Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

DOEpatents

Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

2003-10-21

Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Complementary-encoding holographic associative memory using a photorefractive crystal

NASA Astrophysics Data System (ADS)

Yuan, ShiFu; Wu, Minxian; Yan, Yingbai; Jin, Guofan

1996-06-01

We present a holographic implementation of accurate associative memory with only one holographic memory system. In the implementation, the stored and test images are coded by using complementary-encoding method. The recalled complete image is also a coded image that can be decoded with a decoding mask to get an original image or its complement image. The experiment shows that the complementary encoding can efficiently increase the addressing accuracy in a simple way. Instead of the above complementary-encoding method, a scheme that uses complementary area-encoding method is also proposed for the holographic implementation of gray-level image associative memory with accurate addressing.

Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2001-01-01

A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

PubMed

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target proteins and is likely to become a standard tool for pharmaceutical hit discovery, lead expansion, and Chemical Biology research. The introduction of new methodologies for library encoding and for compound synthesis in the presence of DNA is an exciting research field and will crucially contribute to the performance and the propagation of the technology.

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Screening unlabeled DNA targets with randomly ordered fiber-optic gene arrays.

PubMed

Steemers, F J; Ferguson, J A; Walt, D R

2000-01-01

We have developed a randomly ordered fiber-optic gene array for rapid, parallel detection of unlabeled DNA targets with surface immobilized molecular beacons (MB) that undergo a conformational change accompanied by a fluorescence change in the presence of a complementary DNA target. Microarrays are prepared by randomly distributing MB-functionalized 3-microm diameter microspheres in an array of wells etched in a 500-microm diameter optical imaging fiber. Using several MBs, each designed to recognize a different target, we demonstrate the selective detection of genomic cystic fibrosis related targets. Positional registration and fluorescence response monitoring of the microspheres was performed using an optical encoding scheme and an imaging fluorescence microscope system.

Research on Image Encryption Based on DNA Sequence and Chaos Theory

NASA Astrophysics Data System (ADS)

Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

2018-04-01

Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

PubMed

Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

2017-05-08

In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

PubMed

Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

2017-06-25

Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

Method of artificial DNA splicing by directed ligation (SDL).

PubMed Central

Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA

1991-01-01

An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

PubMed

Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

2008-12-01

Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

The effect of antimicrobial photodynamic therapy on the expression of novel methicillin resistance markers determined using cDNA-AFLP approach in Staphylococcus aureus.

PubMed

Hoorijani, Mohammad Neshvan; Rostami, Hosein; Pourhajibagher, Maryam; Chiniforush, Nasim; Heidari, Mansour; Pourakbari, Babak; Kazemian, Hossein; Davari, Kambiz; Amini, Vahid; Raoofian, Reza; Bahador, Abbas

2017-09-01

Widespread methicillin resistant Staphylococcus aureus (MRSA) and absence of effective antimicrobial agents has led to limited therapeutic options for treating MRSA infection. We aimed to evaluate the effect of antimicrobial photodynamic therapy (aPDT) on the expression of novel identified methicillin resistance markers (NIMRMs) in S. aureus using complementary DNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) approaches to address the therapeutic alternatives for MRSA infections. We used cDNA-AFLP to compare MRSA and methicillin susceptible S. aureus (MSSA) for identification of target genes implicated in methicillin resistance. To determine the sub-lethal aPDT (sPDT), MRSA and MSSA clinical isolates photosensitized with toluidine blue O (TBO), and then were irradiated with diode laser. After sPDT, the colony forming units/mL was quantified. Antimicrobial susceptibility against methicillin was assessed for cell-surviving aPDT. Effects of sPDT on the expression of NIMRMs were evaluated by real-time quantitative reverse transcription PCR. According to our results, serine hydrolase family protein (Shfp) encoding gene and a gene encoding a conserved hypothetical protein (Chp) were implicated in methicillin resistance in MRSA. sPDT reduced the minimum inhibitory concentrations of methicillin by 3-fold in MRSA. sPDT could lead to about 10- and 6.2- fold suppression of expression of the Chp and Shfp encoding genes, respectively. sPDT would lead to reduction in resistance to methicillin of MRSA in surviving cells by suppressing the expression of the Shfp and Chp encoding genes associated with methicillin resistance. This may have potential implications of aPDT for the treatment of MRSA infections. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

PubMed

Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

2018-01-01

Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

DNA-programmable multiplexing for scalable, renewable redox protein bio-nanoelectronics.

PubMed

Withey, Gary D; Kim, Jin Ho; Xu, Jimmy

2008-11-01

A universal, site-addressable DNA linking strategy is deployed for the programmable assembly of multifunctional, long-lasting redox protein nanoelectronic devices. This addressable linker, the first incorporated into a redox enzyme-nanoelectronic system, promotes versatility and renewability by allowing the reconfiguration and replacement of enzymes at will. The linker is transferable to all redox proteins due to the simple conjugation chemistry involved. The efficacy of this linking strategy is assessed using two model enzymes, glucose oxidase (GOx) and alcohol dehydrogenase (ADH), self-assembled onto separate nanoelectrode regions comprised of a highly ordered carbon nanotube (CNT) array. The sequence-specificity of DNA hybridization provides the means of encoding spatial address to the self-assembling process that conjugates enzymes tagged with single-stranded DNA (ssDNA) to the tips of designated CNTs functionalized with the complementary strands. In this study, we demonstrate the feasibility of multiplexed, scalable, reconfigurable and renewable transduction of redox protein signals by virtue of DNA addressing.

Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

PubMed

Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

2008-11-04

We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

DOEpatents

Croteau, Rodney Bruce; Crock, John E.

2005-01-25

A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

Identification and molecular characterization of a novel circular single-stranded DNA virus associated with yerba mate in Argentina.

PubMed

Bejerman, Nicolás; de Breuil, Soledad; Nome, Claudia

2018-06-06

A single-stranded DNA (ssDNA) virus was detected in Yerba mate samples showing chlorotic linear patterns, chlorotic rings and vein yellowing. The full-genome sequences of six different isolates of this ssDNA circular virus were obtained, which share > 99% sequence identity with each other. The newly identified virus has been tentatively named as yerba mate-associated circular DNA virus (YMaCV). The 2707 nt-long viral genome has two and three open reading frame on its complementary and virion-sense strands, respectively. The coat protein is more similar to that of mastreviruses (44% identity), whereas the replication-associated protein of YMaCV is more similar (49% identity) to that encoded by a recently described, unclassified ssDNA virus isolated on trees in Brazil. This is the first report of a circular DNA virus associated with yerba mate. Its unique genome organization and phylogenetic relationships indicates that YMaCV represents a distinct evolutionary lineage within the ssDNA viruses and therefore this virus should be classified as a member of a new species within an unassigned genus or family.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Localization of Action of the Is50-Encoded Transposase Protein

PubMed Central

Phadnis, Suhas H.; Sasakawa, Chihiro; Berg, Douglas E.

1986-01-01

The movement of the bacterial insertion sequence IS50 and of composite elements containing direct terminal repeats of IS50 involves the two ends of IS50, designated O (outside) and I (inside), which are weakly matched in DNA sequence, and an IS50 encoded protein, transposase, which recognizes the O and I ends and acts preferentially in cis. Previous data had suggested that, initially, transposase interacts preferentially with the O end sequence and then, in a second step, with either an O or an I end. To better understand the cis action of transposase and how IS50 ends are selected, we generated a series of composite transposons which contain direct repeats of IS50 elements. In each transposon, one IS50 element encoded transposase (tnp +), and the other contained a null (tnp-) allele. In each of the five sets of composite transposons studied, the transposon for which the tnp+ IS50 element contained its O end was more active than a complementary transposon for which the tnp - IS50 element contained its O end. This pattern of O end use suggests models in which the cis action of transposase and its choice of ends is determined by protein tracking along DNA molecules. PMID:3007274

Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

PubMed Central

Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

2014-01-01

The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

1999-01-01

A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

Functional metagenomics to mine the human gut microbiome for dietary fiber catabolic enzymes.

PubMed

Tasse, Lena; Bercovici, Juliette; Pizzut-Serin, Sandra; Robe, Patrick; Tap, Julien; Klopp, Christophe; Cantarel, Brandi L; Coutinho, Pedro M; Henrissat, Bernard; Leclerc, Marion; Doré, Joël; Monsan, Pierre; Remaud-Simeon, Magali; Potocki-Veronese, Gabrielle

2010-11-01

The human gut microbiome is a complex ecosystem composed mainly of uncultured bacteria. It plays an essential role in the catabolism of dietary fibers, the part of plant material in our diet that is not metabolized in the upper digestive tract, because the human genome does not encode adequate carbohydrate active enzymes (CAZymes). We describe a multi-step functionally based approach to guide the in-depth pyrosequencing of specific regions of the human gut metagenome encoding the CAZymes involved in dietary fiber breakdown. High-throughput functional screens were first applied to a library covering 5.4 × 10(9) bp of metagenomic DNA, allowing the isolation of 310 clones showing beta-glucanase, hemicellulase, galactanase, amylase, or pectinase activities. Based on the results of refined secondary screens, sequencing efforts were reduced to 0.84 Mb of nonredundant metagenomic DNA, corresponding to 26 clones that were particularly efficient for the degradation of raw plant polysaccharides. Seventy-three CAZymes from 35 different families were discovered. This corresponds to a fivefold target-gene enrichment compared to random sequencing of the human gut metagenome. Thirty-three of these CAZy encoding genes are highly homologous to prevalent genes found in the gut microbiome of at least 20 individuals for whose metagenomic data are available. Moreover, 18 multigenic clusters encoding complementary enzyme activities for plant cell wall degradation were also identified. Gene taxonomic assignment is consistent with horizontal gene transfer events in dominant gut species and provides new insights into the human gut functional trophic chain.

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Theory and modeling of particles with DNA-mediated interactions

NASA Astrophysics Data System (ADS)

Licata, Nicholas A.

2008-05-01

In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

Cytochrome P450 1C1 complementary DNA cloning, sequence analysis and constitutive expression induced by benzo-a-pyrene in Nile tilapia (Oreochromis niloticus).

PubMed

Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao

2012-03-01

CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.

Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications.

PubMed

Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip

2011-08-01

The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.

RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1992-01-01

The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

NASA Astrophysics Data System (ADS)

Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

2013-10-01

We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate. Electronic supplementary information (ESI) available: Details on the synthesis, purification and characterisation of the DHLA-PEG600-N3, cyclooctyne-DNA, and QD-TBA20 conjugates as well as all supporting figures and tables. See DOI: 10.1039/c3nr02897f

Molecular cloning and functional characterization of a glucose transporter (CsGLUT) in Clonorchis sinensis.

PubMed

Ahn, Seong Kyu; Cho, Pyo Yun; Na, Byoung-Kuk; Hong, Sung-Jong; Nam, Ho-Woo; Sohn, Woon-Mok; Ardelli, Bernadette F; Park, Yun-Kyu; Kim, Tong-Soo; Cha, Seok Ho

2016-01-01

A complementary DNA (cDNA) encoding a glucose transporter of Clonorchis sinensis (CsGLUT) was isolated from the adult C. sinensis cDNA library. The open reading frame of CsGLUT cDNA consists of 1653 base pairs that encode a 550-amino acid residue protein. Hydropathy analysis suggested that CsGLUT possess 12 putative membrane-spanning domains. The Northern blot analysis result using poly(A)(+)RNA showed a strong band at ~2.1 kb for CsGLUT. When expressed in Xenopus oocytes, CsGLUT mediated the transport of radiolabeled deoxy-D-glucose in a time-dependent but sodium-independent manner. Concentration-dependency results showed saturable kinetics and followed the Michaelis-Menten equation. Nonlinear regression analyses yielded a Km value of 588.5 ± 53.0 μM and a Vmax value of 1500.0 ± 67.5 pmol/oocyte/30 min for [1,2-(3)H]2-deoxy-D-glucose. No trans-uptakes of bile acid (taurocholic acid), amino acids (tryptophan and arginine), or p-aminohippuric acid were observed. CsGLUT-mediated transport of deoxyglucose was significantly and concentration-dependently inhibited by radio-unlabeled deoxyglucose and D-glucose. 3-O-Methylglucose at 10 and 100 μM inhibited deoxyglucose uptake by ~50 % without concentration dependence. No inhibitory effects by galactose, mannose, and fructose were observed. This work may contribute to the molecular biological study of carbohydrate metabolism and new drug development of C. sinensis.

Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

PubMed Central

Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

2012-01-01

DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

Novel encoding methods for DNA-templated chemical libraries.

PubMed

Li, Gang; Zheng, Wenlu; Liu, Ying; Li, Xiaoyu

2015-06-01

Among various types of DNA-encoded chemical libraries, DNA-templated library takes advantage of the sequence-specificity of DNA hybridization, enabling not only highly effective DNA-templated chemical reactions, but also high fidelity in library encoding. This brief review summarizes recent advances that have been made on the encoding strategies for DNA-templated libraries, and it also highlights their respective advantages and limitations for the preparation of DNA-encoded libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.

An internalin a probe-based genosensor for Listeria monocytogenes detection and differentiation.

PubMed

Bifulco, Laura; Ingianni, Angela; Pompei, Raffaello

2013-01-01

Internalin A (InlA), a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide) on the surfaces of screen-printed gold electrodes (Au-SPEs) by means of a mercaptan-activated self-assembled monolayer (SAM). The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV) using methylene blue (MB) as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV) upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

PubMed

Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

2015-04-01

Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

PubMed

Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

2015-03-01

Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease*

PubMed Central

Rogacheva, Maria V.; Manhart, Carol M.; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

2014-01-01

Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair. PMID:24403070

Mlh1-Mlh3, a meiotic crossover and DNA mismatch repair factor, is a Msh2-Msh3-stimulated endonuclease.

PubMed

Rogacheva, Maria V; Manhart, Carol M; Chen, Cheng; Guarne, Alba; Surtees, Jennifer; Alani, Eric

2014-02-28

Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair.

The cloning, characterization, and functional analysis of a gene encoding an isopentenyl diphosphate isomerase involved in triterpene biosynthesis in the Lingzhi or reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

PubMed

Wu, Feng-Li; Shi, Liang; Yao, Jian; Ren, Ang; Zhou, Chao; Mu, Da-Shuai; Zhao, Ming-Wen

2013-01-01

An isopentenyl diphosphate isomerase (IDI) gene, GlIDI, was isolated from Ganoderma lucidum, which produces triterpenes through the mevalonate pathway. The open reading frame of GlIDI encodes a 252 amino acid polypeptide with a theoretical molecular mass of 28.71 kDa and a theoretical isoelectric point of 5.36. GlIDI is highly homologous to other fungal IDIs and contains conserved active residues and nudix motifs shared by the IDI protein family. The color complementation assay indicated that GlIDI can accelerate the accumulation of β-carotene and confirmed that the cloned complementary DNA encoded a functional GlIDI protein. Gene expression analysis showed that the GlIDI transcription level was relatively low in the mycelia and reached a relatively high level in the mushroom primordia. In addition, its expression level could be up-regulated by 254 µM methyl jasmonate. Our results suggest that this enzyme may play an important role in triterpene biosynthesis.

Genome-Wide DNA Methylation Profiling Reveals Epigenetic Adaptation of Stickleback to Marine and Freshwater Conditions.

PubMed

Artemov, Artem V; Mugue, Nikolai S; Rastorguev, Sergey M; Zhenilo, Svetlana; Mazur, Alexander M; Tsygankova, Svetlana V; Boulygina, Eugenia S; Kaplun, Daria; Nedoluzhko, Artem V; Medvedeva, Yulia A; Prokhortchouk, Egor B

2017-09-01

The three-spined stickleback (Gasterosteus aculeatus) represents a convenient model to study microevolution-adaptation to a freshwater environment. Although genetic adaptations to freshwater environments are well-studied, epigenetic adaptations have attracted little attention. In this work, we investigated the role of DNA methylation in the adaptation of the marine stickleback population to freshwater conditions. DNA methylation profiling was performed in marine and freshwater populations of sticklebacks, as well as in marine sticklebacks placed into a freshwater environment and freshwater sticklebacks placed into seawater. We showed that the DNA methylation profile after placing a marine stickleback into fresh water partially converged to that of a freshwater stickleback. For six genes including ATP4A ion pump and NELL1, believed to be involved in skeletal ossification, we demonstrated similar changes in DNA methylation in both evolutionary and short-term adaptation. This suggested that an immediate epigenetic response to freshwater conditions can be maintained in freshwater population. Interestingly, we observed enhanced epigenetic plasticity in freshwater sticklebacks that may serve as a compensatory regulatory mechanism for the lack of genetic variation in the freshwater population. For the first time, we demonstrated that genes encoding ion channels KCND3, CACNA1FB, and ATP4A were differentially methylated between the marine and the freshwater populations. Other genes encoding ion channels were previously reported to be under selection in freshwater populations. Nevertheless, the genes that harbor genetic and epigenetic changes were not the same, suggesting that epigenetic adaptation is a complementary mechanism to selection of genetic variants favorable for freshwater environment. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Functional cDNA expression cloning: Pushing it to the limit

PubMed Central

OKAYAMA, Hiroto

2012-01-01

The 1970s and the following decade are the era of the birth and early development of recombinant DNA technologies, which have entirely revolutionized the modern life science by providing tools that enable us to know the structures of genes and genomes and to dissect their components and understand their functions at the molecular and submolecular levels. One major objective of the life sciences is to achieve molecular and chemical understandings of the functions of genes and their encoded proteins, which are responsible for the manifestation of all biological phenomena in organisms. In the early 1980s, I developed, together with Paul Berg, a new technique that enables the cloning of full-length complementary DNAs (cDNAs) on the basis of their functional expression in a given cell of interest. I review the development, application and future implications in the life sciences of this gene-cloning technique. PMID:22450538

Detection of anthrax lef with DNA-based photonic crystal sensors

NASA Astrophysics Data System (ADS)

Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong

2011-12-01

Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

PubMed

Giehr, Pascal; Walter, Jörn

2018-01-01

The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

DNA encoding a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-08-15

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

PubMed

Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

2017-01-11

We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Constitutively expressing cell lines that secrete a truncated bovine herpes virus-1 glycoprotein (gpI) stimulate T-lymphocyte responsiveness.

PubMed

Leary, T P; Gao, Y; Splitter, G A

1992-07-01

The desire to obtain authentically glycosylated viral protein products in sufficient quantity for immunological study has led to the use of eucaryotic expression vectors for protein production. An additional advantage is that these protein products can be studied individually in the absence of their native viral environment. We have cloned a complementary DNA (cDNA) encoding bovine herpes virus-1 (BHV-1) glycoprotein 1 (gpI) into the eucaryotic expression vector, pZipNeo SVX1. Since this protein is normally embedded within the membrane of BHV-1 infected cells, we removed sequences encoding the transmembrane domain of the native protein. After transfection of the plasmid construct into the canine osteosarcoma cell line, D17, or Madin-Darby bovine kidney (MDBK) cells, a truncated BHV-1 (gpI) was secreted into the culture medium as demonstrated by radioimmunoprecipitation and SDS-PAGE. Both a CD4+ T-lymphocyte line specific for BHV-1 and freshly isolated T lymphocytes could recognize and respond to the secreted recombinant gpI. Further, recombinant gpI could elicit both antibody and cellular responses in cattle when used as an immunogen. Having established constitutively glycoprotein producing cell lines, future studies in vaccine evaluation of gpI will be facilitated.

Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

PubMed

Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

2014-06-01

The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

PubMed Central

Lee, Alex H. F.; Kool, Eric T.

2008-01-01

A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

PubMed Central

Berns, K. I.; Rose, J. A.

1970-01-01

Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

Limnonectins: a new class of antimicrobial peptides from the skin secretion of the Fujian large-headed frog (Limnonectes fujianensis).

PubMed

Wu, Youjia; Wang, Lei; Zhou, Mei; Ma, Chengbang; Chen, Xiaole; Bai, Bing; Chen, Tianbao; Shaw, Chris

2011-06-01

Amphibian skin secretions are rich sources of biologically-active peptides with antimicrobial peptides predominating in many species. Several studies involving molecular cloning of biosynthetic precursor-encoding cDNAs from skin or skin secretions have revealed that these exhibit highly-conserved domain architectures with an unusually high degree of conserved nucleotide and resultant amino acid sequences within the signal peptides. This high degree of nucleotide sequence conservation has permitted the design of primers complementary to such sites facilitating "shotgun" cloning of skin or skin secretion-derived cDNA libraries from hitherto unstudied species. Here we have used such an approach using a skin secretion-derived cDNA library from an unstudied species of Chinese frog - the Fujian large-headed frog, Limnonectes fujianensis - and have discovered two 16-mer peptides of novel primary structures, named limnonectin-1Fa (SFPFFPPGICKRLKRC) and limnonectin-1Fb (SFHVFPPWMCKSLKKC), that represent the prototypes of a new class of amphibian skin antimicrobial peptide. Unusually these limnonectins display activity only against a Gram-negative bacterium (MICs of 35 and 70 μM) and are devoid of haemolytic activity at concentrations up to 160 μM. Thus the "shotgun" cloning approach described can exploit the unusually high degree of nucleotide conservation in signal peptide-encoding domains of amphibian defensive skin secretion peptide precursor-encoding cDNAs to rapidly expedite the discovery of novel and functional defensive peptides in a manner that circumvents specimen sacrifice without compromising robustness of data. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

PubMed

Pang, Jie; Zhang, Ziping; Jin, Haizhu

2016-03-15

Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Edith E., E-mail: ed.mueller@salk.at; Mayr, Johannes A., E-mail: h.mayr@salk.at; Zimmermann, Franz A., E-mail: f.zimmermann@salk.at

2012-01-20

Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complexmore » II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.« less

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

PubMed

Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

2012-09-15

A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

NASA Astrophysics Data System (ADS)

Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

2013-03-01

We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

Monoterpene synthases from common sage (Salvia officinalis)

DOEpatents

Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan

1999-01-01

cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

Molecular identification, immunolocalization, and characterization of Clonorchis sinensis triosephosphate isomerase.

PubMed

Zhou, Juanjuan; Liao, Hua; Li, Shan; Zhou, Chenhui; Huang, Yan; Li, Xuerong; Liang, Chi; Yu, Xinbing

2015-08-01

Clonorchis sinensis triosephosphate isomerase (CsTIM) is a key regulatory enzyme of glycolysis and gluconeogenesis, which catalyzes the interconversion of glyceraldehyde 3-phosphate to dihydroxyacetone phosphate. In this study, the biochemical characterizations of CsTIM have been examined. A full-length complementary DNA (cDNA; Cs105350) sequence encoding CsTIM was obtained from our C. sinensis cDNA library. The open reading frame of CsTIM contains 759 bp which encodes 252 amino acids. The amino acid sequence of CsTIM shares 60-65% identity with other species. Western blot analysis displayed that recombinant CsTIM (rCsTIM) can be probed by anti-rCsTIM rat serum and anti-C. sinensis excretory/secretory products (anti-CsESPs) rat serum. Quantitative reverse transcription (RT)-PCR and western blotting analysis revealed that CsTIM messenger RNA (mRNA) and protein were differentially expressed in development cycle stages of the parasite, including adult worm, metacercaria, excysted metacercaria, and egg. In addition, immunolocalization assay showed that CsTIM was located in the seminal vesicle, eggs, and testicle. Moreover, rCsTIM exhibited active enzyme activity in catalytic reactions. The Michaelis constant (K m) of rCsTIM was 0.33 mM, when using glyceraldehyde 3-phosphate as the substrate. The optimal temperature and pH of CsTIM were 37 °C and 7.5-9.5, respectively. Collectively, these results suggest that CsTIM is an important protein involved in glycometabolism, and CsTIM possibly take part in many biological functions in the growth and development of C. sinensis.

Metabolic rescue in pluripotent cells from patients with mtDNA disease.

PubMed

Ma, Hong; Folmes, Clifford D L; Wu, Jun; Morey, Robert; Mora-Castilla, Sergio; Ocampo, Alejandro; Ma, Li; Poulton, Joanna; Wang, Xinjian; Ahmed, Riffat; Kang, Eunju; Lee, Yeonmi; Hayama, Tomonari; Li, Ying; Van Dyken, Crystal; Gutierrez, Nuria Marti; Tippner-Hedges, Rebecca; Koski, Amy; Mitalipov, Nargiz; Amato, Paula; Wolf, Don P; Huang, Taosheng; Terzic, Andre; Laurent, Louise C; Izpisua Belmonte, Juan Carlos; Mitalipov, Shoukhrat

2015-08-13

Mitochondria have a major role in energy production via oxidative phosphorylation, which is dependent on the expression of critical genes encoded by mitochondrial (mt)DNA. Mutations in mtDNA can cause fatal or severely debilitating disorders with limited treatment options. Clinical manifestations vary based on mutation type and heteroplasmy (that is, the relative levels of mutant and wild-type mtDNA within each cell). Here we generated genetically corrected pluripotent stem cells (PSCs) from patients with mtDNA disease. Multiple induced pluripotent stem (iPS) cell lines were derived from patients with common heteroplasmic mutations including 3243A>G, causing mitochondrial encephalomyopathy and stroke-like episodes (MELAS), and 8993T>G and 13513G>A, implicated in Leigh syndrome. Isogenic MELAS and Leigh syndrome iPS cell lines were generated containing exclusively wild-type or mutant mtDNA through spontaneous segregation of heteroplasmic mtDNA in proliferating fibroblasts. Furthermore, somatic cell nuclear transfer (SCNT) enabled replacement of mutant mtDNA from homoplasmic 8993T>G fibroblasts to generate corrected Leigh-NT1 PSCs. Although Leigh-NT1 PSCs contained donor oocyte wild-type mtDNA (human haplotype D4a) that differed from Leigh syndrome patient haplotype (F1a) at a total of 47 nucleotide sites, Leigh-NT1 cells displayed transcriptomic profiles similar to those in embryo-derived PSCs carrying wild-type mtDNA, indicative of normal nuclear-to-mitochondrial interactions. Moreover, genetically rescued patient PSCs displayed normal metabolic function compared to impaired oxygen consumption and ATP production observed in mutant cells. We conclude that both reprogramming approaches offer complementary strategies for derivation of PSCs containing exclusively wild-type mtDNA, through spontaneous segregation of heteroplasmic mtDNA in individual iPS cell lines or mitochondrial replacement by SCNT in homoplasmic mtDNA-based disease.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Interaction Analysis through Proteomic Phage Display

PubMed Central

2014-01-01

Phage display is a powerful technique for profiling specificities of peptide binding domains. The method is suited for the identification of high-affinity ligands with inhibitor potential when using highly diverse combinatorial peptide phage libraries. Such experiments further provide consensus motifs for genome-wide scanning of ligands of potential biological relevance. A complementary but considerably less explored approach is to display expression products of genomic DNA, cDNA, open reading frames (ORFs), or oligonucleotide libraries designed to encode defined regions of a target proteome on phage particles. One of the main applications of such proteomic libraries has been the elucidation of antibody epitopes. This review is focused on the use of proteomic phage display to uncover protein-protein interactions of potential relevance for cellular function. The method is particularly suited for the discovery of interactions between peptide binding domains and their targets. We discuss the largely unexplored potential of this method in the discovery of domain-motif interactions of potential biological relevance. PMID:25295249

Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

PubMed

Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

2014-10-09

A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

Recent advances on the encoding and selection methods of DNA-encoded chemical library.

