. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  15. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  16. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  17. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  18. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  19. Enfuvirtide (T20)-Based Lipopeptide Is a Potent HIV-1 Cell Fusion Inhibitor: Implications for Viral Entry and Inhibition.

    PubMed

    Ding, Xiaohui; Zhang, Xiujuan; Chong, Huihui; Zhu, Yuanmei; Wei, Huamian; Wu, Xiyuan; He, Jinsheng; Wang, Xinquan; He, Yuxian

    2017-09-15

    The peptide drug enfuvirtide (T20) is the only viral fusion inhibitor used in combination therapy for HIV-1 infection, but it has relatively low antiviral activity and easily induces drug resistance. Emerging studies demonstrate that lipopeptide-based fusion inhibitors, such as LP-11 and LP-19, which mainly target the gp41 pocket site, have greatly improved antiviral potency and in vivo stability. In this study, we focused on developing a T20-based lipopeptide inhibitor that lacks pocket-binding sequence and targets a different site. First, the C-terminal tryptophan-rich motif (TRM) of T20 was verified to be essential for its target binding and inhibition; then, a novel lipopeptide, termed LP-40, was created by replacing the TRM with a fatty acid group. LP-40 showed markedly enhanced binding affinity for the target site and dramatically increased inhibitory activity on HIV-1 membrane fusion, entry, and infection. Unlike LP-11 and LP-19, which required a flexible linker between the peptide sequence and the lipid moiety, addition of a linker to LP-40 sharply reduced its potency, implying different binding modes with the extended N-terminal helices of gp41. Also, interestingly, LP-40 showed more potent activity than LP-11 in inhibiting HIV-1 Env-mediated cell-cell fusion while it was less active than LP-11 in inhibiting pseudovirus entry, and the two inhibitors displayed synergistic antiviral effects. The crystal structure of LP-40 in complex with a target peptide revealed their key binding residues and motifs. Combined, our studies have not only provided a potent HIV-1 fusion inhibitor, but also revealed new insights into the mechanisms of viral inhibition. IMPORTANCE T20 is the only membrane fusion inhibitor available for treatment of viral infection; however, T20 requires high doses and has a low genetic barrier for resistance, and its inhibitory mechanism and structural basis remain unclear. Here, we report the design of LP-40, a T20-based lipopeptide inhibitor that has greatly improved anti-HIV activity and is a more potent inhibitor of cell-cell fusion than of cell-free virus infection. The binding modes of two classes of membrane-anchoring lipopeptides (LP-40 and LP-11) verify the current fusion model in which an extended prehairpin structure bridges the viral and cellular membranes, and their complementary effects suggest a vital strategy for combination therapy of HIV-1 infection. Moreover, our understanding of the mechanism of action of T20 and its derivatives benefits from the crystal structure of LP-40. Copyright © 2017 American Society for Microbiology.

  20. Probing the structural dynamics of the CRISPR-Cas9 RNA-guided DNA-cleavage system by coarse-grained modeling.

    PubMed

    Zheng, Wenjun

    2017-02-01

    In the adaptive immune systems of many bacteria and archaea, the Cas9 endonuclease forms a complex with specific guide/scaffold RNA to identify and cleave complementary target sequences in foreign DNA. This DNA targeting machinery has been exploited in numerous applications of genome editing and transcription control. However, the molecular mechanism of the Cas9 system is still obscure. Recently, high-resolution structures have been solved for Cas9 in different structural forms (e.g., unbound forms, RNA-bound binary complexes, and RNA-DNA-bound tertiary complexes, corresponding to an inactive state, a pre-target-bound state, and a cleavage-competent or product state), which offered key structural insights to the Cas9 mechanism. To further probe the structural dynamics of Cas9 interacting with RNA and DNA at the amino-acid level of details, we have performed systematic coarse-grained modeling using an elastic network model and related analyses. Our normal mode analysis predicted a few key modes of collective motions that capture the observed conformational changes featuring large domain motions triggered by binding of RNA and DNA. Our flexibility analysis identified specific regions with high or low flexibility that coincide with key functional sites (such as DNA/RNA-binding sites, nuclease cleavage sites, and key hinges). We also identified a small set of hotspot residues that control the energetics of functional motions, which overlap with known functional sites and offer promising targets for future mutagenesis efforts to improve the specificity of Cas9. Finally, we modeled the conformational transitions of Cas9 from the unbound form to the binary complex and then the tertiary complex, and predicted a distinct sequence of domain motions. In sum, our findings have offered rich structural and dynamic details relevant to the Cas9 machinery, and will guide future investigation and engineering of the Cas9 systems. Proteins 2017; 85:342-353. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  2. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  3. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  4. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  5. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  6. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  7. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  8. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  9. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  11. Ligand induced ferromagnetism in ZnO nanostructures.

    PubMed

    Wang, Qian; Sun, Qiang; Jena, P

    2008-10-28

    Complementary to the experimental finding that ZnO nanoparticles become ferromagnetic when coated with N and S containing ligands such as dodecylamine and dodecanethiol [Garcia et al., Nano Lett. 7, 1489 (2007)], we provide the first theoretical understanding of the origin of magnetism in ligated ZnO nanoparticles as well as the structural properties of the ligated systems by using density functional theory and generalized gradient approximation for exchange and correlation, and a cluster model for the nanoparticles. We show that N or S atoms of the ligand bind to the Zn sites. The accompanying changes in the Zn-O bond length, hybridization between Zn 4s orbitals with N 2p or S 3p orbitals, and consequently the redistribution of charges between Zn and O atoms result in a magnetic system where the 2p electrons in O and N, and 3p electrons in S sites are spin polarized. Furthermore, the sites nearest to the Zn atom attached to the ligand carry bulk of the magnetic moment. Studies, as a function of cluster size, also illustrate that magnetism resides only on the surface. Our results confirm that the use of ligands can pave a new way for introducing magnetism in ZnO nanostructures, which can be used to develop magnetic sensors to detect N and S containing molecules.

  12. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  13. Self-assembled single-crystal silicon circuits on plastic

    PubMed Central

    Stauth, Sean A.; Parviz, Babak A.

