Sample records for complementary dna ends

  1. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

    PubMed

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

    2009-07-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

  2. Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

    NASA Astrophysics Data System (ADS)

    Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

    2013-03-01

    We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

  3. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  4. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  5. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  6. Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

    PubMed

    Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

    2011-07-21

    Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

  7. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  8. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  9. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  10. DNA attachment to support structures

    DOEpatents

    Balhorn, Rodney L.; Barry, Christopher H.

    2002-01-01

    Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

  11. Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

    PubMed Central

    2015-01-01

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

  12. Yeast Pif1 accelerates annealing of complementary DNA strands.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

    2014-12-09

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

  13. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  14. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  15. Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

    PubMed

    Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

    2018-05-24

    Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

  16. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. RNA-programmed genome editing in human cells

    PubMed Central

    Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

    2013-01-01

    Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

  18. Properties of an unusual DNA primase from an archaeal plasmid

    PubMed Central

    Beck, Kirsten; Lipps, Georg

    2007-01-01

    Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

  19. Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

    PubMed Central

    Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

    2014-01-01

    Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

  20. The minute virus of mice (MVM) nonstructural protein NS1 induces nicking of MVM DNA at a unique site of the right-end telomere in both hairpin and duplex conformations in vitro.

    PubMed

    Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J

    1997-10-01

    The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).

  1. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  2. Autonomous generation and loading of DNA guides by bacterial Argonaute

    PubMed Central

    Chandradoss, Stanley D.; Zhu, Yifan; Timmers, Elizabeth M.; Zhang, Yong; Zhao, Hongtu; Lou, Jizhong; Wang, Yanli; Joo, Chirlmin; van der Oost, John

    2018-01-01

    Summary Several prokaryotic Argonaute proteins (pAgos) utilize small DNA guides to mediate host defense by targeting invading DNA complementary to the DNA guide. It is unknown how these DNA guides are being generated and loaded onto pAgo. Here we demonstrate that guide-free Argonaute from Thermus thermophilus (TtAgo) can degrade dsDNA, thereby generating small dsDNA fragments that subsequently are loaded onto TtAgo. Combining single-molecule fluorescence, molecular dynamic simulations and structural studies, we show that TtAgo loads dsDNA molecules with a preference towards a deoxyguanosine on the passenger strand at the position opposite to the 5’-end of the guide strand. This explains why in vivo TtAgo is preferentially loaded with guides with a 5’-end deoxycytidine. Our data demonstrate that TtAgo can independently generate and selectively load functional DNA guides. PMID:28262506

  3. Method of artificial DNA splicing by directed ligation (SDL).

    PubMed Central

    Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA

    1991-01-01

    An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363

  4. Single Molecule Nano-Metronome

    PubMed Central

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  5. Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

    DTIC Science & Technology

    2006-07-28

    manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

  6. Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change

    DOEpatents

    Miles, Robin R [Danville, CA; Belgrader, Phillip [Severna Park, MD; Fuller, Christopher D [Oakland, CA

    2007-01-02

    Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.

  7. The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

    PubMed Central

    2015-01-01

    Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

  8. DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

    PubMed

    Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

    2007-04-15

    An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

  9. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    PubMed

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  10. Preparation of Small RNAs Using Rolling Circle Transcription and Site-Specific RNA Disconnection.

    PubMed

    Wang, Xingyu; Li, Can; Gao, Xiaomeng; Wang, Jing; Liang, Xingguo

    2015-01-13

    A facile and robust RNA preparation protocol was developed by combining rolling circle transcription (RCT) with RNA cleavage by RNase H. Circular DNA with a complementary sequence was used as the template for promoter-free transcription. With the aid of a 2'-O-methylated DNA, the RCT-generated tandem repeats of the desired RNA sequence were disconnected at the exact end-to-end position to harvest the desired RNA oligomers. Compared with the template DNA, more than 4 × 10(3) times the amount of small RNA products were obtained when modest cleavage was carried out during transcription. Large amounts of RNA oligomers could easily be obtained by simply increasing the reaction volume.

  11. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  12. Cross index for improving cloning selectivity by partially filling in 5'-extensions of DNA produced by type II restriction endonucleases.

    PubMed Central

    Korch, C

    1987-01-01

    A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600

  13. A mechanical mechanism for translocation of ring-shaped helicases on DNA and its demonstration in a macroscopic simulation system

    NASA Astrophysics Data System (ADS)

    Chou, Y. C.

    2018-04-01

    The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.

  14. Physical mapping of complex genomes

    DOEpatents

    Evans, G.A.

    1993-06-15

    A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.

  15. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  16. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    PubMed Central

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  17. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  18. Post-injection hybridization of complementary DNA strands on capillary electrophoresis platforms: a novel solution for dsDNA artifacts.

    PubMed

    McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R

    2008-09-01

    Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.

  19. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    PubMed

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  20. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

    PubMed Central

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

    2011-01-01

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

  1. Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

    NASA Astrophysics Data System (ADS)

    Kowalczykowski, Stephen

    2013-03-01

    We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

  2. Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    PubMed Central

    Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

    2014-01-01

    The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

  3. Poly(ADP-Ribose) Polymerase-1 and DNA-Dependent Protein Kinase Have Equivalent Roles in Double Strand Break Repair Following Ionizing Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, Jody; Smith, Graeme; Curtin, Nicola J., E-mail: n.j.curtin@ncl.ac.u

    2009-12-01

    Purpose: Radiation-induced DNA double strand breaks (DSBs) are predominantly repaired by nonhomologous end joining (NHEJ), involving DNA-dependent protein kinase (DNA-PK). Poly(ADP-ribose) polymerase-1 (PARP-1), well characterized for its role in single strand break repair, may also facilitate DSB repair. We investigated the activation of these enzymes by differing DNA ends and their interaction in the cellular response to ionizing radiation (IR). Methods and Materials: The effect of PARP and DNA-PK inhibitors (KU-0058684 and NU7441) on repair of IR-induced DSBs was investigated in DNA-PK and PARP-1 proficient and deficient cells by measuring gammaH2AX foci and neutral comets. Complementary in vitro enzyme kineticsmore » assays demonstrated the affinities of DNA-PK and PARP-1 for DSBs with varying DNA termini. Results: DNA-PK and PARP-1 both promoted the fast phase of resolution of IR-induced DSBs in cells. Inactivation of both enzymes was not additive, suggesting that PARP-1 and DNA-PK cooperate within the same pathway to promote DSB repair. The affinities of the two enzymes for oligonucleotides with blunt, 3' GGG or 5' GGG overhanging termini were similar and overlapping (K{sub dapp} = 2.6-6.4nM for DNA-PK; 1.7-4.5nM for PARP-1). DNA-PK showed a slightly greater affinity for overhanging DNA and was significantly more efficient when activated by a 5' GGG overhang. PARP-1 had a preference for blunt-ended DNA and required a separate factor for efficient stimulation by a 5' GGG overhang. Conclusion: DNA-PK and PARP-1 are both required in a pathway facilitating the fast phase of DNA DSB repair.« less

  4. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  5. Multisegment nanowire sensors for the detection of DNA molecules.

    PubMed

    Wang, Xu; Ozkan, Cengiz S

    2008-02-01

    We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

  6. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

    PubMed

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

    2011-11-27

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Structural Insights into the HIV-1 Minus-strand Strong-stop DNA*

    PubMed Central

    Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

    2016-01-01

    An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3′-end of the genomic RNA with the complementary r region at the 3′-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). PMID:26668324

  8. RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1992-01-01

    The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

  9. All-DNA finite-state automata with finite memory

    PubMed Central

    Wang, Zhen-Gang; Elbaz, Johann; Remacle, F.; Levine, R. D.; Willner, Itamar

    2010-01-01

    Biomolecular logic devices can be applied for sensing and nano-medicine. We built three DNA tweezers that are activated by the inputs H+/OH-; ; nucleic acid linker/complementary antilinker to yield a 16-states finite-state automaton. The outputs of the automata are the configuration of the respective tweezers (opened or closed) determined by observing fluorescence from a fluorophore/quencher pair at the end of the arms of the tweezers. The system exhibits a memory because each current state and output depend not only on the source configuration but also on past states and inputs. PMID:21135212

  10. Localization of Action of the Is50-Encoded Transposase Protein

    PubMed Central

    Phadnis, Suhas H.; Sasakawa, Chihiro; Berg, Douglas E.

    1986-01-01

    The movement of the bacterial insertion sequence IS50 and of composite elements containing direct terminal repeats of IS50 involves the two ends of IS50, designated O (outside) and I (inside), which are weakly matched in DNA sequence, and an IS50 encoded protein, transposase, which recognizes the O and I ends and acts preferentially in cis. Previous data had suggested that, initially, transposase interacts preferentially with the O end sequence and then, in a second step, with either an O or an I end. To better understand the cis action of transposase and how IS50 ends are selected, we generated a series of composite transposons which contain direct repeats of IS50 elements. In each transposon, one IS50 element encoded transposase (tnp +), and the other contained a null (tnp-) allele. In each of the five sets of composite transposons studied, the transposon for which the tnp+ IS50 element contained its O end was more active than a complementary transposon for which the tnp - IS50 element contained its O end. This pattern of O end use suggests models in which the cis action of transposase and its choice of ends is determined by protein tracking along DNA molecules. PMID:3007274

  11. Role of messenger RNA-ribosome complex in complementary DNA display.

    PubMed

    Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

    2013-07-15

    In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  13. DNA cytoskeleton for stabilizing artificial cells.

    PubMed

    Kurokawa, Chikako; Fujiwara, Kei; Morita, Masamune; Kawamata, Ibuki; Kawagishi, Yui; Sakai, Atsushi; Murayama, Yoshihiro; Nomura, Shin-Ichiro M; Murata, Satoshi; Takinoue, Masahiro; Yanagisawa, Miho

    2017-07-11

    Cell-sized liposomes and droplets coated with lipid layers have been used as platforms for understanding live cells, constructing artificial cells, and implementing functional biomedical tools such as biosensing platforms and drug delivery systems. However, these systems are very fragile, which results from the absence of cytoskeletons in these systems. Here, we construct an artificial cytoskeleton using DNA nanostructures. The designed DNA oligomers form a Y-shaped nanostructure and connect to each other with their complementary sticky ends to form networks. To undercoat lipid membranes with this DNA network, we used cationic lipids that attract negatively charged DNA. By encapsulating the DNA into the droplets, we successfully created a DNA shell underneath the membrane. The DNA shells increased interfacial tension, elastic modulus, and shear modulus of the droplet surface, consequently stabilizing the lipid droplets. Such drastic changes in stability were detected only when the DNA shell was in the gel phase. Furthermore, we demonstrate that liposomes with the DNA gel shell are substantially tolerant against outer osmotic shock. These results clearly show the DNA gel shell is a stabilizer of the lipid membrane akin to the cytoskeleton in live cells.

  14. Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction.

    PubMed

    Lazinski, David W; Camilli, Andrew

    2013-01-01

    The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.

  15. Low joining efficiency and non-conservative repair of two distant double-strand breaks in mouse embryonic stem cells.

    PubMed

    Boubakour-Azzouz, Imenne; Ricchetti, Miria

    2008-02-01

    Efficient and faithful repair of DNA double-strand breaks (DSBs) is critical for genome stability. To understand whether cells carrying a functional repair apparatus are able to efficiently heal two distant chromosome ends and whether this DNA lesion might result in genome rearrangements, we induced DSBs in genetically modified mouse embryonic stem cells carrying two I-SceI sites in cis separated by a distance of 9 kbp. We show that in this context non-homologous end-joining (NHEJ) can repair using standard DNA pairing of the broken ends, but it also joins 3' non-complementary overhangs that require unusual joining intermediates. The repair efficiency of this lesion appears to be dramatically low and the extent of genome alterations was high in striking contrast with the spectra of repair events reported for two collinear DSBs in other experimental systems. The dramatic decline in accuracy suggests that significant constraints operate in the repair process of these distant DSBs, which may also control the low efficiency of this process. These findings provide important insights into the mechanism of repair by NHEJ and how this process may protect the genome from large rearrangements.

  16. Fluorescence correlation spectroscopy analysis for accurate determination of proportion of doubly labeled DNA in fluorescent DNA pool for quantitative biochemical assays.

    PubMed

    Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert

    2014-01-15

    Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Physical mapping of complex genomes

    DOEpatents

    Evans, Glen A.

    1993-01-01

    Method for simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts int he pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert int he common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed. In other preferred embodiments, the cosmid clones are arranged in a three dimensional matrix, pooled and compared in threes according to intersecting planes of the three dimensional matrix. Arrangements corresponding to geometries of higher dimensions may also be prepared and used to simultaneously identify overlapping clones in highly complex libraries with relatively few hybridization reactions.

  18. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  19. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  20. Kinetic and thermodynamic hysteresis imposed by intercalation of proflavine in ferrocene-modified double-stranded DNA.

    PubMed

    Gebala, Magdalena; La Mantia, Fabio; Schuhmann, Wolfgang

    2013-07-22

    Surface-confined immobilized redox species often do not show the expected zero peak separation in slow-scan cyclic voltammograms. This phenomenon is frequently associated to experimental drawbacks and hence neglected. However, a nonzero peak separation, which is common to many electrochemical systems with high structural flexibility, can be rationally assigned to a thermodynamic hysteresis. To study this phenomenon, a surface-confined redox species was used. Specifically, a DNA strand which is tagged with ferrocene (Fc) moieties at its 5' end and its complementary capture probe is thiolated at the 3' end was self-assembled in a monolayer at a Au electrode with the Fc moieties being located at the bottom plane of the double-stranded DNA (dsDNA). The DNA-bound Fc undergoes rapid electron transfer with the electrode surface as evaluated by fast scan cyclic voltammetry. The electron transfer is sensitive to the ion transport along the DNA strands, a phenomenon which is modulated upon specific intercalation of proflavine into surface-bound dsDNA. The electron transfer rate of the Fc(0/+) redox process is influenced by the cationic permselectivity of the DNA monolayer. In addition to the kinetic hindrance, a thermodynamic effect correlated with changes in the activity coefficients of the Fc(0/+) moieties near the gold-dsDNA interface is observed and discussed as source of the observed hysteresis causing the non-zero peak separation in the voltammograms. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  2. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    PubMed

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  4. Porcine parvovirus: DNA sequence and genome organization.

    PubMed

    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

    1989-10-01

    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  5. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  6. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

    PubMed

    Abdulmawjood, A; Roth, S; Bülte, M

    2002-10-01

    For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

  7. Investigating actinomycin D binding to G-quadruplex, i-motif and double-stranded DNA in 27-nt segment of c-MYC gene promoter.

    PubMed

    Niknezhad, Zhila; Hassani, Leila; Norouzi, Davood

    2016-01-01

    c-MYC DNA is an attractive target for drug design, especially for cancer chemotherapy. Around 90% of c-MYC transcription is controlled by NHE III1, whose 27-nt purine-rich strand has the ability to form G-quadruplex structure. In this investigation, interaction of ActD with 27-nt G-rich strand (G/c-MYC) and its equimolar mixture with the complementary sequence, (GC/c-MYC) as well as related C-rich oligonucleotide (C/c-MYC) was evaluated. Molecular dynamic simulations showed that phenoxazine and lactone rings of ActD come close to the outer G-tetrad nucleotides indicating that ActD binds through end-stacking to the quadruplex DNA. RMSD and RMSF revealed that fluctuation of the quadruplex DNA increases upon interaction with the drug. The results of spectrophotometry and spectrofluorometry indicated that ActD most probably binds to the c-MYC quadruplex and duplex DNA via end-stacking and intercalation, respectively and polarity of ActD environment decreases due to the interaction. It was also found that binding of ActD to the GC-rich DNA is stronger than the two other forms of DNA. Circular dichroism results showed that the type of the three forms of DNA structures doesn't change, but their compactness alters due to their interaction with ActD. Finally, it can be concluded that ActD binds differently to double stranded DNA, quadruplex DNA and i-motif. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization.