PubMed

Shi, Bingbing; Zhou, Yu; Huang, Yiran; Zhang, Jianfu; Li, Xiaoyu

2017-02-01

DNA-encoded chemical library (DEL) has emerged as a powerful and versatile tool for ligand discovery in chemical biology research and in drug discovery. Encoding and selection methods are two of the most important technological aspects of DEL that can dictate the performance and utilities of DELs. In this digest, we have summarized recent advances on the encoding and selection strategies of DEL and also discussed the latest developments on DNA-encoded dynamic library, a new frontier in DEL research. Copyright © 2016 Elsevier Ltd. All rights reserved.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Sensitive detection of multiple pathogens using a single DNA probe.

PubMed

Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

2016-12-15

A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

Complementary DNA sequences of the constant regions of T-cell antigen receptors α, β and γ in mandarin fish, Siniperca chuatsi Basilewsky, and their transcriptional changes after stimulation with Flavobacterium columnare.

PubMed

Tian, J Y; Qi, Z T; Wu, N; Chang, M X; Nie, P

2014-02-01

In this study, the constant-region genes (Cα, Cβ and Cγ) that encode the T-cell antigen receptor (TCR) α, β and γ chains were cloned from mandarin fish, Siniperca chuatsi Basilewsky, an important freshwater fish species in China. The complementary DNA sequences of Cα, Cβ and Cγ were 843, 716 and 906 base pairs (bp) in length and had a 465-, 289- and 360-bp 3' untranslated region, encoding 125, 142 and 182 amino acids, respectively. The amino-acid sequences of the constant regions of mandarin fish TCR α, β and γ chains (encoded by Cα, Cβ and Cγ, respectively) were most similar to those of their teleost counterparts, showing 60% similarity with pufferfish, 48% similarity with Atlantic salmon and 57% similarity with flounder, respectively. The phylogenetic analysis revealed that the mandarin fish Cα, Cβ and Cγ were clustered, respectively, with their vertebrate counterparts. The mandarin fish Cα, Cβ and Cγ could also be separated into four domains: immunoglobulin; connecting peptide (CP); transmembrane (TM); and cytoplasmic tail. Several conserved features in mammalian TCRs were also found in those of mandarin fish, such as a conserved cysteine residue in the CP domain of Cα, necessary for creating an interchain disulphide bond with the TCR β chain, and a conserved antigen receptor TM motif in Cα and Cβ. Meanwhile, transcripts of Cα, Cβ and Cγ were detectable in all examined organs, with a stronger signal observed in lymphoid organs. In addition, the temporal transcriptional changes for Cα and Cγ were investigated, 1, 2, 3, 4, 5, 6 and 8 weeks after stimulation with Flavobacterium columnare, in head kidney, spleen, blood, thymus, gill and intestine, using real-time polymerase chain reaction. The results demonstrated stimulation-dependent up-regulations in almost all tissues examined, which indicates that T cells may play important roles in preventing mandarin fish from bacterial invasion. In particular, apart from thymus, T cells were distributed mainly in gill and intestine, where striking up-regulation of Cγ was also observed. These results will facilitate functional studies of teleost TCRs and T cells. © 2013 John Wiley & Sons Ltd.

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

PubMed

Wang, S Y; Gudas, L J

1990-09-15

We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

DTIC Science & Technology

2008-01-01

C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

Complementation of a red-light-indifferent cyanobacterial mutant.

PubMed Central

Chiang, G G; Schaefer, M R; Grossman, A R

1992-01-01

Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of a novel circular DNA virus in pig feces

USDA-ARS?s Scientific Manuscript database

Metagenomic analysis of fecal samples collected from a swine with diarrhea detected sequences encoding a replicase (Rep) protein typically found in small circular Rep-encoding ssDNA (CRESS-DNA) viruses. The complete 3,062 nucleotide genome was generated and found to encode two bi-directionally trans...

First evidence of molecular characterization of rohu carp Sox2 gene being expressed in proliferating spermatogonial cells.

PubMed

Patra, Swagat Kumar; Chakrapani, Vemulawada; Panda, Rudra Prasanna; Mohapatra, Chinmayee; Jayasankar, Pallipuram; Barman, Hirak Kumar

2015-07-15

Because little is known about the function of Sox2 (Sry-related box-2) in teleosts, the objective of this study was to clone and characterize Sox2 complementary DNA (cDNA) from the testis of Indian major carp, Labeo rohita (rohu). The full-length cDNA contained an open reading frame of 936 nucleotides bearing the typical structural features. Phylogenetically, Sox2 of L rohita was most closely related to freshwater counterparts than marine water. The sequence information of cDNA and genomic DNA together revealed that the Sox2 gene is encoded by an uninterrupted exon. Furthermore, comparative mRNA expression profile in various organs including proliferating spermatogonial stem cells (SSCs) suggested about the participatory role of Sox2 during fish male germ cell development and maintenance of stem cells. In support, we have also provided evidence that Sox2 protein is indeed present in rohu SSCs by Western blot analysis. The evolutionarily conserved high-mobility group box domain indicated its possible involvement in common networking pathways for stem cell maintenance and pluripotency between mammals and nonmammals. Our findings could be the first step toward the use of Sox2 as a potential biomarker for proliferating SSCs and understanding the transcriptional regulatory network involved during male germ cell development and maintenance in fish species. Copyright © 2015 Elsevier Inc. All rights reserved.

A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

PubMed

Liu, Ziping; Su, Xingguang

2017-01-15

In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

Cross-regulatory protein-protein interactions between Hox and Pax transcription factors.

PubMed

Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L; Gehring, Walter J

2008-09-09

Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein-protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP-EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein-DNA and protein-RNA interactions; it is also involved in protein-protein interactions.

Cross-regulatory protein–protein interactions between Hox and Pax transcription factors

PubMed Central

Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L.; Gehring, Walter J.

2008-01-01

Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein–protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP–EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein–DNA and protein–RNA interactions; it is also involved in protein–protein interactions. PMID:18755899

Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

PubMed

Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

2014-06-01

Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

PubMed

Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

2005-01-01

Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

Gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein messenger RNAs as colonic carcinoma.

PubMed

Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B

1993-09-01

The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

PubMed

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

PubMed Central

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

PubMed

Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

2012-10-08

One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

PubMed

Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

2016-08-15

In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

PubMed

Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

2016-04-01

The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

Precursors of vertebrate peptide antibiotics dermaseptin b and adenoregulin have extensive sequence identities with precursors of opioid peptides dermorphin, dermenkephalin, and deltorphins.

PubMed

Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P

1994-07-08

The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family despite the fact that they encode end products having very different biological activities. These genes might contain a homologous export exon comprising the 5'-untranslated region, the 22-residue signal peptide, the 20-24-residue acidic spacer, and the basic pair Lys-Arg.

Isolation and characterisation of mRNA encoding the salmon- and chicken-II type gonadotrophin-releasing hormones in the teleost fish Rutilus rutilus (Cyprinidae).

PubMed

Penlington, M C; Williams, M A; Sumpter, J P; Rand-Weaver, M; Hoole, D; Arme, C

1997-12-01

The complementary DNAs (cDNA) encoding the [Trp7,Leu8]-gonadotrophin-releasing hormone (salmon-type GnRH; sGnRH:GeneBank accession no. u60667) and the [His5,Trp7,Tyr8]-GnRH (chicken-II-type GnRH; cGnRH-II: GeneBank accession no. u60668) precursor in the roach (Rutilus rutilus) were isolated and sequenced following reverse transcription and rapid amplification of cDNA ends (RACE). The sGnRH and cGnRH-II precursor cDNAs consisted of 439 and 628 bp, and included open reading frames of 282 and 255 bp respectively. The structures of the encoded peptides were the same as GnRHs previously identified in other vertebrates. The sGnRH and cGnRH-II precursor cDNAs, including the non-coding regions, had 88.6 and 79.9% identity respectively, to those identified in goldfish (Carassius auratus). However, significant similarity was not observed between the non-coding regions of the GnRH cDNAs of Cyprinidae and other fish. The presumed third exon, encoding partial sGnRH associated peptide (GAP) of roach, demonstrated significant nucleotide and amino acid similarity with the appropriate regions in the goldfish, but not with other species, and this may indicate functional differences of GAP between different families of fish. cGnRH-II precursor cDNAs from roach had relatively high nucleotide similarity across this GnRH variant. Cladistic analysis classified the sGnRH and cGnRH-II precursor cDNAs into three and two groups respectively. However, the divergence between nucleotide sequences within the sGnRH variant was greater than those encoding the cGnRH-II precursors. Consistent with the consensus developed from previous studies, Northern blot analysis demonstrated that expression of sGnRH and cGnRH-II was restricted to the olfactory bulbs and midbrain of roach respectively. This work forms the basis for further study on the mechanisms by which the tapeworm, Ligula intestinalis, interacts with the pituitary-gonadal axis of its fish host.

Implementation of digital image encryption algorithm using logistic function and DNA encoding

NASA Astrophysics Data System (ADS)

Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

2018-03-01

Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

Toward a Better Compression for DNA Sequences Using Huffman Encoding

PubMed Central

Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

2017-01-01

Abstract Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016). PMID:27960065

Toward a Better Compression for DNA Sequences Using Huffman Encoding.

PubMed

Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

2017-04-01

Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

Antibody specific for a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-07-11

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

PubMed

Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

2008-09-01

Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

DOEpatents

Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.

2001-01-01

cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

Molecular characterization of an α-N-acetylgalactosaminidase from Clonorchis sinensis.

PubMed

Lee, Myoung-Ro; Yoo, Won Gi; Kim, Yu-Jung; Kim, Dae-Won; Cho, Shin-Hyeong; Hwang, Kwang Yeon; Ju, Jung-Won; Lee, Won-Ja

2012-11-01

The α-N-acetylgalactosaminidase (α-NAGAL) is an exoglycosidase that selectively cleaves terminal α-linked N-acetylgalactosamines from a variety of sugar chains. A complementary DNA (cDNA) clone encoding a novel Clonorchis sinensis α-NAGAL (Cs-α-NAGAL) was identified in the expressed sequence tags database of the adult C. sinensis liver fluke. The complete coding sequence was 1,308 bp long and encoded a 436-residue protein. The selected glycosidase was manually curated as α-NAGAL (EC 3.2.1.49) based on a composite bioinformatics analysis including a search for orthologues, comparative structure modeling, and the generation of a phylogenetic tree. One orthologue of Cs-α-NAGAL was the Rattus norvegicus α-NAGAL (accession number: NP_001012120) that does not exist in C. sinensis. Cs-α-NAGAL belongs to the GH27 family and the GH-D clan. A phylogenetic analysis revealed that the GH27 family of Cs-α-NAGAL was distinct from GH31 and GH36 within the GH-D clan. The putative 3D structure of Cs-α-NAGAL was built using SWISS-MODEL with a Gallus gallus α-NAGAL template (PDB code 1ktb chain A); this model demonstrated the superimposition of a TIM barrel fold (α/β) structure and substrate binding pocket. Cs-α-NAGAL transcripts were detected in the adult worm and egg cDNA libraries of C. sinensis but not in the metacercaria. Recombinant Cs-α-NAGAL (rCs-α-NAGAL) was expressed in Escherichia coli, and the purified rCs-α-NAGAL was recognized specifically by the C. sinensis-infected human sera. This is the first report of an α-NAGAL protein in the Trematode class, suggesting that it is a potential diagnostic or vaccine candidate with strong antigenicity.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Mitochondrial-nuclear interactions and accelerated compensatory evolution: evidence from the primate cytochrome C oxidase complex.

PubMed

Osada, Naoki; Akashi, Hiroshi

2012-01-01

Accelerated rates of mitochondrial protein evolution have been proposed to reflect Darwinian coadaptation for efficient energy production for mammalian flight and brain activity. However, several features of mammalian mtDNA (absence of recombination, small effective population size, and high mutation rate) promote genome degradation through the accumulation of weakly deleterious mutations. Here, we present evidence for "compensatory" adaptive substitutions in nuclear DNA- (nDNA) encoded mitochondrial proteins to prevent fitness decline in primate mitochondrial protein complexes. We show that high mutation rate and small effective population size, key features of primate mitochondrial genomes, can accelerate compensatory adaptive evolution in nDNA-encoded genes. We combine phylogenetic information and the 3D structure of the cytochrome c oxidase (COX) complex to test for accelerated compensatory changes among interacting sites. Physical interactions among mtDNA- and nDNA-encoded components are critical in COX evolution; amino acids in close physical proximity in the 3D structure show a strong tendency for correlated evolution among lineages. Only nuclear-encoded components of COX show evidence for positive selection and adaptive nDNA-encoded changes tend to follow mtDNA-encoded amino acid changes at nearby sites in the 3D structure. This bias in the temporal order of substitutions supports compensatory weak selection as a major factor in accelerated primate COX evolution.

Methods to alter levels of a DNA repair protein

DOEpatents

Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

2006-10-17

An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality".

PubMed

Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James

2013-03-12

A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

DNA-encoded chemistry: enabling the deeper sampling of chemical space.

PubMed

Goodnow, Robert A; Dumelin, Christoph E; Keefe, Anthony D

2017-02-01

DNA-encoded chemical library technologies are increasingly being adopted in drug discovery for hit and lead generation. DNA-encoded chemistry enables the exploration of chemical spaces four to five orders of magnitude more deeply than is achievable by traditional high-throughput screening methods. Operation of this technology requires developing a range of capabilities including aqueous synthetic chemistry, building block acquisition, oligonucleotide conjugation, large-scale molecular biological transformations, selection methodologies, PCR, sequencing, sequence data analysis and the analysis of large chemistry spaces. This Review provides an overview of the development and applications of DNA-encoded chemistry, highlighting the challenges and future directions for the use of this technology.

Solving traveling salesman problems with DNA molecules encoding numerical values.

PubMed

Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

2004-12-01

We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

PubMed

Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

2014-10-17

Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

Design and Synthesis of Biaryl DNA-Encoded Libraries.

PubMed

Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

2016-10-10

DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

PubMed

Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

2016-01-15

In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

Optimized Reaction Conditions for Amide Bond Formation in DNA-Encoded Combinatorial Libraries.

PubMed

Li, Yizhou; Gabriele, Elena; Samain, Florent; Favalli, Nicholas; Sladojevich, Filippo; Scheuermann, Jörg; Neri, Dario

2016-08-08

DNA-encoded combinatorial libraries are increasingly being used as tools for the discovery of small organic binding molecules to proteins of biological or pharmaceutical interest. In the majority of cases, synthetic procedures for the formation of DNA-encoded combinatorial libraries incorporate at least one step of amide bond formation between amino-modified DNA and a carboxylic acid. We investigated reaction conditions and established a methodology by using 1-ethyl-3-(3-(dimethylamino)propyl)carbodiimide, 1-hydroxy-7-azabenzotriazole and N,N'-diisopropylethylamine (EDC/HOAt/DIPEA) in combination, which provided conversions greater than 75% for 423/543 (78%) of the carboxylic acids tested. These reaction conditions were efficient with a variety of primary and secondary amines, as well as with various types of amino-modified oligonucleotides. The reaction conditions, which also worked efficiently over a broad range of DNA concentrations and reaction scales, should facilitate the synthesis of novel DNA-encoded combinatorial libraries.

Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

PubMed

Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

2018-01-01

We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

NASA Astrophysics Data System (ADS)

Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

2013-03-01

We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

PubMed Central

Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

2012-01-01

In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

Assembly of Francisella novicida Cpf1 endonuclease in complex with guide RNA and target DNA

PubMed Central

Montoya, Guillermo; Stella, Stefano

2017-01-01

Bacteria and archaea use the CRISPR–Cas system as an adaptive response against infection by foreign nucleic acids. Owing to its remarkable flexibility, this mechanism has been harnessed and adopted as a powerful tool for genome editing. The CRISPR–Cas system includes two classes that are subdivided into six types and 19 subtypes according to conservation of the cas gene and loci organization. Recently, a new protein with endonuclease activity belonging to class 2 type V has been identified. This endonuclease, termed Cpf1, in complex with a single CRISPR RNA (crRNA) is able to recognize and cleave a target DNA preceded by a 5′-TTN-3′ protospacer-adjacent motif (PAM) complementary to the RNA guide. To obtain structural insight into the inner workings of Cpf1, the crystallization of an active complex containing the full extent of the crRNA and a 31-nucleotide dsDNA target was attempted. The gene encoding Cpf1 from Francisella novicida was cloned, overexpressed and purified. The crRNA was transcribed and purified in vitro. Finally, the ternary FnCpf1–crRNA–DNA complex was assembled and purified by preparative electrophoresis before crystallization. Crystals belonging to space group C2221, with unit-cell parameters a = 85.2, b = 137.6, c = 320.5 Å, were obtained and subjected to preliminary diffraction experiments. PMID:28695850

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

Expression analysis of a novel pyridoxal kinase messenger RNA splice variant, PKL, in oil rape suffering abiotic stress and phytohormones.

PubMed

Yu, Shunwu; Luo, Lijun

2008-12-01

Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.

DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.

PubMed

Du, Huang-Chi; Huang, Hongbing

2017-10-18

DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.

Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

PubMed

Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

2011-08-01

Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

Single-Molecule Encoders for Tracking Motor Proteins on DNA

NASA Astrophysics Data System (ADS)

Lipman, Everett A.

2012-02-01

Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.

DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

PubMed

MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

2015-09-14

The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR make implementation of DESPS straightforward, and may prompt the chemistry community to revisit the synthesis of more complex and diverse libraries.

Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

NASA Astrophysics Data System (ADS)

Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

2018-05-01

In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

Variable word length encoder reduces TV bandwith requirements

NASA Technical Reports Server (NTRS)

Sivertson, W. E., Jr.

1965-01-01

Adaptive variable resolution encoding technique provides an adaptive compression pseudo-random noise signal processor for reducing television bandwidth requirements. Complementary processors are required in both the transmitting and receiving systems. The pretransmission processor is analog-to-digital, while the postreception processor is digital-to-analog.

DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1991-01-01

We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

PubMed

Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

2008-10-15

The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Down-regulation of increased TRAF6 expression in the peripheral mononuclear cells of patients with primary Sjögren's syndrome by an EBV-EBER1-specific synthetic single-stranded complementary DNA molecule.

PubMed

Sipka, Sándor; Zilahi, Erika; Papp, Gábor; Chen, Ji-Qing; Nagy, Andrea; Hegyi, Katalin; Kónya, József; Zeher, Margit

2017-05-01

We described earlier a simultaneously increased that the increased expression of miRNA-146a/b was accompanied by an increase in the expression of and TRAF6 and a decrease in the expression of IRAK1 genes in the peripheral mononuclear cells (PBMCs) of patients with primary Sjogren's syndrome (pSS) patients. Recently, the expression of EBV encoded. RNA (EBER) was published in the B cells of salivary glands of in pSS. In the present study, we applied an EBV-EBER1 specific synthetic single stranded complementary DNA molecule (EBV-EBER1-cDNA) to test whether any EBER1 related effect exists also in PBMCs of pSS patients. In the PBMCs of pSS patients and healthy controls, we investigated in vitro the effects of a synthetic single stranded EBV-EBER1-cDNA molecule, synthetic double-stranded (ds)RNA polyinosinic-polycytidylic acid [poly (I:C)] and polyadenylic acid potassium salt poly-adenylic acid [poly-(A)] on the expression of TRAF6 gene tested by qRTPCR. The release of interferon -α was detected by ELISA. EBV-EBER1-cDNA resulted in a significant reduction in the expression of TRAF6 in the cells of patients, but in the healthy controls not, whereas the treatments with poly (I:C) and poly-(A) could not reduce the TRAF6 over-expression. No release of EBER1 could be observed in the culture supernatants of patients with pSS. Only the treatment with poly (I:C) resulted in a significant increase of interferon -α release, and only in the heathy controls. No release of EBER1 molecules took place during the culturing of cells. EBV-EBER- cDNA acted functionally on the cells of patients only. These findings give a further evidence of the linkage between EBV and pSS, furthermore, they show the possible role of EBV-EBER1 in the induction of increased TRAF6 expression in the peripheral B cells of Sjögren's patients. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Design of a Sensitive and Selective Electrochemical Aptasensor for the Determination of the Complementary cDNA of miRNA-145 Based on the Intercalation and Electrochemical Reduction of Doxorubicin.

PubMed

Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

2017-11-01

The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.

Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

PubMed Central

Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

2010-01-01

The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

Functional studies of RYR1 mutations in the skeletal muscle ryanodine receptor using human RYR1 complementary DNA.

PubMed

Sato, Keisaku; Pollock, Neil; Stowell, Kathryn M

2010-06-01

Malignant hyperthermia is associated with mutations within the gene encoding the skeletal muscle ryanodine receptor, the calcium channel that releases Ca from sarcoplasmic reticulum stores triggering muscle contraction, and other metabolic activities. More than 200 variants have been identified in the ryanodine receptor, but only some of these have been shown to functionally affect the calcium channel. To implement genetic testing for malignant hyperthermia, variants must be shown to alter the function of the channel. A number of different ex vivo methods can be used to demonstrate functionality, as long as cells from human patients can be obtained and cultured from at least two unrelated families. Because malignant hyperthermia is an uncommon disorder and many variants seem to be private, including the newly identified H4833Y mutation, these approaches are limited. The authors cloned the human skeletal muscle ryanodine receptor complementary DNA and expressed both normal and mutated forms in HEK-293 cells and carried out functional analysis using ryanodine binding assays in the presence of a specific agonist, 4-chloro-m-cresol, and the antagonist Mg. Transiently expressed human ryanodine receptor proteins colocalized with an endoplasmic reticulum marker in HEK-293 cells. Ryanodine binding assays confirmed that mutations causing malignant hyperthermia resulted in a hypersensitive channel, while those causing central core disease resulted in a hyposensitive channel. The functional assays validate recombinant human skeletal muscle ryanodine receptor for analysis of variants and add an additional mutation (H4833Y) to the repertoire of mutations that can be used for the genetic diagnosis of malignant hyperthermia.

What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

NASA Astrophysics Data System (ADS)

Liebovitch, Larry

1998-03-01

The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

NASA Astrophysics Data System (ADS)

Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

2016-12-01

Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

DNA-Encoded Chemical Libraries: A Selection System Based on Endowing Organic Compounds with Amplifiable Information.

PubMed

Neri, Dario; Lerner, Richard A

2018-06-20

The discovery of organic ligands that bind specifically to proteins is a central problem in chemistry, biology, and the biomedical sciences. The encoding of individual organic molecules with distinctive DNA tags, serving as amplifiable identification bar codes, allows the construction and screening of combinatorial libraries of unprecedented size, thus facilitating the discovery of ligands to many different protein targets. Fundamentally, one links powers of genetics and chemical synthesis. After the initial description of DNA-encoded chemical libraries in 1992, several experimental embodiments of the technology have been reduced to practice. This review provides a historical account of important milestones in the development of DNA-encoded chemical libraries, a survey of relevant ongoing research activities, and a glimpse into the future.

Electrochemical biosensor for Mycobacterium tuberculosis DNA detection based on gold nanotubes array electrode platform.

PubMed

Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi

2016-04-15

The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.

Cloning and Characterization of Inducible Nitric Oxide Synthase from Mouse Macrophages

NASA Astrophysics Data System (ADS)

Xie, Qiao-Wen; Cho, Hearn J.; Calaycay, Jimmy; Mumford, Richard A.; Swiderek, Kristine M.; Lee, Terry D.; Ding, Aihao; Troso, Tiffany; Nathan, Carl

1992-04-01

Nitric oxide (NO) conveys a variety of messages between cells, including signals for vasorelaxation, neurotransmission, and cytotoxicity. In some endothelial cells and neurons, a constitutive NO synthase is activated transiently by agonists that elevate intracellular calcium concentrations and promote the binding of calmodulin. In contrast, in macrophages, NO synthase activity appears slowly after exposure of the cells to cytokines and bacterial products, is sustained, and functions independently of calcium and calmodulin. A monospecific antibody was used to clone complementary DNA that encoded two isoforms of NO synthase from immunologically activated mouse macrophages. Liquid chromatography-mass spectrometry was used to confirm most of the amino acid sequence. Macrophage NO synthase differs extensively from cerebellar NO synthase. The macrophage enzyme is immunologically induced at the transcriptional level and closely resembles the enzyme in cytokine-treated tumor cells and inflammatory neutrophils.

Effect of light chain V region duplication on IgG oligomerization and in vivo efficacy.

PubMed

Shuford, W; Raff, H V; Finley, J W; Esselstyn, J; Harris, L J

1991-05-03

A human immunoglobulin G1 (IgG1) antibody oligomer was isolated from a transfected myeloma cell line that produced a monoclonal antibody to group B streptococci. Compared to the IgG1 monomer, the oligomer was significantly more effective at protecting neonatal rats from infection in vivo. The oligomer was also shown to cross the placenta and to be stable in neonatal rats. Immunochemical analysis and complementary DNA sequencing showed that the transfected cell line produced two distinct kappa light chains: a normal light chain (Ln) with a molecular mass of 25 kilodaltons and a 37-kilodalton species (L37), the domain composition of which was variable-variable-constant (V-V-C). Cotransfection of vectors encoding the heavy chain and L37 resulted in production of oligomeric IgG.

The bipolar filaments formed by herpes simplex virus type 1 SSB/recombination protein (ICP8) suggest a mechanism for DNA annealing.

PubMed

Makhov, Alexander M; Sen, Anindito; Yu, Xiong; Simon, Martha N; Griffith, Jack D; Egelman, Edward H

2009-02-20

Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is approximately 250 A, with approximately 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing approximately 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makhov, A.M.; Simon, M.; Sen, A.

2009-02-20

Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments ismore » {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.« less

Maintenance and integrity of the mitochondrial genome: a plethora of nuclear genes in the budding yeast.

PubMed

Contamine, V; Picard, M

2000-06-01

Instability of the mitochondrial genome (mtDNA) is a general problem from yeasts to humans. However, its genetic control is not well documented except in the yeast Saccharomyces cerevisiae. From the discovery, 50 years ago, of the petite mutants by Ephrussi and his coworkers, it has been shown that more than 100 nuclear genes directly or indirectly influence the fate of the rho(+) mtDNA. It is not surprising that mutations in genes involved in mtDNA metabolism (replication, repair, and recombination) can cause a complete loss of mtDNA (rho(0) petites) and/or lead to truncated forms (rho(-)) of this genome. However, most loss-of-function mutations which increase yeast mtDNA instability act indirectly: they lie in genes controlling functions as diverse as mitochondrial translation, ATP synthase, iron homeostasis, fatty acid metabolism, mitochondrial morphology, and so on. In a few cases it has been shown that gene overexpression increases the levels of petite mutants. Mutations in other genes are lethal in the absence of a functional mtDNA and thus convert this petite-positive yeast into a petite-negative form: petite cells cannot be recovered in these genetic contexts. Most of the data are explained if one assumes that the maintenance of the rho(+) genome depends on a centromere-like structure dispensable for the maintenance of rho(-) mtDNA and/or the function of mitochondrially encoded ATP synthase subunits, especially ATP6. In fact, the real challenge for the next 50 years will be to assemble the pieces of this puzzle by using yeast and to use complementary models, especially in strict aerobes.

Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

PubMed

Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

2011-07-21

Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

PubMed

Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

2016-08-01

Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Nucleic acids encoding human trithorax protein

DOEpatents

Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline

2001-01-01

In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

A phosphate transporter from the mycorrhizal fungus Glomus versiforme.