    2006-01-01

    We demonstrate the use of self-assembly for the integration of freestanding micrometer-scale components, including single-crystal, silicon field-effect transistors (FETs) and diffusion resistors, onto flexible plastic substrates. Preferential self-assembly of multiple microcomponent types onto a common platform is achieved through complementary shape recognition and aided by capillary, fluidic, and gravitational forces. We outline a microfabrication process that yields single-crystal, silicon FETs in a freestanding, powder-like collection for use with self-assembly. Demonstrations of self-assembled FETs on plastic include logic inverters and measured electron mobility of 592 cm2/V-s. Finally, we extend the self-assembly process to substrates each containing 10,000 binding sites and realize 97% self-assembly yield within 25 min for 100-μm-sized elements. High-yield self-assembly of micrometer-scale functional devices as outlined here provides a powerful approach for production of macroelectronic systems. PMID:16968780

  14. Comparison of three quantitative phosphoproteomic strategies to study receptor tyrosine kinase signaling.

    PubMed

    Zhang, Guoan; Neubert, Thomas A

    2011-12-02

    There are three quantitative phosphoproteomic strategies most commonly used to study receptor tyrosine kinase (RTK) signaling. These strategies quantify changes in: (1) all three forms of phosphosites (phosphoserine, phosphothreonine and phosphotyrosine) following enrichment of phosphopeptides by titanium dioxide or immobilized metal affinity chromatography; (2) phosphotyrosine sites following anti- phosphotyrosine antibody enrichment of phosphotyrosine peptides; or (3) phosphotyrosine proteins and their binding partners following anti-phosphotyrosine protein immunoprecipitation. However, it is not clear from literature which strategy is more effective. In this study, we assessed the utility of these three phosphoproteomic strategies in RTK signaling studies by using EphB receptor signaling as an example. We used all three strategies with stable isotope labeling with amino acids in cell culture (SILAC) to compare changes in phosphoproteomes upon EphB receptor activation. We used bioinformatic analysis to compare results from the three analyses. Our results show that the three strategies provide complementary information about RTK pathways.

  15. DNA methylation dynamics during in vivo differentiation of blood and skin stem cells

    PubMed Central

    Bock, Christoph; Beerman, Isabel; Lien, Wen-Hui; Smith, Zachary D.; Gu, Hongcang; Boyle, Patrick; Gnirke, Andreas; Fuchs, Elaine; Rossi, Derrick J.; Meissner, Alexander

    2012-01-01

    DNA methylation is a mechanism of epigenetic regulation that is common to all vertebrates. Functional studies underscore its relevance for tissue homeostasis, but the global dynamics of DNA methylation during in vivo differentiation remain underexplored. Here we report high-resolution DNA methylation maps of adult stem cell differentiation in mouse, focusing on 19 purified cell populations of the blood and skin lineages. DNA methylation changes were locus-specific and relatively modest in magnitude. They frequently overlapped with lineage-associated transcription factors and their binding sites, suggesting that DNA methylation may protect cells from aberrant transcription factor activation. DNA methylation and gene expression provided complementary information, and combining the two enabled us to infer the cellular differentiation hierarchy of the blood lineage directly from genomic data. In summary, these results demonstrate that in vivo differentiation of adult stem cells is associated with small but informative changes in the genomic distribution of DNA methylation. PMID:22841485

  16. A hexahistidine-Zn2+-dye label reveals STIM1 surface exposure

    PubMed Central

    Hauser, Christina T.; Tsien, Roger Y.

    2007-01-01

    Site-specific fluorescent labeling of proteins in vivo remains one of the most powerful techniques for imaging complex processes in live cells. Although fluorescent proteins in many colors are useful tools for tracking expression and localization of fusion proteins in cells, these relatively large tags (>220 aa) can perturb protein folding, trafficking and function. Much smaller genetically encodable domains (<15 aa) offer complementary advantages. We introduce a small fluorescent chelator whose membrane-impermeant complex with nontoxic Zn2+ ions binds tightly but reversibly to hexahistidine (His6) motifs on surface-exposed proteins. This live-cell label helps to resolve a current controversy concerning externalization of the stromal interaction molecule STIM1 upon depletion of Ca2+ from the endoplasmic reticulum. Whereas N-terminal fluorescent protein fusions interfere with surface exposure of STIM1, short His6 tags are accessible to the dye or antibodies, demonstrating externalization. PMID:17360414

  17. Synthesis and biological evaluation of new 2-(4,5-dihydro-1H-imidazol-2-yl)-3,4-dihydro-2H-1,4-benzoxazine derivatives.

    PubMed

    Touzeau, Frédérique; Arrault, Axelle; Guillaumet, Gérald; Scalbert, Elizabeth; Pfeiffer, Bruno; Rettori, Marie-Claire; Renard, Pierre; Mérour, Jean-Yves

    2003-05-08

    2-(4,5-Dihydro-1H-imidazol-2-yl)-3,4-dihydro-2H-1,4-benzoxazine derivatives and tricyclic analogues with a fused additional ring on the nitrogen atom of the benzoxazine moiety have been prepared and evaluated for their cardiovascular effects as potential antihypertensive agents. The imidazoline ring was generated by reaction of the corresponding ethyl ester with ethylenediamine. Affinities for imidazoline binding sites (IBS) I(1) and I(2) and alpha(1) and alpha(2) adrenergic receptors were evaluated as well as the effects on mean arterial blood pressure (MAP) and heart rate (HR) of spontaneously hypertensive rats. With few exceptions the most active compounds on MAP were those with high affinities for IBS and alpha(2) receptor. Among these, compound 4h was the most interesting and is now, together with its enantiomers, under complementary pharmacological evaluation.

  18. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  19. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  20. Integration of G protein α (Gα) signaling by the regulator of G protein signaling 14 (RGS14).