    PubMed

    Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

    2015-12-01

    Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 (3-/4-) as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

  9. Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

    NASA Astrophysics Data System (ADS)

    Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

    2015-06-01

    Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

  10. Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction

    PubMed Central

    Lazinski, David W.; Camilli, Andrew

    2013-01-01

    The amplification of DNA fragments, cloned between user-defined 5′ and 3′ end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3′ termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5′ ends. The hybrid oligonucleotide has a user-defined sequence at its 5′ end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5′ user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA. PMID:23311318

  11. Sensitive immobilization-free electrochemical DNA sensor based on isothermal circular strand displacement polymerization reaction.

    PubMed

    Xuan, Feng; Luo, Xiaoteng; Hsing, I-Ming

    2012-05-15

    A highly sensitive electrochemical DNA sensor that requires no probe immobilization has been developed based on a target recycling mechanism utilizing a DNA polymerase with a strand displacement activity. The electrochemical detection is realized by taking advantage of the difference in diffusivity between a free ferrocene-labeled peptide nucleic acid (Fc-PNA) and a Fc-PNA hybridized with a complementary DNA, while the DNA polymerase-assisted target recycling leads to signal generation and amplification. The hybridization of the target DNA opens up a stem-loop template DNA with the Fc-PNA hybridized to its extruded 5' end and allows a DNA primer to anneal and be extended by the DNA polymerase, which results in sequential displacement of the target DNA and the Fc-PNA from the template DNA. The displaced target DNA will hybridize with another template DNA, triggering another round of primer extension and strand displacement. The released Fc-PNA, due to its neutral backbone, has much higher diffusivity towards a negatively charged electrode, compared to that when it is hybridized with a negatively charged DNA. Therefore, a significantly enhanced signal of Fc can be observed. The outstanding sensitivity and simplicity make this approach a promising candidate for next-generation electrochemical DNA sensing technologies. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  13. Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

    PubMed Central

    Berns, K. I.; Rose, J. A.

    1970-01-01

    Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

  14. Annealing of Complementary DNA Sequences During Double-Strand Break Repair in Drosophila Is Mediated by the Ortholog of SMARCAL1.

    PubMed

    Holsclaw, Julie Korda; Sekelsky, Jeff

    2017-05-01

    DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity. If unrepaired, they can lead to chromosome fragmentation and cell death. If repaired incorrectly, they can cause mutations and chromosome rearrangements. DSBs are repaired using end-joining or homology-directed repair strategies, with the predominant form of homology-directed repair being synthesis-dependent strand annealing (SDSA). SDSA is the first defense against genomic rearrangements and information loss during DSB repair, making it a vital component of cell health and an attractive target for chemotherapeutic development. SDSA has also been proposed to be the primary mechanism for integration of large insertions during genome editing with CRISPR/Cas9. Despite the central role for SDSA in genome stability, little is known about the defining step: annealing. We hypothesized that annealing during SDSA is performed by the annealing helicase SMARCAL1, which can anneal RPA-coated single DNA strands during replication-associated DNA damage repair. We used unique genetic tools in Drosophila melanogaster to test whether the fly ortholog of SMARCAL1, Marcal1, mediates annealing during SDSA. Repair that requires annealing is significantly reduced in Marcal1 null mutants in both synthesis-dependent and synthesis-independent (single-strand annealing) assays. Elimination of the ATP-binding activity of Marcal1 also reduced annealing-dependent repair, suggesting that the annealing activity requires translocation along DNA. Unlike the null mutant, however, the ATP-binding defect mutant showed reduced end joining, shedding light on the interaction between SDSA and end-joining pathways. Copyright © 2017 by the Genetics Society of America.

  15. The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

    PubMed

    Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

    2013-05-01

    L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

  16. Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

    PubMed

    Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

    2016-03-15

    A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. A Modified Gibson Assembly Method for Cloning Large DNA Fragments with High GC Contents.

    PubMed

    Li, Lei; Jiang, Weihong; Lu, Yinhua

    2018-01-01

    Gibson one-step, isothermal assembly method (Gibson assembly) can be used to efficiently assemble large DNA molecules by in vitro recombination involving a 5'-exonuclease, a DNA polymerase and a DNA ligase. In the past few years, this robust DNA assembly method has been widely applied to seamlessly construct genes, genetic pathways and even entire genomes. Here, we expand this method to clone large DNA fragments with high GC contents, such as antibiotic biosynthetic gene clusters from Streptomyces . Due to the low isothermal condition (50 °C) in the Gibson reaction system, the complementary overlaps with high GC contents are proposed to easily form mismatched linker pairings, which leads to low assembly efficiencies mainly due to vector self-ligation. So, we modified this classic method by the following two steps. First, a pair of universal terminal single-stranded DNA overhangs with high AT contents are added to the ends of the BAC vector. Second, two restriction enzyme sites are introduced into the respective sides of the designed overlaps to achieve the hierarchical assembly of large DNA molecules. The optimized Gibson assembly method facilitates fast acquisition of large DNA fragments with high GC contents from Streptomyces.

  18. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    PubMed Central

    2011-01-01

    Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

  19. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

    PubMed

    Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

    2011-08-24

    Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

  20. Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

    PubMed

    Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

    2003-03-01

    A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

  1. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    PubMed

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  3. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    PubMed

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  4. Sensitive detection of multiple pathogens using a single DNA probe.

    PubMed

    Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

    2016-12-15

    A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    NASA Astrophysics Data System (ADS)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  6. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  7. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  8. From molecular to macroscopic via the rational design of a self-assembled 3D DNA crystal.

    PubMed

    Zheng, Jianping; Birktoft, Jens J; Chen, Yi; Wang, Tong; Sha, Ruojie; Constantinou, Pamela E; Ginell, Stephan L; Mao, Chengde; Seeman, Nadrian C

    2009-09-03

    We live in a macroscopic three-dimensional (3D) world, but our best description of the structure of matter is at the atomic and molecular scale. Understanding the relationship between the two scales requires a bridge from the molecular world to the macroscopic world. Connecting these two domains with atomic precision is a central goal of the natural sciences, but it requires high spatial control of the 3D structure of matter. The simplest practical route to producing precisely designed 3D macroscopic objects is to form a crystalline arrangement by self-assembly, because such a periodic array has only conceptually simple requirements: a motif that has a robust 3D structure, dominant affinity interactions between parts of the motif when it self-associates, and predictable structures for these affinity interactions. Fulfilling these three criteria to produce a 3D periodic system is not easy, but should readily be achieved with well-structured branched DNA motifs tailed by sticky ends. Complementary sticky ends associate with each other preferentially and assume the well-known B-DNA structure when they do so; the helically repeating nature of DNA facilitates the construction of a periodic array. It is essential that the directions of propagation associated with the sticky ends do not share the same plane, but extend to form a 3D arrangement of matter. Here we report the crystal structure at 4 A resolution of a designed, self-assembled, 3D crystal based on the DNA tensegrity triangle. The data demonstrate clearly that it is possible to design and self-assemble a well-ordered macromolecular 3D crystalline lattice with precise control.

  9. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  11. A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

    PubMed

    Liu, Ziping; Su, Xingguang

    2017-01-15

    In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Reinforced self-assembly of donor-acceptor π-conjugated molecules to DNA templates by dipole-dipole interactions together with complementary hydrogen bonding interactions for biomimetics.

    PubMed

    Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan

    2012-10-08

    One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.

  13. A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

    PubMed

    Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

    2016-08-15

    In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents

    PubMed Central

    Chang, Shy-Shin; Hsu, Hsung-Ling; Cheng, Ju-Chien; Tseng, Ching-Ping

    2011-01-01

    Background Bacterial DNA contamination in PCR reagents has been a long standing problem that hampers the adoption of broad-range PCR in clinical and applied microbiology, particularly in detection of low abundance bacteria. Although several DNA decontamination protocols have been reported, they all suffer from compromised PCR efficiency or detection limits. To date, no satisfactory solution has been found. Methodology/Principal Findings We herein describe a method that solves this long standing problem by employing a broad-range primer extension-PCR (PE-PCR) strategy that obviates the need for DNA decontamination. In this method, we first devise a fusion probe having a 3′-end complementary to the template bacterial sequence and a 5′-end non-bacterial tag sequence. We then hybridize the probes to template DNA, carry out primer extension and remove the excess probes using an optimized enzyme mix of Klenow DNA polymerase and exonuclease I. This strategy allows the templates to be distinguished from the PCR reagent contaminants and selectively amplified by PCR. To prove the concept, we spiked the PCR reagents with Staphylococcus aureus genomic DNA and applied PE-PCR to amplify template bacterial DNA. The spiking DNA neither interfered with template DNA amplification nor caused false positive of the reaction. Broad-range PE-PCR amplification of the 16S rRNA gene was also validated and minute quantities of template DNA (10–100 fg) were detectable without false positives. When adapting to real-time and high-resolution melting (HRM) analytical platforms, the unique melting profiles for the PE-PCR product can be used as the molecular fingerprints to further identify individual bacterial species. Conclusions/Significance Broad-range PE-PCR is simple, efficient, and completely obviates the need to decontaminate PCR reagents. When coupling with real-time and HRM analyses, it offers a new avenue for bacterial species identification with a limited source of bacterial DNA, making it suitable for use in clinical and applied microbiology laboratories. PMID:21637859

  15. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  16. Evidence of Liquid Crystal-Assisted Abiotic Ligation of Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Fraccia, Tommaso P.; Zanchetta, Giuliano; Rimoldi, Valeria; Clark, Noel A.; Bellini, Tommaso

    2015-06-01

    The emergence of early life must have been marked by the appearance in the prebiotic era of complex molecular structures and systems, motivating the investigation of conditions that could not only facilitate appropriate chemical synthesis, but also provide the mechanisms of molecular selection and structural templating necessary to pilot the complexification toward specific molecular patterns. We recently proposed and demonstrated that these functions could be afforded by the spontaneous ordering of ultrashort nucleic acids oligomers into Liquid Crystal (LC) phases. In such supramolecular assemblies, duplex-forming oligomers are held in average end-to-end contact to form chemically discontinuous but physically continuous double helices. Using blunt ended duplexes, we found that LC formation could both provide molecular selection mechanisms and boost inter-oligomer ligation. This paper provides an essential extension to this notion by investigating the catalytic effects of LC ordering in duplexes with mutually interacting overhangs. Specifically, we studied the influence of LC ordering of 5'-hydroxy-3'-phosphate partially self-complementary DNA 14mers with 3'-CG sticky-ends, on the efficiency of non-enzymatic ligation reaction induced by water-soluble carbodiimide EDC as condensing agent. We investigated the ligation products in mixtures of DNA with poly-ethylene glycol (PEG) at three PEG concentrations at which the system phase separates creating DNA-rich droplets that organize into isotropic, nematic LC and columnar LC phases. We observe remarkable LC-enhanced chain lengthening, and we demonstrate that such lengthening effectively promotes and stabilizes LC domains, providing the kernel of a positive feedback cycle by which LC ordering promotes elongation, in turn stabilizing the LC ordering.

  17. Fractional Brownian motion and the critical dynamics of zipping polymers.

    PubMed

    Walter, J-C; Ferrantini, A; Carlon, E; Vanderzande, C

    2012-03-01

    We consider two complementary polymer strands of length L attached by a common-end monomer. The two strands bind through complementary monomers and at low temperatures form a double-stranded conformation (zipping), while at high temperature they dissociate (unzipping). This is a simple model of DNA (or RNA) hairpin formation. Here we investigate the dynamics of the strands at the equilibrium critical temperature T=T(c) using Monte Carlo Rouse dynamics. We find that the dynamics is anomalous, with a characteristic time scaling as τ∼L(2.26(2)), exceeding the Rouse time ∼L(2.18). We investigate the probability distribution function, velocity autocorrelation function, survival probability, and boundary behavior of the underlying stochastic process. These quantities scale as expected from a fractional Brownian motion with a Hurst exponent H=0.44(1). We discuss similarities to and differences from unbiased polymer translocation.

  18. Spermine moiety attached to the C-5 position of deoxyuridine enhances the duplex stability of the phosphorothioate DNA/complementary DNA and shows the susceptibility of the substrate to RNase H.

    PubMed

    Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo

    2008-09-01

    Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.

  19. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  20. The Specificity and Flexibility of L1 Reverse Transcription Priming at Imperfect T-Tracts

    PubMed Central

    Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

    2013-01-01

    L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5′-TTTT/A-3′ sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether—and to which degree—the liberated 3′-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3′ end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3′ overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3′ end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome. PMID:23675310

  1. Hairpin structures with conserved sequence motifs determine the 3' ends of non-polyadenylated invertebrate iridovirus transcripts.

    PubMed

    İnce, İkbal Agah; Pijlman, Gorben P; Vlak, Just M; van Oers, Monique M

    2017-11-01

    Previously, we observed that the transcripts of Invertebrate iridescent virus 6 (IIV6) are not polyadenylated, in line with the absence of canonical poly(A) motifs (AATAAA) downstream of the open reading frames (ORFs) in the genome. Here, we determined the 3' ends of the transcripts of fifty-four IIV6 virion protein genes in infected Drosophila Schneider 2 (S2) cells. By using ligation-based amplification of cDNA ends (LACE) it was shown that the IIV6 mRNAs often ended with a CAUUA motif. In silico analysis showed that the 3'-untranslated regions of IIV6 genes have the ability to form hairpin structures (22-56 nt in length) and that for about half of all IIV6 genes these 3' sequences contained complementary TAATG and CATTA motifs. We also show that a hairpin in the 3' flanking region with conserved sequence motifs is a conserved feature in invertebrate-infecting iridoviruses (genus Iridovirus and Chloriridovirus). Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality".

    PubMed

    Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James

    2013-03-12

    A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.

  3. Two conformational states in D-shaped DNA: Effects of local denaturation

    NASA Astrophysics Data System (ADS)

    Lee, O.-Chul; Kim, Cheolhee; Kim, Jae-Yeol; Lee, Nam Ki; Sung, Wokyung

    2016-06-01

    The bending of double-stranded(ds) DNA on the nano-meter scale plays a key role in many cellular processes such as nucleosome packing, transcription-control, and viral-genome packing. In our recent study, a nanometer-sized dsDNA bent into a D shape was formed by hybridizing a circular single-stranded(ss) DNA and a complementary linear ssDNA. Our fluorescence resonance energy transfer (FRET) measurement of D-DNA revealed two types of conformational states: a less-bent state and a kinked state, which can transform into each other. To understand the origin of the two deformed states of D-DNA, here we study the presence of open base-pairs in the ds portion by using the breathing-DNA model to simulate the system. We provide strong evidence that the two states are due to the emergence of local denaturation, i.e., a bubble in the middle and two forks at ends of the dsDNA portion. We also study the system analytically and find that the free-energy landscape is bistable with two minima representative of the two states. The kink and fork sizes estimated by the analytical calculation are also in excellent agreement with the results of the simulation. Thus, this combined experimental-simulation-analytical study corroborates that highly bent D-DNA reduces bending stress via local denaturation.

  4. Influence of pendant chiral C(γ)-(alkylideneamino/guanidino) cationic side-chains of PNA backbone on hybridization with complementary DNA/RNA and cell permeability.

    PubMed

    Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N

    2014-10-17

    Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.

  5. Development of a Reporter System to Explore MMEJ in the Context of Replacing Large Genomic Fragments.

    PubMed

    Yanik, Mert; Ponnam, Surya Prakash Goud; Wimmer, Tobias; Trimborn, Lennart; Müller, Carina; Gambert, Isabel; Ginsberg, Johanna; Janise, Annabella; Domicke, Janina; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut

    2018-06-01

    Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  7. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    PubMed Central

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2004-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

  8. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  9. Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

    PubMed

    Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

    2016-01-15

    In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

  10. Chemistry Division annual progress report for period ending April 30, 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poutsma, M.L.; Ferris, L.M.; Mesmer, R.E.