PubMed

Harrison, M J; van Buuren, M L

1995-12-07

Vesicular-arbuscular (VA) mycorrhizal fungi form symbiotic associations with the roots of most terrestrial plants, including many agriculturally important crop species. The fungi colonize the cortex of the root to obtain carbon from their plant host, while assisting the plant with the uptake of phosphate and other mineral nutrients from the soil. This association is beneficial to the plant, because phosphate is essential for plant growth and development, especially during growth under nutrient-limiting conditions. Molecular genetic studies of these fungi and their interaction with plants have been limited owing to the obligate symbiotic nature of the VA fungi, so the molecular mechanisms underlying fungal-mediated uptake and translocation of phosphate from the soil to the plant remain unknown. Here we begin to investigate this process by identifying a complementary DNA that encodes a transmembrane phosphate transporter (GvPT) from Glomus versiforme, a VA mycorrhizal fungus. The function of the protein encoded by GvPT was confirmed by complementation of a yeast phosphate transport mutant. Expression of GvPT was localized to the external hyphae of G. versiforme during mycorrhizal associations, these being the initial site of phosphate uptake from the soil.

Novel selection methods for DNA-encoded chemical libraries

PubMed Central

Chan, Alix I.; McGregor, Lynn M.; Liu, David R.

2015-01-01

Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. PMID:25723146

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

PubMed Central

Odelberg, S J; Weiss, R B; Hata, A; White, R

1995-01-01

Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

PubMed

Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

2016-01-07

Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

Understanding Our Understanding of Strategic Scenarios: What Role Do Chunks Play?

ERIC Educational Resources Information Center

Linhares, Alexandre; Brum, Paulo

2007-01-01

There is a crucial debate concerning the nature of chess chunks: One current possibility states that chunks are built by encoding particular combinations of pieces-on-squares (POSs), and that chunks are formed mostly by "close" pieces (in a "Euclidean" sense). A complementary hypothesis is that chunks are encoded by abstract,…

Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

PubMed Central

2015-01-01

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

Yeast Pif1 accelerates annealing of complementary DNA strands.

PubMed

Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

2014-12-09

Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

Novel selection methods for DNA-encoded chemical libraries.

PubMed

Chan, Alix I; McGregor, Lynn M; Liu, David R

2015-06-01

Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.

High-density, microsphere-based fiber optic DNA microarrays.

PubMed

Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

2003-05-01

A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

PubMed

Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

2016-12-15

A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Continuous expression in tobacco leaves of a Brassica napus PEND homologue blocks differentiation of plastids and development of palisade cells.

PubMed

Wycliffe, Paul; Sitbon, Folke; Wernersson, Jonny; Ezcurra, Inés; Ellerström, Mats; Rask, Lars

2005-10-01

Brassica napus complementary deoxyribonucleic acid (cDNA) clones encoding a DNA-binding protein, BnPEND, were isolated by Southwestern screening. A distinctive feature of the protein was a bZIP-like sequence in the amino-terminal portion, which, after expression in Escherichia coli, bound DNA. BnPEND transcripts were present in B. napus roots and flower buds, and to a lesser extent in stems, flowers and young leaves. Treatment in the dark for 72 h markedly increased the amount of BnPEND transcript in leaves of all ages. Sequence comparison showed that BnPEND was similar to a presumed transcription factor from B. napus, GSBF1, a protein deduced from an Arabidopsis thaliana cDNA (BX825084) and the PEND protein from Pisum sativum, believed to anchor the plastid DNA to the envelope early during plastid development. Homology to expressed sequence tag (EST) sequences from additional species suggested that BnPEND homologues are widespread among the angiosperms. Transient expression of BnPEND fused with green fluorescent protein (GFP) in Nicotiana benthamiana epidermal cells showed that BnPEND is a plastid protein, and that the 15 amino acids at the amino-terminal contain information about plastid targeting. Expression of BnPEND in Nicotiana tabacum from the Cauliflower Mosaic Virus 35S promoter gave stable transformants with different extents of white to light-green areas in the leaves, and even albino plants. In the white areas, but not in adjacent green tissue, the development of palisade cells and chloroplasts was disrupted. Our data demonstrate that the BnPEND protein, when over-expressed at an inappropriate stage, functionally blocks the development of plastids and leads to altered leaf anatomy, possibly by preventing the release of plastid DNA from the envelope.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

The bipolar filaments formed by Herpes simplex virus type 1 SSB/recombination protein (ICP8) suggest a mechanism for DNA annealing

PubMed Central

Makhov, Alexander M.; Sen, Anindito; Yu, Xiong; Simon, Martha N.; Griffith, Jack D.; Egelman, Edward H.

2009-01-01

Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single strand binding protein and recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic (EM) studies showed that ICP8 will form long left-handed helical filaments. Here EM image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using Scanning Transmission Electron Microscopy. The pitch of the filaments is ~ 250 Å, with ~ 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing ~ 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA, based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary single stranded DNA into double-stranded DNA, where each strand runs in opposite directions. PMID:19138689

Functional characterization of two flap endonuclease-1 homologues in rice.

PubMed

Kimura, Seisuke; Furukawa, Tomoyuki; Kasai, Nobuyuki; Mori, Yoko; Kitamoto, Hiroko K; Sugawara, Fumio; Hashimoto, Junji; Sakaguchi, Kengo

2003-09-18

Flap endonuclease-1 (FEN-1) is an important enzyme involved in DNA replication and repair. Previously, we isolated and characterized a complementary DNA (cDNA) from rice (Oryza sativa) encoding a protein which shows homology with the eukaryotic flap endonuclease-1 (FEN-1). In this report, we found that rice (O. sativa L. cv. Nipponbare) possessed two FEN-1 homologues designated as OsFEN-1a and OsFEN-1b. The OsFEN-1a and OsFEN-1b genes were mapped to chromosome 5 and 3, respectively. Both genes contained 17 exons and 16 introns. Alignment of OsFEN-1a protein with OsFEN-1b protein showed a high degree of sequence similarity, particularly around the N and I domains. Northern hybridization and in situ hybridization analysis demonstrated preferential expression of OsFEN-1a and OsFEN-1b in proliferating tissues such as the shoot apical meristem or young leaves. The levels of OsFEN-1a and OsFEN-1b expression were significantly reduced when cell proliferation was temporarily halted by the removal of sucrose from the growth medium. When the growth-halted cells began to regrow following the addition of sucrose to the medium, both OsFEN-1a and OsFEN-1b were again expressed at high level. These results suggested that OsFEN-1a and OsFEN-1b are required for cell proliferation. Functional complementation assay suggested that OsFEN-1a cDNA had the ability to complement Saccharomyces cerevisiae rad27 null mutant. On the other hand, OsFEN-1b cDNA could not complement the rad27 mutant. The roles of OsFEN-1a and OsFEN-1b in plant DNA replication and repair are discussed.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Investigating the potential of multiwalled carbon nanotubes based zinc nanocomposite as a recognition interface towards plant pathogen detection.

PubMed

Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar

2017-11-01

The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Encoding of social signals in all three electrosensory pathways of Eigenmannia virescens.

PubMed

Stöckl, Anna; Sinz, Fabian; Benda, Jan; Grewe, Jan

2014-11-01

Extracting complementary features in parallel pathways is a widely used strategy for a robust representation of sensory signals. Weakly electric fish offer the rare opportunity to study complementary encoding of social signals in all of its electrosensory pathways. Electrosensory information is conveyed in three parallel pathways: two receptor types of the tuberous (active) system and one receptor type of the ampullary (passive) system. Modulations of the fish's own electric field are sensed by these receptors and used in navigation, prey detection, and communication. We studied the neuronal representation of electric communication signals (called chirps) in the ampullary and the two tuberous pathways of Eigenmannia virescens. We first characterized different kinds of chirps observed in behavioral experiments. Since Eigenmannia chirps simultaneously drive all three types of receptors, we studied their responses in in vivo electrophysiological recordings. Our results demonstrate that different electroreceptor types encode different aspects of the stimuli and each appears best suited to convey information about a certain chirp type. A decoding analysis of single neurons and small populations shows that this specialization leads to a complementary representation of information in the tuberous and ampullary receptors. This suggests that a potential readout mechanism should combine information provided by the parallel processing streams to improve chirp detectability. Copyright © 2014 the American Physiological Society.

Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

2014-09-03

A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

Identification of ADAM 31: a protein expressed in Leydig cells and specialized epithelia.

PubMed

Liu, L; Smith, J W

2000-06-01

A family of proteins containing a disintegrin and metalloproteinase domain (ADAMs) has been identified recently. Here, we report the identification of a novel member of the ADAM protein family from mouse. This protein is designated ADAM 31. The complementary DNA sequence of ADAM 31 predicts a transmembrane protein with metalloproteinase, disintegrin, cysteine-rich, and cytoplasmic domains. Messenger RNA encoding ADAM 31 was most abundant in testes, but was also detected in many other tissues. More significantly, the antibodies raised against ADAM 31 reveal that the protein has a unique and restricted expression pattern. ADAM 31 is expressed in Leydig cells of the testes, but unlike many other ADAMs, it is not found on developing sperm. Furthermore, ADAM 31 is highly expressed on four types of specialized epithelia: the cauda epididymidis, the vas deferens, the convoluted tubules of the kidney, and the parietal cells of the stomach.

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

RNA-programmed genome editing in human cells

PubMed Central

Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

2013-01-01

Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

Properties of an unusual DNA primase from an archaeal plasmid

PubMed Central

Beck, Kirsten; Lipps, Georg

2007-01-01

Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

PubMed

Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-01-01

To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

PubMed Central

2011-01-01

The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

Isolation and characterization of active LINE and SINEs from the eel.

PubMed

Kajikawa, Masaki; Ichiyanagi, Kenji; Tanaka, Nozomu; Okada, Norihiro

2005-03-01

Long interspersed elements (LINEs) and short interspersed elements (SINEs) are retrotransposons. These elements can mobilize by the "copy-and-paste" mechanism, in which their own RNA is reverse-transcribed into complementary DNA (cDNA). LINEs and SINEs not only are components of eukaryotic genomes but also drivers of genomic evolution. Thus, studies of the amplification mechanism of LINEs and SINEs are important for understanding eukaryotic genome evolution. Here we report the characterization of one LINE family (UnaL2) and two SINE families (UnaSINE1 and UnaSINE2) from the eel (Anguilla japonica) genome. UnaL2 is approximately 3.6 kilobases (kb) and encodes only one open reading frame (ORF). UnaL2 belongs to the stringent type--thought to be a major group of LINEs--and can mobilize in HeLa cells. We also show that UnaL2 and the two UnaSINEs have similar 3' tails, and that both UnaSINE1 and UnaSINE2 can be mobilized by UnaL2 in HeLa cells. These elements are thus useful for delineating the amplification mechanism of stringent type LINEs as well as that of SINEs.

Formation of template-switching artifacts by linear amplification.

PubMed

Chakravarti, Dhrubajyoti; Mailander, Paula C

2008-07-01

Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

PubMed

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

Transcriptome, expression, and activity analyses reveal a vital heat shock protein 70 in the stress response of stony coral Pocillopora damicornis.

PubMed

Zhang, Yidan; Zhou, Zhi; Wang, Lingui; Huang, Bo

2018-02-12

Coral bleaching occurs worldwide with increasing frequencies and intensities, which is caused by the stress response of stony coral to environmental change, especially increased sea surface temperature. In the present study, transcriptome, expression, and activity analyses were employed to illustrate the underlying molecular mechanisms of heat shock protein 70 (HSP70) in the stress response of coral to environmental changes. The domain analyses of assembled transcripts revealed 30 HSP70 gene contigs in stony coral Pocillopora damicornis. One crucial HSP70 (PdHSP70) was observed, whose expressions were induced by both elevated temperature and ammonium after expression difference analysis. The complete complementary DNA (cDNA) sequence of PdHSP70 was identified, which encoded a polypeptide of 650 amino acids with a molecular weight of 71.93 kDa. The deduced amino acid sequence of PdHSP70 contained a HSP70 domain (from Pro8 to Gly616), and it shared the highest similarity (95%) with HSP70 from Stylophora pistillata. The expression level of PdHSP70 gene increased significantly at 12 h, and returned to the initial level at 24 h after the stress of high temperature (32 °C). The cDNA fragment encoding the mature peptide of PdHSP70 was recombined and expressed in the prokaryotic expression system. The ATPase activity of recombinant PdHSP70 protein was determined, and it did not change significantly in a wide range of temperature from 25 to 40 °C. These results collectively suggested that PdHSP70 was a vital heat shock protein 70 in the stony coral P. damicornis, whose mRNA expression could be induced by diverse environmental stress and whose activity could remain stable under heat stress. PdHSP70 might be involved in the regulation of the bleaching owing to heat stress in the stony coral P. damicornis.

Identification of the Q969R gain-of-function polymorphism in the gene encoding porcine NLRP3 and its distribution in pigs of Asian and European origin.

PubMed

Tohno, Masanori; Shinkai, Hiroki; Toki, Daisuke; Okumura, Naohiko; Tajima, Kiyoshi; Uenishi, Hirohide

2016-10-01

The nucleotide-binding domain, leucine-rich-containing family, pyrin-domain containing-3 (NLRP3) inflammasome comprises the major components caspase-1, apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), and NLRP3. NLRP3 plays important roles in maintaining immune homeostasis mediated by intestinal microorganisms and in the immunostimulatory properties of vaccine adjuvants used to induce an immune response. In the present study, we first cloned a complementary DNA (cDNA) encoding porcine ASC because its genomic sequence was not completely determined. The availability of the ASC cDNA enabled us to reconstitute porcine NLRP3 inflammasomes using an in vitro system that led to the identification of the immune functions of porcine NLRP3 and ASC based on the production of interleukin-1β (IL-1β). Further, we identified six synonymous and six nonsynonymous single-nucleotide polymorphisms (SNPs) in the coding sequence of NLRP3 of six breeds of pigs, including major commercial breeds. Among the nonsynonymous SNPs, the Q969R polymorphism is associated with an increased release of IL-1β compared with other porcine NLRP3 variants, indicating that this polymorphism represents a gain-of-function mutation. This allele was detected in 100 % of the analyzed Chinese Jinhua and Japanese wild boars, suggesting that the allele is maintained in the major commercial native European breeds Landrace, Large White, and Berkshire. These findings represent an important contribution to our knowledge of the diversity of NLRP3 nucleotide sequences among various pig populations. Moreover, efforts to exploit the gain of function induced by the Q969R polymorphism promise to improve pig breeding and husbandry by conferring enhanced resistance to pathogens as well as contributing to vaccine efficacy.

Acetylcholinesterases of blood-feeding flies and ticks.

PubMed

Temeyer, Kevin B; Tuckow, Alexander P; Brake, Danett K; Li, Andrew Y; Pérez de León, Adalberto A

2013-03-25

Acetylcholinesterase (AChE) is the biochemical target of organophosphate (OP) and carbamate pesticides for invertebrates, vertebrate nerve agents, and AChE inhibitors used to reduce effects of Alzheimer's disease. Organophosphate pesticides (OPs) are widely used to control blood-feeding arthropods, including biting flies and ticks. However, resistance to OPs in pests affecting animal and human health has compromised control efficacy. OP resistance often results from mutations producing an OP-insensitive AChE. Our studies have demonstrated production of OP-insensitive AChEs in biting flies and ticks. Complementary DNA (cDNA) sequences encoding AChEs were obtained for the horn fly, stable fly, sand fly, and the southern cattle tick. The availability of cDNA sequences enables the identification of mutations, expression and characterization of recombinant proteins, gene silencing for functional studies, as well as in vitro screening of novel inhibitors. The southern cattle tick expresses at least three different genes encoding AChE in their synganglion, i.e. brain. Gene amplification for each of the three known cattle tick AChE genes and expression of multiple alleles for each gene may reduce fitness cost associated with OP-resistance. AChE hydrolyzes the neurotransmitter, acetylcholine, but may have additional roles in physiology and development. The three cattle tick AChEs possess significantly different biochemical properties, and are expressed in neural and non-neural tissues, which suggest separation of structure and function. The remarkable complexity of AChEs in ticks suggested by combining genomic data from Ixodes scapularis with our genetic and biochemical data from Rhipicephalus microplus is suggestive of previously unknown gene duplication and diversification. Comparative studies between invertebrate and vertebrate AChEs could enhance our understanding of structure-activity relationships. Research with ticks as a model system offers the opportunity to elucidate structure-activity relationships for AChE that are important for advances in targeted pest control, as well as potential applications for medicine and biosecurity. Published by Elsevier Ireland Ltd.

Multi-modulus algorithm based on global artificial fish swarm intelligent optimization of DNA encoding sequences.

PubMed

Guo, Y C; Wang, H; Wu, H P; Zhang, M Q

2015-12-21

Aimed to address the defects of the large mean square error (MSE), and the slow convergence speed in equalizing the multi-modulus signals of the constant modulus algorithm (CMA), a multi-modulus algorithm (MMA) based on global artificial fish swarm (GAFS) intelligent optimization of DNA encoding sequences (GAFS-DNA-MMA) was proposed. To improve the convergence rate and reduce the MSE, this proposed algorithm adopted an encoding method based on DNA nucleotide chains to provide a possible solution to the problem. Furthermore, the GAFS algorithm, with its fast convergence and global search ability, was used to find the best sequence. The real and imaginary parts of the initial optimal weight vector of MMA were obtained through DNA coding of the best sequence. The simulation results show that the proposed algorithm has a faster convergence speed and smaller MSE in comparison with the CMA, the MMA, and the AFS-DNA-MMA.

Storing data encoded DNA in living organisms

DOEpatents

Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

2006-06-06

Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

PubMed

Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

2013-01-01

Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

Characterisation of divergent flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil

PubMed Central

Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira

2013-01-01

Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302

Shark (Scyliorhinus torazame) metallothionein: cDNA cloning, genomic sequence, and expression analysis.

PubMed

Cho, Young Sun; Choi, Buyl Nim; Ha, En-Mi; Kim, Ki Hong; Kim, Sung Koo; Kim, Dong Soo; Nam, Yoon Kwon

2005-01-01

Novel metallothionein (MT) complementary DNA and genomic sequences were isolated from a cartilaginous shark species, Scyliorhinus torazame. The full-length open reading frame (ORF) of shark MT cDNA encoded 68 amino acids with a high cysteine content (29%). The genomic ORF sequence (932 bp) of shark MT isolated by polymerase chain reaction (PCR) comprised 3 exons with 2 interventing introns. Shark MT sequence shared many conserved features with other vertebrate MTs: overall amino acid identities of shark MT ranged from 47% to 57% with fish MTs, and 41% to 62% with mammalian MTs. However, in addition to these conserved characteristics, shark MT sequence exhibited some unique characteristics. It contained 4 extra amino acids (Lys-Ala-Gly-Arg) at the end of the beta-domain, which have not been reported in any other vertebrate MTs. The last amino acid residue at the C-terminus was Ser, which also has not been reported in fish and mammalian MTs. The MT messenger RNA levels in shark liver and kidney, assessed by semiquantitative reverse transcriptase PCR and RNA blot hybridization, were significantly affected by experimental exposures to heavy metals (cadmium, copper, and zinc). Generally, the transcriptional activation of shark MT gene was dependent on the dose (0-10 mg/kg body weight for injection and 0-20 microM for immersion) and duration (1-10 days); zinc was a more potent inducer than copper and cadmium.

Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

PubMed

Deng, Jiajia; Toh, Chee-Seng

2013-06-17

A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

Systemically administered gp100 encoding DNA vaccine for melanoma using water-in-oil-in-water multiple emulsion delivery systems.

PubMed

Kalariya, Mayurkumar; Amiji, Mansoor M

2013-09-10

The purpose of this study was to develop a water-in-oil-in-water (W/O/W) multiple emulsions-based vaccine delivery system for plasmid DNA encoding the gp100 peptide antigen for melanoma immunotherapy. The gp100 encoding plasmid DNA was encapsulated in the inner-most aqueous phase of squalane oil containing W/O/W multiple emulsions using a two-step emulsification method. In vitro transfection ability of the encapsulated plasmid DNA was investigated in murine dendritic cells by transgene expression analysis using fluorescence microscopy and ELISA methods. Prophylactic immunization using the W/O/W multiple emulsions encapsulated the gp100 encoding plasmid DNA vaccine significantly reduced tumor volume in C57BL/6 mice during subsequent B16-F10 tumor challenge. In addition, serum Th1 cytokine levels and immuno-histochemistry of excised tumor tissues indicated activation of cytotoxic T-lymphocytes mediated anti-tumor immunity causing tumor growth suppression. The W/O/W multiple emulsions-based vaccine delivery system efficiently delivers the gp100 plasmid DNA to induce cell-mediated anti-tumor immunity. Copyright © 2013 Elsevier B.V. All rights reserved.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Flower-like ZnO nanostructure based electrochemical DNA biosensor for bacterial meningitis detection.

PubMed

Tak, Manvi; Gupta, Vinay; Tomar, Monika

2014-09-15

Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.

A nanophosphor-based method for selective DNA recovery in Synthosomes.

PubMed

Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

2006-01-01

A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

Cloning and characteristics of fish glial fibrillary acidic protein: implications for optic nerve regeneration.

PubMed

Cohen, I; Shani, Y; Schwartz, M

1993-08-15

Mammalian central nervous system neurons do not regenerate after axonal injury, unlike their counterparts in fish and amphibians. After axonal injury, glial cells in mammals do not support regrowth of axons, while in fish they support the regeneration process. Controversy exists as to whether or not the intact fish optic nerve expresses glial fibrillary acidic protein, a well-known marker for mature astrocytes, and thus whether its astrocytes differ in this respect from those of the brain and spinal cord, as well as from optic nerve astrocytes of other species. In an attempt to resolve this question we cloned fish glial fibrillary acidic protein. Two different complementary DNA clones were isolated from a carp brain complementary DNA library, each encoding a different form of glial fibrillary acidic protein apparently originating from different genes. Monospecific polyclonal antibodies were raised against a peptide synthesized according to the predicted amino acid sequence, and used to identify and localize the fish glial fibrillary acidic protein. Two glial fibrillary acidic proteins (of 49 kDa and 51 kDa) were identified by the antibodies in all tested fish central nervous system tissues. The antibodies were then used to examine glial fibrillary acidic protein immunoreactivity in sections taken from uninjured and injured optic nerves of goldfish. Injury was followed by an elevation in glial fibrillary acidic protein immunoreactivity along the whole length of the nerve, except at the site of the injury, where--as in the case of vimentin--no immunoreactivity was detectable. However, in contrast to vimentin-positive glial cells, which repopulate the site of the injury soon after the optic nerve is injured, glial fibrillary acidic protein-positive glial cells remained outside the injury site for as long as 6 weeks after the injury. Despite the injury-induced changes in glial fibrillary acidic protein immunoreactivity, no change was observed in the level of transcript encoding glial fibrillary acidic protein after injury, while there was an increase in the amount of glial fibrillary acidic protein associated with the cytoskeleton and a reduction in the soluble form. These results suggest that the injury-induced changes in immunoreactivity on sections involve changes not in transcription or translation of glial fibrillary acidic protein, but in glial fibrillary acidic protein compartmentalization.

An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening

PubMed Central

2017-01-01

DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing. PMID:28199790

An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening.

PubMed

MacConnell, Andrew B; Price, Alexander K; Paegel, Brian M

2017-03-13

DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing.

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Development and Synthesis of DNA-Encoded Benzimidazole Library.

PubMed

Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

2018-04-25

Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Is junk DNA bunk? A critique of ENCODE.

PubMed

Doolittle, W Ford

2013-04-02

Do data from the Encyclopedia Of DNA Elements (ENCODE) project render the notion of junk DNA obsolete? Here, I review older arguments for junk grounded in the C-value paradox and propose a thought experiment to challenge ENCODE's ontology. Specifically, what would we expect for the number of functional elements (as ENCODE defines them) in genomes much larger than our own genome? If the number were to stay more or less constant, it would seem sensible to consider the rest of the DNA of larger genomes to be junk or, at least, assign it a different sort of role (structural rather than informational). If, however, the number of functional elements were to rise significantly with C-value then, (i) organisms with genomes larger than our genome are more complex phenotypically than we are, (ii) ENCODE's definition of functional element identifies many sites that would not be considered functional or phenotype-determining by standard uses in biology, or (iii) the same phenotypic functions are often determined in a more diffuse fashion in larger-genomed organisms. Good cases can be made for propositions ii and iii. A larger theoretical framework, embracing informational and structural roles for DNA, neutral as well as adaptive causes of complexity, and selection as a multilevel phenomenon, is needed.

Perlecan and vascular endothelial growth factor-encoding DNA-loaded chitosan scaffolds promote angiogenesis and wound healing.

PubMed

Lord, Megan S; Ellis, April L; Farrugia, Brooke L; Whitelock, John M; Grenett, Hernan; Li, Chuanyu; O'Grady, Robert L; DeCarlo, Arthur A

2017-03-28

The repair of dermal wounds, particularly in the diabetic population, poses a significant healthcare burden. The impaired wound healing of diabetic wounds is attributed to low levels of endogenous growth factors, including vascular endothelial growth factor (VEGF), that normally stimulate multiple phases of wound healing. In this study, chitosan scaffolds were prepared via freeze drying and loaded with plasmid DNA encoding perlecan domain I and VEGF189 and analyzed in vivo for their ability to promote dermal wound healing. The plasmid DNA encoding perlecan domain I and VEGF189 loaded scaffolds promoted dermal wound healing in normal and diabetic rats. This treatment resulted in an increase in the number of blood vessels and sub-epithelial connective tissue matrix components within the wound beds compared to wounds treated with chitosan scaffolds containing control DNA or wounded controls. These results suggest that chitosan scaffolds containing plasmid DNA encoding VEGF189 and perlecan domain I have the potential to induce angiogenesis and wound healing. Copyright © 2017 Elsevier B.V. All rights reserved.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA

PubMed Central

Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo

1971-01-01

The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808

Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system.

PubMed

Kawano, Tomonori

2013-03-01

There have been a wide variety of approaches for handling the pieces of DNA as the "unplugged" tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given "passwords" and/or secret numbers using DNA sequences. The "passwords" of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original "passwords." The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed.

Design and Analysis of Compact DNA Strand Displacement Circuits for Analog Computation Using Autocatalytic Amplifiers.

PubMed

Song, Tianqi; Garg, Sudhanshu; Mokhtar, Reem; Bui, Hieu; Reif, John

2018-01-19

A main goal in DNA computing is to build DNA circuits to compute designated functions using a minimal number of DNA strands. Here, we propose a novel architecture to build compact DNA strand displacement circuits to compute a broad scope of functions in an analog fashion. A circuit by this architecture is composed of three autocatalytic amplifiers, and the amplifiers interact to perform computation. We show DNA circuits to compute functions sqrt(x), ln(x) and exp(x) for x in tunable ranges with simulation results. A key innovation in our architecture, inspired by Napier's use of logarithm transforms to compute square roots on a slide rule, is to make use of autocatalytic amplifiers to do logarithmic and exponential transforms in concentration and time. In particular, we convert from the input that is encoded by the initial concentration of the input DNA strand, to time, and then back again to the output encoded by the concentration of the output DNA strand at equilibrium. This combined use of strand-concentration and time encoding of computational values may have impact on other forms of molecular computation.