    PubMed

    Brown, Nicole E; Goswami, Devrishi; Branch, Mary Rose; Ramineni, Suneela; Ortlund, Eric A; Griffin, Patrick R; Hepler, John R

    2015-04-03

    RGS14 contains distinct binding sites for both active (GTP-bound) and inactive (GDP-bound) forms of Gα subunits. The N-terminal regulator of G protein signaling (RGS) domain binds active Gαi/o-GTP, whereas the C-terminal G protein regulatory (GPR) motif binds inactive Gαi1/3-GDP. The molecular basis for how RGS14 binds different activation states of Gα proteins to integrate G protein signaling is unknown. Here we explored the intramolecular communication between the GPR motif and the RGS domain upon G protein binding and examined whether RGS14 can functionally interact with two distinct forms of Gα subunits simultaneously. Using complementary cellular and biochemical approaches, we demonstrate that RGS14 forms a stable complex with inactive Gαi1-GDP at the plasma membrane and that free cytosolic RGS14 is recruited to the plasma membrane by activated Gαo-AlF4(-). Bioluminescence resonance energy transfer studies showed that RGS14 adopts different conformations in live cells when bound to Gα in different activation states. Hydrogen/deuterium exchange mass spectrometry revealed that RGS14 is a very dynamic protein that undergoes allosteric conformational changes when inactive Gαi1-GDP binds the GPR motif. Pure RGS14 forms a ternary complex with Gαo-AlF4(-) and an AlF4(-)-insensitive mutant (G42R) of Gαi1-GDP, as observed by size exclusion chromatography and differential hydrogen/deuterium exchange. Finally, a preformed RGS14·Gαi1-GDP complex exhibits full capacity to stimulate the GTPase activity of Gαo-GTP, demonstrating that RGS14 can functionally engage two distinct forms of Gα subunits simultaneously. Based on these findings, we propose a working model for how RGS14 integrates multiple G protein signals in host CA2 hippocampal neurons to modulate synaptic plasticity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  2. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  4. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  6. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  7. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  8. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  9. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  10. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  11. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  12. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  13. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  14. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  15. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  16. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  17. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  18. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  19. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  20. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  1. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  2. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  3. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  4. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  5. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  6. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  7. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  8. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  9. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  10. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  11. Crosslinking Constraints and Computational Models as Complementary Tools in Modeling the Extracellular Domain of the Glycine Receptor

    PubMed Central

    Liu, Zhenyu; Szarecka, Agnieszka; Yonkunas, Michael; Speranskiy, Kirill; Kurnikova, Maria; Cascio, Michael

    2014-01-01

    The glycine receptor (GlyR), a member of the pentameric ligand-gated ion channel superfamily, is the major inhibitory neurotransmitter-gated receptor in the spinal cord and brainstem. In these receptors, the extracellular domain binds agonists, antagonists and various other modulatory ligands that act allosterically to modulate receptor function. The structures of homologous receptors and binding proteins provide templates for modeling of the ligand-binding domain of GlyR, but limitations in sequence homology and structure resolution impact on modeling studies. The determination of distance constraints via chemical crosslinking studies coupled with mass spectrometry can provide additional structural information to aid in model refinement, however it is critical to be able to distinguish between intra- and inter-subunit constraints. In this report we model the structure of GlyBP, a structural and functional homolog of the extracellular domain of human homomeric α1 GlyR. We then show that intra- and intersubunit Lys-Lys crosslinks in trypsinized samples of purified monomeric and oligomeric protein bands from SDS-polyacrylamide gels may be identified and differentiated by MALDI-TOF MS studies of limited resolution. Thus, broadly available MS platforms are capable of providing distance constraints that may be utilized in characterizing large complexes that may be less amenable to NMR and crystallographic studies. Systematic studies of state-dependent chemical crosslinking and mass spectrometric identification of crosslinked sites has the potential to complement computational modeling efforts by providing constraints that can validate and refine allosteric models. PMID:25025226

  12. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  13. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  14. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  15. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  16. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  17. Two alternative ways of start site selection in human norovirus reinitiation of translation.

    PubMed

    Luttermann, Christine; Meyers, Gregor

    2014-04-25

    The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

  18. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  19. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  20. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  1. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  2. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  3. miRNA-558 promotes gastric cancer progression through attenuating Smad4-mediated repression of heparanase expression.

    PubMed

    Zheng, Liduan; Jiao, Wanju; Song, Huajie; Qu, Hongxia; Li, Dan; Mei, Hong; Chen, Yajun; Yang, Feng; Li, Huanhuan; Huang, Kai; Tong, Qiangsong

    2016-09-29

    Previous studies have indicated that as the only mammalian endo-β-D-glucuronidase, heparanase (HPSE) is up-regulated and associated with poor prognosis in gastric cancer, while the underlying mechanisms still remain to be determined. Herein, through integrative analysis of public datasets, we found microRNA-558 (miR-558) and SMAD family member 4 (Smad4) as the crucial transcription regulators of HPSE expression in gastric cancer, with their adjacent target sites within the promoter of HPSE. We identified that endogenous miR-558 activated the transcription and expression of HPSE in gastric cancer cell lines. In contrast, Smad4 suppressed the nascent transcription and expression of HPSE via directly binding to its promoter. Mechanistically, miR-558 recognized its complementary site within HPSE promoter to decrease the binding of Smad4 in an Argonaute 1-dependent manner. Ectopic expression or knockdown experiments indicated that miR-558 promoted the in vitro and in vivo tumorigenesis and aggressiveness of gastric cancer cell lines via attenuating Smad4-mediated repression of HPSE expression. In clinical gastric cancer specimens, up-regulation of miR-558 and down-regulation of Smad4 were positively correlated with HPSE expression. Kaplan-Meier survival analysis revealed that miR-558 and Smad4 were associated with unfavourable and favourable outcome of gastric cancer patients, respectively. Therefore, these findings demonstrate that miR-558 facilitates the progression of gastric cancer through directly targeting the HPSE promoter to attenuate Smad4-mediated repression of HPSE expression.

  4. miRNA-558 promotes gastric cancer progression through attenuating Smad4-mediated repression of heparanase expression

    PubMed Central

    Zheng, Liduan; Jiao, Wanju; Song, Huajie; Qu, Hongxia; Li, Dan; Mei, Hong; Chen, Yajun; Yang, Feng; Li, Huanhuan; Huang, Kai; Tong, Qiangsong

    2016-01-01

    Previous studies have indicated that as the only mammalian endo-β-D-glucuronidase, heparanase (HPSE) is up-regulated and associated with poor prognosis in gastric cancer, while the underlying mechanisms still remain to be determined. Herein, through integrative analysis of public datasets, we found microRNA-558 (miR-558) and SMAD family member 4 (Smad4) as the crucial transcription regulators of HPSE expression in gastric cancer, with their adjacent target sites within the promoter of HPSE. We identified that endogenous miR-558 activated the transcription and expression of HPSE in gastric cancer cell lines. In contrast, Smad4 suppressed the nascent transcription and expression of HPSE via directly binding to its promoter. Mechanistically, miR-558 recognized its complementary site within HPSE promoter to decrease the binding of Smad4 in an Argonaute 1-dependent manner. Ectopic expression or knockdown experiments indicated that miR-558 promoted the in vitro and in vivo tumorigenesis and aggressiveness of gastric cancer cell lines via attenuating Smad4-mediated repression of HPSE expression. In clinical gastric cancer specimens, up-regulation of miR-558 and down-regulation of Smad4 were positively correlated with HPSE expression. Kaplan–Meier survival analysis revealed that miR-558 and Smad4 were associated with unfavourable and favourable outcome of gastric cancer patients, respectively. Therefore, these findings demonstrate that miR-558 facilitates the progression of gastric cancer through directly targeting the HPSE promoter to attenuate Smad4-mediated repression of HPSE expression. PMID:27685626