    1993-08-01

    The Chemistry Division conducts basic and applied chemical research on projects important to DOE`s missions in sciences, energy technologies, advanced materials, and waste management/environmental restoration; it also conducts complementary research for other sponsors. The research are arranged according to: coal chemistry, aqueous chemistry at high temperatures and pressures, geochemistry, chemistry of advanced inorganic materials, structure and dynamics of advanced polymeric materials, chemistry of transuranium elements and compounds, chemical and structural principles in solvent extraction, surface science related to heterogeneous catalysis, photolytic transformations of hazardous organics, DNA sequencing and mapping, and special topics.

  11. Detection of Ammonia-Oxidizing Bacteria (AOB) Using a Porous Silicon Optical Biosensor Based on a Multilayered Double Bragg Mirror Structure.

    PubMed

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2018-01-01

    We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.

  12. RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

    PubMed

    Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

    2008-06-15

    A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

  13. A Smart DNA Tweezer for Detection of Human Telomerase Activity.

    PubMed

    Xu, Xiaowen; Wang, Lei; Li, Kan; Huang, Qihong; Jiang, Wei

    2018-03-06

    Reliable and accurate detection of telomerase activity is crucial to better understand its role in cancer cells and to further explore its function in cancer diagnosis and treatment. Here, we construct a smart DNA tweezer (DT) for detection of telomerase activity. The DT is assembled by three specially designed single-stranded oligonucleotides: a central strand dually labeled with donor/acceptor fluorophores and two arm strands containing overhangs complementary to telomerase reaction products (TRPs). It can get closed through hybridization with TRPs and get reopen through strand displacement reaction by TRPs' complementary sequences. First, under the action of telomerase, telomerase binding substrates (TS) are elongated to generate TRPs ended with telomeric repeats (TTAGGG) n . TRPs hybridize with the two arm overhangs cooperatively and strain DT to closed state, inducing an increased fluorescence resonance energy transfer (FRET) efficiency, which is utilized for telomerase activity detection. Second, upon introduction of a removal strand (RS) complementary to TRPs, the closed DT is relaxed to open state via the toehold-mediated strand displacement, inducing a decreased FRET efficiency, which is utilized for determination of TRP length distribution. The detection limit of telomerase activity is equivalent to 141 cells/μL for HeLa cells, and telomerase-active cellular extracts can be differentiated from telomerase-inactive cellular extracts. Furthermore, TRPs owning 1, 2, 3, 4, and ≥5 telomeric repeats are identified to account for 25.6%, 20.5%, 15.7%, 12.5%, and 25.7%, respectively. The proposed strategy will offer a new approach for reliable, accurate detection of telomerase activity and product length distribution for deeper studying its role and function in cancer.

  14. Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

    PubMed

    Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

    2011-08-01

    Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

  15. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  16. Human Immunodeficiency Virus Integration Protein Expressed in Escherichia Coli Possesses Selective DNA Cleaving Activity

    NASA Astrophysics Data System (ADS)

    Sherman, Paula A.; Fyfe, James A.

    1990-07-01

    The human immunodeficiency virus (HIV) integration protein, a potential target for selective antiviral therapy, was expressed in Escherichia coli. The purified protein, free of detectable contaminating endonucleases, selectively cleaved double-stranded DNA oligonucleotides that mimic the U3 and the U5 termini of linear HIV DNA. Two nucleotides were removed from the 3' ends of both the U5 plus strand and the U3 minus strand; in both cases, cleavage was adjacent to a conserved CA dinucleotide. The reaction was metal-ion dependent, with a preference for Mn2+ over Mg2+. Reaction selectivity was further demonstrated by the lack of cleavage of an HIV U5 substrate on the complementary (minus) strand, an analogous substrate that mimics the U3 terminus of an avian retrovirus, and an HIV U5 substrate in which the conserved CA dinucleotide was replaced with a TA dinucleotide. Such an integration protein-mediated cleavage reaction is expected to occur as part of the integration event in the retroviral life cycle, in which a double-stranded DNA copy of the viral RNA genome is inserted into the host cell DNA.

  17. Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

    NASA Astrophysics Data System (ADS)

    Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

    2018-05-01

    In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

  18. DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1991-01-01

    We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773

  19. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  20. Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

    PubMed

    Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

    2011-01-01

    Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

  1. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  2. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  3. Design of a Sensitive and Selective Electrochemical Aptasensor for the Determination of the Complementary cDNA of miRNA-145 Based on the Intercalation and Electrochemical Reduction of Doxorubicin.

    PubMed

    Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

    2017-11-01

    The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.

  4. Terahertz spectroscopy for the isothermal detection of bacterial DNA by magnetic bead-based rolling circle amplification.

    PubMed

    Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling

    2017-12-04

    The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.

  5. Electrochemical biosensor for Mycobacterium tuberculosis DNA detection based on gold nanotubes array electrode platform.

    PubMed

    Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi

    2016-04-15

    The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Development of a suspension microarray for the genotyping of African swine fever virus targeting the SNPs in the C-terminal end of the p72 gene region of the genome.

    PubMed

    Leblanc, N; Cortey, M; Fernandez Pinero, J; Gallardo, C; Masembe, C; Okurut, A R; Heath, L; van Heerden, J; Sánchez-Vizcaino, J M; Ståhl, K; Belák, S

    2013-08-01

    African swine fever virus (ASFV) causes one of the most dreaded transboundary animal diseases (TADs) in Suidae. African swine fever (ASF) often causes high rates of morbidity and mortality, which can reach 100% in domestic swine. To date, serological diagnosis has the drawback of not being able to differentiate variants of this virus. Previous studies have identified the 22 genotypes based on sequence variation in the C-terminal region of the p72 gene, which has become the standard for categorizing ASFVs. This article describes a genotyping assay developed using a segment of PCR-amplified genomic DNA of approximately 450 bp, which encompasses the C-terminal end of the p72 gene. Complementary paired DNA probes of 15 or 17 bp in length, which are identical except for a single nucleotide polymorphism (SNP) in the central position, were designed to either individually or in combination differentiate between the 22 genotypes. The assay was developed using xMAP technology; probes were covalently linked to microspheres, hybridized to PCR product, labelled with a reporter and read in the Luminex 200 analyzer. Characterization of the sample was performed by comparing fluorescence of the paired SNP probes, that is, the probe with higher fluorescence in a complementary pair identified the SNP that a particular sample possessed. In the final assay, a total of 52 probes were employed, 24 SNP pairs and 4 for general detection. One or more samples from each of the 22 genotypes were tested. The assay was able to detect and distinguish all 22 genotypes. This novel assay provides a powerful novel tool for the simultaneous rapid diagnosis and genotypic differentiation of ASF. © 2012 Blackwell Verlag GmbH.

  7. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  8. Multifaceted regulation of V(D)J recombination

    NASA Astrophysics Data System (ADS)

    Wang, Guannan

    V(D)J recombination is responsible for generating an enormous repertoire of immunoglobulins and T cell receptors, therefore it is a centerpiece to the formation of the adaptive immune system. The V(D)J recombination process proceeds through two steps, site-specific cleavage at RSS (Recombination Signal Sequence) site mediated by the RAG recombinase (RAG1/2) and the subsequent imprecise resolution of the DNA ends, which is carried out by the ubiquitous non-homologous end joining pathway (NHEJ). The V(D)J recombination reaction is obliged to be tightly controlled under all circumstances, as it involves generations of DNA double strand breaks, which are considered the most dangerous lesion to a cell. Multifaceted regulatory mechanisms have been evolved to create great diversity of the antigen receptor repertoire while ensuring genome stability. The RAG-mediated cleavage reaction is stringently regulated at both the pre-cleavage stage and the post-cleavage stage. Specifically, RAG1/2 first forms a pre-cleavage complex assembled at the boarder of RSS and coding flank, which ensures the appropriate DNA targeting. Subsequently, this complex initiates site-specific cleavage, generating two types of double stranded DNA breaks, hairpin-ended coding ends (HP-CEs) and blunt signal ends (SEs). After the cleavage, RAG1/2 proteins bind and retain the recombination ends to form post-cleavage complexes (PCC), which collaborates with the NHEJ machinery for appropriate transfer of recombination ends to NHEJ for proper end resolution. However, little is known about the molecular basis of this collaboration, partly attributed to the lack of sensitive assays to reveal the interaction of PCC with HP-CEs. Here, for the first time, by using two complementary fluorescence-based techniques, fluorescence anisotropy and fluorescence resonance energy transfer (FRET), I managed to monitor the RAG1/2-catalyzed cleavage reaction in real time, from the pre-cleavage to the post-cleavage stages. By examining the dynamic fluorescence changes during the RAG-mediated cleavage reactions, and by manipulating the reaction conditions, I was able to characterize some fundamental properties of RAG-DNA interactions before and after cleavage. Firstly, Mg 2+, known as a physiological cofactor at the excision step, also promotes the HP-CEs retention in the RAG complex after cleavage. Secondly, the structure of pre-cleavage complex may affect the subsequent collaborations with NHEJ for end resolution. Thirdly, the non-core region of RAG2 may have differential influences on the PCC retention of HP-CEs and SEs. Furthermore, I also provide the first evidence of RAG1-mediated regulation of RAG2. Our study provides important insights into the multilayered regulatory mechanisms, in modulating recombination events in developing lymphocytes and paves the way for possible development of detection and diagnotic markers for defective recombination events that are often associated immunodeficiency and/or lymphoid malignancy.

  9. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  10. Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

    PubMed Central

    Odelberg, S J; Weiss, R B; Hata, A; White, R

    1995-01-01

    Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

  11. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    PubMed

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venkadesh, S.; Mandal, P.K.; Gautham, N., E-mail: n_gautham@hotmail.com

    Highlights: {yields} This is the first crystal structure of a four-way junction with sticky ends. {yields} Four junction structures bind to each other and form a rhombic cavity. {yields} Each rhombus binds to others to form 'infinite' 2D tiles. {yields} This is an example of bottom-up fabrication of a DNA nano-lattice. -- Abstract: We report here the crystal structure of the partially self-complementary decameric sequence d(CGGCGGCCGC), which self assembles to form a four-way junction with sticky ends. Each junction binds to four others through Watson-Crick base pairing at the sticky ends to form a rhombic structure. The rhombuses bind tomore » each other and form two dimensional tiles. The tiles stack to form the crystal. The crystal diffracted in the space group P1 to a resolution of 2.5 A. The junction has the anti-parallel stacked-X conformation like other junction structures, though the formation of the rhombic net noticeably alters the details of the junction geometry.« less

  13. Method for detecting point mutations in DNA utilizing fluorescence energy transfer

    DOEpatents

    Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle

    2001-01-01

    A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.

  14. Diagnosis of EGFR exon21 L858R point mutation as lung cancer biomarker by electrochemical DNA biosensor based on reduced graphene oxide /functionalized ordered mesoporous carbon/Ni-oxytetracycline metallopolymer nanoparticles modified pencil graphite electrode.

    PubMed

    Shoja, Yalda; Kermanpur, Ahmad; Karimzadeh, Fathallah

    2018-08-15

    In this present work we made a novel, fast, selective and sensitive electrochemical genobiosensor to detection of EGFR exon 21 point mutation based on two step electropolymerization of Ni(II)-oxytetracycline conducting metallopolymer nanoparticles (Ni-OTC NPs) on the surface of pencil graphite electrode (PGE) which was modified by reduced graphene oxide/carboxyl functionalized ordered mesoporous carbon (rGO/f-OMC) nanocomposite. ssDNA capture probe with amine groups at the5' end which applied as recognition element was immobilized on the rGO/f-OMC/PGE surface via the strong amide bond. Ni-OTC metallopolymer NPs were electropolymerized to rGO/ssDNA-OMC/PGE surface and then hybridization fallows through the peak current change in differential pulse voltammetry (DPV) using Ni-OTC NPs as a redox label. The biosensor was characterized by field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), FT-IR spectroscopy, energy dispersive X-ray spectroscopy (EDX), cyclic voltammetry and Nitrogen adsorption-desorption analysis. The Ni-OTC current response verified only the complementary sequence indicating a significant reduction current signal in comparison to single point mismatched and non-complementary and sequences. Under optimal conditions, the prepared biosensor showed long-term stability (21 days) with a wide linear range from 0.1 µM to 3 µM with high sensitivity (0.0188 mA/µM) and low detection limit (120 nM). Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

    PubMed Central

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-01-01

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

  16. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

    PubMed

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-02-15

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

  17. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

    PubMed

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2016-01-07

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

  18. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    PubMed

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  19. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  1. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription

    PubMed Central

    Beerens, Nancy; Kjems, Jørgen

    2010-01-01

    Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859

  3. Polμ tumor variants decrease the efficiency and accuracy of NHEJ

    PubMed Central

    Sastre-Moreno, Guillermo; Pryor, John M.; Díaz-Talavera, Alberto; Ruiz, José F.; Ramsden, Dale A.

    2017-01-01

    Abstract The non homologous end-joining (NHEJ) pathway of double-strand break (DSB) repair often requires DNA synthesis to fill the gaps generated upon alignment of the broken ends, a complex task performed in human cells by two specialized DNA polymerases, Polλ and Polμ. It is now well established that Polμ is the one adapted to repair DSBs with non-complementary ends, the most challenging scenario, although the structural basis and physiological implications of this adaptation are not fully understood. Here, we demonstrate that two human Polμ point mutations, G174S and R175H, previously identified in two different tumor samples and affecting two adjacent residues, limit the efficiency of accurate NHEJ by Polμ in vitro and in vivo. Moreover, we show that this limitation is the consequence of a decreased template dependency during NHEJ, which renders the error-rate of the mutants higher due to the ability of Polμ to randomly incorporate nucleotides at DSBs. These results highlight the relevance of the 8 kDa domain of Polμ for accurate and efficient NHEJ, but also its contribution to the error-prone behavior of Polμ at 2-nt gaps. This work provides the first demonstration that mutations affecting Polμ identified in tumors can alter the efficiency and fidelity of NHEJ. PMID:28973441

  4. Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost

    PubMed Central

    Benoit, Roger M.; Ostermeier, Christian; Geiser, Martin; Li, Julia Su Zhou; Widmer, Hans; Auer, Manfred

    2016-01-01

    Seamless cloning methods, such as co-transformation cloning, sequence- and ligation-independent cloning (SLIC) or the Gibson assembly, are essential tools for the precise construction of plasmids. The efficiency of co-transformation cloning is however low and the Gibson assembly reagents are expensive. With the aim to improve the robustness of seamless cloning experiments while keeping costs low, we examined the importance of complementary single-stranded DNA ends for co-transformation cloning and the influence of single-stranded gaps in circular plasmids on SLIC cloning efficiency. Most importantly, our data show that single-stranded gaps in double-stranded plasmids, which occur in typical SLIC protocols, can drastically decrease the efficiency at which the DNA transforms competent E. coli bacteria. Accordingly, filling-in of single-stranded gaps using DNA polymerase resulted in increased transformation efficiency. Ligation of the remaining nicks did not lead to a further increase in transformation efficiency. These findings demonstrate that highly efficient insert-plasmid assembly can be achieved by using only T5 exonuclease and Phusion DNA polymerase, without Taq DNA ligase from the original Gibson protocol, which significantly reduces the cost of the reactions. We successfully used this modified Gibson assembly protocol with two short insert-plasmid overlap regions, each counting only 15 nucleotides. PMID:27073895

  5. Investigating the potential of multiwalled carbon nanotubes based zinc nanocomposite as a recognition interface towards plant pathogen detection.

    PubMed

    Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar

    2017-11-01

    The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  7. Ultrasensitive signal-on DNA biosensor based on nicking endonuclease assisted electrochemistry signal amplification.