Blue light photoreceptors and methods of using the same

DOEpatents

Cashmore, Anthony Robert; Ahmad, Margaret; Lin, Chentao

1998-01-01

The invention features a substantially pure preparation of a nucleic acid encoding a HY4 or a HY4-related gene. The invention further features transgenic plants encoding a HY4 gene having a shorter stem than substantially homozygous wild type nontransgenic plants; and, transgenic plants comprising complementary HY4 sequences having a longer stem than substantially homozygous wild type nontransgenic plants.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Nature and distribution of feline sarcoma virus nucleotide sequences.

PubMed Central

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed Central

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-01-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

PubMed

Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

1998-02-01

The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

Ovarian-specific expression of a new gene regulated by the goat PIS region and transcribed by a FOXL2 bidirectional promoter.

PubMed

Pannetier, Maëlle; Renault, Lauriane; Jolivet, Geneviève; Cotinot, Corinne; Pailhoux, Eric

2005-06-01

Studies on XX sex reversal in polled goats (PIS mutation: polled intersex syndrome) have led to the discovery of a female-specific locus crucial for ovarian differentiation. This genomic region is composed of at least two genes, FOXL2 and PISRT1, sharing a common transcriptional regulatory region, PIS. In this paper, we describe a third gene, PFOXic (promoter FOXL2 inverse complementary), located near FOXL2 in the opposite orientation. This gene composed of five exons encodes a 1723-bp cDNA, enclosing two repetitive elements in its 3' end. PFOXic mRNA encodes a putative protein of 163 amino acids with no homologies in any of the databases tested. The transcriptional expression of PFOXic is driven by a bidirectional promoter also enhancing FOXL2 transcription. In goats, PFOXic is expressed in developing ovaries, from 36 days postcoitum until adulthood. Ovarian-specific expression of PFOXic is regulated by the PIS region. PFOXic is found conserved only in Bovidae. But, a human gene located in the opposite orientation relative to FOXL2 can be considered a human PFOXic. Finally, we discuss evidence arguing for regulation of the level of FOXL2 transcription via the bidirectional promoter and the level of transcription of PFOXic.

Porcine circovirus: transcription and rolling-circle DNA replication

USDA-ARS?s Scientific Manuscript database

This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Differential expression of a novel seven transmembrane domain protein in epididymal fat from aged and diabetic mice.

PubMed

Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C

1999-06-01

To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

PubMed

Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

PubMed Central

Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

2015-01-01

Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

Detection and diversity of fungal nitric oxide reductase genes ( p450nor) in agricultural soils

DOE PAGES

Higgins, Steven A.; Welsh, Allana; Orellana, Luis H.; ...

2016-03-11

Members of the Fungi convert nitrate (NO 3 -) and nitrite (NO 2 -) to gaseous nitrous oxide (N 2O) (denitrification), but the fungal contributions to N-loss from soil remain uncertain. Cultivation-based methodologies that include antibiotics to selectively assess fungal activities have limitations and complementary molecular approaches to assign denitrification potential to fungi are desirable. Microcosms established with soils from two representative U.S. Midwest agricultural regions produced N 2O from added NO 3 - or NO 2 - in the presence of antibiotics to inhibit bacteria. Cultivation efforts yielded 214 fungal isolates belonging to at least 15 distinct morphological groups,more » of which 151 produced N 2O from NO 2 -. Novel PCR primers targeting the p450nor gene that encodes the nitric oxide (NO) reductase responsible for N 2O production in fungi yielded 26 novel p450nor amplicons from DNA of 37 isolates and 23 amplicons from environmental DNA obtained from two agricultural soils. The sequences shared 54-98% amino acid identity to reference P450nor sequences within the phylum Ascomycota, and expand the known fungal P450nor sequence diversity. p450nor was detected in all fungal isolates that produced N 2O from nitrite, whereas nirK (encoding the NO-forming nitrite reductase) was amplified in only 13-74% of the N 2O-forming isolates using two separate nirK primer sets. Altogether, our findings demonstrate the value of p450nor-targeted PCR to complement existing approaches to assess the fungal contributions to denitrification and N 2O formation.« less

Cloning HSP70 and HSP90 genes of kaluga (Huso dauricus) and the effects of temperature and salinity stress on their gene expression.

PubMed

Peng, Guogan; Zhao, Wen; Shi, Zhenguang; Chen, Huirong; Liu, Yang; Wei, Jie; Gao, Fengying

2016-03-01

The genes encoding HSP70 and HSP90 proteins were isolated from kaluga by homologous cloning and rapid amplification of complementary DNA (cDNA) ends (RACE). HSP70 (GenBank accession no. KP050541) and HSP90 (GenBank accession no. KP050542) cDNAs were composed of 2275 and 2718 bp and encoded polypeptides of 650 and 725 amino acids, respectively. Basic Local Alignment Search Tool (BLAST) analysis showed that HSP70 and HSP90 of kaluga shared high identities with those of Acipenser ruthenus, Acipenser schrenckii, and Acipenser baerii (98-99 %). Fluorescent real-time RT-PCR under unstressed conditions revealed that HSP70 and HSP90 were expressed in 11 different tissues of kaluga. Messenger RNA (mRNA) expressions of both HSP70 and HSP90 were highest in the intestine and lowest in the muscle. In addition, the patterns of mRNA expression of HSP70 and HSP90 were similar, although the level of expression was more in HSP90 than in HSP70 (P < 0.05).We also analyzed patterns of HSP70 and HSP90 expression in the muscle, gill, and liver of kaluga under different combinations of temperature and salinity stress, including temperatures of 4,10, 25, and 28 °C at 0 ppt salinity, and salinities of 10, 20, 30, and 40 ppt at 16 °C, where 16 °C at 0 ppt (parts per thousand) served as the control. We found that levels of mRNA expression of both HSP70 and HSP90 were highest at 4 °C in the muscle, gill, and liver and changed little with salinity stress. These results increase understanding of the mechanisms of stress response of cold freshwater fish.

Detection and diversity of fungal nitric oxide reductase genes ( p450nor) in agricultural soils

DOE Office of Scientific and Technical Information (OSTI.GOV)

Higgins, Steven A.; Welsh, Allana; Orellana, Luis H.

Members of the Fungi convert nitrate (NO 3 -) and nitrite (NO 2 -) to gaseous nitrous oxide (N 2O) (denitrification), but the fungal contributions to N-loss from soil remain uncertain. Cultivation-based methodologies that include antibiotics to selectively assess fungal activities have limitations and complementary molecular approaches to assign denitrification potential to fungi are desirable. Microcosms established with soils from two representative U.S. Midwest agricultural regions produced N 2O from added NO 3 - or NO 2 - in the presence of antibiotics to inhibit bacteria. Cultivation efforts yielded 214 fungal isolates belonging to at least 15 distinct morphological groups,more » of which 151 produced N 2O from NO 2 -. Novel PCR primers targeting the p450nor gene that encodes the nitric oxide (NO) reductase responsible for N 2O production in fungi yielded 26 novel p450nor amplicons from DNA of 37 isolates and 23 amplicons from environmental DNA obtained from two agricultural soils. The sequences shared 54-98% amino acid identity to reference P450nor sequences within the phylum Ascomycota, and expand the known fungal P450nor sequence diversity. p450nor was detected in all fungal isolates that produced N 2O from nitrite, whereas nirK (encoding the NO-forming nitrite reductase) was amplified in only 13-74% of the N 2O-forming isolates using two separate nirK primer sets. Altogether, our findings demonstrate the value of p450nor-targeted PCR to complement existing approaches to assess the fungal contributions to denitrification and N 2O formation.« less

Quantitative Proteomic and Microarray Analysis of the Archaeon Methanosarcina Acetivorans Grown with Acetate Versus Methanol*

PubMed Central

Li, Lingyun; Li, Qingbo; Rohlin, Lars; Kim, UnMi; Salmon, Kirsty; Rejtar, Tomas; Gunsalus, Robert P.; Karger, Barry L.; Ferry, James G.

2008-01-01

Summary Methanosarcina acetivorans strain C2A is an acetate- and methanol-utilizing methane-producing organism for which the genome, the largest yet sequenced among the Archaea, reveals extensive physiological diversity. LC linear ion trap-FTICR mass spectrometry was employed to analyze acetate- vs. methanol-grown cells metabolically labeled with 14N vs. 15N, respectively, to obtain quantitative protein abundance ratios. DNA microarray analyses of acetate- vs. methanol-grown cells was also performed to determine gene expression ratios. The combined approaches were highly complementary, extending the physiological understanding of growth and methanogenesis. Of the 1081 proteins detected, 255 were ≥ 3-fold differentially abundant. DNA microarray analysis revealed 410 genes that were ≥ 2.5-fold differentially expressed of 1972 genes with detected expression. The ratios of differentially abundant proteins were in good agreement with expression ratios of the encoding genes. Taken together, the results suggest several novel roles for electron transport components specific to acetate-grown cells, including two flavodoxins each specific for growth on acetate or methanol. Protein abundance ratios indicated that duplicate CO dehydrogenase/acetyl-CoA complexes function in the conversion of acetate to methane. Surprisingly, the protein abundance and gene expression ratios indicated a general stress response in acetate- vs. methanol-grown cells that included enzymes specific for polyphosphate accumulation and oxidative stress. The microarray analysis identified transcripts of several genes encoding regulatory proteins with identity to the PhoU, MarR, GlnK, and TetR families commonly found in the Bacteria domain. An analysis of neighboring genes suggested roles in controlling phosphate metabolism (PhoU), ammonia assimilation (GlnK), and molybdopterin cofactor biosynthesis (TetR). Finally, the proteomic and microarray results suggested roles for two-component regulatory systems specific for each growth substrate. PMID:17269732

Molecular and bioinformatical characterization of a novel superfamily of cysteine-rich peptides from arthropods.

PubMed

Zeng, Xian-Chun; Nie, Yao; Luo, Xuesong; Wu, Shifen; Shi, Wanxia; Zhang, Lei; Liu, Yichen; Cao, Hanjun; Yang, Ye; Zhou, Jianping

2013-03-01

The full-length cDNA sequences of two novel cysteine-rich peptides (referred to as HsVx1 and MmKTx1) were obtained from scorpions. The two peptides represent a novel class of cysteine-rich peptides with a unique cysteine pattern. The genomic sequence of HsVx1 is composed of three exons interrupted by two introns that are localized in the mature peptide encoding region and inserted in phase 1 and phase 2, respectively. Such a genomic organization markedly differs from those of other peptides from scorpions described previously. Genome-wide search for the orthologs of HsVx1 identified 59 novel cysteine-rich peptides from arthropods. These peptides share a consistent cysteine pattern with HsVx1. Genomic comparison revealed extensive intron length differences and intronic number and position polymorphisms among the genes of these peptides. Further analysis identified 30 cases of intron sliding, 1 case of intron gain and 22 cases of intron loss occurred with the genes of the HsVx1 and HsVx1-like peptides. It is interesting to see that three HsVx1-like peptides XP_001658928, XP_001658929 and XP_001658930 were derived from a single gene (XP gene): the former two were generated from alternative splicing; the third one was encoded by a DNA region in the reverse complementary strand of the third intron of the XP gene. These findings strongly suggest that the genes of these cysteine-rich peptides were evolved by intron sliding, intron gain/loss, gene recombination and alternative splicing events in response to selective forces without changing their cysteine pattern. The evolution of these genes is dominated by intron sliding and intron loss. Copyright © 2012 Elsevier Inc. All rights reserved.

Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

NASA Astrophysics Data System (ADS)

Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

2010-07-01

In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

PubMed

Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

2013-12-15

We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

PubMed

Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

2014-04-01

The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

PubMed

Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

2017-09-19

DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

PubMed

Schneider, G J; Geiduschek, E P

1990-06-25

The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

PubMed

Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

2017-03-21

A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

Quantum dot-based microfluidic biosensor for cancer detection

NASA Astrophysics Data System (ADS)

Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

2015-05-01

We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

Ultrasensitive and label-free detection of pathogenic avian influenza DNA by using CMOS impedimetric sensors.

PubMed

Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C

2012-05-15

This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.

Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

NASA Astrophysics Data System (ADS)

Singh, Swati; Kumar, Ashok; Khare, Shashi; Mulchandani, Ashok; Rajesh

2014-11-01

A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to its complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml-1 with a limit of detection of 0.16 ng ml-1.

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Methods and materials relating to IMPDH and GMP production

DOEpatents

Collart, Frank R.; Huberman, Eliezer

1997-01-01

Disclosed are purified and isolated DNA sequences encoding eukaryotic proteins possessing biological properties of inosine 5'-monophosphate dehydrogenase ("IMPDH"). Illustratively, mammalian (e.g., human) IMPDH-encoding DNA sequences are useful in transformation or transfection of host cells for the large scale recombinant production of the enzymatically active expression products and/or products (e.g., GMP) resulting from IMPDH catalyzed synthesis in cells. Vectors including IMPDH-encoding DNA sequences are useful in gene amplification procedures. Recombinant proteins and synthetic peptides provided by the invention are useful as immunological reagents and in the preparation of antibodies (including polyclonal and monoclonal antibodies) for quantitative detection of IMPDH.

Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain

NASA Astrophysics Data System (ADS)

Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.

1985-12-01

A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.

Local alignment of two-base encoded DNA sequence

PubMed Central

Homer, Nils; Merriman, Barry; Nelson, Stanley F

2009-01-01

Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732

Discovering Drugs with DNA-Encoded Library Technology: From Concept to Clinic with an Inhibitor of Soluble Epoxide Hydrolase.

PubMed

Belyanskaya, Svetlana L; Ding, Yun; Callahan, James F; Lazaar, Aili L; Israel, David I

2017-05-04

DNA-encoded chemical library technology was developed with the vision of its becoming a transformational platform for drug discovery. The hope was that a new paradigm for the discovery of low-molecular-weight drugs would be enabled by combining the vast molecular diversity achievable with combinatorial chemistry, the information-encoding attributes of DNA, the power of molecular biology, and a streamlined selection-based discovery process. Here, we describe the discovery and early clinical development of GSK2256294, an inhibitor of soluble epoxide hydrolase (sEH, EPHX2), by using encoded-library technology (ELT). GSK2256294 is an orally bioavailable, potent and selective inhibitor of sEH that has a long half life and produced no serious adverse events in a first-time-in-human clinical study. To our knowledge, GSK2256294 is the first molecule discovered from this technology to enter human clinical testing and represents a realization of the vision that DNA-encoded chemical library technology can efficiently yield molecules with favorable properties that can be readily progressed into high-quality drugs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of Western Equine Encephalitis Virus Structural Proteins That Confer Protection after DNA Vaccination▿

PubMed Central

Gauci, Penelope J.; Wu, Josh Q. H.; Rayner, George A.; Barabé, Nicole D.; Nagata, Leslie P.; Proll, David F.

2010-01-01

DNA vaccines encoding different portions of the structural proteins of western equine encephalitis virus were tested for the efficacy of their protection in a 100% lethal mouse model of the virus. The 6K-E1 structural protein encoded by the DNA vaccine conferred complete protection against challenge with the homologous strain and limited protection against challenge with a heterologous strain. PMID:19923571

LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

PubMed

Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

2017-08-01

DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p < 0.05) at day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-12

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

PubMed

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-12-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

PubMed

Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

2018-06-04

The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

A Multiantigenic DNA Vaccine That Induces Broad Hepatitis C Virus-Specific T-Cell Responses in Mice.

PubMed

Gummow, Jason; Li, Yanrui; Yu, Wenbo; Garrod, Tamsin; Wijesundara, Danushka; Brennan, Amelia J; Mullick, Ranajoy; Voskoboinik, Ilia; Grubor-Bauk, Branka; Gowans, Eric J

2015-08-01

There are 3 to 4 million new hepatitis C virus (HCV) infections annually around the world, but no vaccine is available. Robust T-cell mediated responses are necessary for effective clearance of the virus, and DNA vaccines result in a cell-mediated bias. Adjuvants are often required for effective vaccination, but during natural lytic viral infections damage-associated molecular patterns (DAMPs) are released, which act as natural adjuvants. Hence, a vaccine that induces cell necrosis and releases DAMPs will result in cell-mediated immunity (CMI), similar to that resulting from natural lytic viral infection. We have generated a DNA vaccine with the ability to elicit strong CMI against the HCV nonstructural (NS) proteins (3, 4A, 4B, and 5B) by encoding a cytolytic protein, perforin (PRF), and the antigens on a single plasmid. We examined the efficacy of the vaccines in C57BL/6 mice, as determined by gamma interferon enzyme-linked immunosorbent spot assay, cell proliferation studies, and intracellular cytokine production. Initially, we showed that encoding the NS4A protein in a vaccine which encoded only NS3 reduced the immunogenicity of NS3, whereas including PRF increased NS3 immunogenicity. In contrast, the inclusion of NS4A increased the immunogenicity of the NS3, NS4B, andNS5B proteins, when encoded in a DNA vaccine that also encoded PRF. Finally, vaccines that also encoded PRF elicited similar levels of CMI against each protein after vaccination with DNA encoding NS3, NS4A, NS4B, and NS5B compared to mice vaccinated with DNA encoding only NS3 or NS4B/5B. Thus, we have developed a promising "multiantigen" vaccine that elicits robust CMI. Since their development, vaccines have reduced the global burden of disease. One strategy for vaccine development is to use commercially viable DNA technology, which has the potential to generate robust immune responses. Hepatitis C virus causes chronic liver infection and is a leading cause of liver cancer. To date, no vaccine is currently available, and treatment is costly and often results in side effects, limiting the number of patients who are treated. Despite recent advances in treatment, prevention remains the key to efficient control and elimination of this virus. Here, we describe a novel DNA vaccine against hepatitis C virus that is capable of inducing robust cell-mediated immune responses in mice and is a promising vaccine candidate for humans. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system

PubMed Central

Kawano, Tomonori

2013-01-01

There have been a wide variety of approaches for handling the pieces of DNA as the “unplugged” tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given “passwords” and/or secret numbers using DNA sequences. The “passwords” of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original “passwords.” The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed. PMID:23750303

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide.

PubMed

Sayed, Nour; Jousselin, Ambre; Felden, Brice

2011-12-25

Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.

Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

PubMed

Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

2011-12-01

High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

Acetylcholinesterase of the sand fly, Phlebotomus papatasi (Scopoli): cDNA sequence, baculovirus expression, and biochemical properties

PubMed Central

2013-01-01

Background Millions of people and domestic animals around the world are affected by leishmaniasis, a disease caused by various species of flagellated protozoans in the genus Leishmania that are transmitted by several sand fly species. Insecticides are widely used for sand fly population control to try to reduce or interrupt Leishmania transmission. Zoonotic cutaneous leishmaniasis caused by L. major is vectored mainly by Phlebotomus papatasi (Scopoli) in Asia and Africa. Organophosphates comprise a class of insecticides used for sand fly control, which act through the inhibition of acetylcholinesterase (AChE) in the central nervous system. Point mutations producing an altered, insensitive AChE are a major mechanism of organophosphate resistance in insects and preliminary evidence for organophosphate-insensitive AChE has been reported in sand flies. This report describes the identification of complementary DNA for an AChE in P. papatasi and the biochemical characterization of recombinant P. papatasi AChE. Methods A P. papatasi Israeli strain laboratory colony was utilized to prepare total RNA utilized as template for RT-PCR amplification and sequencing of cDNA encoding acetylcholinesterase 1 using gene specific primers and 3’-5’-RACE. The cDNA was cloned into pBlueBac4.5/V5-His TOPO, and expressed by baculovirus in Sf21 insect cells in serum-free medium. Recombinant P. papatasi acetylcholinesterase was biochemically characterized using a modified Ellman’s assay in microplates. Results A 2309 nucleotide sequence of PpAChE1 cDNA [GenBank: JQ922267] of P. papatasi from a laboratory colony susceptible to insecticides is reported with 73-83% nucleotide identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85% amino acid identity with acetylcholinesterases of Cx. pipiens, Aedes aegypti, and 92% amino acid identity for L. longipalpis. Recombinant P. papatasi AChE1 was expressed in the baculovirus system and characterized as an insect acetylcholinesterase with substrate preference for acetylthiocholine and inhibition at high substrate concentration. Enzyme activity was strongly inhibited by eserine, BW284c51, malaoxon, and paraoxon, and was insensitive to the butyrylcholinesterase inhibitors ethopropazine and iso-OMPA. Conclusions Results presented here enable the screening and identification of PpAChE mutations resulting in the genotype for insensitive PpAChE. Use of the recombinant P. papatasi AChE1 will facilitate rapid in vitro screening to identify novel PpAChE inhibitors, and comparative studies on biochemical kinetics of inhibition. PMID:23379291

Characterization of a 3.3-kb plasmid of Escherichia coli O157:H7 and evaluation of stability of genetically engineered derivatives of this plasmid expressing green fluorescence.

PubMed

Sharma, Vijay K; Stanton, Thaddeus B

2008-12-10

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 (strain 86-24) harbors a 3.3-kb plasmid (pSP70) that does not encode a selectable phenotype. A 1.1-kb fragment of DNA encoding kanamycin resistance (Kan(r)) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct pSP70-Kan(r) that conferred Kan(r) to the host E. coli strain. Oligonucleotides complementary to 5' and 3' ends of the fragment encoding Kan(r) were used for initiating nucleotide sequencing from the plus and minus strands of pSP70, and thereafter primer walking was used to determine nucleotide sequence of pSP70. Analysis of nucleotide sequence revealed that pSP70 contained 3306 base pairs in its genome and that the genome was almost 100% identical to nucleotide sequences of small plasmids identified in EHEC O157:H7 isolates from Germany and Japan. A DNA cassette encoding a green fluorescent protein (GFP), ampicillin resistance (Amp(r)), and a double transcriptional terminator (DT) was cloned in pSP70 either at the BamHI site (created by deletion of mobA by PCR) or at the NsiI site located downstream of mobA to generate pSP70 DeltamobA-GFP/Amp(r)/DT (pSM431) and pSP70-GFP/Amp(r)/DT (pSM433), respectively. Introduction of pSM431 or pSM433 into EHEC O157:H7 yielded ampicillin-resistant colonies that glowed green under UV illumination. Consecutive subcultures of EHEC O157:H7, carrying pSM431 or pSM433 under conditions simulating the environment of bovine intestine (no selective antibiotic, incubation temperature of 39 degrees C, with or without oxygen), demonstrated that these plasmids were highly stable as greater than 95% of the isolates recovered from these subcultures were positive for green fluorescence. These findings indicate that EHEC O157:H7 carrying pSM431 or pSM433 would be useful for studying persistence and shedding of this important food-borne pathogen in cattle.

DNA-Encoded Raman-Active Anisotropic Nanoparticles for microRNA Detection.

PubMed

Qi, Lin; Xiao, Mingshu; Wang, Xiwei; Wang, Cheng; Wang, Lihua; Song, Shiping; Qu, Xiangmeng; Li, Li; Shi, Jiye; Pei, Hao

2017-09-19

The development of highly sensitive and selective methods for the detection of microRNA (miRNA) has attracted tremendous attention because of its importance in fundamental biological studies and diagnostic applications. In this work, we develop DNA-encoded Raman-active anisotropic nanoparticles modified origami paper analytical devices (oPADs) for rapid, highly sensitive, and specific miRNA detection. The Raman-active anisotropic nanoparticles were prepared using 10-mer oligo-A, -T, -C, and -G to mediate the growth of Ag cubic seeds into Ag nanoparticles (AgNPs) with different morphologies. The resulting AgNPs were further encoded with DNA probes to serve as effective surface-enhanced Raman scattering (SERS) probes. The analytical device was then fabricated on a single piece of SERS probes loaded paper-based substrate and assembled based on the principles of origami. The addition of the target analyte amplifies the Raman signals on DNA-encoded AgNPs through a target-dependent, sequence specific DNA hybridization assembly. This simple and low-cost analytical device is generic and applicable to a variety of miRNAs, allowing detection sensitivity down to 1 pM and assay time within 15 min, and therefore holds promising applications in point-of-care diagnostics.

The Retrovirus pol Gene Encodes a Product Required for DNA Integration: Identification of a Retrovirus int Locus

NASA Astrophysics Data System (ADS)

Panganiban, Antonito T.; Temin, Howard M.

1984-12-01

We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.

Topological Interaction by Entanglement of DNA

NASA Astrophysics Data System (ADS)

Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

2012-02-01

We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

PubMed

Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-11-20

We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

PubMed

Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

2009-09-01

Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

DTIC Science & Technology

2006-05-01

W81XWH-04-1-0489 TITLE: An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply PRINCIPAL...Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply 5b. GRANT NUMBER W81XWH-04-1-0489 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR...blocking renewal of blood vessel growth in the tumor bed, have been proposed as suitable antitumor strategies. Endoglin (CD105) is a suitable

A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

PubMed

Wang, Guannan; Su, Xingguang

2010-06-01

A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

An in silico model for identification of small RNAs in whole bacterial genomes: characterization of antisense RNAs in pathogenic Escherichia coli and Streptococcus agalactiae strains.

PubMed

Pichon, Christophe; du Merle, Laurence; Caliot, Marie Elise; Trieu-Cuot, Patrick; Le Bouguénec, Chantal

2012-04-01

Characterization of small non-coding ribonucleic acids (sRNA) among the large volume of data generated by high-throughput RNA-seq or tiling microarray analyses remains a challenge. Thus, there is still a need for accurate in silico prediction methods to identify sRNAs within a given bacterial species. After years of effort, dedicated software were developed based on comparative genomic analyses or mathematical/statistical models. Although these genomic analyses enabled sRNAs in intergenic regions to be efficiently identified, they all failed to predict antisense sRNA genes (asRNA), i.e. RNA genes located on the DNA strand complementary to that which encodes the protein. The statistical models enabled any genomic region to be analyzed theorically but not efficiently. We present a new model for in silico identification of sRNA and asRNA candidates within an entire bacterial genome. This model was successfully used to analyze the Gram-negative Escherichia coli and Gram-positive Streptococcus agalactiae. In both bacteria, numerous asRNAs are transcribed from the complementary strand of genes located in pathogenicity islands, strongly suggesting that these asRNAs are regulators of the virulence expression. In particular, we characterized an asRNA that acted as an enhancer-like regulator of the type 1 fimbriae production involved in the virulence of extra-intestinal pathogenic E. coli.

An in silico model for identification of small RNAs in whole bacterial genomes: characterization of antisense RNAs in pathogenic Escherichia coli and Streptococcus agalactiae strains

PubMed Central

Pichon, Christophe; du Merle, Laurence; Caliot, Marie Elise; Trieu-Cuot, Patrick; Le Bouguénec, Chantal

2012-01-01

Characterization of small non-coding ribonucleic acids (sRNA) among the large volume of data generated by high-throughput RNA-seq or tiling microarray analyses remains a challenge. Thus, there is still a need for accurate in silico prediction methods to identify sRNAs within a given bacterial species. After years of effort, dedicated software were developed based on comparative genomic analyses or mathematical/statistical models. Although these genomic analyses enabled sRNAs in intergenic regions to be efficiently identified, they all failed to predict antisense sRNA genes (asRNA), i.e. RNA genes located on the DNA strand complementary to that which encodes the protein. The statistical models enabled any genomic region to be analyzed theorically but not efficiently. We present a new model for in silico identification of sRNA and asRNA candidates within an entire bacterial genome. This model was successfully used to analyze the Gram-negative Escherichia coli and Gram-positive Streptococcus agalactiae. In both bacteria, numerous asRNAs are transcribed from the complementary strand of genes located in pathogenicity islands, strongly suggesting that these asRNAs are regulators of the virulence expression. In particular, we characterized an asRNA that acted as an enhancer-like regulator of the type 1 fimbriae production involved in the virulence of extra-intestinal pathogenic E. coli. PMID:22139924

Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

DTIC Science & Technology

2013-01-01

identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

[DNA structure from A to Z--biological implications of structural diversity of DNA].