  5. In vivo, Argonaute-bound microRNAs exist predominantly in a reservoir of low molecular weight complexes not associated with mRNA

    PubMed Central

    La Rocca, Gaspare; Olejniczak, Scott H.; González, Alvaro J.; Briskin, Daniel; Vidigal, Joana A.; Spraggon, Lee; DeMatteo, Raymond G.; Radler, Megan R.; Lindsten, Tullia; Ventura, Andrea; Tuschl, Thomas; Leslie, Christina S.; Thompson, Craig B.

    2015-01-01

    MicroRNAs repress mRNA translation by guiding Argonaute proteins to partially complementary binding sites, primarily within the 3′ untranslated region (UTR) of target mRNAs. In cell lines, Argonaute-bound microRNAs exist mainly in high molecular weight RNA-induced silencing complexes (HMW-RISC) associated with target mRNA. Here we demonstrate that most adult tissues contain reservoirs of microRNAs in low molecular weight RISC (LMW-RISC) not bound to mRNA, suggesting that these microRNAs are not actively engaged in target repression. Consistent with this observation, the majority of individual microRNAs in primary T cells were enriched in LMW-RISC. During T-cell activation, signal transduction through the phosphoinositide-3 kinase–RAC-alpha serine/threonine-protein kinase–mechanistic target of rapamycin pathway increased the assembly of microRNAs into HMW-RISC, enhanced expression of the glycine-tryptophan protein of 182 kDa, an essential component of HMW-RISC, and improved the ability of microRNAs to repress partially complementary reporters, even when expression of targeting microRNAs did not increase. Overall, data presented here demonstrate that microRNA-mediated target repression in nontransformed cells depends not only on abundance of specific microRNAs, but also on regulation of RISC assembly by intracellular signaling. PMID:25568082

  6. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  7. Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

    PubMed

    Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

    2009-03-15

    Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

  8. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  9. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  10. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  11. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  12. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  13. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  14. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  15. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  16. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  17. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  18. Mechanism of MicroRNA-Target Interaction: Molecular Dynamics Simulations and Thermodynamics Analysis

    PubMed Central

    Wang, Yonghua; Li, Yan; Ma, Zhi; Yang, Wei; Ai, Chunzhi

    2010-01-01

    MicroRNAs (miRNAs) are endogenously produced ∼21-nt riboregulators that associate with Argonaute (Ago) proteins to direct mRNA cleavage or repress the translation of complementary RNAs. Capturing the molecular mechanisms of miRNA interacting with its target will not only reinforce the understanding of underlying RNA interference but also fuel the design of more effective small-interfering RNA strands. To address this, in the present work the RNA-bound (Ago-miRNA, Ago-miRNA-target) and RNA-free Ago forms were analyzed by performing both molecular dynamics simulations and thermodynamic analysis. Based on the principal component analysis results of the simulation trajectories as well as the correlation analysis in fluctuations of residues, we discover that: 1) three important (PAZ, Mid and PIWI) domains exist in Argonaute which define the global dynamics of the protein; 2) the interdomain correlated movements are so crucial for the interaction of Ago-RNAs that they not only facilitate the relaxation of the interactions between residues surrounding the RNA binding channel but also induce certain conformational changes; and 3) it is just these conformational changes that expand the cavity of the active site and open putative pathways for both the substrate uptake and product release. In addition, by thermodynamic analysis we also discover that for both the guide RNA 5′-end recognition and the facilitated site-specific cleavage of the target, the presence of two metal ions (of Mg2+) plays a predominant role, and this conclusion is consistent with the observed enzyme catalytic cleavage activity in the ternary complex (Ago-miRNA-mRNA). Our results find that it is the set of arginine amino acids concentrated in the nucleotide-binding channel in Ago, instead of the conventionally-deemed seed base-paring, that makes greater contributions in stabilizing the binding of the nucleic acids to Ago. PMID:20686687

  19. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1∙Nup98)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quan, Beili; Seo, Hyuk-Soo; Blobel, Günter

    2014-07-01

    mRNA export factor 1 (Rae1) and nucleoporin 98 (Nup98) are host cell targets for the matrix (M) protein of vesicular stomatitis virus (VSV). How Rae1 functions in mRNA export and how M protein targets both Rae1 and Nup98 are not understood at the molecular level. To obtain structural insights, we assembled a 1:1:1 complex of M•Rae1•Nup98 and established a crystal structure at 3.15-Å resolution. We found that the M protein contacts the Rae1•Nup98 heterodimer principally by two protrusions projecting from the globular domain of M like a finger and thumb. Both projections clamp to the side of the β-propeller ofmore » Rae1, with the finger also contacting Nup98. The most prominent feature of the finger is highly conserved Methionine 51 (Met51) with upstream and downstream acidic residues. The complementary surface on Rae1 displays a deep hydrophobic pocket, into which Met51 fastens like a bolt, and a groove of basic residues on either side, which bond to the acidic residues of the finger. Notably, the M protein competed for in vitro binding of various oligonucleotides to Rae1•Nup98. We localized this competing activity of M to its finger using a synthetic peptide. Collectively, our data suggest that Rae1 serves as a binding protein for the phosphate backbone of any nucleic acid and that the finger of M mimics this ligand. In the context of mRNA export, we propose that a given mRNA segment, after having been deproteinated by helicase, is transiently reproteinated by Nup98-tethered Rae1. We suggest that such repetitive cycles provide cytoplasmic stopover sites required for ratcheting mRNA across the nuclear pore.« less

  20. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  1. Multiplexed evaluation of capture agent binding kinetics using arrays of silicon photonic microring resonators.