    PubMed

    Liu, Zhongyuan; Zhang, Wei; Zhu, Shuyun; Zhang, Ling; Hu, Lianzhe; Parveen, Saima; Xu, Guobao

    2011-11-15

    Combining the advantages of signal-on strategy and nicking endonuclease assisted electrochemistry signal amplification (NEAESA), a new sensitive and signal-on electrochemical DNA biosensor for the sequence specific DNA detection based on NEAESA has been developed for the first time. A Hairpin-shape probe (HP), containing the target DNA recognition sequence, is thiol-modified at 5' end and immobilized on gold electrode via Au-S bonding. Subsequently, the HP modified electrode is hybridized with target DNA to form a duplex. Then the nicking endonuclease is added and nicks the HP strand in the duplex. After nicking, 3'-ferrocene (Fc)-labeled part complementary probe (Fc-PCP) is introduced on the electrode surface by hybridizing with the thiol-modified HP fragment, which results in the generation of electrochemical signal. Hence, the DNA biosensor is constructed successfully. The present DNA biosensor shows a wide linear range of 5.0×10(-13)-5.0×10(-8)M for detecting target DNA, with a low detection limit of 0.167pM. The proposed strategy does not require any amplifying labels (enzymes, DNAzymes, nanoparticles, etc.) for biorecognition events, which avoids false-positive results to occur frequently. Moreover, the strategy has the benefits of simple preparation, convenient operation, good selectivity, and high sensitivity. With the advantages mentioned above, this simple and sensitive strategy has the potential to be integrated in portable, low cost and simplified devices for diagnostic applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Super-resolution optical microscopy study of telomere structure.

    PubMed

    Phipps, Mary Lisa; Goodwin, Peter M; Martinez, Jennifer S; Goodwin, Edwin H

    2016-09-01

    Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5?-TTAGGG-3? in humans) repeated more than a thousand times, a short 3? single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3? overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded “t-loop.” Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.

  9. Super-resolution optical microscopy study of telomere structure

    NASA Astrophysics Data System (ADS)

    Phipps, Mary Lisa; Goodwin, Peter M.; Martinez, Jennifer S.; Goodwin, Edwin H.

    2016-09-01

    Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5‧-TTAGGG-3‧ in humans) repeated more than a thousand times, a short 3‧ single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3‧ overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded "t-loop." Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.

  10. Molecular genetic analysis of the V kappa Ser group associated with two mouse light chain genetic markers. Complementary DNA cloning and southern hybridization analysis

    PubMed Central

    1985-01-01

    Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938

  11. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

  12. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  13. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    PubMed

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  14. Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

    PubMed

    Deng, Jiajia; Toh, Chee-Seng

    2013-06-17

    A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

  15. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  16. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  17. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  18. Flower-like ZnO nanostructure based electrochemical DNA biosensor for bacterial meningitis detection.

    PubMed

    Tak, Manvi; Gupta, Vinay; Tomar, Monika

    2014-09-15

    Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A nanophosphor-based method for selective DNA recovery in Synthosomes.

    PubMed

    Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

    2006-01-01

    A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

  20. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  1. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  2. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Cospeciation of Psyllids and Their Primary Prokaryotic Endosymbionts

    PubMed Central

    Thao, MyLo L.; Moran, Nancy A.; Abbot, Patrick; Brennan, Eric B.; Burckhardt, Daniel H.; Baumann, Paul

    2000-01-01

    Psyllids are plant sap-feeding insects that harbor prokaryotic endosymbionts in specialized cells within the body cavity. Four-kilobase DNA fragments containing 16S and 23S ribosomal DNA (rDNA) were amplified from the primary (P) endosymbiont of 32 species of psyllids representing three psyllid families and eight subfamilies. In addition, 0.54-kb fragments of the psyllid nuclear gene wingless were also amplified from 26 species. Phylogenetic trees derived from 16S-23S rDNA and from the host wingless gene are very similar, and tests of compatibility of the data sets show no significant conflict between host and endosymbiont phylogenies. This result is consistent with a single infection of a shared psyllid ancestor and subsequent cospeciation of the host and the endosymbiont. In addition, the phylogenies based on DNA sequences generally agreed with psyllid taxonomy based on morphology. The 3′ end of the 16S rDNA of the P endosymbionts differs from that of other members of the domain Bacteria in the lack of a sequence complementary to the mRNA ribosome binding site. The rate of sequence change in the 16S-23S rDNA of the psyllid P endosymbiont was considerably higher than that of other bacteria, including other fast-evolving insect endosymbionts. The lineage consisting of the P endosymbionts of psyllids was given the designation Candidatus Carsonella (gen. nov.) with a single species, Candidatus Carsonella ruddii (sp. nov.). PMID:10877784

  4. Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

    PubMed

    Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

    1996-01-01

    The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

  5. New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

    PubMed

    Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

    2015-03-15

    This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA

    PubMed Central

    Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo

    1971-01-01

    The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808

  7. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    PubMed

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  8. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  9. Nature and distribution of feline sarcoma virus nucleotide sequences.

    PubMed Central

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  10. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  11. Porcine circovirus: transcription and rolling-circle DNA replication

    USDA-ARS?s Scientific Manuscript database

    This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...

  12. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  13. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  14. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    PubMed

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  15. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  16. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  17. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  18. Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.

    PubMed

    Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi

    2013-12-15

    We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

    PubMed

    Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

    2017-09-19

    DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

  20. Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit

    NASA Astrophysics Data System (ADS)

    Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.

    1987-10-01

    The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.

  1. Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

    PubMed

    Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

    2018-01-01

    Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

  2. Quantum dot-based microfluidic biosensor for cancer detection

    NASA Astrophysics Data System (ADS)

    Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

    2015-05-01

    We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

  3. Ultrasensitive and label-free detection of pathogenic avian influenza DNA by using CMOS impedimetric sensors.

    PubMed

    Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C

    2012-05-15

    This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

    NASA Astrophysics Data System (ADS)

    Singh, Swati; Kumar, Ashok; Khare, Shashi; Mulchandani, Ashok; Rajesh

    2014-11-01

    A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to its complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml-1 with a limit of detection of 0.16 ng ml-1.

  5. Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

    PubMed

    Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

    1999-07-30

    A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

  6. Micrometer-sized TPM emulsion droplets with surface-mobile binding groups

    NASA Astrophysics Data System (ADS)

    van der Wel, Casper; van de Stolpe, Guido L.; Verweij, Ruben W.; Kraft, Daniela J.

    2018-03-01

    Colloids coated with lipid membranes have been widely employed for fundamental studies of lipid membrane processes, biotechnological applications such as drug delivery and biosensing, and more recently, for self-assembly. The latter has been made possible by inserting DNA oligomers with covalently linked hydrophobic anchors into the membrane. The lateral mobility of the DNA linkers on micrometer-sized droplets and solid particles has opened the door to creating structures with unprecedented structural flexibility. Here, we investigate micro-emulsions of TPM (3-(trimethoxysilyl)propyl methacrylate) as a platform for lipid monolayers and further functionalization with proteins and DNA oligonucleotides. TPM droplets can be produced with a narrow size distribution and are polymerizable, thus providing supports for model lipid membranes with controlled size and curvature. With fluorescence recovery after photobleaching, we observed that droplet-attached lipids, NeutrAvidin proteins, as well as DNA oligonucleotides all show mobility on the surface. We explored the assembly of micron-sized particles on TPM-droplets by exploiting either avidin-biotin interactions or double-stranded DNA with complementary single-stranded end groups. While the single molecules are mobile, the particles that are attached to them are not. We propose that this is caused by the heterogeneous nature of emulsified TPM, which forms an oligomer network that limits the collective motion of linkers, but allows the surface mobility of individual molecules.

  7. Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain

    NASA Astrophysics Data System (ADS)

    Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.

    1985-12-01

    A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.

  8. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  9. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  10. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  11. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  12. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. CTC1-mediated C-strand fill-in is an essential step in telomere length maintenance

    PubMed Central

    Feng, Xuyang; Hsu, Shih-Jui; Kasbek, Christopher; Chaiken, Mary

    2017-01-01

    Abstract To prevent progressive telomere shortening as a result of conventional DNA replication, new telomeric DNA must be added onto the chromosome end. The de novo DNA synthesis involves elongation of the G-rich strand of the telomere by telomerase. In human cells, the CST complex (CTC1-STN1-TEN1) also functions in telomere replication. CST first aids in duplication of the telomeric dsDNA. Then after telomerase has extended the G-rich strand, CST facilitates fill-in synthesis of the complementary C-strand. Here, we analyze telomere structure after disruption of human CTC1 and demonstrate that functional CST is essential for telomere length maintenance due to its role in mediating C-strand fill-in. Removal of CTC1 results in elongation of the 3΄ overhang on the G-rich strand. This leads to accumulation of RPA and telomeric DNA damage signaling. G-overhang length increases with time after CTC1 disruption and at early times net G-strand growth is apparent, indicating telomerase-mediated G-strand extension. In contrast, C-strand length decreases continuously, indicating a deficiency in C-strand fill-in synthesis. The lack of C-strand maintenance leads to gradual shortening of the telomeric dsDNA, similar to that observed in cells lacking telomerase. Thus, telomerase-mediated G-strand extension and CST-mediated C-strand fill-in are equally important for telomere length maintenance. PMID:28334750

  14. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  15. Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

    PubMed

    Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-11-20

    We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

    PubMed

    Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

    2009-09-01

    Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

  17. A novel technology for the detection, enrichment, and separation of trace amounts of target DNA based on amino-modified fluorescent magnetic composite nanoparticles.

    PubMed

    Wang, Guannan; Su, Xingguang

    2010-06-01

    A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.

  18. [DNA structure from A to Z--biological implications of structural diversity of DNA].

    PubMed

    Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A

    2006-01-01

    Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

  19. An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres

    PubMed Central

    Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling

    2012-01-01

    An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594

  20. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  1. Insights into DNA-mediated interparticle interactions from a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Ding, Yajun; Mittal, Jeetain

    2014-11-01

    DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

  2. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

    PubMed

    Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

    2014-06-01

    Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Organization of 'nanocrystal molecules' using DNA

    NASA Astrophysics Data System (ADS)

    Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

    1996-08-01

    PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

  4. A PDDA/poly(2,6-pyridinedicarboxylic acid)-CNTs composite film DNA electrochemical sensor and its application for the detection of specific sequences related to PAT gene and NOS gene.

    PubMed

    Yang, Tao; Zhang, Wei; Du, Meng; Jiao, Kui

    2008-05-30

    2,6-Pyridinedicarboxylic acid (PDC) was electropolymerized on the glassy carbon electrode (GCE) surface combined with carboxylic group-functionalized single-walled carbon nanotubes (SWNTs) by cyclic voltammetry (CV) to form PDC-SWNTs composite film, which was rich in negatively charged carboxylic group. Then, poly(diallyldimethyl ammonium chloride) (PDDA), a linear cationic polyelectrolyte, was electrostatically adsorbed on the PDC-SWNTs/GCE surface. DNA probes with negatively charged phosphate group at the 5' end were immobilized on the PDDA/PDC-SWNTs/GCE due to the strong electrostatic attraction between PDDA and phosphate group of DNA. It has been found that modification of the electrode with PDC-SWNTs film has enhanced the effective electrode surface area and electron-transfer ability, in addition to providing negatively charged groups for the electrostatic assembly of cationic polyelectrolyte. PDDA plays a key role in the attachment of DNA probes to the PDC-SWNTs composite film and acts as a bridge to connect DNA with PDC-SWNTs film. The cathodic peak current of methylene blue (MB), an electroactive label, decreased obviously after the hybridization of DNA probe (ssDNA) with the complementary DNA (cDNA). This peak current change was used to monitor the recognition of the specific sequences related to PAT gene in the transgenic corn and the polymerase chain reaction (PCR) amplification of NOS gene from the sample of transgenic soybean with satisfactory results. Under optimal conditions, the dynamic detection range of the sensor to PAT gene target sequence was from 1.0x10(-11) to 1.0x10(-6) mol/L with the detection limit of 2.6x10(-12) mol/L.

  5. Laser microbeams for DNA damage induction, optical tweezers for the search on blood pressure relaxing drugs: contributions to ageing research

    NASA Astrophysics Data System (ADS)

    Grigaravicius, P.; Monajembashi, S.; Hoffmann, M.; Altenberg, B.; Greulich, K. O.

    2009-08-01

    One essential cause of human ageing is the accumulation of DNA damages during lifetime. Experimental studies require quantitative induction of damages and techniques to visualize the subsequent DNA repair. A new technique, the "immuno fluorescent comet assay", is used to directly visualize DNA damages in the microscope. Using DNA repair proteins fluorescently labeled with green fluorescent protein, it could be shown that the repair of the most dangerous DNA double strand breaks starts with the inaccurate "non homologous end joining" pathway and only after 1 - 1 ½ minutes may switch to the more accurate "homologous recombination repair". One might suggest investigating whether centenarians use "homologous recombination repair" differently from those ageing at earlier years and speculate whether it is possible, for example by nutrition, to shift DNA repair to a better use of the error free pathway and thus promote healthy ageing. As a complementary technique optical tweezers, and particularly its variant "erythrocyte mediated force application", is used to simulate the effects of blood pressure on HUVEC cells representing the inner lining of human blood vessels. Stimulating one cell induces in the whole neighbourhood waves of calcium and nitric oxide, known to relax blood vessels. NIFEDIPINE and AMLODIPINE, both used as drugs in the therapy of high blood pressure, primarily a disease of the elderly, prolong the availability of nitric oxide. This partially explains their mode of action. In contrast, VERAPAMILE, also a blood pressure reducing drug, does not show this effect, indicating that obviously an alternative mechanism must be responsible for vessel relaxation.

  6. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  7. Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

    ERIC Educational Resources Information Center

    Militello, Kevin T.

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

  8. Efficient Mutagenesis Independent of Ligation (EMILI).

    PubMed

    Füzik, Tibor; Ulbrich, Pavel; Ruml, Tomáš

    2014-11-01

    Site-directed mutagenesis is one of the most widely used techniques in life sciences. Here we describe an improved and simplified method for introducing mutations at desired sites. It consists of an inverse PCR using a plasmid template and two partially complementary primers. The synthesis step is followed by annealing of the PCR product's sticky ends, which are generated by exonuclease digestion. This method is fast, extremely efficient and cost-effective. It can be used to introduce large insertions and deletions, but also for multiple point mutations in a single step. To show the principle and to prove the efficiency of the method, we present a series of basic mutations (insertions, deletions, point mutations) on pUC19 plasmid DNA. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Electron transfer of plurimodified DNA SAMs.

    PubMed

    Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

    2007-07-17

    An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

  10. Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

    PubMed Central

    Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2015-01-01

    The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

  11. Effects of Complementary DNA and Salt on the Thermoresponsiveness of Poly(N-isopropylacrylamide)-b-DNA.

    PubMed

    Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo

    2016-02-02

    The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.

  12. Polyfluorophore Excimers and Exciplexes as FRET Donors in DNA

    PubMed Central

    Teo, Yin Nah; Kool, Eric T.