PubMed

Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

2006-01-01

Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres

PubMed Central

Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling

2012-01-01

An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594

Stacked-unstacked equilibrium at the nick site of DNA.

PubMed

Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

2004-09-17

Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

Insights into DNA-mediated interparticle interactions from a coarse-grained model

NASA Astrophysics Data System (ADS)

Ding, Yajun; Mittal, Jeetain

2014-11-01

DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Black carp vasa identifies embryonic and gonadal germ cells.

PubMed

Xue, Ting; Yu, Miao; Pan, Qihua; Wang, Yizhou; Fang, Jian; Li, Lingyu; Deng, Yu; Chen, Kai; Wang, Qian; Chen, Tiansheng

2017-07-01

Identification of molecular markers is an essential step in the study of germ cells. Vasa is an RNA helicase and a well-known germ cell marker that plays a crucial role in germ cell development. Here, we identified the Vasa homolog termed Mpvasa as the first germ cell marker in black carp (Mylopharyngodon piceus). First, a 2819-bp full-length Mpvasa complementary DNA (cDNA) was cloned by PCR using degenerated primers of conserved sequences and gene-specific primers. The Mpvasa cDNA sequence encodes a 637-amino acid protein that contains eight conserved characteristic motifs of the DEAD box protein family, and shares high identity to grass carp (81%) and zebrafish (74%) vasa homologs. Second, Mpvasa expression was restricted to the gonad in adulthood by RT-PCR and Western blot analysis. The dynamic patterns of temporal-spatial expression of Mpvasa during gametogenesis were examined by in situ hybridization, and Mpvasa transcripts were strictly detected in gonadal germ cells throughout oogenesis, predominantly in immature oocytes (stage I, II, and III oocytes). Third, Mpvasa transcripts were highly detected in unfertilized eggs and early embryos, and the signal indicated a dynamic migration of the primordial germ cells during embryogenesis, suggesting that Mpvasa transcripts were maternally inherited and specifically distributed in germ cells. Taken together, these results demonstrated that Mpvasa is an applicable molecular marker for identification of gonadal and embryonic germ cells, which facilitates the isolation and utilization of germ cells in black carp.

Isolation and characterization of Cu/Zn-superoxide dismutase in Fasciola gigantica.

PubMed

Lalrinkima, H; Raina, O K; Chandra, Dinesh; Jacob, Siju Susan; Bauri, R K; Chandra, Subhash; Yadav, H S; Singh, M N; Rialch, A; Varghese, A; Banerjee, P S; Kaur, Navneet; Sharma, Arvind

2015-01-01

A full-length complementary DNA (cDNA) encoding Cu/Zn-superoxide dismutase was isolated from Fasciola gigantica that on nucleotide sequencing showed a close homology (98.9%) with Cu/Zn-superoxide dismutase (SOD) of the temperate liver fluke, F. hepatica. Expression of the gene was found in all the three developmental stages of the parasite viz. adult, newly excysted juvenile and metacercaria at transcriptional level by reverse transcription-polymerase chain reaction (RT-PCR) and at the protein level by Western blotting. F. gigantica Cu/Zn-SOD cDNA was cloned and expressed in Escherichia coli. Enzyme activity of the recombinant protein was determined by nitroblue tetrazolium (NBT)-polyacrylamide gel electrophoresis (PAGE) and this activity was inactivated by hydrogen peroxide but not by sodium azide, indicating that the recombinant protein is Cu/Zn-SOD. The enzyme activity was relatively stable at a broad pH range of pH 4.0-10.0. Native Cu/Zn-superoxide dismutase protein was detected in the somatic extract and excretory-secretory products of the adult F. gigantica by Western blotting. NBT-PAGE showed a single Cu/Zn-SOD present in the somatic extract while three SODs are released ex vivo by the adult parasite. The recombinant superoxide dismutase did not react with the serum from buffaloes infected with F. gigantica. The role of this enzyme in defense by the parasite against the host reactive oxygen species is discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

N7-platinated ribonucleotides are not incorporated by RNA polymerases. New perspectives for a rational design of platinum antitumor drugs.

PubMed

Benedetti, Michele; Romano, Alessandro; De Castro, Federica; Girelli, Chiara R; Antonucci, Daniela; Migoni, Danilo; Verri, Tiziano; Fanizzi, Francesco P

2016-10-01

In this work, we assessed the capacity of RNA polymerases to use platinated ribonucleotides as substrates for RNA synthesis by testing the incorporation of the model compound [Pt(dien)(N7-5'-GTP)] (dien=diethylenetriamine; GTP=5'-guanosine triphosphate) into a natural RNA sequence. The yield of in vitro transcription operated by T7 RNA polymerase, on the LacZ (Escherichia coli gene encoding for β-galactosidase) sequence, decreases progressively with decreasing the concentration of natural GTP, in favor of the platinated nucleotide, [Pt(dien)(N7-5'-GTP)]. Comparison of the T7 RNA polymerase transcription activities for [Pt(dien)(N7-5'-GTP)] compound incorporation reaction test, with respect to the effect of a decreasing concentration of natural GTP, showed no major differences. A specific inhibitory effect of compound [Pt(dien)(N7-5'-GTP)] (which may pair the complementary base on the DNA strand, without being incorporated in the RNA by the T7 RNA polymerase) was evidenced. Our findings therefore suggest that RNA polymerases, unlike DNA polymerases, are unable to incorporate N7-platinated nucleotides into newly synthesized nucleic acids. In this respect, specifically designed N7-platinated nucleotides based compounds could be used in alternative to the classical platinum based drugs. This approach may offer a possible strategy to target specifically DNA, without affecting RNA, and is potentially able to better modulate pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.

Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

ERIC Educational Resources Information Center

Militello, Kevin T.

2013-01-01

Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

Electron transfer of plurimodified DNA SAMs.

PubMed

Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

2007-07-17

An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

PubMed Central

Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

2015-01-01

The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

PubMed

Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

2016-02-02

The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

Molecular characterization and localization of the first tyramine receptor of the American cockroach (Periplaneta americana).

PubMed

Rotte, C; Krach, C; Balfanz, S; Baumann, A; Walz, B; Blenau, W

2009-09-15

The phenolamines octopamine and tyramine control, regulate, and modulate many physiological and behavioral processes in invertebrates. Vertebrates possess only small amounts of both substances, and thus, octopamine and tyramine, together with other biogenic amines, are referred to as "trace amines." Biogenic amines evoke cellular responses by activating G-protein-coupled receptors. We have isolated a complementary DNA (cDNA) that encodes a biogenic amine receptor from the American cockroach Periplaneta americana, viz., Peatyr1, which shares high sequence similarity to members of the invertebrate tyramine-receptor family. The PeaTYR1 receptor was stably expressed in human embryonic kidney (HEK) 293 cells, and its ligand response has been examined. Receptor activation with tyramine reduces adenylyl cyclase activity in a dose-dependent manner (EC(50) approximately 350 nM). The inhibitory effect of tyramine is abolished by co-incubation with either yohimbine or chlorpromazine. Receptor expression has been investigated by reverse transcription polymerase chain reaction and immunocytochemistry. The mRNA is present in various tissues including brain, salivary glands, midgut, Malpighian tubules, and leg muscles. The effect of tyramine on salivary gland acinar cells has been investigated by intracellular recordings, which have revealed excitatory presynaptic actions of tyramine. This study marks the first comprehensive molecular, pharmacological, and functional characterization of a tyramine receptor in the cockroach.

Biochemical and structural characterization of a novel arginine kinase from the spider Polybetes pythagoricus

DOE PAGES

Laino, Aldana; Lopez-Zavala, Alonso A.; Garcia-Orozco, Karina D.; ...

2017-09-11

Energy buffering systems are key for homeostasis during variations in energy supply. Spiders are the most important predators for insects and therefore key in terrestrial ecosystems. From biomedical interest, spiders are important for their venoms and as a source of potent allergens, such as arginine kinase (AK, EC 2.7.3.3). AK is an enzyme crucial for energy metabolism, keeping the pool of phosphagens in invertebrates, and also an allergen for humans. In this work, we studied AK from the Argentininan spider Polybetes pythagoricus ( PpAK), from its complementary DNA to the crystal structure. The PpAK cDNA from muscle was cloned, andmore » it is comprised of 1068 nucleotides that encode a 384-amino acids protein, similar to other invertebrate AKs. The apparent Michaelis-Menten kinetic constant ( K m) was 1.7 mM with a k cat of 75 s –1. Two crystal structures are presented, the apo PvAK and PpAK bound to arginine, both in the open conformation with the active site lid (residues 310–320) completely disordered. The guanidino group binding site in the apo structure appears to be organized to accept the arginine substrate. Lastly, these results contribute to knowledge of mechanistic details of the function of arginine kinase.« less

Biochemical and structural characterization of a novel arginine kinase from the spider Polybetes pythagoricus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laino, Aldana; Lopez-Zavala, Alonso A.; Garcia-Orozco, Karina D.

Energy buffering systems are key for homeostasis during variations in energy supply. Spiders are the most important predators for insects and therefore key in terrestrial ecosystems. From biomedical interest, spiders are important for their venoms and as a source of potent allergens, such as arginine kinase (AK, EC 2.7.3.3). AK is an enzyme crucial for energy metabolism, keeping the pool of phosphagens in invertebrates, and also an allergen for humans. In this work, we studied AK from the Argentininan spider Polybetes pythagoricus ( PpAK), from its complementary DNA to the crystal structure. The PpAK cDNA from muscle was cloned, andmore » it is comprised of 1068 nucleotides that encode a 384-amino acids protein, similar to other invertebrate AKs. The apparent Michaelis-Menten kinetic constant ( K m) was 1.7 mM with a k cat of 75 s –1. Two crystal structures are presented, the apo PvAK and PpAK bound to arginine, both in the open conformation with the active site lid (residues 310–320) completely disordered. The guanidino group binding site in the apo structure appears to be organized to accept the arginine substrate. Lastly, these results contribute to knowledge of mechanistic details of the function of arginine kinase.« less

Chemical Space of DNA-Encoded Libraries.

PubMed

Franzini, Raphael M; Randolph, Cassie

2016-07-28

In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

A Bacteriophage-Encoded J-Domain Protein Interacts with the DnaK/Hsp70 Chaperone and Stabilizes the Heat-Shock Factor σ32 of Escherichia coli

PubMed Central

Perrody, Elsa; Cirinesi, Anne-Marie; Desplats, Carine; Keppel, France; Schwager, Françoise; Tranier, Samuel; Georgopoulos, Costa; Genevaux, Pierre

2012-01-01

The universally conserved J-domain proteins (JDPs) are obligate cochaperone partners of the Hsp70 (DnaK) chaperone. They stimulate Hsp70's ATPase activity, facilitate substrate delivery, and confer specific cellular localization to Hsp70. In this work, we have identified and characterized the first functional JDP protein encoded by a bacteriophage. Specifically, we show that the ORFan gene 057w of the T4-related enterobacteriophage RB43 encodes a bona fide JDP protein, named Rki, which specifically interacts with the Escherichia coli host multifunctional DnaK chaperone. However, in sharp contrast with the three known host JDP cochaperones of DnaK encoded by E. coli, Rki does not act as a generic cochaperone in vivo or in vitro. Expression of Rki alone is highly toxic for wild-type E. coli, but toxicity is abolished in the absence of endogenous DnaK or when the conserved J-domain of Rki is mutated. Further in vivo analyses revealed that Rki is expressed early after infection by RB43 and that deletion of the rki gene significantly impairs RB43 proliferation. Furthermore, we show that mutations in the host dnaK gene efficiently suppress the growth phenotype of the RB43 rki deletion mutant, thus indicating that Rki specifically interferes with DnaK cellular function. Finally, we show that the interaction of Rki with the host DnaK chaperone rapidly results in the stabilization of the heat-shock factor σ32, which is normally targeted for degradation by DnaK. The mechanism by which the Rki-dependent stabilization of σ32 facilitates RB43 bacteriophage proliferation is discussed. PMID:23133404

Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

PubMed

Livingston, B T; Shaw, R; Bailey, A; Wilt, F

1991-12-01

In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

Maternal Betaine Supplementation during Gestation Enhances Expression of mtDNA-Encoded Genes through D-Loop DNA Hypomethylation in the Skeletal Muscle of Newborn Piglets.

PubMed

Jia, Yimin; Song, Haogang; Gao, Guichao; Cai, Demin; Yang, Xiaojing; Zhao, Ruqian

2015-11-25

Betaine has been widely used in animal and human nutrition to promote muscle growth and performance, yet it remains unknown whether maternal betaine supplementation during gestation affects the metabolic characteristics of neonatal skeletal muscles. In the present study, feeding sows with betaine-supplemented diets throughout gestation significantly upregulated the expression of mtDNA-encoded OXPHOS genes (p < 0.05), including COX1, COX2, and ND5, in the muscle of newborn piglets, which was associated with enhanced mitochondrial COX enzyme activity (p < 0.05). Concurrently, maternal betaine supplementation increased the plasma betaine concentration and muscle expression of methyl transfer enzymes (p < 0.05), BHMT and GNMT, in offspring piglets. Nevertheless, Dnmt3a was downregulated at the level of both mRNA and protein, which was associated with a hypomethylated mtDNA D-loop region (p < 0.05). These results suggest that maternal betaine supplementation during gestation enhances expression of mtDNA-encoded genes through D-loop DNA hypomethylation in the skeletal muscle of newborn piglets.

Double stranded nucleic acid biochips

DOEpatents

Chernov, Boris; Golova, Julia

2006-05-23

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

Methods for transforming and expression screening of filamentous fungal cells with a DNA library

DOEpatents

Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

2015-06-02

The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

Potential of mean force of DNA guided assemblies past Debye-Hückel regime

NASA Astrophysics Data System (ADS)

Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica

Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.

Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

PubMed

Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

2013-07-15

Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

PubMed Central

Bogani, Federica; Boehmer, Paul E.

2008-01-01

Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymerase (Pol) (UL30) exhibits apurinic/apyrimidinic (AP) and 5′-deoxyribose phosphate (dRP) lyase activities. These activities are integral to BER and lead to DNA cleavage on the 3′ side of abasic sites and 5′-dRP residues that remain after cleavage by 5′-AP endonuclease. The UL30-catalyzed reaction occurs independently of divalent cation and proceeds via a Schiff base intermediate, indicating that it occurs via a lyase mechanism. Partial proteolysis of the Schiff base shows that the DNA lyase activity resides in the Pol domain of UL30. These observations together with the presence of a virus-encoded uracil DNA glycosylase indicates that HSV-1 has the capacity to perform critical steps in BER. These findings have implications on the role of BER in viral genome maintenance during lytic replication and reactivation from latency. PMID:18695225

Predication-based semantic indexing: permutations as a means to encode predications in semantic space.

PubMed

Cohen, Trevor; Schvaneveldt, Roger W; Rindflesch, Thomas C

2009-11-14

Corpus-derived distributional models of semantic distance between terms have proved useful in a number of applications. For both theoretical and practical reasons, it is desirable to extend these models to encode discrete concepts and the ways in which they are related to one another. In this paper, we present a novel vector space model that encodes semantic predications derived from MEDLINE by the SemRep system into a compact spatial representation. The associations captured by this method are of a different and complementary nature to those derived by traditional vector space models, and the encoding of predication types presents new possibilities for knowledge discovery and information retrieval.

Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

PubMed Central

Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

2013-01-01

An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

The catalytic A1 domains of cholera toxin and heat-labile enterotoxin are potent DNA adjuvants that evoke mixed Th1/Th17 cellular immune responses

PubMed Central

Bagley, Kenneth; Xu, Rong; Ota-Setlik, Ayuko; Egan, Michael; Schwartz, Jennifer; Fouts, Timothy

2015-01-01

DNA encoded adjuvants are well known for increasing the magnitude of cellular and/or humoral immune responses directed against vaccine antigens. DNA adjuvants can also tune immune responses directed against vaccine antigens to better protect against infection of the target organism. Two potent DNA adjuvants that have unique abilities to tune immune responses are the catalytic A1 domains of Cholera Toxin (CTA1) and Heat-Labile Enterotoxin (LTA1). Here, we have characterized the adjuvant activities of CTA1 and LTA1 using HIV and SIV genes as model antigens. Both of these adjuvants enhanced the magnitude of antigen-specific cellular immune responses on par with those induced by the well-characterized cytokine adjuvants IL-12 and GM-CSF. CTA1 and LTA1 preferentially enhanced cellular responses to the intracellular antigen SIVmac239-gag over those for the secreted HIVBaL-gp120 antigen. IL-12, GM-CSF and electroporation did the opposite suggesting differences in the mechanisms of actions of these diverse adjuvants. Combinations of CTA1 or LTA1 with IL-12 or GM-CSF generated additive and better balanced cellular responses to both of these antigens. Consistent with observations made with the holotoxin and the CTA1-DD adjuvant, CTA1 and LTA1 evoked mixed Th1/Th17 cellular immune responses. Together, these results show that CTA1 and LTA1 are potent DNA vaccine adjuvants that favor the intracellular antigen gag over the secreted antigen gp120 and evoke mixed Th1/Th17 responses against both of these antigens. The results also indicate that achieving a balanced immune response to multiple intracellular and extracellular antigens delivered via DNA vaccination may require combining adjuvants that have different and complementary mechanisms of action. PMID:26042527

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

A single ataxia telangiectasia gene with a product similar to PI-3 kinase.

PubMed

Savitsky, K; Bar-Shira, A; Gilad, S; Rotman, G; Ziv, Y; Vanagaite, L; Tagle, D A; Smith, S; Uziel, T; Sfez, S; Ashkenazi, M; Pecker, I; Frydman, M; Harnik, R; Patanjali, S R; Simmons, A; Clines, G A; Sartiel, A; Gatti, R A; Chessa, L; Sanal, O; Lavin, M F; Jaspers, N G; Taylor, A M; Arlett, C F; Miki, T; Weissman, S M; Lovett, M; Collins, F S; Shiloh, Y

1995-06-23

A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3' kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer.

Targeted and genome-scale methylomics reveals gene body signatures in human cell lines

PubMed Central

Ball, Madeleine Price; Li, Jin Billy; Gao, Yuan; Lee, Je-Hyuk; LeProust, Emily; Park, In-Hyun; Xie, Bin; Daley, George Q.; Church, George M.

2012-01-01

Cytosine methylation, an epigenetic modification of DNA, is a target of growing interest for developing high throughput profiling technologies. Here we introduce two new, complementary techniques for cytosine methylation profiling utilizing next generation sequencing technology: bisulfite padlock probes (BSPPs) and methyl sensitive cut counting (MSCC). In the first method, we designed a set of ~10,000 BSPPs distributed over the ENCODE pilot project regions to take advantage of existing expression and chromatin immunoprecipitation data. We observed a pattern of low promoter methylation coupled with high gene body methylation in highly expressed genes. Using the second method, MSCC, we gathered genome-scale data for 1.4 million HpaII sites and confirmed that gene body methylation in highly expressed genes is a consistent phenomenon over the entire genome. Our observations highlight the usefulness of techniques which are not inherently or intentionally biased in favor of only profiling particular subsets like CpG islands or promoter regions. PMID:19329998

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

PubMed Central

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

High-Resolution Sequence-Function Mapping of Full-Length Proteins

PubMed Central

Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.

2015-01-01

Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064

Cloning and functional expression of a plant voltage-dependent chloride channel.

PubMed Central

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

PubMed Central

Barth, Anna; Kobbe, Daniela; Focke, Manfred

2016-01-01

Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Swati; Kumar, Ashok, E-mail: rajesh-csir@yahoo.com, E-mail: ashokigib@rediffmail.com; Academy of Scientific and Innovative Research

A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to itsmore » complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml{sup −1} with a limit of detection of 0.16 ng ml{sup −1}.« less

Quantum dot-based microfluidic biosensor for cancer detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

2015-05-11

We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

Genetic programs can be compressed and autonomously decompressed in live cells

NASA Astrophysics Data System (ADS)

Lapique, Nicolas; Benenson, Yaakov

2018-04-01

Fundamental computer science concepts have inspired novel information-processing molecular systems in test tubes1-13 and genetically encoded circuits in live cells14-21. Recent research has shown that digital information storage in DNA, implemented using deep sequencing and conventional software, can approach the maximum Shannon information capacity22 of two bits per nucleotide23. In nature, DNA is used to store genetic programs, but the information content of the encoding rarely approaches this maximum24. We hypothesize that the biological function of a genetic program can be preserved while reducing the length of its DNA encoding and increasing the information content per nucleotide. Here we support this hypothesis by describing an experimental procedure for compressing a genetic program and its subsequent autonomous decompression and execution in human cells. As a test-bed we choose an RNAi cell classifier circuit25 that comprises redundant DNA sequences and is therefore amenable for compression, as are many other complex gene circuits15,18,26-28. In one example, we implement a compressed encoding of a ten-gene four-input AND gate circuit using only four genetic constructs. The compression principles applied to gene circuits can enable fitting complex genetic programs into DNA delivery vehicles with limited cargo capacity, and storing compressed and biologically inert programs in vivo for on-demand activation.

[Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

PubMed

Bukowski, Karol; Woźniak, Katarzyna

2018-03-09

Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(2):225-235. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

DNA-Encoded Dynamic Combinatorial Chemical Libraries.

PubMed

Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

2015-06-26

Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Non-essential MCM-related proteins mediate a response to DNA damage in the archaeon Methanococcus maripaludis.

PubMed

Walters, Alison D; Chong, James P J

2017-05-01

The single minichromosome maintenance (MCM) protein found in most archaea has been widely studied as a simplified model for the MCM complex that forms the catalytic core of the eukaryotic replicative helicase. Organisms of the order Methanococcales are unusual in possessing multiple MCM homologues. The Methanococcus maripaludis S2 genome encodes four MCM homologues, McmA-McmD. DNA helicase assays reveal that the unwinding activity of the three MCM-like proteins is highly variable despite sequence similarities and suggests additional motifs that influence MCM function are yet to be identified. While the gene encoding McmA could not be deleted, strains harbouring individual deletions of genes encoding each of the other MCMs display phenotypes consistent with these proteins modulating DNA damage responses. M. maripaludis S2 is the first archaeon in which MCM proteins have been shown to influence the DNA damage response.

Assessing the biocompatibility of click-linked DNA in Escherichia coli

PubMed Central

Sanzone, A. Pia; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

2012-01-01

The biocompatibility of a triazole mimic of the DNA phosphodiester linkage in Escherichia coli has been evaluated. The requirement for selective pressure on the click-containing gene was probed via a plasmid containing click DNA backbone linkages in each strand of the gene encoding the fluorescent protein mCherry. The effect of proximity of the click linkers on their biocompatibility was also probed by placing two click DNA linkers 4-bp apart at the region encoding the fluorophore of the fluorescent protein. The resulting click-containing plasmid was found to encode mCherry in E. coli at a similar level to the canonical equivalent. The ability of the cellular machinery to read through click-linked DNA was further probed by using the above click-linked plasmid to express mCherry using an in vitro transcription/translation system, and found to also be similar to that from canonical DNA. The yield and fluorescence of recombinant mCherry expressed from the click-linked plasmid was also compared to that from the canonical equivalent, and found to be the same. The biocompatibility of click DNA ligation sites at close proximity in a non-essential gene demonstrated in E. coli suggests the possibility of using click DNA ligation for the enzyme-free assembly of chemically modified genes and genomes. PMID:22904087

Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection

NASA Astrophysics Data System (ADS)

Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.

2017-09-01

Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.

Controlled assembly of artificial protein-protein complexes via DNA duplex formation.

PubMed

Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J

2015-03-18

DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles

1997-01-01

Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

Twenty-five Years of DNA-Encoded Chemical Libraries.

PubMed

Neri, Dario

2017-05-04

Reference library: The availability of DNA-encoded chemical libraries containing billions of compounds facilitates the discovery of binding molecules for pharmaceutical applications and for investigating biological processes. This Special Issue highlights the use of this library technology and some of the latest developments in the field. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA encoding for plant digalactosyldiacylglycerol galactosyltransferase and methods of use

DOEpatents

Benning, Christoph; Doermann, Peter

2003-11-04

The cDNA encoding digalactosyldiacylglycerol galactosyltransferase (DGD1) is provided. The deduced amino acid sequence is also provided. Methods of making and using DGD1 to screen for new herbicides and alter a plant's leaf lipid composition are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors.

Antibodies specific for HT.sub.m4

DOEpatents

Lim, Bing; Adra, Chaker N.; Lelias, Jean-Michel

1998-01-01

The invention relates to a recombinant DNA molecule which encodes a HT.sub.m4 protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT.sub.m4 protein and a recombinant HT.sub.m4 protein. The invention also relates to a method for detecting the presence of a hereditary atopy.

Amplifying genetic logic gates.

PubMed

Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

2013-05-03

Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

PubMed

Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

2017-02-23

Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny.

PubMed

Yu, Xiang-Qin; Drew, Bryan T; Yang, Jun-Bo; Gao, Lian-Ming; Li, De-Zhu

2017-01-01

Schima is an ecologically and economically important woody genus in tea family (Theaceae). Unresolved species delimitations and phylogenetic relationships within Schima limit our understanding of the genus and hinder utilization of the genus for economic purposes. In the present study, we conducted comparative analysis among the complete chloroplast (cp) genomes of 11 Schima species. Our results indicate that Schima cp genomes possess a typical quadripartite structure, with conserved genomic structure and gene order. The size of the Schima cp genome is about 157 kilo base pairs (kb). They consistently encode 114 unique genes, including 80 protein-coding genes, 30 tRNAs, and 4 rRNAs, with 17 duplicated in the inverted repeat (IR). These cp genomes are highly conserved and do not show obvious expansion or contraction of the IR region. The percent variability of the 68 coding and 93 noncoding (>150 bp) fragments is consistently less than 3%. The seven most widely touted DNA barcode regions as well as one promising barcode candidate showed low sequence divergence. Eight mutational hotspots were identified from the 11 cp genomes. These hotspots may potentially be useful as specific DNA barcodes for species identification of Schima. The 58 cpSSR loci reported here are complementary to the microsatellite markers identified from the nuclear genome, and will be leveraged for further population-level studies. Phylogenetic relationships among the 11 Schima species were resolved with strong support based on the cp genome data set, which corresponds well with the species distribution pattern. The data presented here will serve as a foundation to facilitate species identification, DNA barcoding and phylogenetic reconstructions for future exploration of Schima.

Identification of DNA gyrase inhibitor (GyrI) in Escherichia coli.