    PubMed

    Byeon, Ji-Yeon; Bailey, Ryan C

    2011-09-07

    High affinity capture agents recognizing biomolecular targets are essential in the performance of many proteomic detection methods. Herein, we report the application of a label-free silicon photonic biomolecular analysis platform for simultaneously determining kinetic association and dissociation constants for two representative protein capture agents: a thrombin-binding DNA aptamer and an anti-thrombin monoclonal antibody. The scalability and inherent multiplexing capability of the technology make it an attractive platform for simultaneously evaluating the binding characteristics of multiple capture agents recognizing the same target antigen, and thus a tool complementary to emerging high-throughput capture agent generation strategies.

  2. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  3. Pyrrolic tripodal receptors for carbohydrates. Role of functional groups and binding geometry on carbohydrate recognition.

    PubMed

    Cacciarini, Martina; Nativi, Cristina; Norcini, Martina; Staderini, Samuele; Francesconi, Oscar; Roelens, Stefano

    2011-02-21

    The contribution from several H-bonding groups and the impact of geometric requirements on the binding ability of benzene-based tripodal receptors toward carbohydrates have been investigated by measuring the affinity of a set of structures toward octyl β-D-glucopyranoside, selected as a representative monosaccharide. The results reported in the present study demonstrate that a judicious choice of correct geometry and appropriate functional groups is critical to achieve the complementary hydrogen bonding interactions required for an effective carbohydrate recognition.

  4. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  5. Structure-based affinity maturation of a chimeric anti-ricin antibody C4C13.

    PubMed

    Luo, Longlong; Luo, Qun; Guo, Leiming; Lv, Ming; Lin, Zhou; Geng, Jing; Li, Xinying; Li, Yan; Shen, Beifen; Qiao, Chunxia; Feng, Jiannan

    2014-01-01

    Ricin is a highly lethal toxin. Anti-ricin chimeric monoclonal antibody (mAb) C4C13 was prepared in our lab; however, its binding affinity was much weaker than that of the parent antibody 4C13. In this study, based on the computer-guided homology modeling and conformational optimization methods, the 3-D structure of C4C13 variable regions Fv was constructed and optimized. Using molecular docking and dynamics simulation methods, the 3-D complex structure of ricin and C4C13 Fv was obtained. Considering the orientation property, surface electrostatic distribution, residues chemical and physical character and intermolecular hydrogen bond, the binding mode and key residues were predicted. According to C4C13 Fv fragment and ricin complementary binding surface, electrostatic attraction periphery and van der Waals interaction interface, three mutants (i.e., M1 (N(H102)F, W(H103)Y); M2 (W(H103)Y) and M3 (R(L90)G)) were designed, in which M1 and M2 were predicted to possess higher antigen-binding activity than C4C13, while M3 was weaker. The relative affinity assays by ELISA showed that M1 and M2 mutations had higher affinity (9.6 and 18.3 nmol/L) than C4C13 (130 nmol/L) and M3 had weaker affinity (234.5 nmol/L) than C4C13. The results showed that the modeling complex structure of the antigen (ricin) and antibody (C4C13) is reasonable. Our work offered affinity maturated antibodies by site mutations, which were beneficial for valuable anti-ricin antibody design and preparation in future.

  6. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  8. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  9. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  10. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  11. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  12. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  13. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  14. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  15. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  16. Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54

    PubMed Central

    Chu, Chia-ying

    2006-01-01

    RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390

  17. Nuclear respiratory factor 2 regulates the expression of the same NMDA receptor subunit genes as NRF-1: both factors act by a concurrent and parallel mechanism to couple energy metabolism and synaptic transmission.

    PubMed

    Priya, Anusha; Johar, Kaid; Wong-Riley, Margaret T T

    2013-01-01

    Neuronal activity and energy metabolism are tightly coupled processes. Previously, we found that nuclear respiratory factor 1 (NRF-1) transcriptionally co-regulates energy metabolism and neuronal activity by regulating all 13 subunits of the critical energy generating enzyme, cytochrome c oxidase (COX), as well as N-methyl-d-aspartate (NMDA) receptor subunits 1 and 2B, GluN1 (Grin1) and GluN2B (Grin2b). We also found that another transcription factor, nuclear respiratory factor 2 (NRF-2 or GA-binding protein) regulates all subunits of COX as well. The goal of the present study was to test our hypothesis that NRF-2 also regulates specific subunits of NMDA receptors, and that it functions with NRF-1 via one of three mechanisms: complementary, concurrent and parallel, or a combination of complementary and concurrent/parallel. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation of mouse neuroblastoma cells and rat visual cortical tissue, promoter mutations, real-time quantitative PCR, and western blot analysis, NRF-2 was found to functionally regulate Grin1 and Grin2b genes, but not any other NMDA subunit genes. Grin1 and Grin2b transcripts were up-regulated by depolarizing KCl, but silencing of NRF-2 prevented this up-regulation. On the other hand, over-expression of NRF-2 rescued the down-regulation of these subunits by the impulse blocker TTX. NRF-2 binding sites on Grin1 and Grin2b are conserved among species. Our data indicate that NRF-2 and NRF-1 operate in a concurrent and parallel manner in mediating the tight coupling between energy metabolism and neuronal activity at the molecular level. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  19. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  20. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  1. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  2. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  3. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  4. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  5. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  6. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  7. Untangling the Diverse Interior and Multiple Exterior Guest Interactions of a Supramolecular Host by the Simultaneous Analysis of Complementary Observables.

    PubMed

    Sgarlata, Carmelo; Raymond, Kenneth N

    2016-07-05

    The entropic and enthalpic driving forces for encapsulation versus sequential exterior guest binding to the [Ga4L6](12-) supramolecular host in solution are very different, which significantly complicates the determination of these thermodynamic parameters. The simultaneous use of complementary techniques, such as NMR, UV-vis, and isothermal titration calorimetry, enables the disentanglement of such multiple host-guest interactions. Indeed, data collected by each technique measure different components of the host-guest equilibria and together provide a complete picture of the solution thermodynamics. Unfortunately, commercially available programs do not allow for global analysis of different physical observables. We thus resorted to a novel procedure for the simultaneous refinement of multiple parameters (ΔG°, ΔH°, and ΔS°) by treating different observables through a weighted nonlinear least-squares analysis of a constrained model. The refinement procedure is discussed for the multiple binding of the Et4N(+) guest, but it is broadly applicable to the deconvolution of other intricate host-guest equilibria.