    2009-01-01

    We describe studies aimed at testing whether oligomeric exciplex- and excimer fluorophores conjugated to DNA have the potential to act as donors for energy transfer by the Förster mechanism. Oligodeoxyfluorosides (ODFs) are composed of stacked, electronically interacting fluorophores replacing the bases on a DNA scaffold. The monomer chromophores in the twenty tetramer-length ODFs studied here include pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and a nonfluorescent spacer (S); these are conjugated in varied combinations at the 3’ end of a 14mer DNA probe sequence. In the absence of an acceptor chromophore, many of the ODF-DNAs show broad, unstructured long-wavelength emission peaks characteristic of excimer and exciplex excited states, similar to what has been observed for unconjugated ODFs. Although such delocalized excited states have been widely studied, we know of no prior report of their use in FRET. We tested the ability of the twenty ODFs to donate energy to Cy5 and TAMRA dyes conjugated to a complementary strand of DNA, with these acceptors oriented either at the near or far end of the ODF-conjugated probes. Results showed that a number of the ODF fluorophores exhibited relatively efficient energy transfer characteristic of the Förster mechanism, as judged by drops in donor emission quantum yield and fluorescence lifetime, accompanied by increases in intensity of acceptor emission bands. Excimer/exciplex bands in the donors were selectively quenched while shorter-wavelength monomer emission stayed relatively constant, consistent with the notion that the delocalized excited states, rather than individual fluorophores, are the donors. Interestingly, only specific sequences of ODFs were able to act as donors, while others did not, even though their emission wavelengths were similar. The new FRET donors possess large Stokes shifts, which can be beneficial for multiple applications. In addition, all ODFs can be excited at a single wavelength; thus, ODFs may be candidates as “universal FRET donors”, thus allowing multicolor FRET of multiple species to be carried out with one excitation. PMID:19916519

  13. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  14. Potential of mean force of DNA guided assemblies past Debye-Hückel regime

    NASA Astrophysics Data System (ADS)

    Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica

    Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.

  15. Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

    PubMed

    Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

    2013-07-15

    Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  17. DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

    PubMed Central

    Barth, Anna; Kobbe, Daniela; Focke, Manfred

    2016-01-01

    Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

  18. Single-walled carbon nanotubes based chemiresistive genosensor for label-free detection of human rheumatic heart disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Swati; Kumar, Ashok, E-mail: rajesh-csir@yahoo.com, E-mail: ashokigib@rediffmail.com; Academy of Scientific and Innovative Research

    A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to itsmore » complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml{sup −1} with a limit of detection of 0.16 ng ml{sup −1}.« less

  19. Quantum dot-based microfluidic biosensor for cancer detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

    2015-05-11

    We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

  20. Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection

    NASA Astrophysics Data System (ADS)

    Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.

    2017-09-01

    Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.

  1. Controlled assembly of artificial protein-protein complexes via DNA duplex formation.

    PubMed

    Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J

    2015-03-18

    DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.

  2. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  3. Interplay between Ku and Replication Protein A in the Restriction of Exo1-mediated DNA Break End Resection*

    PubMed Central

    Krasner, Danielle S.; Daley, James M.; Sung, Patrick; Niu, Hengyao

    2015-01-01

    DNA double-strand breaks can be eliminated via non-homologous end joining or homologous recombination. Non-homologous end joining is initiated by the association of Ku with DNA ends. In contrast, homologous recombination entails nucleolytic resection of the 5′-strands, forming 3′-ssDNA tails that become coated with replication protein A (RPA). Ku restricts end access by the resection nuclease Exo1. It is unclear how partial resection might affect Ku engagement and Exo1 restriction. Here, we addressed these questions in a reconstituted system with yeast proteins. With blunt-ended DNA, Ku protected against Exo1 in a manner that required its DNA end-binding activity. Despite binding poorly to ssDNA, Ku could nonetheless engage a 5′-recessed DNA end with a 40-nucleotide (nt) ssDNA overhang, where it localized to the ssDNA-dsDNA junction and efficiently blocked resection by Exo1. Interestingly, RPA could exclude Ku from a partially resected structure with a 22-nt ssDNA tail and thus restored processing by Exo1. However, at a 40-nt tail, Ku remained stably associated at the ssDNA-dsDNA junction, and RPA simultaneously engaged the ssDNA region. We discuss a model in which the dynamic equilibrium between Ku and RPA binding to a partially resected DNA end influences the timing and efficiency of the resection process. PMID:26067273

  4. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    PubMed

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  5. Expression analysis of a novel pyridoxal kinase messenger RNA splice variant, PKL, in oil rape suffering abiotic stress and phytohormones.

    PubMed

    Yu, Shunwu; Luo, Lijun

    2008-12-01

    Pyridoxal kinase is key enzyme for the biosynthesis of pyridoxal 5'-phosphate, the biologically active form of vitamin B6, in the salvage pathway. A pyridoxal kinase gene, BnPKL (GenBank accession No. DQ463962), was isolated from oilseed rape (Brassica napus L.) following water stress through rapid amplification of complementary DNA (cDNA) ends. The results showed that the gene had two splice variants: PKL and PKL2. PKL, the long cDNA, encodes a 334 amino acid protein with a complete ATP-binding site, pyridoxal kinase-binding site and dimer interface site of a pyridoxal kinase, while PKL2, the short cDNA, lacked a partial domain. Southern blot showed that there were two copies in Brassica napus. The expression of BnPKL cDNA could rescue the mutant phenotype of Escherichia coli defective in pyridoxal kinase. Real-time reverse transcription-polymerase chain reaction revealed that the relative abundance of two transcripts are modulated by development and environmental stresses. Abscisic acid and NaCl were inclined to decrease PKL expression, but H2O2 and cold temperatures induced the PKL expression. In addition, the PKL expression could be transiently induced by jasmonate acid at an early stage, abscisic acid, salicylic acid and jasmonate acid enhanced the PKL expression in roots. Our results demonstrated that BnPKL was a pyridoxal kinase involved in responses to biotic and abiotic stresses.

  6. The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor.

    PubMed

    Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza

    2014-12-01

    This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Fluorescent aptasensor for detection of four tetracycline veterinary drugs in milk based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

    PubMed

    Zhou, Chen; Zou, Haimin; Sun, Chengjun; Ren, Dongxia; Xiong, Wei; Li, Yongxin

    2018-05-01

    Based on a novel signal amplification strategy by catalytic hairpin assembly and displacement of G-quadruplex DNA, an enzyme-free, non-label fluorescent aptasensing approach was established for sensitive detection of four tetracycline veterinary drugs in milk. The network consisted of a pair of partially complementary DNA hairpins (HP1 and HP2). The DNA aptamer of four tetracycline veterinary drugs was located at the sticky end of the HP1. The ring region of HP1 rich in G and C could form a stable G-quadruplex structure, which could emit specific fluorescence signal after binding with the fluorescent dye and N-methylmesoporphyrin IX (NMM). When presented in the system, the target analytes would be repeatedly used to trigger a recycling procedure between the hairpins, generating numerous HP1-HP2 duplex complexes and displacing G-quadruplex DNA. Thus, the sensitive detection of target analytes was achieved in a wide linear range (0-1000 μg/L) with the detection limit of 4.6 μg/L. Moreover, this proposed method showed high discrimination efficiency towards target analytes against other common mismatched veterinary drugs, and could be successfully applied to the analysis of milk samples. Graphical abstract Schematic of target analyte detection based on catalytic hairpin assembly reaction and displacement of G-quadruplex.

  8. Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

    PubMed Central

    Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

    2012-01-01

    In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

  9. Rotating Rod Renewable Microcolumns for Automated, Solid-Phase DNA Hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bruckner-Lea, Cynthia J.; Stottlemyre, Mark R.; Holman, David A.

    1999-12-01

    The development of a new temperature-controlled renewable microcolumn flow cell for solid-phase nucleic acid analysis in a sequential injection system is described. The flow cell includes a stepper motor-driven rotating rod with the working end cut to a 45 degree angle. In one position, the end of the rod prevents passage of microbeads while allowing fluid flow; rotation of the rod by 180 degrees release the beads. This system was used to rapidly test many hybridization and elution protocols to examine the temperature and solution conditions required for sequence specific nucleic acid hybridization. Target nucleic acids labeled with a near-infraredmore » fluorescent dye were detected immediately post-column using a flow-through fluorescence detector, with a detection limit of 40 pM dye concentration at a flow rate of 5 mu l/s. Temperature control of the column and the presence of Triton X-100 surfactant were critical for specific hybridization. Perfusion of the column with complementary oligonucleotide (200 mu l, 10nM) resulted in hybridization with 8% of the DNA binding sites on the microbeads with a solution residence time of less than a second and a total sample perfusion time of 40 seconds. The use of the renewable column system for detection of an unlabeled PCR product in a sandwich assay was also demonstrated.« less

  10. Protection of Arabidopsis Blunt-Ended Telomeres Is Mediated by a Physical Association with the Ku Heterodimer[OPEN

    PubMed Central

    Valuchova, Sona; Prokop, Zbynek; Hofr, Ctirad

    2017-01-01

    Telomeres form specialized chromatin that protects natural chromosome termini from being recognized as DNA double-strand breaks. Plants possess unusual blunt-ended telomeres that are unable to form t-loops or complex with single-strand DNA binding proteins, raising the question of the mechanism behind their protection. We have previously suggested that blunt-ended telomeres in Arabidopsis thaliana are protected by Ku, a DNA repair factor with a high affinity for DNA ends. In nonhomologous end joining, Ku loads onto broken DNA via a channel consisting of positively charged amino acids. Here, we demonstrate that while association of Ku with plant telomeres also depends on this channel, Ku’s requirements for DNA binding differ between DNA repair and telomere protection. We show that a Ku complex proficient in DNA loading but impaired in translocation along DNA is able to protect blunt-ended telomeres but is deficient in DNA repair. This suggests that Ku physically sequesters blunt-ended telomeres within its DNA binding channel, shielding them from other DNA repair machineries. PMID:28584163

  11. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The cohering telomeres of Oxytricha.

    PubMed Central

    Oka, Y; Thomas, C A

    1987-01-01

    We have studied the process by which purified Oxytricha macronuclear DNA associates with itself to form large aggregates. The various macronuclear DNA molecules all have the same terminal or telomeric DNA sequences that are shown below. 5' C4A4C4A4C4--mean length----G4T4G4T4G4T4G4T4G4 G4T4G4T4G4T4G4T4G4-----2.4 kb------C4A4C4A4C4. When incubated at high concentrations, these telomeric sequences cohere with one another to form an unusual structure--one that is quite different from any DNA structure so far described. The evidence for this is the following: 1) These sequences cohere albeit slowly, in the presence of relatively high concentrations of Na+, and no other cation tested. This contrasts with the rapid coherence of complementary single-chain terminals of normal DNA (sticky ends) which occurs in the presence of any cation tested. 2) If the cohered form is transferred into buffers containing a special cation, K+, it becomes much more resistant to dissociation by heating. We estimate that K+ increases the thermal stability by 25 degrees or more. The only precedent known (to us) for a cation-specific stabilization is that seen in the quadruplex structure formed by poly I. The thermal stability of double helical macronuclear DNA depends on the cation concentration, but not the cation type. Limited treatment with specific nucleases show that the 3' and 5'-ended strands are essential for the formation of the cohering structure. Once in the cohered form, the telomeric sequences are protected from the action of nucleases. Coherence is inhibited by specific, but not by non-specific, synthetic oligomers, and by short telomeric fragments with or without their terminal single chains. We conclude that the coherence occurs by the formation of a novel condensed structure that involves the terminal nucleotides in three or four chains. Images PMID:3120149

  13. Element for use in an inductive coupler for downhole components

    DOEpatents

    Hall, David R [Provo, UT; Fox, Joe [Spanish Fork, UT

    2009-03-31

    An element for use in an inductive coupler for downhole components comprises an annular housing having a generally circular recess. The element further comprises a plurality of generally linear, magnetically conductive segments. Each segment includes a bottom portion, an inner wall portion, and an outer wall portion. The portions together define a generally linear trough from a first end to a second end of each segment. The segments are arranged adjacent to each other within the housing recess to form a generally circular trough. The ends of at least half of the segments are shaped such that the first end of one of the segments is complementary in form to the second end of an adjacent segment. In one embodiment, all of the ends are angled. Preferably, the first ends are angled with the same angle and the second ends are angled with the complementary angle.

  14. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Cancer.gov

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  15. What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

    2017-12-01

    Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

  16. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    PubMed

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. An optical relay approach to very low cost hybrid polymer-complementary metal-oxide semiconductor electrophoresis instrumentation.

    PubMed

    Hall, Gordon H; Sloan, David L; Ma, Tianchi; Couse, Madeline H; Martel, Stephane; Elliott, Duncan G; Glerum, D Moira; Backhouse, Christopher J

    2014-07-04

    Electrophoresis is an integral part of many molecular diagnostics protocols and an inexpensive implementation would greatly facilitate point-of-care (POC) applications. However, the high instrumentation cost presents a substantial barrier, much of it associated with fluorescence detection. The cost of such systems could be substantially reduced by placing the fluidic channel and photodiode directly above the detector in order to collect a larger portion of the fluorescent light. In future, this could be achieved through the integration and monolithic fabrication of photoresist microchannels on complementary metal-oxide semiconductor microelectronics (CMOS). However, the development of such a device is expensive due to high non-recurring engineering costs. To facilitate that development, we present a system that utilises an optical relay to integrate low-cost polymeric microfluidics with a CMOS chip that provides a photodiode, analog-digital conversion and a standard serial communication interface. This system embodies an intermediate level of microelectronic integration, and significantly decreases development costs. With a limit of detection of 1.3±0.4nM of fluorescently end-labeled deoxyribonucleic acid (DNA), it is suitable for diagnostic applications. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Demography or selection on linked cultural traits or genes? Investigating the driver of low mtDNA diversity in the sperm whale using complementary mitochondrial and nuclear genome analyses.

    PubMed

    Morin, Phillip A; Foote, Andrew D; Baker, Charles Scott; Hancock-Hanser, Brittany L; Kaschner, Kristin; Mate, Bruce R; Mesnick, Sarah L; Pease, Victoria L; Rosel, Patricia E; Alexander, Alana

    2018-06-01

    Mitochondrial DNA has been heavily utilized in phylogeography studies for several decades. However, underlying patterns of demography and phylogeography may be misrepresented due to coalescence stochasticity, selection, variation in mutation rates and cultural hitchhiking (linkage of genetic variation to culturally-transmitted traits affecting fitness). Cultural hitchhiking has been suggested as an explanation for low genetic diversity in species with strong social structures, counteracting even high mobility, abundance and limited barriers to dispersal. One such species is the sperm whale, which shows very limited phylogeographic structure and low mtDNA diversity despite a worldwide distribution and large population. Here, we use analyses of 175 globally distributed mitogenomes and three nuclear genomes to evaluate hypotheses of a population bottleneck/expansion vs. a selective sweep due to cultural hitchhiking or selection on mtDNA as the mechanism contributing to low worldwide mitochondrial diversity in sperm whales. In contrast to mtDNA control region (CR) data, mitogenome haplotypes are largely ocean-specific, with only one of 80 shared between the Atlantic and Pacific. Demographic analyses of nuclear genomes suggest low mtDNA diversity is consistent with a global reduction in population size that ended approximately 125,000 years ago, correlated with the Eemian interglacial. Phylogeographic analysis suggests that extant sperm whales descend from maternal lineages endemic to the Pacific during the period of reduced abundance and have subsequently colonized the Atlantic several times. Results highlight the apparent impact of past climate change, and suggest selection and hitchhiking are not the sole processes responsible for low mtDNA diversity in this highly social species. © 2018 John Wiley & Sons Ltd.

  19. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  20. Biochemical evidence for Ku-independent backup pathways of NHEJ.

    PubMed

    Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

    2003-09-15

    Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3' or 5' protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3' overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed.

  1. Biochemical evidence for Ku-independent backup pathways of NHEJ

    PubMed Central

    Wang, Huichen; Perrault, Ange Ronel; Takeda, Yoshihiko; Qin, Wei; Wang, Hongyan; Iliakis, George

    2003-01-01

    Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a non-homologous end joining (NHEJ) apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4 and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with an order of magnitude slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group and frequently joins incorrect ends. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK-dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. The present study investigates the role of Ku in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient, error-free, end joining observed in such in vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite the fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA end joining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing end joining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts in line with the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3′ or 5′ protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3′ overhangs. We propose that the affinity of Ku for DNA ends, particularly when cooperating with DNA-PKcs, suppresses B-NHEJ by quickly and efficiently binding DNA ends and directing them to D-NHEJ for rapid joining. A chromatin-based model of DNA DSB rejoining accommodating biochemical and genetic results is presented and deviations between in vitro and in vivo results discussed. PMID:12954774

  2. Unifying the DNA End-processing Roles of the Artemis Nuclease

    PubMed Central

    Chang, Howard H. Y.; Watanabe, Go; Lieber, Michael R.