PubMed

Nakanishi, A; Oshida, T; Matsushita, T; Imajoh-Ohmi, S; Ohnuki, T

1998-01-23

DNA gyrase is an essential enzyme in DNA replication in Escherichia coli. It mediates the introduction of negative supercoils near oriC, removal of positive supercoils ahead of the growing DNA fork, and separation of the two daughter duplexes. In the course of purifying DNA gyrase from E. coli KL16, we found an 18-kDa protein that inhibited the supercoiling activity of DNA gyrase, and we coined it DNA gyrase inhibitory protein (GyrI). Its NH2-terminal amino acid sequence of 16 residues was determined to be identical to that of a putative gene product (a polypeptide of 157 amino acids) encoded by yeeB (EMBL accession no. U00009) and sbmC (Baquero, M. R., Bouzon, M., Varea, J., and Moreno, F. (1995) Mol. Microbiol. 18, 301-311) of E. coli. Assuming the identity of the gene (gyrI) encoding GyrI with the previously reported genes yeeB and sbmC, we cloned the gene after amplification by polymerase chain reaction and purified the 18-kDa protein from an E. coli strain overexpressing it. The purified 18-kDa protein was confirmed to inhibit the supercoiling activity of DNA gyrase in vitro. In vivo, both overexpression and antisense expression of the gyrI gene induced filamentous growth of cells and suppressed cell proliferation. GyrI protein is the first identified chromosomally nucleoid-encoded regulatory factor of DNA gyrase in E. coli.

The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor.

PubMed

Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza

2014-12-01

This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.

Double dissociation of value computations in orbitofrontal and anterior cingulate neurons

PubMed Central

Kennerley, Steven W.; Behrens, Timothy E. J.; Wallis, Jonathan D.

2011-01-01

Damage to prefrontal cortex (PFC) impairs decision-making, but the underlying value computations that might cause such impairments remain unclear. Here we report that value computations are doubly dissociable within PFC neurons. While many PFC neurons encoded chosen value, they used opponent encoding schemes such that averaging the neuronal population eliminated value coding. However, a special population of neurons in anterior cingulate cortex (ACC) - but not orbitofrontal cortex (OFC) - multiplex chosen value across decision parameters using a unified encoding scheme, and encoded reward prediction errors. In contrast, neurons in OFC - but not ACC - encoded chosen value relative to the recent history of choice values. Together, these results suggest complementary valuation processes across PFC areas: OFC neurons dynamically evaluate current choices relative to recent choice values, while ACC neurons encode choice predictions and prediction errors using a common valuation currency reflecting the integration of multiple decision parameters. PMID:22037498

Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

PubMed

Ahour, F; Shamsi, A

2017-09-01

Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA Gyrase Is the Target for the Quinolone Drug Ciprofloxacin in Arabidopsis thaliana*

PubMed Central

Evans-Roberts, Katherine M.; Mitchenall, Lesley A.; Wall, Melisa K.; Leroux, Julie; Mylne, Joshua S.; Maxwell, Anthony

2016-01-01

The Arabidopsis thaliana genome contains four genes that were originally annotated as potentially encoding DNA gyrase: ATGYRA, ATGYRB1, ATGYRB2, and ATGYRB3. Although we subsequently showed that ATGYRB3 does not encode a gyrase subunit, the other three genes potentially encode subunits of a plant gyrase. We also showed evidence for the existence of supercoiling activity in A. thaliana and that the plant is sensitive to quinolone and aminocoumarin antibiotics, compounds that target DNA gyrase in bacteria. However, it was not possible at that time to show whether the A. thaliana genes encoded an active gyrase enzyme, nor whether that enzyme is indeed the target for the quinolone and aminocoumarin antibiotics. Here we show that an A. thaliana mutant resistant to the quinolone drug ciprofloxacin has a point mutation in ATGYRA. Moreover we show that, as in bacteria, the quinolone-sensitive (wild-type) allele is dominant to the resistant gene. Further we have heterologously expressed ATGYRA and ATGYRB2 in a baculovirus expression system and shown supercoiling activity of the partially purified enzyme. Expression/purification of the quinolone-resistant A. thaliana gyrase yields active enzyme that is resistant to ciprofloxacin. Taken together these experiments now show unequivocally that A. thaliana encodes an organelle-targeted DNA gyrase that is the target of the quinolone drug ciprofloxacin; this has important consequences for plant physiology and the development of herbicides. PMID:26663076

ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

Cancer.gov

The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

2017-12-01

Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

Recombinant HT{sub m4} gene, protein and assays

DOEpatents

Lim, B.; Adra, C.N.; Lelias, J.M.

1996-09-03

The invention relates to a recombinant DNA molecule which encodes a HT{sub m4} protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT{sub m4} protein and a recombinant HT{sub m4} protein. The invention also relates to a method for detecting the presence of a hereditary atopy. 2 figs.

Antibodies specific for HT{sub m4}

DOEpatents

Lim, B.; Adra, C.N.; Lelias, J.M.

1998-01-06

The invention relates to a recombinant DNA molecule which encodes a HT{sub m4} protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT{sub m4} protein and a recombinant HT{sub m4} protein. The invention also relates to a method for detecting the presence of a hereditary atopy. 2 figs.

Recombinant HT.sub.m4 gene, protein and assays

DOEpatents

Lim, Bing; Adra, Chaker N.; Lelias, Jean-Michel

1996-01-01

The invention relates to a recombinant DNA molecule which encodes a HT.sub.m4 protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT.sub.m4 protein and a recombinant HT.sub.m4 protein. The invention also relates to a method for detecting the presence of a hereditary atopy.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, S.; Richardson, C.

1997-03-25

A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

NASA Astrophysics Data System (ADS)

Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

2017-02-01

The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber, to reanneal the reshuffled library. In the binding chamber (the cooled chamber) specific retaining structures are integrated. These hold back beads functionalized with the target protein, while the chamber is continuously flushed with library molecules. Afterwards the whole system can be flushed with buffer to wash out unspecific bound molecules. Finally the protein-loaded beads with attached molecules can be eluted for further investigation.

Connective tissue growth factor linked to the E7 tumor antigen generates potent antitumor immune responses mediated by an antiapoptotic mechanism.

PubMed

Cheng, W-F; Chang, M-C; Sun, W-Z; Lee, C-N; Lin, H-W; Su, Y-N; Hsieh, C-Y; Chen, C-A

2008-07-01

A novel method for generating an antigen-specific cancer vaccine and immunotherapy has emerged using a DNA vaccine. However, antigen-presenting cells (APCs) have a limited life span, which hinders their long-term ability to prime antigen-specific T cells. Connective tissue growth factor (CTGF) has a role in cell survival. This study explored the intradermal administration of DNA encoding CTGF with a model tumor antigen, human papilloma virus type 16 E7. Mice vaccinated with CTGF/E7 DNA exhibited a dramatic increase in E7-specific CD4(+) and CD8(+) T-cell precursors. They also showed an impressive antitumor effect against E7-expressing tumors compared with mice vaccinated with the wild-type E7 DNA. The delivery of DNA encoding CTGF and E7 or CTGF alone could prolong the survival of transduced dendritic cells (DCs) in vivo. In addition, CTGF/E7-transduced DCs could enhance a higher number of E7-specific CD8(+) T cells than E7-transduced DCs. By prolonging the survival of APCs, DNA vaccine encoding CTGF linked to a tumor antigen represents an innovative approach to enhance DNA vaccine potency and holds promise for cancer prophylaxis and immunotherapy.

Temperate Phages Acquire DNA from Defective Prophages by Relaxed Homologous Recombination: The Role of Rad52-Like Recombinases

PubMed Central

De Paepe, Marianne; Hutinet, Geoffrey; Son, Olivier; Amarir-Bouhram, Jihane; Schbath, Sophie; Petit, Marie-Agnès

2014-01-01

Bacteriophages (or phages) dominate the biosphere both numerically and in terms of genetic diversity. In particular, genomic comparisons suggest a remarkable level of horizontal gene transfer among temperate phages, favoring a high evolution rate. Molecular mechanisms of this pervasive mosaicism are mostly unknown. One hypothesis is that phage encoded recombinases are key players in these horizontal transfers, thanks to their high efficiency and low fidelity. Here, we associate two complementary in vivo assays and a bioinformatics analysis to address the role of phage encoded recombinases in genomic mosaicism. The first assay allowed determining the genetic determinants of mosaic formation between lambdoid phages and Escherichia coli prophage remnants. In the second assay, recombination was monitored between sequences on phage λ, and allowed to compare the performance of three different Rad52-like recombinases on the same substrate. We also addressed the importance of homologous recombination in phage evolution by a genomic comparison of 84 E. coli virulent and temperate phages or prophages. We demonstrate that mosaics are mainly generated by homology-driven mechanisms that tolerate high substrate divergence. We show that phage encoded Rad52-like recombinases act independently of RecA, and that they are relatively more efficient when the exchanged fragments are divergent. We also show that accessory phage genes orf and rap contribute to mosaicism. A bioinformatics analysis strengthens our experimental results by showing that homologous recombination left traces in temperate phage genomes at the borders of recently exchanged fragments. We found no evidence of exchanges between virulent and temperate phages of E. coli. Altogether, our results demonstrate that Rad52-like recombinases promote gene shuffling among temperate phages, accelerating their evolution. This mechanism may prove to be more general, as other mobile genetic elements such as ICE encode Rad52-like functions, and play an important role in bacterial evolution itself. PMID:24603854

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

PubMed

Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

2015-08-13

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT)

PubMed Central

2015-01-01

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure–activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality. PMID:26288689

Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

NASA Astrophysics Data System (ADS)

Liu, Qinghua

The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

EPA Science Inventory

A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

SEMI-ROLLED LEAF1 Encodes a Putative Glycosylphosphatidylinositol-Anchored Protein and Modulates Rice Leaf Rolling by Regulating the Formation of Bulliform Cells1[W][OA

PubMed Central

Xiang, Jing-Jing; Zhang, Guang-Heng; Qian, Qian; Xue, Hong-Wei

2012-01-01

Leaf rolling is an important agronomic trait in rice (Oryza sativa) breeding and moderate leaf rolling maintains the erectness of leaves and minimizes shadowing between leaves, leading to improved photosynthetic efficiency and grain yields. Although a few rolled-leaf mutants have been identified and some genes controlling leaf rolling have been isolated, the molecular mechanisms of leaf rolling still need to be elucidated. Here we report the isolation and characterization of SEMI-ROLLED LEAF1 (SRL1), a gene involved in the regulation of leaf rolling. Mutants srl1-1 (point mutation) and srl1-2 (transferred DNA insertion) exhibit adaxially rolled leaves due to the increased numbers of bulliform cells at the adaxial cell layers, which could be rescued by complementary expression of SRL1. SRL1 is expressed in various tissues and is expressed at low levels in bulliform cells. SRL1 protein is located at the plasma membrane and predicted to be a putative glycosylphosphatidylinositol-anchored protein. Moreover, analysis of the gene expression profile of cells that will become epidermal cells in wild type but probably bulliform cells in srl1-1 by laser-captured microdissection revealed that the expression of genes encoding vacuolar H+-ATPase (subunits A, B, C, and D) and H+-pyrophosphatase, which are increased during the formation of bulliform cells, were up-regulated in srl1-1. These results provide the transcript profile of rice leaf cells that will become bulliform cells and demonstrate that SRL1 regulates leaf rolling through inhibiting the formation of bulliform cells by negatively regulating the expression of genes encoding vacuolar H+-ATPase subunits and H+-pyrophosphatase, which will help to understand the mechanism regulating leaf rolling. PMID:22715111

Localizing Proteins in Fixed Giardia lamblia and Live Cultured Mammalian Cells by Confocal Fluorescence Microscopy.

PubMed

Nyindodo-Ogari, Lilian; Schwartzbach, Steven D; Skalli, Omar; Estraño, Carlos E

2016-01-01

Confocal fluorescence microscopy and electron microscopy (EM) are complementary methods for studying the intracellular localization of proteins. Confocal fluorescence microscopy provides a rapid and technically simple method to identify the organelle in which a protein localizes but only EM can identify the suborganellular compartment in which that protein is present. Confocal fluorescence microscopy, however, can provide information not obtainable by EM but required to understand the dynamics and interactions of specific proteins. In addition, confocal fluorescence microscopy of cells transfected with a construct encoding a protein of interest fused to a fluorescent protein tag allows live cell studies of the subcellular localization of that protein and the monitoring in real time of its trafficking. Immunostaining methods for confocal fluorescence microscopy are also faster and less involved than those for EM allowing rapid optimization of the antibody dilution needed and a determination of whether protein antigenicity is maintained under fixation conditions used for EM immunogold labeling. This chapter details a method to determine by confocal fluorescence microscopy the intracellular localization of a protein by transfecting the organism of interest, in this case Giardia lamblia, with the cDNA encoding the protein of interest and then processing these organisms for double label immunofluorescence staining after chemical fixation. Also presented is a method to identify the organelle targeting information in the presequence of a precursor protein, in this case the presequence of the precursor to the Euglena light harvesting chlorophyll a/b binding protein of photosystem II precursor (pLHCPII), using live cell imaging of mammalian COS7 cells transiently transfected with a plasmid encoding a pLHCPII presequence fluorescent protein fusion and stained with organelle-specific fluorescent dyes.

Structure and expression strategy of the genome of Culex pipiens densovirus, a mosquito densovirus with an ambisense organization.

PubMed

Baquerizo-Audiot, Elizabeth; Abd-Alla, Adly; Jousset, Françoise-Xavière; Cousserans, François; Tijssen, Peter; Bergoin, Max

2009-07-01

The genome of all densoviruses (DNVs) so far isolated from mosquitoes or mosquito cell lines consists of a 4-kb single-stranded DNA molecule with a monosense organization (genus Brevidensovirus, subfamily Densovirinae). We previously reported the isolation of a Culex pipiens DNV (CpDNV) that differs significantly from brevidensoviruses by (i) having a approximately 6-kb genome, (ii) lacking sequence homology, and (iii) lacking antigenic cross-reactivity with Brevidensovirus capsid polypeptides. We report here the sequence organization and transcription map of this virus. The cloned genome of CpDNV is 5,759 nucleotides (nt) long, and it possesses an inverted terminal repeat (ITR) of 285 nt and an ambisense organization of its genes. The nonstructural (NS) proteins NS-1, NS-2, and NS-3 are located in the 5' half of one strand and are organized into five open reading frames (ORFs) due to the split of both NS-1 and NS-2 into two ORFs. The ORF encoding capsid polypeptides is located in the 5' half of the complementary strand. The expression of NS proteins is controlled by two promoters, P7 and P17, driving the transcription of a 2.4-kb mRNA encoding NS-3 and of a 1.8-kb mRNA encoding NS-1 and NS-2, respectively. The two NS mRNAs species are spliced off a 53-nt sequence. Capsid proteins are translated from an unspliced 2.3-kb mRNA driven by the P88 promoter. CpDNV thus appears as a new type of mosquito DNV, and based on the overall organization and expression modalities of its genome, it may represent the prototype of a new genus of DNV.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

A novel chaotic image encryption scheme using DNA sequence operations

NASA Astrophysics Data System (ADS)

Wang, Xing-Yuan; Zhang, Ying-Qian; Bao, Xue-Mei

2015-10-01

In this paper, we propose a novel image encryption scheme based on DNA (Deoxyribonucleic acid) sequence operations and chaotic system. Firstly, we perform bitwise exclusive OR operation on the pixels of the plain image using the pseudorandom sequences produced by the spatiotemporal chaos system, i.e., CML (coupled map lattice). Secondly, a DNA matrix is obtained by encoding the confused image using a kind of DNA encoding rule. Then we generate the new initial conditions of the CML according to this DNA matrix and the previous initial conditions, which can make the encryption result closely depend on every pixel of the plain image. Thirdly, the rows and columns of the DNA matrix are permuted. Then, the permuted DNA matrix is confused once again. At last, after decoding the confused DNA matrix using a kind of DNA decoding rule, we obtain the ciphered image. Experimental results and theoretical analysis show that the scheme is able to resist various attacks, so it has extraordinarily high security.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Step-gate polysilicon nanowires field effect transistor compatible with CMOS technology for label-free DNA biosensor.

PubMed

Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F

2013-02-15

Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.

Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

PubMed

Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

2009-07-01

XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

PubMed

Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

2012-01-01

A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

PubMed Central

McWilliams, D; Callahan, R C; Boime, I

1977-01-01

A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

PubMed

Thomason, Lynn C; Costantino, Nina; Court, Donald L

2016-09-13

Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

PubMed

Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

2016-04-01

An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

PubMed

Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

2016-12-01

Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

PubMed Central

Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

1992-01-01

The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

HT.sub.m4 methods of treatment and assays, agonists and antagonists

DOEpatents

Lim, Bing; Adra, Chaker N.; Lelias, Jean-Michel

1999-01-01

The invention relates to a recombinant DNA molecule which encodes a HT.sub.m4 protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT.sub.m4 protein and a recombinant HT.sub.m4 protein. The invention also relates to a method for detecting the presence of a hereditary atopy.

Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

1984-02-01

Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

Identification of a maize nucleic acid-binding protein (NBP) belonging to a family of nuclear-encoded chloroplast proteins.

PubMed Central

Cook, W B; Walker, J C

1992-01-01

A cDNA encoding a nuclear-encoded chloroplast nucleic acid-binding protein (NBP) has been isolated from maize. Identified as an in vitro DNA-binding activity, NBP belongs to a family of nuclear-encoded chloroplast proteins which share a common domain structure and are thought to be involved in posttranscriptional regulation of chloroplast gene expression. NBP contains an N-terminal chloroplast transit peptide, a highly acidic domain and a pair of ribonucleoprotein consensus sequence domains. NBP is expressed in a light-dependent, organ-specific manner which is consistent with its involvement in chloroplast biogenesis. The relationship of NBP to the other members of this protein family and their possible regulatory functions are discussed. Images PMID:1346929

Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

PubMed

Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

2014-01-01

In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

NASA Astrophysics Data System (ADS)

Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

2016-09-01

Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Poliovirus RNA polymerase: in vitro enzymatic activities, fidelity of replication, and characterization of a temperature-sensitive RNA-negative mutant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stokes, M.A.M.

1985-01-01

The in vitro activities of the purified poliovirus RNA polymerase were investigated in this study. The polymerase was shown to be a strict RNA dependent RNA polymerase. It only copied RNA templates but used either a DNA or RNA primer to initiate RNA synthesis. Partially purified polymerase has some DNA polymerase activities. Additional purification of the enzyme and studies with a mutant poliovirus RNA polymerase indicated that the DNA polymerase activities were due to a cellular polymerase. The fidelity of RNA replication in vitro by the purified poliovirus RNA polymerase was studied by measuring the rate of misincorporation of noncomplementarymore » ribonucleotide monophosphates on synthetic homopolymeric RNA templates. The results showed that the ratio of noncomplementary to complementary ribonucleotides incorporated was 1-5 x 10/sup -3/. The viral polymerase of a poliovirus temperature sensitive RNA-negative mutant, Ts 10, was isolated. This study confirmed that the mutant was viable 33/sup 0/, but was RNA negative at 39/sup 0/. Characterization of the Ts 10 polymerase showed it was significantly more sensitive to heat inactivation than was the old-type polymerase. Highly purified poliovirions were found to contain several noncapsid proteins. At least two of these proteins were labeled by (/sup 35/S)methionine infected cells and appeared to be virally encoded proteins. One of these proteins was immunoprecipitated by anti-3B/sup vpg/ antiserum. This protein had the approximate Mr = 50,000 and appeared to be one of the previously identified 3B/sup vpg/ precursor proteins.« less

Identification and characterization of the reptilian GnRH-II gene in the leopard gecko, Eublepharis macularius, and its evolutionary considerations.

PubMed

Ikemoto, Tadahiro; Park, Min Kyun

2003-10-16

To elucidate the molecular phylogeny and evolution of a particular peptide, one must analyze not the limited primary amino acid sequences of the low molecular weight mature polypeptide, but rather the sequences of the corresponding precursors from various species. Of all the structural variants of gonadotropin-releasing hormone (GnRH), GnRH-II (chicken GnRH-II, or cGnRH-II) is remarkably conserved without any sequence substitutions among vertebrates, but its precursor sequences vary considerably. We have identified and characterized the full-length complementary DNA (cDNA) encoding the GnRH-II precursor and determined its genomic structure, consisting of four exons and three introns, in a reptilian species, the leopard gecko Eublepharis macularius. This is the first report about the GnRH-II precursor cDNA/gene from reptiles. The deduced leopard gecko prepro-GnRH-II polypeptide had the highest identities with the corresponding polypeptides of amphibians. The GnRH-II precursor mRNA was detected in more than half of the tissues and organs examined. This widespread expression is consistent with the previous findings in several species, though the roles of GnRH outside the hypothalamus-pituitary-gonadal axis remain largely unknown. Molecular phylogenetic analysis combined with sequence comparison showed that the leopard gecko is more similar to fishes and amphibians than to eutherian mammals with respect to the GnRH-II precursor sequence. These results strongly suggest that the divergence of the GnRH-II precursor sequences seen in eutherian mammals may have occurred along with amniote evolution.

Cinnamate:CoA ligase initiates the biosynthesis of a benzoate-derived xanthone phytoalexin in Hypericum calycinum cell cultures.

PubMed

Gaid, Mariam M; Sircar, Debabrata; Müller, Andreas; Beuerle, Till; Liu, Benye; Ernst, Ludger; Hänsch, Robert; Beerhues, Ludger

2012-11-01

Although a number of plant natural products are derived from benzoic acid, the biosynthesis of this structurally simple precursor is poorly understood. Hypericum calycinum cell cultures accumulate a benzoic acid-derived xanthone phytoalexin, hyperxanthone E, in response to elicitor treatment. Using a subtracted complementary DNA (cDNA) library and sequence information about conserved coenzyme A (CoA) ligase motifs, a cDNA encoding cinnamate:CoA ligase (CNL) was isolated. This enzyme channels metabolic flux from the general phenylpropanoid pathway into benzenoid metabolism. HcCNL preferred cinnamic acid as a substrate but failed to activate benzoic acid. Enzyme activity was strictly dependent on the presence of Mg²⁺ and K⁺ at optimum concentrations of 2.5 and 100 mM, respectively. Coordinated increases in the Phe ammonia-lyase and HcCNL transcript levels preceded the accumulation of hyperxanthone E in cell cultures of H. calycinum after the addition of the elicitor. HcCNL contained a carboxyl-terminal type 1 peroxisomal targeting signal made up by the tripeptide Ser-Arg-Leu, which directed an amino-terminal reporter fusion to the peroxisomes. Masking the targeting signal by carboxyl-terminal reporter fusion led to cytoplasmic localization. A phylogenetic tree consisted of two evolutionarily distinct clusters. One cluster was formed by CoA ligases related to benzenoid metabolism, including HcCNL. The other cluster comprised 4-coumarate:CoA ligases from spermatophytes, ferns, and mosses, indicating divergence of the two clades prior to the divergence of the higher plant lineages.

Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

PubMed

Naimuddin, Mohammed; Kubo, Tai

2011-12-01

We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

Theory and modeling of particles with DNA-mediated interactions

NASA Astrophysics Data System (ADS)

Licata, Nicholas A.

In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. A quantitative comparison between the theory and experiments is made by calculating the experimentally observed melting profile. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. The model predicts a crossover from localized to diffusive behavior. The random walk statistics for the particles' in plane diffusion is discussed. The lateral motion is analogous to dispersive transport in disordered semiconductors, ranging from standard diffusion with a renormalized diffusion coefficient to anomalous, subdiffusive behavior. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. An optimal concentration ratio is determined for the experimental implementation of our self-assembly proposal. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. We determine the probability that the system self-assembles the desired cluster geometry, and discuss the connections to jamming in granular and colloidal systems. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. A key-lock model is proposed to describe the results of in-vitro experiments, and the situation in-vivo is discussed. The cooperative binding, and hence the specificity to cancerous cells, is kinetically limited. The implications for optimizing the design of nanoparticle based drug delivery platforms is discussed. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

An Efficient Method for Electroporation of Small Interfering RNAs into ENCODE Project Tier 1 GM12878 and K562 Cell Lines.

PubMed

Muller, Ryan Y; Hammond, Ming C; Rio, Donald C; Lee, Yeon J

2015-12-01

The Encyclopedia of DNA Elements (ENCODE) Project aims to identify all functional sequence elements in the human genome sequence by use of high-throughput DNA/cDNA sequencing approaches. To aid the standardization, comparison, and integration of data sets produced from different technologies and platforms, the ENCODE Consortium selected several standard human cell lines to be used by the ENCODE Projects. The Tier 1 ENCODE cell lines include GM12878, K562, and H1 human embryonic stem cell lines. GM12878 is a lymphoblastoid cell line, transformed with the Epstein-Barr virus, that was selected by the International HapMap Project for whole genome and transcriptome sequencing by use of the Illumina platform. K562 is an immortalized myelogenous leukemia cell line. The GM12878 cell line is attractive for the ENCODE Projects, as it offers potential synergy with the International HapMap Project. Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. Here, we present an efficient and reproducible method for transfection of a variety of siRNAs into the GM12878 and K562 cell lines, which subsequently results in targeted protein depletion.

TF1, the bacteriophage SPO1-encoded type II DNA-binding protein, is essential for viral multiplication.

PubMed

Sayre, M H; Geiduschek, E P

1988-09-01

The lytic Bacillus subtilis bacteriophage SPO1 encodes an abundant, 99-amino-acid type II DNA-binding protein, transcription factor 1 (TF1). TF1 is special in this family of procaryotic chromatin-forming proteins in its preference for hydroxymethyluracil-containing DNA, such as SPO1 DNA, and in binding with high affinity to specific sites in the SPO1 chromosome. We constructed recessive null alleles of the TF1 gene and introduced them into SPO1 chromosomes. Segregation analysis with partially diploid phage heterozygous for TF1 showed that phage bearing only these null alleles was inviable. Deletion of the nine C-proximal amino acids of TF1 prohibited phage multiplication in vivo and abolished its site-specific DNA-binding activity in vitro.

Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses.

PubMed

Pritham, Ellen J; Putliwala, Tasneem; Feschotte, Cédric

2007-04-01

We previously identified a group of atypical mobile elements designated Mavericks from the nematodes Caenorhabditis elegans and C. briggsae and the zebrafish Danio rerio. Here we present the results of comprehensive database searches of the genome sequences available, which reveal that Mavericks are widespread in invertebrates and non-mammalian vertebrates but show a patchy distribution in non-animal species, being present in the fungi Glomus intraradices and Phakopsora pachyrhizi and in several single-celled eukaryotes such as the ciliate Tetrahymena thermophila, the stramenopile Phytophthora infestans and the trichomonad Trichomonas vaginalis, but not detectable in plants. This distribution, together with comparative and phylogenetic analyses of Maverick-encoded proteins, is suggestive of an ancient origin of these elements in eukaryotes followed by lineage-specific losses and/or recurrent episodes of horizontal transmission. In addition, we report that Maverick elements have amplified recently to high copy numbers in T. vaginalis where they now occupy as much as 30% of the genome. Sequence analysis confirms that most Mavericks encode a retroviral-like integrase, but lack other open reading frames typically found in retroelements. Nevertheless, the length and conservation of the target site duplication created upon Maverick insertion (5- or 6-bp) is consistent with a role of the integrase-like protein in the integration of a double-stranded DNA transposition intermediate. Mavericks also display long terminal-inverted repeats but do not contain ORFs similar to proteins encoded by DNA transposons. Instead, Mavericks encode a conserved set of 5 to 9 genes (in addition to the integrase) that are predicted to encode proteins with homology to replication and packaging proteins of some bacteriophages and diverse eukaryotic double-stranded DNA viruses, including a DNA polymerase B homolog and putative capsid proteins. Based on these and other structural similarities, we speculate that Mavericks represent an evolutionary missing link between seemingly disparate invasive DNA elements that include bacteriophages, adenoviruses and eukaryotic linear plasmids.