  8. Affimer proteins are versatile and renewable affinity reagents

    PubMed Central

    Tiede, Christian; Bedford, Robert; Heseltine, Sophie J; Smith, Gina; Wijetunga, Imeshi; Ross, Rebecca; AlQallaf, Danah; Roberts, Ashley PE; Balls, Alexander; Curd, Alistair; Hughes, Ruth E; Martin, Heather; Needham, Sarah R; Zanetti-Domingues, Laura C; Sadigh, Yashar; Peacock, Thomas P; Tang, Anna A; Gibson, Naomi; Kyle, Hannah; Platt, Geoffrey W; Ingram, Nicola; Taylor, Thomas; Coletta, Louise P; Manfield, Iain; Knowles, Margaret; Bell, Sandra; Esteves, Filomena; Maqbool, Azhar; Prasad, Raj K; Drinkhill, Mark; Bon, Robin S; Patel, Vikesh; Goodchild, Sarah A; Martin-Fernandez, Marisa; Owens, Ray J; Nettleship, Joanne E; Webb, Michael E; Harrison, Michael; Lippiat, Jonathan D; Ponnambalam, Sreenivasan; Peckham, Michelle; Smith, Alastair; Ferrigno, Paul Ko; Johnson, Matt; McPherson, Michael J; Tomlinson, Darren Charles

    2017-01-01

    Molecular recognition reagents are key tools for understanding biological processes and are used universally by scientists to study protein expression, localisation and interactions. Antibodies remain the most widely used of such reagents and many show excellent performance, although some are poorly characterised or have stability or batch variability issues, supporting the use of alternative binding proteins as complementary reagents for many applications. Here we report on the use of Affimer proteins as research reagents. We selected 12 diverse molecular targets for Affimer selection to exemplify their use in common molecular and cellular applications including the (a) selection against various target molecules; (b) modulation of protein function in vitro and in vivo; (c) labelling of tumour antigens in mouse models; and (d) use in affinity fluorescence and super-resolution microscopy. This work shows that Affimer proteins, as is the case for other alternative binding scaffolds, represent complementary affinity reagents to antibodies for various molecular and cell biology applications. DOI: http://dx.doi.org/10.7554/eLife.24903.001 PMID:28654419

  9. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  10. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  11. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  12. Electrostatic transition state stabilization rather than reactant destabilization provides the chemical basis for efficient chorismate mutase catalysis.

    PubMed

    Burschowsky, Daniel; van Eerde, André; Ökvist, Mats; Kienhöfer, Alexander; Kast, Peter; Hilvert, Donald; Krengel, Ute

    2014-12-09

    For more than half a century, transition state theory has provided a useful framework for understanding the origins of enzyme catalysis. As proposed by Pauling, enzymes accelerate chemical reactions by binding transition states tighter than substrates, thereby lowering the activation energy compared with that of the corresponding uncatalyzed process. This paradigm has been challenged for chorismate mutase (CM), a well-characterized metabolic enzyme that catalyzes the rearrangement of chorismate to prephenate. Calculations have predicted the decisive factor in CM catalysis to be ground state destabilization rather than transition state stabilization. Using X-ray crystallography, we show, in contrast, that a sluggish variant of Bacillus subtilis CM, in which a cationic active-site arginine was replaced by a neutral citrulline, is a poor catalyst even though it effectively preorganizes chorismate for the reaction. A series of high-resolution molecular snapshots of the reaction coordinate, including the apo enzyme, and complexes with substrate, transition state analog and product, demonstrate that an active site, which is only complementary in shape to a reactive substrate conformer, is insufficient for effective catalysis. Instead, as with other enzymes, electrostatic stabilization of the CM transition state appears to be crucial for achieving high reaction rates.

  13. Single-channel recordings of RyR1 at microsecond resolution in CMOS-suspended membranes.

    PubMed

    Hartel, Andreas J W; Ong, Peijie; Schroeder, Indra; Giese, M Hunter; Shekar, Siddharth; Clarke, Oliver B; Zalk, Ran; Marks, Andrew R; Hendrickson, Wayne A; Shepard, Kenneth L

    2018-02-20

    Single-channel recordings are widely used to explore functional properties of ion channels. Typically, such recordings are performed at bandwidths of less than 10 kHz because of signal-to-noise considerations, limiting the temporal resolution available for studying fast gating dynamics to greater than 100 µs. Here we present experimental methods that directly integrate suspended lipid bilayers with high-bandwidth, low-noise transimpedance amplifiers based on complementary metal-oxide-semiconductor (CMOS) integrated circuits (IC) technology to achieve bandwidths in excess of 500 kHz and microsecond temporal resolution. We use this CMOS-integrated bilayer system to study the type 1 ryanodine receptor (RyR1), a Ca 2+ -activated intracellular Ca 2+ -release channel located on the sarcoplasmic reticulum. We are able to distinguish multiple closed states not evident with lower bandwidth recordings, suggesting the presence of an additional Ca 2+ binding site, distinct from the site responsible for activation. An extended beta distribution analysis of our high-bandwidth data can be used to infer closed state flicker events as fast as 35 ns. These events are in the range of single-file ion translocations.

  14. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.

    2014-01-01

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  15. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  16. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  17. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  18. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  19. Paramagnetic and fluorescent liposomes for target-specific imaging and therapy of tumor angiogenesis

    PubMed Central

    Kluza, Ewelina; Van Tilborg, Geralda A. F.; van der Schaft, Daisy W. J.; Griffioen, Arjan W.; Mulder, Willem J. M.; Nicolay, Klaas

    2010-01-01

    Angiogenesis is essential for tumor growth and metastatic potential and for that reason considered an important target for tumor treatment. Noninvasive imaging technologies, capable of visualizing tumor angiogenesis and evaluating the efficacy of angiostatic therapies, are therefore becoming increasingly important. Among the various imaging modalities, magnetic resonance imaging (MRI) is characterized by a superb spatial resolution and anatomical soft-tissue contrast. Revolutionary advances in contrast agent chemistry have delivered versatile angiogenesis-specific molecular MRI contrast agents. In this paper, we review recent advances in the preclinical application of paramagnetic and fluorescent liposomes for noninvasive visualization of the molecular processes involved in tumor angiogenesis. This liposomal contrast agent platform can be prepared with a high payload of contrast generating material, thereby facilitating its detection, and is equipped with one or more types of targeting ligands for binding to specific molecules expressed at the angiogenic site. Multimodal liposomes endowed with contrast material for complementary imaging technologies, e.g., MRI and optical, can be exploited to gain important preclinical insights into the mechanisms of binding and accumulation at angiogenic vascular endothelium and to corroborate the in vivo findings. Interestingly, liposomes can be designed to contain angiostatic therapeutics, allowing for image-supervised drug delivery and subsequent monitoring of therapeutic efficacy. PMID:20390447

  20. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  1. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  2. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  3. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  6. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  7. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  8. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  10. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  11. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  12. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  13. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  14. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  15. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  16. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  17. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  18. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  19. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  20. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  1. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  2. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  3. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  4. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  5. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  6. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  7. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  8. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  9. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  11. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  12. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  13. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  15. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  16. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  17. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  18. Improving the complementary methods to estimate evapotranspiration under diverse climatic and physical conditions

    NASA Astrophysics Data System (ADS)

    Anayah, F. M.; Kaluarachchi, J. J.