    2015-01-01

    Artemis is a member of the metallo-β-lactamase protein family of nucleases. It is essential in vertebrates because, during V(D)J recombination, the RAG complex generates hairpins when it creates the double strand breaks at V, D, and J segments, and Artemis is required to open the hairpins so that they can be joined. Artemis is a diverse endo- and exonuclease, and creating a unified model for its wide range of nuclease properties has been challenging. Here we show that Artemis resects iteratively into blunt DNA ends with an efficiency that reflects the AT-richness of the DNA end. GC-rich ends are not cut by Artemis alone because of a requirement for DNA end breathing (and confirmed using fixed pseudo-Y structures). All DNA ends are cut when both the DNA-dependent protein kinase catalytic subunit and Ku accompany Artemis but not when Ku is omitted. These are the first biochemical data demonstrating a Ku dependence of Artemis action on DNA ends of any configuration. The action of Artemis at blunt DNA ends is slower than at overhangs, consistent with a requirement for a slow DNA end breathing step preceding the cut. The AT sequence dependence, the order of strand cutting, the length of the cuts, and the Ku-dependence of Artemis action at blunt ends can be reconciled with the other nucleolytic properties of both Artemis and Artemis·DNA-PKcs in a model incorporating DNA end breathing of blunt ends to form transient single to double strand boundaries that have structural similarities to hairpins and fixed 5′ and 3′ overhangs. PMID:26276388

  3. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Cdc13 prevents telomere uncapping and Rad50-dependent homologous recombination

    PubMed Central

    Grandin, Nathalie; Damon, Christelle; Charbonneau, Michel

    2001-01-01

    Cdc13 performs an essential function in telomere end protection in budding yeast. Here, we analyze the consequences on telomere dynamics of cdc13-induced telomeric DNA damage in proliferating cells. Checkpoint-deficient cdc13-1 cells accumulated DNA damage and eventually senesced. However, these telomerase-proficient cells could survive by using homologous recombination but, contrary to telomerase-deficient cells, did so without prior telomere shortening. Strikingly, homologous recombination in cdc13-1 mec3, as well as in telomerase-deficient cdc13-1 cells, which were Rad52- and Rad50-dependent but Rad51-independent, exclusively amplified the TG1–3 repeats. This argues that not only short telomeres are substrates for type II recombination. The Cdc13-1 mutant protein harbored a defect in its association with Stn1 and Ten1 but also an additional, unknown, defect that could not be cured by expressing a Cdc13-1– Ten1–Stn1 fusion. We propose that Cdc13 prevents telomere uncapping and inhibits recombination between telomeric sequences through a pathway distinct from and complementary to that used by telomerase. PMID:11689452

  5. Step-gate polysilicon nanowires field effect transistor compatible with CMOS technology for label-free DNA biosensor.

    PubMed

    Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F

    2013-02-15

    Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  7. Immunofluorescence-based methods to monitor DNA end resection

    PubMed Central

    Mukherjee, Bipasha; Tomimatsu, Nozomi; Burma, Sandeep

    2017-01-01

    Summary Double-strand breaks (DSBs) are the most deleterious amongst all types of DNA damage that can occur in the cell. These breaks arise from both endogenous (for example, DNA replication stress) as well as exogenous insults (for example, ionizing radiation). DSBs are principally repaired by one of two major pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). NHEJ is an error-prone process that can occur in all phases of the cell cycle, while HR is limited to the S and G2 phases of the cell cycle when a sister chromatid is available as a template for error-free repair. The first step in HR is “DNA end resection”, a process during which the broken DNA end is converted into a long stretch of 3′-ended single-stranded DNA (ssDNA). In recent years, DNA end resection has been identified as a pivotal step that controls “repair pathway choice” i.e., the appropriate choice between NHEJ and HR for DSB repair. Therefore, methods to quantitatively or semi-quantitatively assess DNA end resection have gained importance in laboratories working on DNA repair. In this chapter, we describe two simple immunofluorescence-based techniques to monitor DNA end resection in mammalian cells. The first technique involves immuno-detection of Replication Protein A (RPA), a ssDNA-binding protein that binds to resected DNA. The second technique involves labeling of genomic DNA with 5-bromo-2′-deoxyuridine (BrdU) that can be detected by anti-BrdU antibody only after the DNA becomes single stranded due to resection. These methods are not complicated, do not involve sophisticated instrumentation or reporter constructs, and can be applied to most mammalian cell lines, and therefore, should be of broad utility as simple ways of monitoring DNA end resection in vivo. PMID:25804748

  8. Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

    PubMed

    Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

    2012-01-01

    A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  10. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

    PubMed

    Thomason, Lynn C; Costantino, Nina; Court, Donald L

    2016-09-13

    Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.

  11. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    PubMed

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  12. A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

    PubMed

    Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

    2016-12-01

    Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Visual detection of multidrug resistance gene in living cell using the molecular beacon imaging

    NASA Astrophysics Data System (ADS)

    Zhou, Qiumei; Ma, Yi; Gu, Yueqing

    2014-09-01

    A major problem in cancer treatment is the development of resistance to chemotherapeutic agents in tumor cells. Detection of effective prognostic biomarkers and targets are of crucial importance to the management of individualized therapies. However, quantitative analysis of the drug resistance gene had been difficult because of technical limitations. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA), which served as a beacon for detecting human drug resistance indicater. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5'end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The hDAuNP beacons could be taken up by living cells with low inherent cytotoxicity and higher stability. hDAuNP beacon imaged by confocal laser scanning microscopy to detect the resistance gene expression. The detected fluorescence in MCF7and MCF7/ADR cells correlates with the specific drug resistance gene expression, which is consistent with the result from Q-PCR. Thus, this approach overcame many of the challenges of previous techniques by creating highly sensitive and effective intracellular probes for monitoring gene expression.

  14. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

  15. Anionic magnetite nanoparticle conjugated with pyrrolidinyl peptide nucleic acid for DNA base discrimination

    NASA Astrophysics Data System (ADS)

    Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha

    2016-09-01

    Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.

  16. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  17. Display of disulfide-rich proteins by complementary DNA display and disulfide shuffling assisted by protein disulfide isomerase.

    PubMed

    Naimuddin, Mohammed; Kubo, Tai

    2011-12-01

    We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  19. miR-ID: A novel, circularization-based platform for detection of microRNAs

    PubMed Central

    Kumar, Pavan; Johnston, Brian H.; Kazakov, Sergei A.

    2011-01-01

    MicroRNAs (miRNAs) are important regulators of gene expression and have great potential as biomarkers, prognostic indicators, and therapeutic targets. Determining the expression patterns of these molecules is essential for elucidating their biogenesis, regulation, relation to disease, and response to therapy. Although PCR-based assays are commonly used for expression profiling of miRNAs, the small size, sequence heterogeneity, and (in some cases) end modifications of miRNAs constrain the performance of existing PCR methods. Here we introduce miR-ID, a novel method that avoids these constraints while providing superior sensitivity and sequence specificity at a lower cost. It also has the unique ability to differentiate unmodified small RNAs from those carrying 2′-OMe groups at their 3′-ends while detecting both forms. miR-ID is comprised of the following steps: (1) circularization of the miRNA by a ligase; (2) reverse transcription of the circularized miRNA (RTC), producing tandem repeats of a DNA sequence complementary to the miRNA; and (3) qPCR amplification of segments of this multimeric cDNA using 5′-overlapping primers and a nonspecific dye such as SYBR Green. No chemically modified probes (e.g., TaqMan) or primers (e.g., LNA) are required. The circular RNA and multimeric cDNA templates provide unmatched flexibility in the positioning of primers, which may include straddling the boundaries between these repetitive miRNA sequences. miR-ID is based on new findings that are themselves of general interest, including reverse transcription of small RNA circles and the use of 5′-overlapping primers for detection of repetitive sequences by qPCR. PMID:21169480

  20. Structural Insights Into DNA Repair by RNase T—An Exonuclease Processing 3′ End of Structured DNA in Repair Pathways

    PubMed Central

    Hsiao, Yu-Yuan; Fang, Woei-Horng; Lee, Chia-Chia; Chen, Yi-Ping; Yuan, Hanna S.

    2014-01-01

    DNA repair mechanisms are essential for preservation of genome integrity. However, it is not clear how DNA are selected and processed at broken ends by exonucleases during repair pathways. Here we show that the DnaQ-like exonuclease RNase T is critical for Escherichia coli resistance to various DNA-damaging agents and UV radiation. RNase T specifically trims the 3′ end of structured DNA, including bulge, bubble, and Y-structured DNA, and it can work with Endonuclease V to restore the deaminated base in an inosine-containing heteroduplex DNA. Crystal structure analyses further reveal how RNase T recognizes the bulge DNA by inserting a phenylalanine into the bulge, and as a result the 3′ end of blunt-end bulge DNA can be digested by RNase T. In contrast, the homodimeric RNase T interacts with the Y-structured DNA by a different binding mode via a single protomer so that the 3′ overhang of the Y-structured DNA can be trimmed closely to the duplex region. Our data suggest that RNase T likely processes bulge and bubble DNA in the Endonuclease V–dependent DNA repair, whereas it processes Y-structured DNA in UV-induced and various other DNA repair pathways. This study thus provides mechanistic insights for RNase T and thousands of DnaQ-like exonucleases in DNA 3′-end processing. PMID:24594808

  1. Rapid polymerase chain reaction screening of Helicobacter pylori chromosomal point mutations.

    PubMed

    Ge, Z; Taylor, D E

    1997-09-01

    Microdiversity (within individual genes) in the genomes of different Helicobacter pylori strains has been demonstrated to be more frequent than that seen in other prokaryotes. Point mutations in some genes, such as the vacA and 23S ribosomal RNA genes could result in the alteration of pathogenicity or antibiotic susceptibility of individual H. pylori strains. Development of a simple, rapid, and reliable screening method would be useful in the molecular characterization of genetic variation among different H. pylori strains. The copP gene from H. pylori UA802 was used as a model for developing a mutation screening method. Four point mutations were introduced into the copP gene by in vitro site-directed mutagenesis and were verified by DNA sequencing. The mutated copP gene replaced the wild-type locus by natural transformation and homologous recombination. The site-specific mutants were screened by polymerase chain reaction (PCR) using 3'-end mismatched primers. The origins of the PCR fragments were demonstrated by Southern hybridization with the copP-derived DNA probe. Three of these four mutations were characterized by PCR with the specific primers that contained the 3'-terminal nucleotide complementary only to the mutated nucleotide on both plasmid and chromosomal DNA templates. One mutation was able to be identified with the foregoing primer containing an additional wild-type nucleotide at its 3'-end. Point mutant screening with these specific primers offers 100% sensitivity in the aforementioned conditions. To achieve optimal screening, the concentration of magnesium and the annealing temperature have to be adjusted. The procedure reported in this study is a simple, economical, rapid, and efficient approach in the identification of site-specific mutations on both plasmids and chromosomal DNA. Although the method was developed by using a specified H. pylori gene, it can be extended easily to other genes of interest in H. pylori or other organisms.

  2. Characterization of soil nematode communities in three cropping systems through morphological and DNA metabarcoding approaches

    USDA-ARS?s Scientific Manuscript database

    Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...

  3. Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

    PubMed

    Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

    2008-03-01

    We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

  4. Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

    PubMed Central

    Hardman, Norman

    1974-01-01

    Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

  5. ‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

    PubMed Central

    Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

    2008-01-01

    We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

  6. A human transcription factor in search mode.

    PubMed

    Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

    2016-01-08

    Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Probing the interaction of archaeal DNA polymerases with deaminated bases using X-ray crystallography and non-hydrogen bonding isosteric base analogues.

    PubMed

    Killelea, Tom; Ghosh, Samantak; Tan, Samuel S; Heslop, Pauline; Firbank, Susan J; Kool, Eric T; Connolly, Bernard A

    2010-07-13

    Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describe uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at position 2 explains the stimulation of the polymerase 3'-5' proofreading exonuclease, observed with deaminated bases at this location. A beta-hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double-stranded DNA. This denatures the two complementary primer bases and directs the resulting 3' single-stranded extension toward the exonuclease active site. Finally, the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using nonpolar isosteres. Affinity for both 2,4-difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine, respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4-difluorobenzene is seen, confirming a role for shape recognition.

  8. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

    PubMed Central

    Sin, Jeong-Im

    2009-01-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

  9. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

    PubMed

    Sin, Jeong-Im

    2009-09-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

  10. Structural determinants of HIV-1 nucleocapsid protein for cTAR DNA binding and destabilization, and correlation with inhibition of self-primed DNA synthesis.

    PubMed

    Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves

    2005-05-20

    The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.

  11. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  12. HUMAN GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE-2 (GAPD2) GENE IS EXPRESSED SPECIFICALLY IN SPERMATOGENIC CELLS

    EPA Science Inventory

    Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...

  13. Comparison of multiple gene assembly methods for metabolic engineering

    Treesearch

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  14. Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

    USDA-ARS?s Scientific Manuscript database

    A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

  15. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  16. Fluorescence correlation spectroscopy study of the complexation of DNA hybrids, IgG antibody, and a chimeric protein of IgG-binding ZZ domains fused with a carbohydrate binding module.

    PubMed

    Rosa, A M M; Prazeres, D M F; Paulo, P M R

    2017-06-28

    Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.

  17. Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching

    PubMed Central

    Teo, Yin Nah; Wilson, James N.

    2010-01-01

    We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115

  18. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  19. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  20. Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arondel, V.; Lemieux, B.; Hwang, I.

    1992-11-20

    A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less

  1. DNA breaks and end resection measured genome-wide by end sequencing | Center for Cancer Research

    Cancer.gov

    About the Cover The cover depicts a ribbon of DNA portrayed as a city skyline. The central gap in the landscape localizes to the precise site of the DNA break. The features surrounding the break denote the processing of DNA-end structures (end-resection) emanating from the break location. Cover artwork by Ethan Tyler, NIH. Abstract

  2. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  3. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  4. Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

    PubMed

    Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

    2012-01-15

    A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

    NASA Astrophysics Data System (ADS)

    Zhao, Weian; Brook, Michael A.; Li, Yingfu

    Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

  6. DNA Nanotechnology for Cancer Therapy

    PubMed Central

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

  7. Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2

    PubMed Central

    De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.

    2013-01-01

    SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376

  8. End labeling procedures: an overview.

    PubMed

    Hilario, Elena

    2004-09-01

    There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.