DNA Gyrase Is the Target for the Quinolone Drug Ciprofloxacin in Arabidopsis thaliana.

PubMed

Evans-Roberts, Katherine M; Mitchenall, Lesley A; Wall, Melisa K; Leroux, Julie; Mylne, Joshua S; Maxwell, Anthony

2016-02-12

The Arabidopsis thaliana genome contains four genes that were originally annotated as potentially encoding DNA gyrase: ATGYRA, ATGYRB1, ATGYRB2, and ATGYRB3. Although we subsequently showed that ATGYRB3 does not encode a gyrase subunit, the other three genes potentially encode subunits of a plant gyrase. We also showed evidence for the existence of supercoiling activity in A. thaliana and that the plant is sensitive to quinolone and aminocoumarin antibiotics, compounds that target DNA gyrase in bacteria. However, it was not possible at that time to show whether the A. thaliana genes encoded an active gyrase enzyme, nor whether that enzyme is indeed the target for the quinolone and aminocoumarin antibiotics. Here we show that an A. thaliana mutant resistant to the quinolone drug ciprofloxacin has a point mutation in ATGYRA. Moreover we show that, as in bacteria, the quinolone-sensitive (wild-type) allele is dominant to the resistant gene. Further we have heterologously expressed ATGYRA and ATGYRB2 in a baculovirus expression system and shown supercoiling activity of the partially purified enzyme. Expression/purification of the quinolone-resistant A. thaliana gyrase yields active enzyme that is resistant to ciprofloxacin. Taken together these experiments now show unequivocally that A. thaliana encodes an organelle-targeted DNA gyrase that is the target of the quinolone drug ciprofloxacin; this has important consequences for plant physiology and the development of herbicides. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Complementary DNA cloning and organ expression of cytochrome P450 1C2 in carp (Cyprinus carpio).

PubMed

Kaminishi, Yoshio; El-Kady, Mohamed A H; Mitsuo, Ryoichi; Itakura, Takao

2007-01-01

Cytochrome P450 (CYP) genes, which make up a large gene superfamily, are known to play an important role in drug metabolism. The CYP1 family, one of the gene families of the CYP superfamily, has three subfamilies of genes whose sequences have been deposited in the GenBank/EMBL thus far: CYP1A, CYP1B, and CYP1C. Mammals as well as fish confront numerous foreign chemicals in the environment that may accumulate to toxic levels unless they are metabolized and eliminated by processes largely mediated by CYP enzymes. A new complementary DNA of the CYP1C subfamily encoding CYP1C2 was isolated from the carp liver after a single intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 198 bp, an open reading frame of 1575 bp coding for 524 amino acids and a stop codon, and a 3' noncoding region of 531 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The amino acid sequence deduced from the carp CYP1C2 sequence showed a similarity of 76.6% with that deduced from our previously reported carp CYP1C1. It exhibited similarities of 77.3, 73.7, and 76.4% with those deduced from scup CYP1C2, scup CYP1C1, and Japanese eel CYP1C1 sequences, respectively. Carp CYP1C2 cDNA showed similarities with reported CYP1Bs of teleosts and mammals, namely, 47.6, 45.3, 45.7, 44.0, and 44.6% for carp, plaice, human, rat, and mouse CYP1B1s, respectively, while it exhibited a similarity of 49.0% with carp CYP1B2. The carp CYP1C2 sequence was aligned with the CYP1 sequences and has been deposited in the GenBank/EMBL data bank with the accession number AY437777. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of CYP1C with CYP1B than with CYP1A. The tree showed possibile existence of CYP1C subfamily genes in mammalian species. Northern blot analysis of the liver, intestines, kidneys, and gills revealed a distinct induced expression only in the kidneys, with no detectable constitutive expression in the other organs studied.

Characterization of soil nematode communities in three cropping systems through morphological and DNA metabarcoding approaches

USDA-ARS?s Scientific Manuscript database

Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...

Sequence Identification, Recombinant Production, and Analysis of the Self-Assembly of Egg Stalk Silk Proteins from Lacewing Chrysoperla carnea.

PubMed

Neuenfeldt, Martin; Scheibel, Thomas

2017-06-13

Egg stalk silks of the common green lacewing Chrysoperla carnea likely comprise at least three different silk proteins. Based on the natural spinning process, it was hypothesized that these proteins self-assemble without shear stress, as adult lacewings do not use a spinneret. To examine this, the first sequence identification and determination of the gene expression profile of several silk proteins and various transcript variants thereof was conducted, and then the three major proteins were recombinantly produced in Escherichia coli encoded by their native complementary DNA (cDNA) sequences. Circular dichroism measurements indicated that the silk proteins in aqueous solutions had a mainly intrinsically disordered structure. The largest silk protein, which we named ChryC1, exhibited a lower critical solution temperature (LCST) behavior and self-assembled into fibers or film morphologies, depending on the conditions used. The second silk protein, ChryC2, self-assembled into nanofibrils and subsequently formed hydrogels. Circular dichroism and Fourier transform infrared spectroscopy confirmed conformational changes of both proteins into beta sheet rich structures upon assembly. ChryC3 did not self-assemble into any morphology under the tested conditions. Thereby, through this work, it could be shown that recombinant lacewing silk proteins can be produced and further used for studying the fiber formation of lacewing egg stalks.

Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

PubMed

Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

2008-10-15

Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

PubMed

Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

2010-12-01

Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

High data rate Reed-Solomon encoding and decoding using VLSI technology

NASA Technical Reports Server (NTRS)

Miller, Warner; Morakis, James

1987-01-01

Presented as an implementation of a Reed-Solomon encode and decoder, which is 16-symbol error correcting, each symbol is 8 bits. This Reed-Solomon (RS) code is an efficient error correcting code that the National Aeronautics and Space Administration (NASA) will use in future space communications missions. A Very Large Scale Integration (VLSI) implementation of the encoder and decoder accepts data rates up 80 Mbps. A total of seven chips are needed for the decoder (four of the seven decoding chips are customized using 3-micron Complementary Metal Oxide Semiconduction (CMOS) technology) and one chip is required for the encoder. The decoder operates with the symbol clock being the system clock for the chip set. Approximately 1.65 billion Galois Field (GF) operations per second are achieved with the decoder chip set and 640 MOPS are achieved with the encoder chip.

Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

PubMed

Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

2008-03-01

We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity

PubMed Central

Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.

2016-01-01

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

PubMed Central

Hardman, Norman

1974-01-01

Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

PubMed Central

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

A human transcription factor in search mode.

PubMed

Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

2016-01-08

Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Functional Identification and Characterization of the Brassica Napus Transcription Factor Gene BnAP2, the Ortholog of Arabidopsis Thaliana APETALA2

PubMed Central

Xiong, Zhiyong; Chen, Chunli; Wang, Lijun; Yu, Jingyin; Lu, Changming; Wei, Wenhui

2012-01-01

BnAP2, an APETALA2 (AP2)-like gene, has been isolated from Brassica napus cultivar Zhongshuang 9. The cDNA of BnAP2, with 1, 299 bp in length, encoded a transcription factor comprising of 432 amino acid residues. Results from complementary experiment indicated that BnAP2 was completely capable of restoring the phenotype of Arabidopsis ap2-11 mutant. Together with the sequence and expression data, the complementation data suggested that BnAP2 encodes the ortholog of AtAP2. To address the transcriptional activation of BnAP2, we performed transactivation assays in yeast. Fusion protein of BnAP2 with GAL4 DNA binding domain strongly activated transcription in yeast, and the transactivating activity of BnAP2 was localized to the N-terminal 100 amino acids. To further study the function of BnAP2 involved in the phenotype of B. napus, we used a transgenic approach that involved targeted RNA interference (RNAi) repression induced by ihp-RNA. Floral various phenotype defectives and reduced female fertility were observed in B. napus BnAP2-RNAi lines. Loss of the function of BnAP2 gene also resulted in delayed sepal abscission and senescence with the ethylene-independent pathway. In the strong BnAP2-RNAi lines, seeds showed defects in shape, structure and development and larger size. Strong BnAP2-RNAi and wild-type seeds initially did not display a significant difference in morphology at 10 DAF, but the development of BnAP2-RNAi seeds was slower than that of wild type at 20 DAF, and further at 30 DAF, wild-type seeds were essentially at their final size, whereas BnAP2-RNAi seeds stopped growing and developing and gradually withered. PMID:22479468

Functional identification and characterization of the Brassica napus transcription factor gene BnAP2, the ortholog of Arabidopsis thaliana APETALA2.

PubMed

Yan, Xiaohong; Zhang, Lei; Chen, Bo; Xiong, Zhiyong; Chen, Chunli; Wang, Lijun; Yu, Jingyin; Lu, Changming; Wei, Wenhui

2012-01-01

BnAP2, an APETALA2 (AP2)-like gene, has been isolated from Brassica napus cultivar Zhongshuang 9. The cDNA of BnAP2, with 1, 299 bp in length, encoded a transcription factor comprising of 432 amino acid residues. Results from complementary experiment indicated that BnAP2 was completely capable of restoring the phenotype of Arabidopsis ap2-11 mutant. Together with the sequence and expression data, the complementation data suggested that BnAP2 encodes the ortholog of AtAP2. To address the transcriptional activation of BnAP2, we performed transactivation assays in yeast. Fusion protein of BnAP2 with GAL4 DNA binding domain strongly activated transcription in yeast, and the transactivating activity of BnAP2 was localized to the N-terminal 100 amino acids. To further study the function of BnAP2 involved in the phenotype of B. napus, we used a transgenic approach that involved targeted RNA interference (RNAi) repression induced by ihp-RNA. Floral various phenotype defectives and reduced female fertility were observed in B. napus BnAP2-RNAi lines. Loss of the function of BnAP2 gene also resulted in delayed sepal abscission and senescence with the ethylene-independent pathway. In the strong BnAP2-RNAi lines, seeds showed defects in shape, structure and development and larger size. Strong BnAP2-RNAi and wild-type seeds initially did not display a significant difference in morphology at 10 DAF, but the development of BnAP2-RNAi seeds was slower than that of wild type at 20 DAF, and further at 30 DAF, wild-type seeds were essentially at their final size, whereas BnAP2-RNAi seeds stopped growing and developing and gradually withered.

A Comparison of Red Fluorescent Proteins to Model DNA Vaccine Expression by Whole Animal In Vivo Imaging.

PubMed

Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S

2015-01-01

DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.

Pulmonary delivery of respiratory syncytial virus DNA vaccines using macroaggregated albumin particles.

PubMed

Harcourt, Jennifer L; Anderson, Larry J; Sullender, Wayne; Tripp, Ralph A

2004-06-02

At present there is no safe and effective vaccine for respiratory syncytial virus (RSV). DNA vaccines encoding RSV surface glycoproteins are one option being examined. Current methods to deliver DNA vaccines generally require repeated high dose intramuscular or intradermal administration for effectiveness. In this study, we examine the efficacy of pulmonary DNA vaccination using low dose DNA vaccines encoding the RSV F glycoprotein conjugated to macroaggregated albumin (MAA-F). Single vaccination of BALB/c mice with 1 microg MAA-F was ineffective, however mice boosted with an additional 1 microg MAA-F, or vaccinated a single time with 10 microg MAA-F, developed substantially improved immunity associated with reduced viral titers, increased anti-F antibody responses, and enhanced Th1 and Th2 intracellular cytokine responses. This study shows that MAA may be a useful carrier for RSV DNA vaccines.

Random access in large-scale DNA data storage.

PubMed

Organick, Lee; Ang, Siena Dumas; Chen, Yuan-Jyue; Lopez, Randolph; Yekhanin, Sergey; Makarychev, Konstantin; Racz, Miklos Z; Kamath, Govinda; Gopalan, Parikshit; Nguyen, Bichlien; Takahashi, Christopher N; Newman, Sharon; Parker, Hsing-Yeh; Rashtchian, Cyrus; Stewart, Kendall; Gupta, Gagan; Carlson, Robert; Mulligan, John; Carmean, Douglas; Seelig, Georg; Ceze, Luis; Strauss, Karin

2018-03-01

Synthetic DNA is durable and can encode digital data with high density, making it an attractive medium for data storage. However, recovering stored data on a large-scale currently requires all the DNA in a pool to be sequenced, even if only a subset of the information needs to be extracted. Here, we encode and store 35 distinct files (over 200 MB of data), in more than 13 million DNA oligonucleotides, and show that we can recover each file individually and with no errors, using a random access approach. We design and validate a large library of primers that enable individual recovery of all files stored within the DNA. We also develop an algorithm that greatly reduces the sequencing read coverage required for error-free decoding by maximizing information from all sequence reads. These advances demonstrate a viable, large-scale system for DNA data storage and retrieval.

Quantitation of heteroplasmy of mtDNA sequence variants identified in a population of AD patients and controls by array-based resequencing.

PubMed

Coon, Keith D; Valla, Jon; Szelinger, Szabolics; Schneider, Lonnie E; Niedzielko, Tracy L; Brown, Kevin M; Pearson, John V; Halperin, Rebecca; Dunckley, Travis; Papassotiropoulos, Andreas; Caselli, Richard J; Reiman, Eric M; Stephan, Dietrich A

2006-08-01

The role of mitochondrial dysfunction in the pathogenesis of Alzheimer's disease (AD) has been well documented. Though evidence for the role of mitochondria in AD seems incontrovertible, the impact of mitochondrial DNA (mtDNA) mutations in AD etiology remains controversial. Though mutations in mitochondrially encoded genes have repeatedly been implicated in the pathogenesis of AD, many of these studies have been plagued by lack of replication as well as potential contamination of nuclear-encoded mitochondrial pseudogenes. To assess the role of mtDNA mutations in the pathogenesis of AD, while avoiding the pitfalls of nuclear-encoded mitochondrial pseudogenes encountered in previous investigations and showcasing the benefits of a novel resequencing technology, we sequenced the entire coding region (15,452 bp) of mtDNA from 19 extremely well-characterized AD patients and 18 age-matched, unaffected controls utilizing a new, reliable, high-throughput array-based resequencing technique, the Human MitoChip. High-throughput, array-based DNA resequencing of the entire mtDNA coding region from platelets of 37 subjects revealed the presence of 208 loci displaying a total of 917 sequence variants. There were no statistically significant differences in overall mutational burden between cases and controls, however, 265 independent sites of statistically significant change between cases and controls were identified. Changed sites were found in genes associated with complexes I (30.2%), III (3.0%), IV (33.2%), and V (9.1%) as well as tRNA (10.6%) and rRNA (14.0%). Despite their statistical significance, the subtle nature of the observed changes makes it difficult to determine whether they represent true functional variants involved in AD etiology or merely naturally occurring dissimilarity. Regardless, this study demonstrates the tremendous value of this novel mtDNA resequencing platform, which avoids the pitfalls of erroneously amplifying nuclear-encoded mtDNA pseudogenes, and our proposed analysis paradigm, which utilizes the availability of raw signal intensity values for each of the four potential alleles to facilitate quantitative estimates of mtDNA heteroplasmy. This information provides a potential new target for burgeoning diagnostics and therapeutics that could truly assist those suffering from this devastating disorder.

Characterization of the cDNA coding for rat brain cysteine sulfinate decarboxylase: brain and liver enzymes are identical proteins encoded by two distinct mRNAs.

PubMed

Tappaz, M; Bitoun, M; Reymond, I; Sergeant, A

1999-09-01

Cysteine sulfinate decarboxylase (CSD) is considered as the rate-limiting enzyme in the biosynthesis of taurine, a possible osmoregulator in brain. Through cloning and sequencing of RT-PCR and RACE-PCR products of rat brain mRNAs, a 2,396-bp cDNA sequence was obtained encoding a protein of 493 amino acids (calculated molecular mass, 55.2 kDa). The corresponding fusion protein showed a substrate specificity similar to that of the endogenous enzyme. The sequence of the encoded protein is identical to that encoded by liver CSD cDNA. Among other characterized amino acid decarboxylases, CSD shows the highest homology (54%) with either isoform of glutamic acid decarboxylase (GAD65 and GAD67). A single mRNA band, approximately 2.5 kb, was detected by northern blot in RNA extracts of brain, liver, and kidney. However, brain and liver CSD cDNA sequences differed in the 5' untranslated region. This indicates two forms of CSD mRNA. Analysis of PCR-amplified products of genomic DNA suggests that the brain form results from the use of a 3' alternative internal splicing site within an exon specifically found in liver CSD mRNA. Through selective RT-PCR the brain form was detected in brain only, whereas the liver form was found in liver and kidney. These results indicate a tissue-specific regulation of CSD genomic expression.

Effect of tape stripping and adjuvants on immune response after intradermal DNA electroporation.

PubMed

Vandermeulen, Gaëlle; Daugimont, Liévin; Richiardi, Hervé; Vanderhaeghen, Marie-Lise; Lecouturier, Nathalie; Ucakar, Bernard; Préat, Véronique

2009-07-01

DNA vaccines require both efficient delivery methods and appropriate adjuvants. Based on their mechanisms of action, we hypothesised that some adjuvants could enhance vaccine immunogenicity or direct the response towards Th1 profile after intradermal DNA electroporation. After intradermal electroporation of plasmid DNA encoding luciferase, mice received hyaluronidase, imiquimod, monophosphoryl lipid A or were tape stripped in order to modulate the immune response against the encoded protein. We measured total immunoglobulin G, IgG1, IgG2a titres and the cytokines produced by splenocyte cultures to assess both humoral and cellular response. The effect of tape stripping on the response against intradermally delivered ovalbumin protein was also assessed. Neither hyaluronidase nor imiquimod improved the immune response against the encoded luciferase. Monophosphoryl lipid A did not modify the cytokines production but increased the anti-luciferase IgG2a titres. Tape stripping significantly increased anti-luciferase IgG2a and IFN-gamma responses. It also enhanced the humoral response after intradermal injection of the ovalbumin protein. Tape stripping is able to increase the Th1 immune response against both DNA and protein vaccines. Therefore, tape stripping appears to have interesting adjuvant effect on intradermal vaccination.

Rapidly expanding genetic diversity and host range of the Circoviridae viral family and other Rep encoding small circular ssDNA genomes.

PubMed

Delwart, Eric; Li, Linlin

2012-03-01

The genomes of numerous circoviruses and distantly related circular ssDNA viruses encoding a rolling circle replication initiator protein (Rep) have been characterized from the tissues of mammals, fish, insects, plants (geminivirus and nanovirus), in human and animal feces, in an algae cell, and in diverse environmental samples. We review the genome organization, phylogenetic relationships and initial prevalence studies of cycloviruses, a proposed new genus in the Circoviridae family. Viral fossil rep sequences were also recently identified integrated on the chromosomes of mammals, frogs, lancelets, crustaceans, mites, gastropods, roundworms, placozoans, hydrozoans, protozoans, land plants, fungi, algae, and phytoplasma bacterias and their plasmids, reflecting the very wide past host range of rep bearing viruses. An ancient origin for viruses with Rep-encoding small circular ssDNA genomes, predating the diversification of eukaryotes, is discussed. The cellular hosts and pathogenicity of many recently described rep-containing circular ssDNA genomes remain to be determined. Future studies of the virome of single cell and multi-cellular eukaryotes are likely to further extend the known diversity and host-range of small rep-containing circular ssDNA viral genomes. Copyright © 2011 Elsevier B.V. All rights reserved.

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

PubMed Central

Sin, Jeong-Im

2009-01-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

PubMed

Sin, Jeong-Im

2009-09-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

PubMed

Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

2018-05-24

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Simulations Using Random-Generated DNA and RNA Sequences

ERIC Educational Resources Information Center

Bryce, C. F. A.

1977-01-01

Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

HUMAN GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE-2 (GAPD2) GENE IS EXPRESSED SPECIFICALLY IN SPERMATOGENIC CELLS

EPA Science Inventory

Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...

Comparison of multiple gene assembly methods for metabolic engineering

Treesearch

Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

2007-01-01

A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

USDA-ARS?s Scientific Manuscript database

A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

Kits for Characterization of Chromosomal Inversions Using Probes

NASA Technical Reports Server (NTRS)

Ray, F. Andrew (Inventor)

2017-01-01

A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

Design, synthesis and selection of DNA-encoded small-molecule libraries.

PubMed

Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

2009-09-01

Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

PubMed

Andera, L; Geiduschek, E P

1994-03-01

The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

Escherichia coli DinB inhibits replication fork progression without significantly inducing the SOS response.

PubMed

Mori, Tetsuya; Nakamura, Tatsuro; Okazaki, Naoto; Furukohri, Asako; Maki, Hisaji; Akiyama, Masahiro Tatsumi

2012-01-01

The SOS response is readily triggered by replication fork stalling caused by DNA damage or a dysfunctional replicative apparatus in Escherichia coli cells. E. coli dinB encodes DinB DNA polymerase and its expression is upregulated during the SOS response. DinB catalyzes translesion DNA synthesis in place of a replicative DNA polymerase III that is stalled at a DNA lesion. We showed previously that DNA replication was suppressed without exogenous DNA damage in cells overproducing DinB. In this report, we confirm that this was due to a dose-dependent inhibition of ongoing replication forks by DinB. Interestingly, the DinB-overproducing cells did not significantly induce the SOS response even though DNA replication was perturbed. RecA protein is activated by forming a nucleoprotein filament with single-stranded DNA, which leads to the onset of the SOS response. In the DinB-overproducing cells, RecA was not activated to induce the SOS response. However, the SOS response was observed after heat-inducible activation in strain recA441 (encoding a temperature-sensitive RecA) and after replication blockage in strain dnaE486 (encoding a temperature-sensitive catalytic subunit of the replicative DNA polymerase III) at a non-permissive temperature when DinB was overproduced in these cells. Furthermore, since catalytically inactive DinB could avoid the SOS response to a DinB-promoted fork block, it is unlikely that overproduced DinB takes control of primer extension and thus limits single-stranded DNA. These observations suggest that DinB possesses a feature that suppresses DNA replication but does not abolish the cell's capacity to induce the SOS response. We conclude that DinB impedes replication fork progression in a way that does not activate RecA, in contrast to obstructive DNA lesions and dysfunctional replication machinery.

Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

PubMed

Rosa, A M M; Prazeres, D M F; Paulo, P M R

2017-06-28

Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Versatile logic devices based on programmable DNA-regulated silver-nanocluster signal transducers.

PubMed

Huang, Zhenzhen; Tao, Yu; Pu, Fang; Ren, Jinsong; Qu, Xiaogang

2012-05-21

A DNA-encoding strategy is reported for the programmable regulation of the fluorescence properties of silver nanoclusters (AgNCs). By taking advantage of the DNA-encoding strategy, aqueous AgNCs were used as signal transducers to convert DNA inputs into fluorescence outputs for the construction of various DNA-based logic gates (AND, OR, INHIBIT, XOR, NOR, XNOR, NAND, and a sequential logic gate). Moreover, a biomolecular keypad that was capable of constructing crossword puzzles was also fabricated. These AgNC-based logic systems showed several advantages, including a simple transducer-introduction strategy, universal design, and biocompatible operation. In addition, this proof of concept opens the door to a new generation of signal transducer materials and provides a general route to versatile biomolecular logic devices for practical applications. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On-Chip Fluorescence Switching System for Constructing a Rewritable Random Access Data Storage Device.

PubMed

Nguyen, Hoang Hiep; Park, Jeho; Hwang, Seungwoo; Kwon, Oh Seok; Lee, Chang-Soo; Shin, Yong-Beom; Ha, Tai Hwan; Kim, Moonil

2018-01-10

We report the development of on-chip fluorescence switching system based on DNA strand displacement and DNA hybridization for the construction of a rewritable and randomly accessible data storage device. In this study, the feasibility and potential effectiveness of our proposed system was evaluated with a series of wet experiments involving 40 bits (5 bytes) of data encoding a 5-charactered text (KRIBB). Also, a flexible data rewriting function was achieved by converting fluorescence signals between "ON" and "OFF" through DNA strand displacement and hybridization events. In addition, the proposed system was successfully validated on a microfluidic chip which could further facilitate the encoding and decoding process of data. To the best of our knowledge, this is the first report on the use of DNA hybridization and DNA strand displacement in the field of data storage devices. Taken together, our results demonstrated that DNA-based fluorescence switching could be applicable to construct a rewritable and randomly accessible data storage device through controllable DNA manipulations.

The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases

PubMed Central

Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi

1999-01-01

We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016

Agrobacterium-mediated transformation of lipomyces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Ziyu; Magnuson, Jon K.; Deng, Shuang

This disclosure provides Agrobacterium-mediated transformation methods for the oil-producing (oleaginous) yeast Lipomyces sp., as well as yeast produced by the method. Such methods utilize Agrobacterium sp. cells that have a T-DNA binary plasmid, wherein the T-DNA binary plasmid comprises a first nucleic acid molecule encoding a first protein and a second nucleic acid molecule encoding a selective marker that permits growth of transformed Lipomyces sp. cells in selective culture media comprising an antibiotic.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

PubMed Central

2015-01-01

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

PubMed Central

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

Single Molecule Nano-Metronome

PubMed Central

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

DTIC Science & Technology

2006-07-28

manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Ribosomal DNA status inferred from DNA cloud assays and mass spectrometry identification of agarose-squeezed proteins interacting with chromatin (ASPIC-MS).

PubMed

Krol, Kamil; Jendrysek, Justyna; Debski, Janusz; Skoneczny, Marek; Kurlandzka, Anna; Kaminska, Joanna; Dadlez, Michal; Skoneczna, Adrianna

2017-04-11

Ribosomal RNA-encoding genes (rDNA) are the most abundant genes in eukaryotic genomes. To meet the high demand for rRNA, rDNA genes are present in multiple tandem repeats clustered on a single or several chromosomes and are vastly transcribed. To facilitate intensive transcription and prevent rDNA destabilization, the rDNA-encoding portion of the chromosome is confined in the nucleolus. However, the rDNA region is susceptible to recombination and DNA damage, accumulating mutations, rearrangements and atypical DNA structures. Various sophisticated techniques have been applied to detect these abnormalities. Here, we present a simple method for the evaluation of the activity and integrity of an rDNA region called a "DNA cloud assay". We verified the efficacy of this method using yeast mutants lacking genes important for nucleolus function and maintenance (RAD52, SGS1, RRM3, PIF1, FOB1 and RPA12). The DNA cloud assay permits the evaluation of nucleolus status and is compatible with downstream analyses, such as the chromosome comet assay to identify DNA structures present in the cloud and mass spectrometry of agarose squeezed proteins (ASPIC-MS) to detect nucleolar DNA-bound proteins, including Las17, the homolog of human Wiskott-Aldrich Syndrome Protein (WASP).