    2014-06-01

    Reliable estimation of evapotranspiration (ET) is important for the purpose of water resources planning and management. Complementary methods, including complementary relationship areal evapotranspiration (CRAE), advection aridity (AA) and Granger and Gray (GG), have been used to estimate ET because these methods are simple and practical in estimating regional ET using meteorological data only. However, prior studies have found limitations in these methods especially in contrasting climates. This study aims to develop a calibration-free universal method using the complementary relationships to compute regional ET in contrasting climatic and physical conditions with meteorological data only. The proposed methodology consists of a systematic sensitivity analysis using the existing complementary methods. This work used 34 global FLUXNET sites where eddy covariance (EC) fluxes of ET are available for validation. A total of 33 alternative model variations from the original complementary methods were proposed. Further analysis using statistical methods and simplified climatic class definitions produced one distinctly improved GG-model-based alternative. The proposed model produced a single-step ET formulation with results equal to or better than the recent studies using data-intensive, classical methods. Average root mean square error (RMSE), mean absolute bias (BIAS) and R2 (coefficient of determination) across 34 global sites were 20.57 mm month-1, 10.55 mm month-1 and 0.64, respectively. The proposed model showed a step forward toward predicting ET in large river basins with limited data and requiring no calibration.

  19. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  20. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  1. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  2. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  3. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  4. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  5. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  6. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  7. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  8. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  9. The Identity-Location Binding Problem.

    PubMed

    Howe, Piers D L; Ferguson, Adam

    2015-09-01

    The binding problem is fundamental to visual perception. It is the problem of associating an object's visual properties with itself and not with some other object. The problem is made particular difficult because different properties of an object, such as its color, shape, size, and motion, are often processed independently, sometimes in different cortical areas. The results of these separate analyses have to be combined before the object can be seen as a single coherent entity as opposed to a collection of unconnected features. Visual bindings are typically initiated and updated in a serial fashion, one object at a time. Here, we show that one type of binding, location-identity bindings, can be updated in parallel. We do this by using two complementary techniques, the simultaneous-sequential paradigm and systems factorial technology. These techniques make different assumptions and rely on different behavioral measures, yet both came to the same conclusion. Copyright © 2014 Cognitive Science Society, Inc.

  10. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  11. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  12. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  13. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  14. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  15. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  16. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  17. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  18. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  19. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  20. Structure-based biophysical analysis of the interaction of rhodopsin with G protein and arrestin.

    PubMed

    Sommer, Martha E; Elgeti, Matthias; Hildebrand, Peter W; Szczepek, Michal; Hofmann, Klaus Peter; Scheerer, Patrick

    2015-01-01

    In this chapter, we describe a set of complementary techniques that we use to study the activation of rhodopsin, a G protein-coupled receptor (GPCR), and its functional interactions with G protein and arrestin. The protein reagents used for these studies come from native disc membranes or heterologous expression, and G protein and arrestin are often replaced with less complex synthetic peptides derived from key interaction sites of these binding partners (BPs). We first report on our approach to protein X-ray crystallography and describe how protein crystals from native membranes are obtained. The crystal structures provide invaluable resolution, but other techniques are required to assess the dynamic equilibria characteristic for active GPCRs. The simplest approach is "Extra Meta II," which uses UV/Vis absorption spectroscopy to monitor the equilibrium of photoactivated states. Site-specific information about the BPs (e.g., arrestin) is added by fluorescence techniques employing mutants labeled with reporter groups. All functional changes in both the receptor and interacting proteins or peptides are seen with highest precision using Fourier transform infrared (FTIR) difference spectroscopy. In our approach, the lack of site-specific information in FTIR is overcome by parallel molecular dynamics simulations, which are employed to interpret the results and to extend the timescale down to the range of conformational substates. © 2015 Elsevier Inc. All rights reserved.

  1. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  2. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  3. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  4. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  5. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  6. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  7. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  8. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  9. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  11. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  12. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  13. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  14. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  15. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  16. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Uses of monoclonial antibody 8H9

    DOEpatents

    Cheung, Nai-Kong V.

    2015-06-23

    This invention provides an antibody that binds the same antigen as that of monoclonal antibody 8H9, wherein the heavy chain CDR (Complementary Determining Region)1 comprises NYDIN, heavy chain CDR2 comprises WIFPGDGSTQY, heavy chain CDR3 comprises QTTATWFAY, and the light chain CDR1 comprises RASQSISDYLH, light chain CDR2 comprises YASQSIS, and light chain CDR3 comprises QNGHSFPLT. In another embodiment, there is provided a polypeptide that binds the same antigen as that of monoclonal antibody 8H9, wherein the polypeptide comprises NYDIN, WIFPGDGSTQY, QTTATWFAY, RASQSISDYLH, YASQSIS, and QNGHSFPLT.

  18. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  19. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  20. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  1. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  2. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  3. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  4. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  5. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  6. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  7. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  8. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  9. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  10. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  11. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  12. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  13. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  14. Design of Novel Chemotherapeutic Agents Targeting Checkpoint Kinase 1 Using 3D-QSAR Modeling and Molecular Docking Methods.