  9. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    PubMed

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

    PubMed

    Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

    2018-08-27

    A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Dual Roles for DNA Polymerase Theta in Alternative End-Joining Repair of Double-Strand Breaks in Drosophila

    PubMed Central

    McVey, Mitch

    2010-01-01

    DNA double-strand breaks are repaired by multiple mechanisms that are roughly grouped into the categories of homology-directed repair and non-homologous end joining. End-joining repair can be further classified as either classical non-homologous end joining, which requires DNA ligase 4, or “alternative” end joining, which does not. Alternative end joining has been associated with genomic deletions and translocations, but its molecular mechanism(s) are largely uncharacterized. Here, we report that Drosophila melanogaster DNA polymerase theta (pol theta), encoded by the mus308 gene and previously implicated in DNA interstrand crosslink repair, plays a crucial role in DNA ligase 4-independent alternative end joining. In the absence of pol theta, end joining is impaired and residual repair often creates large deletions flanking the break site. Analysis of break repair junctions from flies with mus308 separation-of-function alleles suggests that pol theta promotes the use of long microhomologies during alternative end joining and increases the likelihood of complex insertion events. Our results establish pol theta as a key protein in alternative end joining in Drosophila and suggest a potential mechanistic link between alternative end joining and interstrand crosslink repair. PMID:20617203

  12. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  13. Rad51 and RecA juxtapose dsDNA ends ready for DNA ligase-catalyzed end-joining under recombinase-suppressive conditions

    PubMed Central

    Konomura, Naoto; Arai, Naoto; Shinohara, Takeshi; Kobayashi, Jun; Iwasaki, Wakana; Ikawa, Shukuko; Kusano, Kohji; Shibata, Takehiko

    2017-01-01

    RecA-family recombinase-catalyzed ATP-dependent homologous joint formation is critical for homologous recombination, in which RecA or Rad51 binds first to single-stranded (ss)DNA and then interacts with double-stranded (ds)DNA. However, when RecA or Rad51 interacts with dsDNA before binding to ssDNA, the homologous joint-forming activity of RecA or Rad51 is quickly suppressed. We found that under these and adenosine diphosphate (ADP)-generating suppressive conditions for the recombinase activity, RecA or Rad51 at similar optimal concentrations enhances the DNA ligase-catalyzed dsDNA end-joining (DNA ligation) about 30- to 40-fold. The DNA ligation enhancement by RecA or Rad51 transforms most of the substrate DNA into multimers within 2–5 min, and for this enhancement, ADP is the common and best cofactor. Adenosine triphosphate (ATP) is effective for RecA, but not for Rad51. Rad51/RecA-enhanced DNA ligation depends on dsDNA-binding, as shown by a mutant, and is independent of physical interactions with the DNA ligase. These observations demonstrate the common and unique activities of RecA and Rad51 to juxtapose dsDNA-ends in preparation for covalent joining by a DNA ligase. This new in vitro function of Rad51 provides a simple explanation for our genetic observation that Rad51 plays a role in the fidelity of the end-joining of a reporter plasmid DNA, by yeast canonical non-homologous end-joining (NHEJ) in vivo. PMID:27794044

  14. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    PubMed

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  16. Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, S.; Maye, M; Zhang, Y

    We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

  17. Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

    NASA Technical Reports Server (NTRS)

    Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

    1982-01-01

    The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

  18. Shark (Scyliorhinus torazame) metallothionein: cDNA cloning, genomic sequence, and expression analysis.

    PubMed

    Cho, Young Sun; Choi, Buyl Nim; Ha, En-Mi; Kim, Ki Hong; Kim, Sung Koo; Kim, Dong Soo; Nam, Yoon Kwon

    2005-01-01

    Novel metallothionein (MT) complementary DNA and genomic sequences were isolated from a cartilaginous shark species, Scyliorhinus torazame. The full-length open reading frame (ORF) of shark MT cDNA encoded 68 amino acids with a high cysteine content (29%). The genomic ORF sequence (932 bp) of shark MT isolated by polymerase chain reaction (PCR) comprised 3 exons with 2 interventing introns. Shark MT sequence shared many conserved features with other vertebrate MTs: overall amino acid identities of shark MT ranged from 47% to 57% with fish MTs, and 41% to 62% with mammalian MTs. However, in addition to these conserved characteristics, shark MT sequence exhibited some unique characteristics. It contained 4 extra amino acids (Lys-Ala-Gly-Arg) at the end of the beta-domain, which have not been reported in any other vertebrate MTs. The last amino acid residue at the C-terminus was Ser, which also has not been reported in fish and mammalian MTs. The MT messenger RNA levels in shark liver and kidney, assessed by semiquantitative reverse transcriptase PCR and RNA blot hybridization, were significantly affected by experimental exposures to heavy metals (cadmium, copper, and zinc). Generally, the transcriptional activation of shark MT gene was dependent on the dose (0-10 mg/kg body weight for injection and 0-20 microM for immersion) and duration (1-10 days); zinc was a more potent inducer than copper and cadmium.

  19. DNA Packaging Specificity of Bacteriophage N15 with an Excursion into the Genetics of a Cohesive End Mismatch

    PubMed Central

    Feiss, Michael; Young Min, Jea; Sultana, Sawsan; Patel, Priyal; Sippy, Jean

    2015-01-01

    During DNA replication by the λ-like bacteriophages, immature concatemeric DNA is produced by rolling circle replication. The concatemers are processed into mature chromosomes with cohesive ends, and packaged into prohead shells, during virion assembly. Cohesive ends are generated by the viral enzyme terminase, which introduces staggered nicks at cos, an approx. 200 bp-long sequence containing subsites cosQ, cosN and cosB. Interactions of cos subsites of immature concatemeric DNA with terminase orchestrate DNA processing and packaging. To initiate DNA packaging, terminase interacts with cosB and nicks cosN. The cohesive ends of N15 DNA differ from those of λ at 2/12 positions. Genetic experiments show that phages with chromosomes containing mismatched cohesive ends are functional. In at least some infections, the cohesive end mismatch persists through cyclization and replication, so that progeny phages of both allelic types are produced in the infected cell. N15 possesses an asymmetric packaging specificity: N15 DNA is not packaged by phages λ or 21, but surprisingly, N15-specific terminase packages λ DNA. Implications for genetic interactions among λ-like bacteriophages are discussed. PMID:26633301

  20. Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

    DTIC Science & Technology

    2008-09-22

    the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

  1. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  2. Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

    PubMed

    Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

    1989-01-01

    A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

  3. An origin of the immunogenicity of in vitro transcribed RNA.

    PubMed

    Mu, Xin; Greenwald, Emily; Ahmad, Sadeem; Hur, Sun

    2018-06-01

    The emergence of RNA-based therapeutics demands robust and economical methods to produce RNA with few byproducts from aberrant activity. While in vitro transcription using the bacteriophage T7 RNA polymerase is one such popular method, its transcripts are known to display an immune-stimulatory activity that is often undesirable and uncontrollable. We here showed that the immune-stimulatory activity of T7 transcript is contributed by its aberrant activity to initiate transcription from a promoter-less DNA end. This activity results in the production of an antisense RNA that is fully complementary to the intended sense RNA product, and consequently a long double-stranded RNA (dsRNA) that can robustly stimulate a cytosolic pattern recognition receptor, MDA5. This promoter-independent transcriptional activity of the T7 RNA polymerase was observed for a wide range of DNA sequences and lengths, but can be suppressed by altering the transcription reaction with modified nucleotides or by reducing the Mg2+ concentration. The current work thus not only offers a previously unappreciated mechanism by which T7 transcripts stimulate the innate immune system, but also shows that the immune-stimulatory activity can be readily regulated.

  4. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  5. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  6. Multidimensional analysis of intracellular bacteriophage T7 DNA: effects of amber mutations in genes 3 and 19.

    PubMed Central

    Serwer, P; Watson, R H; Hayes, S J

    1987-01-01

    By use of rate-zonal centrifugation, followed by either one- or two-dimensional agarose gel electrophoresis, the forms of intracellular bacteriophage T7 DNA produced by replication, recombination, and packaging have been analyzed. Previous studies had shown that at least some intracellular DNA with sedimentation coefficients between 32S (the S value of mature T7 DNA) and 100S is concatemeric, i.e., linear and longer than mature T7 DNA. The analysis presented here confirmed that most of this DNA is linear, but also revealed a significant amount of circular DNA. The data suggest that these circles are produced during DNA packaging. It is proposed that circles are produced after a capsid has bound two sequential genomes in a concatemer. The size distribution of the linear, concatemeric DNA had peaks at the positions of dimeric and trimeric concatemers. Restriction endonuclease analysis revealed that most of the mature T7 DNA subunits of concatemers were joined left end to right end. However, these data also suggest that a comparatively small amount of left-end to left-end joining occurs, possibly by blunt-end ligation. A replicating form of T7 DNA that had an S value greater than 100 (100S+ DNA) was also found to contain concatemers. However, some of the 100S+ DNA, probably the most branched component, remained associated with the origin after agarose gel electrophoresis. It has been found that T7 protein 19, known to be required for DNA packaging, was also required to prevent loss, probably by nucleolytic degradation, of the right end of all forms of intracellular T7 DNA. T7 gene 3 endonuclease, whose activity is required for both recombination of T7 DNA and degradation of host DNA, was required for the formation of the 32S to 100S molecules that behaved as concatemers during gel electrophoresis. In the absence of gene 3 endonuclease, the primary accumulation product was origin-associated 100S+ DNA with properties that suggest the accumulation of branches, primarily at the left end of mature DNA subunits within the 100S+ DNA. Images PMID:2822958

  7. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  8. Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

    NASA Astrophysics Data System (ADS)

    Kikuchi, Shoshi

    2009-02-01

    Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

  9. A cascade amplification strategy based on rolling circle amplification and hydroxylamine amplified gold nanoparticles enables chemiluminescence detection of adenosine triphosphate.

    PubMed

    Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping

    2014-08-07

    A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.

  10. B-DNA Structure and Stability as Function of Nucleic Acid Composition: Dispersion-Corrected DFT Study of Dinucleoside Monophosphate Single and Double Strands

    PubMed Central

    Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

    2013-01-01

    We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2

  11. Probing the interaction of archaeal DNA polymerases with deaminated bases using X-ray crystallography and non-hydrogen bonding isosteric base analogues†

    PubMed Central

    Killelea, Tom; Ghosh, Samantak; Tan, Samuel S.; Heslop, Pauline; Firbank, Susan; Kool, Eric T.; Connolly, Bernard A.

    2010-01-01

    Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describes uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at the +2 position explains the stimulation of the polymerase 3′-5′ proof reading exonuclease, observed with deaminated bases at this location. A β hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double stranded DNA. This denatures the two complementary primer bases and directs the resulting 3′ single-stranded extension towards the exonuclease active site. Finally the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using non-polar isosteres. Affinity for both 2,4 difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4 difluorobenzene is seen, confirming a role for shape recognition. PMID:20527806

  12. Getting it Right: How DNA Polymerases Select the Right Nucleotide.

    PubMed

    Ludmann, Samra; Marx, Andreas

    2016-01-01

    All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

  13. RNAi drives nonreciprocal translocations at eroding chromosome ends to establish telomere-free linear chromosomes.

    PubMed

    Begnis, Martina; Apte, Manasi S; Masuda, Hirohisa; Jain, Devanshi; Wheeler, David Lee; Cooper, Julia Promisel

    2018-04-01

    The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI rDNA " chromosomes), it is dispensable for HAATI rDNA maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI rDNA genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device. © 2018 Begnis et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.

    PubMed

    Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng

    2018-05-31

    By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.

  15. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    PubMed

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  16. Liquid biopsy in non-small cell lung cancer: a key role in the future of personalized medicine?

    PubMed

    Pi, Can; Zhang, Ming-Feng; Peng, Xiao-Xiao; Zhang, Yi-Chen; Xu, Chong-Rui; Zhou, Qing

    2017-12-01

    Liquid biopsies, especially the analysis of circulating tumor DNA (ctDNA), as a novel and non-invasive method for the diagnosis and monitoring of non-small cell lung cancer (NSCLC) have already been implemented in clinical settings. The majority of ctDNA is released from apoptotic or necrotic tumor cells, thus reflecting the genetic profile of a tumor. Numerous studies have reported a high concordance in mutation profiles derived from liquid biopsy and tissue biopsy, especially in driver genes. Liquid biopsy could overcome the clonal heterogeneity of tumour biopsy, as it provides a single snapshot of a tumour tissue. Moreover, non-invasiveness is the biggest advantage for liquid biopsy, and the procedure can be repeatedly performed during the treatment for the purpose of monitoring. Therefore, ctDNA could act as a potential complementary method for tissue biopsies in diagnosis, prognostic, treatment response and resistance. Areas covered: This review summarizes the recent advancements in liquid biopsy with a focus on NSCLC, including its applications and technologies associated with assessing ctDNA. The authors conclude the review by discussing the challenges associated with liquid biopsy. Expert commentary: The analysis of ctDNA represents a promising method for liquid biopsy, which will be a novel and potentially complementary method in diagnosis, treatment and prognostic in NSCLC at all stages.

  17. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  18. Regulation of corneal repair by particle-mediated gene transfer of opioid growth factor receptor complementary DNA.

    PubMed

    Zagon, Ian S; Sassani, Joseph W; Malefyt, Kristin J; McLaughlin, Patricia J

    2006-11-01

    To determine whether molecular manipulation of the opioid growth factor receptor (OGFr) alters corneal reepithelialization following central corneal abrasion in rats. The plasmid pcDNA3.1 + OGFr, carrying the rat OGFr complementary DNA in both the sense and antisense orientations, and empty vector (EV), were delivered by gene gun to the rat cornea. After 24 hours, corneas were abraded and reepithelialization was documented by fluorescein photography. Twenty-four hours after wounding, DNA synthesis (with bromodeoxyuridine) was examined. Eyes transfected with sense constructs of OGFr had corneal defects that were 24%, 52%, and 50% larger than the EV group at 16, 24, and 28 hours, respectively. Conversely, corneas transfected with antisense constructs of OGFr had corneal defects that were 56% and 48% smaller than the EV group at 16 and 24 hours, respectively. Bromodeoxyuridine labeling in the basal and suprabasal layers of the antisense group were increased 3.3- and 3.7-fold, respectively, in DNA synthesis from corresponding EV layers; DNA synthesis was comparable in the sense and EV groups. Excess OGFr delays reepithelialization, whereas attenuation of OGFr accelerates repair of the corneal surface. Clinical Relevance Inhibition of opioid growth factor action using gene therapy could be important in the treatment of corneal diseases such as nonhealing and recurrent erosions, diabetic keratopathy, and neurotrophic keratitis.

  19. Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General Phenomenon Governed by Steric Hindrance in Duplex DNA.

    PubMed

    Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin

    2016-04-19

    G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.

  20. Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection.

    PubMed

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2017-05-10

    A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices.

  1. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    PubMed

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Motif-based analysis of large nucleotide data sets using MEME-ChIP

    PubMed Central

    Ma, Wenxiu; Noble, William S; Bailey, Timothy L

    2014-01-01

    MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928

  3. Mechanisms of Surface-Mediated DNA Hybridization

    PubMed Central

    2015-01-01

    Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

  4. Impedimetric genosensor for detection of hepatitis C virus (HCV1) DNA using viral probe on methylene blue doped silica nanoparticles.

    PubMed

    Singhal, Chaitali; Ingle, Aviraj; Chakraborty, Dhritiman; Pn, Anoop Krishna; Pundir, C S; Narang, Jagriti

    2017-05-01

    An impedimetric genosensor was fabricated for detection of hepatitis C virus (HCV) genotype 1 in serum, based on hybridization of the probe with complementary target cDNA from sample. To achieve it, probe DNA complementary to HCVgene was immobilized on the surface of methylene blue (MB) doped silica nanoparticles MB@SiNPs) modified fluorine doped tin oxide (FTO) electrode. The synthesized MB@SiNPs was characterized using scanning electron microscopy (SEM), high resolution transmission electron microscopy (HRTEM) and X-ray diffraction (XRD) pattern. This modified electrode (ssDNA/MB@SiNPs/FTO) served both as a signal amplification platform (due to silica nanoparticles (SiNPs) as well as an electrochemical indicator (due to methylene blue (MB)) for the detection of the HCV DNA in patient serum sample. The genosensor was optimized and evaluated. The sensor showed a dynamic linear range 100-10 6 copies/mL, with a detection limit of 90 copies/mL. The sensor was applied for detection of HCV in sera of hepatitis patient and could be renewed. The half life of the sensor was 4 weeks. The MB@SiNPs/FTO electrode could be used for preparation of other gensensors also. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.