Ribosomal DNA status inferred from DNA cloud assays and mass spectrometry identification of agarose-squeezed proteins interacting with chromatin (ASPIC-MS)

PubMed Central

Krol, Kamil; Jendrysek, Justyna; Debski, Janusz; Skoneczny, Marek; Kurlandzka, Anna; Kaminska, Joanna; Dadlez, Michal; Skoneczna, Adrianna

2017-01-01

Ribosomal RNA-encoding genes (rDNA) are the most abundant genes in eukaryotic genomes. To meet the high demand for rRNA, rDNA genes are present in multiple tandem repeats clustered on a single or several chromosomes and are vastly transcribed. To facilitate intensive transcription and prevent rDNA destabilization, the rDNA-encoding portion of the chromosome is confined in the nucleolus. However, the rDNA region is susceptible to recombination and DNA damage, accumulating mutations, rearrangements and atypical DNA structures. Various sophisticated techniques have been applied to detect these abnormalities. Here, we present a simple method for the evaluation of the activity and integrity of an rDNA region called a “DNA cloud assay”. We verified the efficacy of this method using yeast mutants lacking genes important for nucleolus function and maintenance (RAD52, SGS1, RRM3, PIF1, FOB1 and RPA12). The DNA cloud assay permits the evaluation of nucleolus status and is compatible with downstream analyses, such as the chromosome comet assay to identify DNA structures present in the cloud and mass spectrometry of agarose squeezed proteins (ASPIC-MS) to detect nucleolar DNA-bound proteins, including Las17, the homolog of human Wiskott-Aldrich Syndrome Protein (WASP). PMID:28212567

Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

PubMed Central

Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

2011-01-01

Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

PubMed

Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

2012-01-15

A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

Complementary codes for odor identity and intensity in olfactory cortex

PubMed Central

Bolding, Kevin A; Franks, Kevin M

2017-01-01

The ability to represent both stimulus identity and intensity is fundamental for perception. Using large-scale population recordings in awake mice, we find distinct coding strategies facilitate non-interfering representations of odor identity and intensity in piriform cortex. Simply knowing which neurons were activated is sufficient to accurately represent odor identity, with no additional information about identity provided by spike time or spike count. Decoding analyses indicate that cortical odor representations are not sparse. Odorant concentration had no systematic effect on spike counts, indicating that rate cannot encode intensity. Instead, odor intensity can be encoded by temporal features of the population response. We found a subpopulation of rapid, largely concentration-invariant responses was followed by another population of responses whose latencies systematically decreased at higher concentrations. Cortical inhibition transforms olfactory bulb output to sharpen these dynamics. Our data therefore reveal complementary coding strategies that can selectively represent distinct features of a stimulus. DOI: http://dx.doi.org/10.7554/eLife.22630.001 PMID:28379135

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

DNA Nanotechnology for Cancer Therapy

PubMed Central

Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

2016-01-01

DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

[A METHOD FOR DIFFERENTIATION OF BACILLUS ANTHRACIS STRAINS AND PHYLOGENETICALLY RELATED SPECIES BASED ON DETERMINATION OF THE STRUCTURAL DIFFERENCESBETWEEN CHROMOSOMAL GENES FOR BIOSYNTHESIS OF FLAGELLIN AND METHIONINE].

PubMed

Mikshis, N I; Kashtanova, T N; Kutyrev, V V

2015-01-01

Nucleotide sequence analysis of several genes responsible for the anthrax pathogen definitive properties--motility and penicillinase activity--determined a chromosomal locus promising for interspecies differentiation. We demonstrated that the gene fliC encoding flagellin synthesis contains extended region, distinguishing B. anthracis strains from the majority of non-pathogenic and opportunistic bacilli. A novel method for the anthrax pathogen indication and identification based on determination of the differences in the chromosomal genes fliC and hom2 structure was suggested. A total of 60 strains of different Bacillus spp. (B. anthracis, B. cereus, B. thuringiensis, B. mycoides, B. megaterium, B. subtilis, etc.) were tested using two chromosomal DNA targets. The algorithm developed in this work permits to detect the pathogenic microorganism and reliably differentiate it from other Bacillus spp. representatives. The introduction of primers complementary to specific sequences of pXO1 and pXQ2 plasmids into the multiplex PCR makes it possible to receive additional information on proposed virulence of the isolate.

A Self-Assembled Coumarin-Anchored Dendrimer for Efficient Gene Delivery and Light-Responsive Drug Delivery.

PubMed

Wang, Hui; Miao, Wujun; Wang, Fei; Cheng, Yiyun

2018-06-11

The assembly of low molecular weight polymers into highly efficient and nontoxic nanostructures has broad applicability in gene delivery. In this study, we reported the assembly of coumarin-anchored low generation dendrimers in aqueous solution via hydrophobic interactions. The synthesized material showed significantly improved DNA binding and gene delivery, and minimal toxicity on the transfected cells. Moreover, the coumarin moieties in the assembled nanostructures endow the materials with light-responsive drug delivery behaviors. The coumarin substitutes in the assembled nanostructures were cross-linked with each other upon irradiation at 365 nm, and the cross-linked assemblies were degraded upon further irradiation at 254 nm. As a result, the drug-loaded nanoparticle showed a light-responsive drug release behavior and light-enhanced anticancer activity. The assembled nanoparticle also exhibited a complementary anticancer activity through the codelivery of 5-fluorouracil and a therapeutic gene encoding tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). This study provided a facile strategy to develop light-responsive polymers for the codelivery of therapeutic genes and anticancer drugs.

Systemic Delivery of MeCP2 Rescues Behavioral and Cellular Deficits in Female Mouse Models of Rett Syndrome

PubMed Central

Garg, Saurabh K.; Lioy, Daniel T.; Cheval, Hélène; McGann, James C.; Bissonnette, John M.; Murtha, Matthew J.; Foust, Kevin D.; Kaspar, Brian K.; Bird, Adrian

2013-01-01

De novo mutations in the X-linked gene encoding the transcription factor methyl-CpG binding protein 2 (MECP2) are the most frequent cause of the neurological disorder Rett syndrome (RTT). Hemizygous males usually die of neonatal encephalopathy. Heterozygous females survive into adulthood but exhibit severe symptoms including microcephaly, loss of purposeful hand motions and speech, and motor abnormalities, which appear after a period of apparently normal development. Most studies have focused on male mouse models because of the shorter latency to and severity in symptoms, yet how well these mice mimic the disease in affected females is not clear. Very few therapeutic treatments have been proposed for females, the more gender-appropriate model. Here, we show that self-complementary AAV9, bearing MeCP2 cDNA under control of a fragment of its own promoter (scAAV9/MeCP2), is capable of significantly stabilizing or reversing symptoms when administered systemically into female RTT mice. To our knowledge, this is the first potential gene therapy for females afflicted with RTT. PMID:23966684

Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

PubMed

Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

2018-08-27

A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

Use of Staby® technology for development and production of DNA vaccines free of antibiotic resistance gene

PubMed Central

Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric

2013-01-01

The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby® technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby® technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1). PMID:24051431

Use of Staby(®) technology for development and production of DNA vaccines free of antibiotic resistance gene.

PubMed

Reschner, Anca; Scohy, Sophie; Vandermeulen, Gaëlle; Daukandt, Marc; Jacques, Céline; Michel, Benjamin; Nauwynck, Hans; Xhonneux, Florence; Préat, Véronique; Vanderplasschen, Alain; Szpirer, Cédric

2013-10-01

The appearance of new viruses and the cost of developing certain vaccines require that new vaccination strategies now have to be developed. DNA vaccination seems to be a particularly promising method. For this application, plasmid DNA is injected into the subject (man or animal). This plasmid DNA encodes an antigen that will be expressed by the cells of the subject. In addition to the antigen, the plasmid also encodes a resistance to an antibiotic, which is used during the construction and production steps of the plasmid. However, regulatory agencies (FDA, USDA and EMA) recommend to avoid the use of antibiotics resistance genes. Delphi Genetics developed the Staby(®) technology to replace the antibiotic-resistance gene by a selection system that relies on two bacterial genes. These genes are small in size (approximately 200 to 300 bases each) and consequently encode two small proteins. They are naturally present in the genomes of bacteria and on plasmids. The technology is already used successfully for production of recombinant proteins to achieve higher yields and without the need of antibiotics. In the field of DNA vaccines, we have now the first data validating the innocuousness of this Staby(®) technology for eukaryotic cells and the feasibility of an industrial production of an antibiotic-free DNA vaccine. Moreover, as a proof of concept, mice have been successfully vaccinated with our antibiotic-free DNA vaccine against a deadly disease, pseudorabies (induced by Suid herpesvirus-1).

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

PubMed

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Chemical Biology Probes from Advanced DNA-encoded Libraries.

PubMed

Salamon, Hazem; Klika Škopić, Mateja; Jung, Kathrin; Bugain, Olivia; Brunschweiger, Andreas

2016-02-19

The identification of bioactive compounds is a crucial step toward development of probes for chemical biology studies. Screening of DNA-encoded small molecule libraries (DELs) has emerged as a validated technology to interrogate vast chemical space. DELs consist of chimeric molecules composed of a low-molecular weight compound that is conjugated to a DNA identifier tag. They are screened as pooled libraries using selection to identify "hits." Screening of DELs has identified numerous bioactive compounds. Some of these molecules were instrumental in gaining a deeper understanding of biological systems. One of the main challenges in the field is the development of synthesis methodology for DELs.

New Trends of Digital Data Storage in DNA

PubMed Central

2016-01-01

With the exponential growth in the capacity of information generated and the emerging need for data to be stored for prolonged period of time, there emerges a need for a storage medium with high capacity, high storage density, and possibility to withstand extreme environmental conditions. DNA emerges as the prospective medium for data storage with its striking features. Diverse encoding models for reading and writing data onto DNA, codes for encrypting data which addresses issues of error generation, and approaches for developing codons and storage styles have been developed over the recent past. DNA has been identified as a potential medium for secret writing, which achieves the way towards DNA cryptography and stenography. DNA utilized as an organic memory device along with big data storage and analytics in DNA has paved the way towards DNA computing for solving computational problems. This paper critically analyzes the various methods used for encoding and encrypting data onto DNA while identifying the advantages and capability of every scheme to overcome the drawbacks identified priorly. Cryptography and stenography techniques have been analyzed in a critical approach while identifying the limitations of each method. This paper also identifies the advantages and limitations of DNA as a memory device and memory applications. PMID:27689089

New Trends of Digital Data Storage in DNA.

PubMed

De Silva, Pavani Yashodha; Ganegoda, Gamage Upeksha

With the exponential growth in the capacity of information generated and the emerging need for data to be stored for prolonged period of time, there emerges a need for a storage medium with high capacity, high storage density, and possibility to withstand extreme environmental conditions. DNA emerges as the prospective medium for data storage with its striking features. Diverse encoding models for reading and writing data onto DNA, codes for encrypting data which addresses issues of error generation, and approaches for developing codons and storage styles have been developed over the recent past. DNA has been identified as a potential medium for secret writing, which achieves the way towards DNA cryptography and stenography. DNA utilized as an organic memory device along with big data storage and analytics in DNA has paved the way towards DNA computing for solving computational problems. This paper critically analyzes the various methods used for encoding and encrypting data onto DNA while identifying the advantages and capability of every scheme to overcome the drawbacks identified priorly. Cryptography and stenography techniques have been analyzed in a critical approach while identifying the limitations of each method. This paper also identifies the advantages and limitations of DNA as a memory device and memory applications.

Functional analysis of environmental DNA-derived type II polyketide synthases reveals structurally diverse secondary metabolites.

PubMed

Feng, Zhiyang; Kallifidas, Dimitris; Brady, Sean F

2011-08-02

A single gram of soil is predicted to contain thousands of unique bacterial species. The majority of these species remain recalcitrant to standard culture methods, prohibiting their use as sources of unique bioactive small molecules. The cloning and analysis of DNA extracted directly from environmental samples (environmental DNA, eDNA) provides a means of exploring the biosynthetic capacity of natural bacterial populations. Environmental DNA libraries contain large reservoirs of bacterial genetic diversity from which new secondary metabolite gene clusters can be systematically recovered and studied. The identification and heterologous expression of type II polyketide synthase-containing eDNA clones is reported here. Functional analysis of three soil DNA-derived polyketide synthase systems in Streptomyces albus revealed diverse metabolites belonging to well-known, rare, and previously uncharacterized structural families. The first of these systems is predicted to encode the production of the known antibiotic landomycin E. The second was found to encode the production of a metabolite with a previously uncharacterized pentacyclic ring system. The third was found to encode the production of unique KB-3346-5 derivatives, which show activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. These results, together with those of other small-molecule-directed metagenomic studies, suggest that culture-independent approaches are capable of accessing biosynthetic diversity that has not yet been extensively explored using culture-based methods. The large-scale functional screening of eDNA clones should be a productive strategy for generating structurally previously uncharacterized chemical entities for use in future drug development efforts.

The Elusive Nature of Adaptive Mitochondrial DNA Evolution of an Arctic Lineage Prone to Frequent Introgression

PubMed Central

Melo-Ferreira, José; Vilela, Joana; Fonseca, Miguel M.; da Fonseca, Rute R.; Boursot, Pierre; Alves, Paulo C.

2014-01-01

Mitochondria play a fundamental role in cellular metabolism, being responsible for most of the energy production of the cell in the oxidative phosphorylation (OXPHOS) pathway. Mitochondrial DNA (mtDNA) encodes for key components of this process, but its direct role in adaptation remains far from understood. Hares (Lepus spp.) are privileged models to study the impact of natural selection on mitogenomic evolution because 1) species are adapted to contrasting environments, including arctic, with different metabolic pressures, and 2) mtDNA introgression from arctic into temperate species is widespread. Here, we analyzed the sequences of 11 complete mitogenomes (ten newly obtained) of hares of temperate and arctic origins (including two of arctic origin introgressed into temperate species). The analysis of patterns of codon substitutions along the reconstructed phylogeny showed evidence for positive selection in several codons in genes of the OXPHOS complexes, most notably affecting the arctic lineage. However, using theoretical models, no predictable effect of these differences was found on the structure and physicochemical properties of the encoded proteins, suggesting that the focus of selection may lie on complex interactions with nuclear encoded peptides. Also, a cloverleaf structure was detected in the control region only from the arctic mtDNA lineage, which may influence mtDNA replication and transcription. These results suggest that adaptation impacted the evolution of hare mtDNA and may have influenced the occurrence and consequences of the many reported cases of massive mtDNA introgression. However, the origin of adaptation remains elusive. PMID:24696399

Turning self-destructing Salmonella into a universal DNA vaccine delivery platform.

PubMed

Kong, Wei; Brovold, Matthew; Koeneman, Brian A; Clark-Curtiss, Josephine; Curtiss, Roy

2012-11-20

We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases.

Turning self-destructing Salmonella into a universal DNA vaccine delivery platform

PubMed Central

Kong, Wei; Brovold, Matthew; Koeneman, Brian A.; Clark-Curtiss, Josephine; Curtiss, Roy

2012-01-01

We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases. PMID:23129620

Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

PubMed

Abdul-Wahid, Aws; Faubert, Gaétan

2007-12-05

In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

Purification and molecular cloning of SH2- and SH3-containing inositol polyphosphate-5-phosphatase, which is involved in the signaling pathway of granulocyte-macrophage colony-stimulating factor, erythropoietin, and Bcr-Abl.

PubMed

Odai, H; Sasaki, K; Iwamatsu, A; Nakamoto, T; Ueno, H; Yamagata, T; Mitani, K; Yazaki, Y; Hirai, H

1997-04-15

Grb2/Ash and Shc are the adapter proteins that link tyrosine-kinase receptors to Ras and make tyrosine-kinase functionally associated with receptors and Ras in fibroblasts and hematopoietic cells. Grb2/Ash and Shc have the SH3, SH2, or phosphotyrosine binding domains. These domains bind to proteins containing proline-rich regions or tyrosine-phosphorylated proteins and contribute to the association of Grb2/Ash and Shc with other signaling molecules. However, there could remain unidentified signaling molecules that physically and functionally interact with these adapter proteins and have biologically important roles in the signaling pathways. By using the GST fusion protein including the full length of Grb2/Ash, we have found that c-Cbl and an unidentified 135-kD protein (pp135) are associated with Grb2/Ash. We have also found that they become tyrosine-phosphorylated by treatment of a human leukemia cell line, UT-7, with granulocyte-macrophage colony-stimulating factor (GM-CSF). We have purified the pp135 by using GST-Grb2/Ash affinity column and have isolated the full-length complementary DNA (cDNA) encoding the pp135 using a cDNA probe, which was obtained by the degenerate polymerase chain reaction based on a peptide sequence of the purified pp135. The cloned cDNA has 3,958 nucleotides that contain a single long open reading frame of 3,567 nucleotides, encoding a 1,189 amino acid protein with a predicted molecular weight of approximately 133 kD. The deduced amino acid sequence reveals that pp135 is a protein that has one SH2, one SH3, and one proline-rich domain. The pp135, which contains two motifs conserved among the inositol polyphosphate-5-phosphatase proteins, was shown to have the inositol polyphosphate-5-phosphatase activity. The pp135 was revealed to associate constitutively with Grb2/Ash and inducibly with Shc using UT-7 cells stimulated with GM-CSF. In the cell lines derived from human chronic myelogenous leukemia, pp135 was constitutively tyrosine-phosphorylated and associated with Shc and Bcr-Abl. These facts suggest that pp135 is a signaling molecule that has a unique enzymatic activity and should play an important role in the signaling pathway triggered by GM-CSF and in the transformation of hematopoietic cells caused by Bcr-Abl.

A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

PubMed

Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

2011-01-01

Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

PubMed

Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

2006-05-01

To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that the pathogenesis of the disorder may arise from a lowered energy supply to the retina and RPE.

Next-generation digital information storage in DNA.

PubMed

Church, George M; Gao, Yuan; Kosuri, Sriram

2012-09-28

Digital information is accumulating at an astounding rate, straining our ability to store and archive it. DNA is among the most dense and stable information media known. The development of new technologies in both DNA synthesis and sequencing make DNA an increasingly feasible digital storage medium. We developed a strategy to encode arbitrary digital information in DNA, wrote a 5.27-megabit book using DNA microchips, and read the book by using next-generation DNA sequencing.

Synchronous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment based on a zwitterionic copper (II) metal-organic framework.

PubMed

Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang

2018-04-01

From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus

PubMed Central

Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.

2005-01-01

Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565

Genomic instability--an evolving hallmark of cancer.

PubMed

Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D

2010-03-01

Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.

The gene therapy of collagen-induced arthritis in rats by intramuscular administration of the plasmid encoding TNF-binding domain of variola virus CrmB protein.

PubMed

Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V

2016-07-01

Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins.

Is junk DNA bunk? A critique of ENCODE

PubMed Central

Doolittle, W. Ford

2013-01-01

Do data from the Encyclopedia Of DNA Elements (ENCODE) project render the notion of junk DNA obsolete? Here, I review older arguments for junk grounded in the C-value paradox and propose a thought experiment to challenge ENCODE’s ontology. Specifically, what would we expect for the number of functional elements (as ENCODE defines them) in genomes much larger than our own genome? If the number were to stay more or less constant, it would seem sensible to consider the rest of the DNA of larger genomes to be junk or, at least, assign it a different sort of role (structural rather than informational). If, however, the number of functional elements were to rise significantly with C-value then, (i) organisms with genomes larger than our genome are more complex phenotypically than we are, (ii) ENCODE’s definition of functional element identifies many sites that would not be considered functional or phenotype-determining by standard uses in biology, or (iii) the same phenotypic functions are often determined in a more diffuse fashion in larger-genomed organisms. Good cases can be made for propositions ii and iii. A larger theoretical framework, embracing informational and structural roles for DNA, neutral as well as adaptive causes of complexity, and selection as a multilevel phenomenon, is needed. PMID:23479647

Complementary DNA libraries: an overview.

PubMed

Ying, Shao-Yao

2004-07-01

The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.; Maye, M; Zhang, Y

We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

The yeast retrotransposon Ty5 uses the anticodon stem-loop of the initiator methionine tRNA as a primer for reverse transcription.

PubMed Central

Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F

1999-01-01

Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136

Characterization of Stearoyl-CoA Desaturases from a Psychrophilic Antarctic Copepod, Tigriopus kingsejongensis.

PubMed

Jung, Woongsic; Kim, Eun Jae; Han, Se Jong; Choi, Han-Gu; Kim, Sanghee

2016-10-01

Stearoyl-CoA desaturase is a key regulator in fatty acid metabolism that catalyzes the desaturation of stearic acid to oleic acid and controls the intracellular levels of monounsaturated fatty acids (MUFAs). Two stearoyl-CoA desaturases (SCD, Δ9 desaturases) genes were identified in an Antarctic copepod, Tigriopus kingsejongensis, that was collected in a tidal pool near the King Sejong Station, King George Island, Antarctica. Full-length complementary DNA (cDNA) sequences of two T. kingsejongensis SCDs (TkSCDs) were obtained from next-generation sequencing and isolated by reverse transcription PCR. DNA sequence lengths of the open reading frames of TkSCD-1 and TkSCD-2 were determined to be 1110 and 681 bp, respectively. The molecular weights deduced from the corresponding genes were estimated to be 43.1 kDa (TkSCD-1) and 26.1 kDa (TkSCD-2). The amino acid sequences were compared with those of fatty acid desaturases and sterol desaturases from various organisms and used to analyze the relationships among TkSCDs. As assessed by heterologous expression of recombinant proteins in Escherichia coli, the enzymatic functions of both stearoyl-CoA desaturases revealed that the amount of C16:1 and C18:1 fatty acids increased by greater than 3-fold after induction with isopropyl β-D-thiogalactopyranoside. In particular, C18:1 fatty acid production increased greater than 10-fold in E. coli expressing TkSCD-1 and TkSCD-2. The results of this study suggest that both SCD genes from an Antarctic marine copepod encode a functional desaturase that is capable of increasing the amounts of palmitoleic acid and oleic acid in a prokaryotic expression system.

Cloning of cytochrome P450 3A137 complementary DNA in silver carp and expression induction by ionic liquid.

PubMed

Li, Xiaoyu; Ma, Junguo; Lei, Wenlong; Li, Jie; Zhang, Yaning; Li, Yuanlong

2013-08-01

Cytochrome P450 (CYP) enzymes, especially CYP 3A, are responsible for metabolizing of various kinds of endogenous and exogenous compounds in animals. In the present study, a full-length sequence of CYP 3A137 cDNA in silver carp was cloned and sequenced, and then a phylogenetic tree of CYP 3A was structured. Additionally, the acute toxicity of the ionic liquid 1-octyl-3-methylimidazolium bromide ([C8mim]Br) on silver carp and transcription and microsome enzyme activity of CYP 3A137 in the liver of silver fish after rifampicin or [C8mim]Br exposure were also determined in this study. The results show that the full length of CYP 3A137 cDNA is 1810 base pair (bp) long and contains an open reading frame of 1539bp encoding a protein of 513 amino acids. Sequence analysis reveals that CYP 3A137 is highly conserved in fish. Moreover, the results of quantitative real-time polymerase chain reaction reveal that CYP 3A137 in silver carp is constitutively expressed in all tissues examined and the sequence of expression rate is liver>intestine>kidney>spleen>brain>heart>muscle. Finally, the results of acute toxicity tests indicate that both rifampicin and [C8mim]Br significantly up-regulate the expression of CYP 3A137 at mRNA level and increase CYP 3A137 enzyme activity in fish liver, suggesting that CYP 3A137 be involved in metabolism of [C8mim]Br in silver carp. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

DNA attachment to support structures

DOEpatents

Balhorn, Rodney L.; Barry, Christopher H.

2002-01-01

Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

PubMed Central

Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

2013-01-01

Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

Isolation and characterization of a cDNA from Cuphea lanceolata encoding a beta-ketoacyl-ACP reductase.

PubMed

Klein, B; Pawlowski, K; Höricke-Grandpierre, C; Schell, J; Töpfer, R

1992-05-01

A cDNA encoding beta-ketoacyl-ACP reductase (EC 1.1.1.100), an integral part of the fatty acid synthase type II, was cloned from Cuphea lanceolata. This cDNA of 1276 bp codes for a polypeptide of 320 amino acids with 63 N-terminal residues presumably representing a transit peptide and 257 residues corresponding to the mature protein of 27 kDa. The encoded protein shows strong homology with the amino-terminal sequence and two tryptic peptides from avocado mesocarp beta-ketoacyl-ACP reductase, and its total amino acid composition is highly similar to those of the beta-ketoacyl-ACP reductases of avocado and spinach. Amino acid sequence homologies to polyketide synthase, beta-ketoreductases and short-chain alcohol dehydrogenases are discussed. An engineered fusion protein lacking most of the transit peptide, which was produced in Escherichia coli, was isolated and proved to possess beta-ketoacyl-ACP reductase activity. Hybridization studies revealed that in C. lanceolata beta-ketoacyl-ACP reductase is encoded by a small family of at least two genes and that members of this family are expressed in roots, leaves, flowers and seeds.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

PubMed

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

DTIC Science & Technology

2008-09-22

the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

Organization of the murine Cd22 locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

1993-07-01

Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

Encoded Library Synthesis Using Chemical Ligation and the Discovery of sEH Inhibitors from a 334-Million Member Library

NASA Astrophysics Data System (ADS)

Litovchick, Alexander; Dumelin, Christoph E.; Habeshian, Sevan; Gikunju, Diana; Guié, Marie-Aude; Centrella, Paolo; Zhang, Ying; Sigel, Eric A.; Cuozzo, John W.; Keefe, Anthony D.; Clark, Matthew A.

2015-06-01

A chemical ligation method for construction of DNA-encoded small-molecule libraries has been developed. Taking advantage of the ability of the Klenow fragment of DNA polymerase to accept templates with triazole linkages in place of phosphodiesters, we have designed a strategy for chemically ligating oligonucleotide tags using cycloaddition chemistry. We have utilized this strategy in the construction and selection of a small molecule library, and successfully identified inhibitors of the enzyme soluble epoxide hydrolase.

Enterocin C, a class IIb bacteriocin produced by E. faecalis C901, a strain isolated from human colostrum.

PubMed

Maldonado-Barragán, Antonio; Caballero-Guerrero, Belén; Jiménez, Esther; Jiménez-Díaz, Rufino; Ruiz-Barba, José L; Rodríguez, Juan M

2009-07-31

Enterocin C (EntC), a class IIb bacteriocin was purified from culture supernatants of Enterococcus faecalis C901, a strain isolated from human colostrum. Enterocin C consists of two distinct peptides, named EntC1 and EntC2, whose complementary action is required for full antimicrobial activity. The structural genes entC1 and entC2 encoding enterocins EntC1 and EntC2, respectively, and that encoding the putative immunity protein (EntCI) are located in the 9-kb plasmid pEntC, harboured by E. faecalis C901. The N-terminal sequence of both antimicrobial peptides revealed that EntC1 (4284 Da) is identical to Ent1071A, one of the two peptides that form enterocin 1071 (Ent1071), a bacteriocin produced by E. faecalis BFE 1071. In contrast, EntC2 (3867 Da) presents the non-polar alanine residue at position 17 (Ala(17)) instead of the polar threonine residue (Thr(17)) in Ent1071B, the second peptide constituting Ent1071. In spite of peptide similarities, EntC differs from Ent1071 in major aspects, including the complementary activity among its constitutive peptides and its wider inhibitory spectrum of activity. Different amphiphilic alpha-helical conformations between EntC2 and Ent1071B could explain both, acquired complementary activity and increased antimicrobial spectrum.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.

PubMed

Siggens, L; Ekwall, K

2014-09-01

The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.