    PubMed

    Balupuri, Anand; Balasubramanian, Pavithra K; Cho, Seung J

    2016-01-01

    Checkpoint kinase 1 (Chk1) has emerged as a potential therapeutic target for design and development of novel anticancer drugs. Herein, we have performed three-dimensional quantitative structure-activity relationship (3D-QSAR) and molecular docking analyses on a series of diazacarbazoles to design potent Chk1 inhibitors. 3D-QSAR models were developed using comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) techniques. Docking studies were performed using AutoDock. The best CoMFA and CoMSIA models exhibited cross-validated correlation coefficient (q2) values of 0.631 and 0.585, and non-cross-validated correlation coefficient (r2) values of 0.933 and 0.900, respectively. CoMFA and CoMSIA models showed reasonable external predictabilities (r2 pred) of 0.672 and 0.513, respectively. A satisfactory performance in the various internal and external validation techniques indicated the reliability and robustness of the best model. Docking studies were performed to explore the binding mode of inhibitors inside the active site of Chk1. Molecular docking revealed that hydrogen bond interactions with Lys38, Glu85 and Cys87 are essential for Chk1 inhibitory activity. The binding interaction patterns observed during docking studies were complementary to 3D-QSAR results. Information obtained from the contour map analysis was utilized to design novel potent Chk1 inhibitors. Their activities and binding affinities were predicted using the derived model and docking studies. Designed inhibitors were proposed as potential candidates for experimental synthesis.

  15. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  16. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  17. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  18. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  19. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  20. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  1. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  2. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  3. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  4. Distribution and diversity of ribosome binding sites in prokaryotic genomes.

    PubMed

    Omotajo, Damilola; Tate, Travis; Cho, Hyuk; Choudhary, Madhusudan

    2015-08-14

    Prokaryotic translation initiation involves the proper docking, anchoring, and accommodation of mRNA to the 30S ribosomal subunit. Three initiation factors (IF1, IF2, and IF3) and some ribosomal proteins mediate the assembly and activation of the translation initiation complex. Although the interaction between Shine-Dalgarno (SD) sequence and its complementary sequence in the 16S rRNA is important in initiation, some genes lacking an SD ribosome binding site (RBS) are still well expressed. The objective of this study is to examine the pattern of distribution and diversity of RBS in fully sequenced bacterial genomes. The following three hypotheses were tested: SD motifs are prevalent in bacterial genomes; all previously identified SD motifs are uniformly distributed across prokaryotes; and genes with specific cluster of orthologous gene (COG) functions differ in their use of SD motifs. Data for 2,458 bacterial genomes, previously generated by Prodigal (PROkaryotic DYnamic programming Gene-finding ALgorithm) and currently available at the National Center for Biotechnology Information (NCBI), were analyzed. Of the total genes examined, ~77.0% use an SD RBS, while ~23.0% have no RBS. Majority of the genes with the most common SD motifs are distributed in a manner that is representative of their abundance for each COG functional category, while motifs 13 (5'-GGA-3'/5'-GAG-3'/5'-AGG-3') and 27 (5'-AGGAGG-3') appear to be predominantly used by genes for information storage and processing, and translation and ribosome biogenesis, respectively. These findings suggest that an SD sequence is not obligatory for translation initiation; instead, other signals, such as the RBS spacer, may have an overarching influence on translation of mRNAs. Subsequent analyses of the 5' secondary structure of these mRNAs may provide further insight into the translation initiation mechanism.

  5. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging

    PubMed Central

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-01-01

    The 5′ untranslated region (5′ UTR) of HIV-1 genomic RNA (gRNA) includes structural elements that regulate reverse transcription, transcription, translation, tRNALys3 annealing to the gRNA, and gRNA dimerization and packaging into viruses. It has been reported that gRNA dimerization and packaging are regulated by changes in the conformation of the 5′-UTR RNA. In this study, we show that annealing of tRNALys3 or a DNA oligomer complementary to sequences within the primer binding site (PBS) loop of the 5′ UTR enhances its dimerization in vitro. Structural analysis of the 5′-UTR RNA using selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) shows that the annealing promotes a conformational change of the 5′ UTR that has been previously reported to favor gRNA dimerization and packaging into virus. The model predicted by SHAPE analysis is supported by antisense experiments designed to test which annealed sequences will promote or inhibit gRNA dimerization. Based on reports showing that the gRNA dimerization favors its incorporation into viruses, we tested the ability of a mutant gRNA unable to anneal to tRNALys3 to be incorporated into virions. We found a ∼60% decrease in mutant gRNA packaging compared with wild-type gRNA. Together, these data further support a model for viral assembly in which the initial annealing of tRNALys3 to gRNA is cytoplasmic, which in turn aids in the promotion of gRNA dimerization and its incorporation into virions. PMID:23960173

  6. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  7. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  8. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  9. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  10. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  11. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  12. The 5′-tail of antisense RNAII of pMV158 plays a critical role in binding to the target mRNA and in translation inhibition of repB

    PubMed Central

    López-Aguilar, Celeste; Romero-López, Cristina; Espinosa, Manuel; Berzal-Herranz, Alfredo; del Solar, Gloria

    2015-01-01

    Rolling-circle replication of streptococcal plasmid pMV158 is controlled by the concerted action of two trans-acting elements, namely transcriptional repressor CopG and antisense RNAII, which inhibit expression of the repB gene encoding the replication initiator protein. The pMV158-encoded antisense RNAII exerts its activity of replication control by inhibiting translation of the essential repB gene. RNAII is the smallest and simplest among the characterized antisense RNAs involved in control of plasmid replication. Structure analysis of RNAII revealed that it folds into an 8-bp-long stem containing a 1-nt bulge and closed by a 6-nt apical loop. This hairpin is flanked by a 17-nt-long single-stranded 5′-tail and an 8-nt-long 3′-terminal U-rich stretch. Here, the 3′ and 5′ regions of the 5′-tail of RNAII are shown to play a critical role in the binding to the target mRNA and in the inhibition of repB translation, respectively. In contrast, the apical loop of the single hairpin of RNAII plays a rather secondary role and the upper stem region hardly contributes to the binding or inhibition processes. The entire 5′-tail is required for efficient inhibition of repB translation, though only the 8-nt-long region adjacent to the hairpin seems to be essential for rapid binding to the mRNA. These results show that a “kissing” interaction involving base-pairing between complementary hairpin loops in RNAII and mRNA is not critical for efficient RNA/RNA binding or repB translation inhibition. A singular binding mechanism is envisaged whereby initial pairing between complementary single-stranded regions in the antisense and sense RNAs progresses upwards into the corresponding hairpin stems to form the intermolecular duplex. PMID:26175752

  13. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  14. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  15. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  16. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  17. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  18. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  19. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Top