  6. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  7. Advanced Containment System

    DOEpatents

    Kostelnik, Kevin M.; Kawamura, Hideki; Richardson, John G.; Noda, Masaru

    2004-10-12

    An advanced containment system for containing buried waste and associated leachate. A trench is dug on either side of the zone of interest containing the buried waste so as to accommodate a micro tunnel boring machine. A series of small diameter tunnels are serially excavated underneath the buried waste. The tunnels are excavated by the micro tunnel boring machine at a consistent depth and are substantially parallel to each other. As tunneling progresses, steel casing sections are connected end to end in the excavated portion of the tunnel so that a steel tube is formed. Each casing section has complementary interlocking structure running its length that interlocks with complementary interlocking structure on the adjacent casing section. Thus, once the first tube is emplaced, placement of subsequent tubes is facilitated by the complementary interlocking structure on the adjacent, previously placed, casing sections.

  8. Advanced Containment System

    DOEpatents

    Kostelnik, Kevin M.; Kawamura, Hideki; Richardson, John G.; Noda, Masaru

    2005-05-24

    An advanced containment system for containing buried waste and associated leachate. A trench is dug on either side of the zone of interest containing the buried waste so as to accommodate a micro tunnel boring machine. A series of small diameter tunnels are serially excavated underneath the buried waste. The tunnels are excavated by the micro tunnel boring machine at a consistent depth and are substantially parallel to each other. As tunneling progresses, steel casing sections are connected end to end in the excavated portion of the tunnel so that a steel tube is formed. Each casing section has complementary interlocking structure running its length that interlocks with complementary interlocking structure on the adjacent casing section. Thus, once the first tube is emplaced, placement of subsequent tubes is facilitated by the complementary interlocking structure on the adjacent, previously placed, casing sections.

  9. DNA Breaks and End Resection Measured Genome-wide by End Sequencing.

    PubMed

    Canela, Andres; Sridharan, Sriram; Sciascia, Nicholas; Tubbs, Anthony; Meltzer, Paul; Sleckman, Barry P; Nussenzweig, André

    2016-09-01

    DNA double-strand breaks (DSBs) arise during physiological transcription, DNA replication, and antigen receptor diversification. Mistargeting or misprocessing of DSBs can result in pathological structural variation and mutation. Here we describe a sensitive method (END-seq) to monitor DNA end resection and DSBs genome-wide at base-pair resolution in vivo. We utilized END-seq to determine the frequency and spectrum of restriction-enzyme-, zinc-finger-nuclease-, and RAG-induced DSBs. Beyond sequence preference, chromatin features dictate the repertoire of these genome-modifying enzymes. END-seq can detect at least one DSB per cell among 10,000 cells not harboring DSBs, and we estimate that up to one out of 60 cells contains off-target RAG cleavage. In addition to site-specific cleavage, we detect DSBs distributed over extended regions during immunoglobulin class-switch recombination. Thus, END-seq provides a snapshot of DNA ends genome-wide, which can be utilized for understanding genome-editing specificities and the influence of chromatin on DSB pathway choice. Published by Elsevier Inc.

  10. Complexes of oligo(poly)nucleotides with structural anomalies

    NASA Astrophysics Data System (ADS)

    Dolinnaya, N. G.; Gryaznova, O. I.

    1989-08-01

    The results of studies on the structure and properties of DNA-RNA hybrids and complexes of oligo(poly)nucleotides containing non-canonical base pairs or unpaired bases both within and at the ends of the double helix are surveyed. The methods used in the study of such systems are briefly characterised: X-ray diffraction analysis, NMR and UV spectroscopy, circular dichroism, scanning microcalorimetry, etc. A comparative analysis of the influence of the non-canonical pairs on the structure and the energetic and kinetic parameters of the formation and dissociation of the oligonucleotide complexes has been carried out. The question of the stability of the non-canonical pairs as a function of their nature and position in the double helix is considered. The mechanisms of the formation of the hydrogen bonds between the bases of non-complementary pairs are discussed. The bibliography includes 171 references.

  11. Histone H1 functions as a stimulatory factor in backup pathways of NHEJ

    PubMed Central

    Rosidi, Bustanur; Wang, Minli; Wu, Wenqi; Sharma, Aparna; Wang, Huichen; Iliakis, George

    2008-01-01

    DNA double-strand breaks (DSBs) induced in the genome of higher eukaryotes by ionizing radiation (IR) are predominantly removed by two pathways of non-homologous end-joining (NHEJ) termed D-NHEJ and B-NHEJ. While D-NHEJ depends on the activities of the DNA-dependent protein kinase (DNA-PK) and DNA ligase IV/XRCC4/XLF, B-NHEJ utilizes, at least partly, DNA ligase III/XRCC1 and PARP-1. Using in vitro end-joining assays and protein fractionation protocols similar to those previously applied for the characterization of DNA ligase III as an end-joining factor, we identify here histone H1 as an additional putative NHEJ factor. H1 strongly enhances DNA-end joining and shifts the product spectrum from circles to multimers. While H1 enhances the DNA-end-joining activities of both DNA Ligase IV and DNA Ligase III, the effect on ligase III is significantly stronger. Histone H1 also enhances the activity of PARP-1. Since histone H1 has been shown to counteract D-NHEJ, these observations and the known functions of the protein identify it as a putative alignment factor operating preferentially within B-NHEJ. PMID:18250087

  12. Species delimitation in the Central African herbs Haumania (Marantaceae) using georeferenced nuclear and chloroplastic DNA sequences.

    PubMed

    Ley, A C; Hardy, O J

    2010-11-01

    Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  14. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    PubMed Central

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

    2015-01-01

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724

  15. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining.

    PubMed

    Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L; Tomkinson, Alan E; Tainer, John A; Ellenberger, Tom

    2015-08-18

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes

    NASA Astrophysics Data System (ADS)

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2015-12-01

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b

  17. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    NASA Astrophysics Data System (ADS)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  18. Rupture of DNA aptamer: New insights from simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

  19. Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

    PubMed

    Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

    2000-07-05

    The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

  20. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  1. Controlling charge current through a DNA based molecular transistor

    NASA Astrophysics Data System (ADS)

    Behnia, S.; Fathizadeh, S.; Ziaei, J.

    2017-01-01

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

  2. Hiding message into DNA sequence through DNA coding and chaotic maps.

    PubMed

    Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

    2014-09-01

    The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

  3. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  4. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  5. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  6. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  7. Phase behaviour in complementary DNA-coated gold nanoparticles and fd-viruses mixtures: a numerical study.

    PubMed

    Chiappini, Massimiliano; Eiser, Erika; Sciortino, Francesco

    2017-01-01

    A new gel-forming colloidal system based on a binary mixture of fd-viruses and gold nanoparticles functionalized with complementary DNA single strands has been recently introduced. Upon quenching below the DNA melt temperature, such a system results in a highly porous gel state, that may be developed in a new functional material of tunable porosity. In order to shed light on the gelation mechanism, we introduce a model closely mimicking the experimental one and we explore via Monte Carlo simulations its equilibrium phase diagram. Specifically, we model the system as a binary mixture of hard rods and hard spheres mutually interacting via a short-range square-well attractive potential. In the experimental conditions, we find evidence of a phase separation occurring either via nucleation-and-growth or via spinodal decomposition. The spinodal decomposition leads to the formation of small clusters of bonded rods and spheres whose further diffusion and aggregation leads to the formation of a percolating network in the system. Our results are consistent with the hypothesis that the mixture of DNA-coated fd-viruses and gold nanoparticles undergoes a non-equilibrium gelation via an arrested spinodal decomposition mechanism.

  8. Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

    PubMed Central

    Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

    1990-01-01

    Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

  9. Fischer carbene mediated covalent grafting of a peptide nucleic acid on gold surfaces and IR optical detection of DNA hybridization with a transition metalcarbonyl label

    NASA Astrophysics Data System (ADS)

    Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle

    2016-11-01

    Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.

  10. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  11. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  12. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    PubMed

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  13. Gold surface supported spherical liposome-gold nano-particle nano-composite for label free DNA sensing.

    PubMed

    Bhuvana, M; Narayanan, J Shankara; Dharuman, V; Teng, W; Hahn, J H; Jayakumar, K

    2013-03-15

    Immobilization of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) liposome-gold nano-particle (DOPE-AuNP) nano-composite covalently on 3-mercaptopropionic acid (MPA) on gold surface is demonstrated for the first time for electrochemical label free DNA sensing. Spherical nature of the DOPE on the MPA monolayer is confirmed by the appearance of sigmoidal voltammetric profile, characteristic behavior of linear diffusion, for the MPA-DOPE in presence of [Fe(CN)(6)](3-/4-) and [Ru(NH(3))(6)](3+) redox probes. The DOPE liposome vesicle fusion is prevented by electroless deposition of AuNP on the hydrophilic amine head groups of the DOPE. Immobilization of single stranded DNA (ssDNA) is made via simple gold-thiol linkage for DNA hybridization sensing in the presence of [Fe(CN)(6)](3-/4-). The sensor discriminates the hybridized (complementary target hybridized), un-hybridized (non-complementary target hybridized) and single base mismatch target hybridized surfaces sensitively and selectively without signal amplification. The lowest target DNA concentration detected is 0.1×10(-12)M. Cyclic voltammetry (CV), electrochemical impedance (EIS), differential pulse voltammetry (DPV) and quartz crystal microbalance (QCM) techniques are used for DNA sensing on DOPE-AuNP nano-composite. Transmission Electron Microscopy (TEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM), Dynamic Light Scattering (DLS) and Ultraviolet-Visible (UV) spectroscopic techniques are used to understand the interactions between the DOPE, AuNP and ssDNA. The results indicate the presence of an intact and well defined spherical DOPE-AuNP nano-composite on the gold surface. The method could be applied for fabrication of the surface based liposome-AuNP-DNA composite for cell transfection studies at reduced reagents and costs. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    PubMed

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.

    PubMed

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-11-02

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.

  16. Fluorometric aptasensing of the neonicotinoid insecticide acetamiprid by using multiple complementary strands and gold nanoparticles.

    PubMed

    Bahreyni, Amirhossein; Yazdian-Robati, Rezvan; Ramezani, Mohammad; Abnous, Khalil; Taghdisi, Seyed Mohammad

    2018-04-29

    A fluorometric aptamer-based assay was developed for ultrasensitive and selective determination of the neonicotinoid insecticide acetamiprid. The method is based on the use of an aptamer against acetamiprid, multiple complementary strands (CSs), and gold nanoparticles (AuNPs). It is found that by using different CSs, the sensitivity and selectivity of the method is enhanced. On addition of acetamiprid to the aptamer, they will bind to each other and CS1-fluorescein (FAM)-labeled CS2 (as a dsDNA) will be formed. The FAM-labeled dsDNA does not bind to the AuNPs (as a strong quencher) and remains free in the environment, resulting in a strong fluorescence intensity. Without the introduction of acetamiprid, FAM-labeled CS2 binds to AuNPs directly and indirectly through hybridization with CS3 immobilized on the surface of the AuNPs. So, the fluorescence intensity of FAM-labeled CS2 is significantly quenched by AuNPs. The method can detect acetamiprid in the 5 to 50 nM concentration range with a 2.8 nM detection limit. The assay was applied to the determination of acetamiprid in spiked tap water where is gave recoveries that ranged between 95.4% and 94.4%. Graphical abstract (a) In the presence of acetamiprid, aptamer interacts with acetamiprid. The formation of aptamer/acetamiprid causes pairing of complementary strand 1 with FAM-labeled complementary strand, leading to a strong fluorescence intensity. (b) In the absence of acetamiprid, aptamer is hybridized with complementary strand 1. Thus, a very weak fluorescence signal is detected.

  17. Cancer Care Experiences and the Use of Complementary and Alternative Medicine at End of Life in Nova Scotia’s Black Communities

    PubMed Central

    Maddalena, Victor J.; Bernard, Wanda Thomas; Etowa, Josephine; Murdoch, Sharon Davis; Smith, Donna; Jarvis, Phyllis Marsh

    2016-01-01

    Purpose This qualitative study examines the meanings that African Canadians living in Nova Scotia, Canada, ascribe to their experiences with cancer, family caregiving, and their use of complementary and alternative medicine (CAM) at end of life. Design Case study methodology using in-depth interviews were used to examine the experiences of caregivers of decedents who died from cancer in three families. Findings For many African Canadians end of life is characterized by care provided by family and friends in the home setting, community involvement, a focus on spirituality, and an avoidance of institutionalized health services. Caregivers and their families experience multiple challenges (and multiple demands). There is evidence to suggest that the use of CAM and home remedies at end of life are common. Discussion The delivery of palliative care to African Canadian families should consider and support their preference to provide end-of-life care in the home setting. PMID:20220031

  18. Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta

    PubMed Central

    Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.

    2014-01-01

    Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323

  19. Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.

    PubMed

    Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping

    2018-06-12

    The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7  cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.

  20. DNA methylation of phosphatase and actin regulator 3 detects colorectal cancer in stool and complements FIT.

    PubMed

    Bosch, Linda J W; Oort, Frank A; Neerincx, Maarten; Khalid-de Bakker, Carolina A J; Terhaar sive Droste, Jochim S; Melotte, Veerle; Jonkers, Daisy M A E; Masclee, Ad A M; Mongera, Sandra; Grooteclaes, Madeleine; Louwagie, Joost; van Criekinge, Wim; Coupé, Veerle M H; Mulder, Chris J; van Engeland, Manon; Carvalho, Beatriz; Meijer, Gerrit A

    2012-03-01

    Using a bioinformatics-based strategy, we set out to identify hypermethylated genes that could serve as biomarkers for early detection of colorectal cancer (CRC) in stool. In addition, the complementary value to a Fecal Immunochemical Test (FIT) was evaluated. Candidate genes were selected by applying cluster alignment and computational analysis of promoter regions to microarray-expression data of colorectal adenomas and carcinomas. DNA methylation was measured by quantitative methylation-specific PCR on 34 normal colon mucosa, 71 advanced adenoma, and 64 CRC tissues. The performance as biomarker was tested in whole stool samples from in total 193 subjects, including 19 with advanced adenoma and 66 with CRC. For a large proportion of these series, methylation data for GATA4 and OSMR were available for comparison. The complementary value to FIT was measured in stool subsamples from 92 subjects including 44 with advanced adenoma or CRC. Phosphatase and Actin Regulator 3 (PHACTR3) was identified as a novel hypermethylated gene showing more than 70-fold increased DNA methylation levels in advanced neoplasia compared with normal colon mucosa. In a stool training set, PHACTR3 methylation showed a sensitivity of 55% (95% CI: 33-75) for CRC and a specificity of 95% (95% CI: 87-98). In a stool validation set, sensitivity reached 66% (95% CI: 50-79) for CRC and 32% (95% CI: 14-57) for advanced adenomas at a specificity of 100% (95% CI: 86-100). Adding PHACTR3 methylation to FIT increased sensitivity for CRC up to 15%. PHACTR3 is a new hypermethylated gene in CRC with a good performance in stool DNA testing and has complementary value to FIT.

  1. Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization

    NASA Astrophysics Data System (ADS)

    James, Carrie Rae

    Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.

  2. Efficient Fluorescence Resonance Energy Transfer between Quantum Dots and Gold Nanoparticles Based on Porous Silicon Photonic Crystal for DNA Detection

    PubMed Central

    Zhang, Hongyan; Lv, Jie; Jia, Zhenhong

    2017-01-01

    A novel assembled biosensor was prepared for detecting 16S rRNA, a small-size persistent specific for Actinobacteria. The mechanism of the porous silicon (PS) photonic crystal biosensor is based on the fluorescence resonance energy transfer (FRET) between quantum dots (QDs) and gold nanoparticles (AuNPs) through DNA hybridization, where QDs act as an emission donor and AuNPs serve as a fluorescence quencher. Results showed that the photoluminescence (PL) intensity of PS photonic crystal was drastically increased when the QDs-conjugated probe DNA was adhered to the PS layer by surface modification using a standard cross-link chemistry method. The PL intensity of QDs was decreased when the addition of AuNPs-conjugated complementary 16S rRNA was dropped onto QDs-conjugated PS. Based on the analysis of different target DNA concentration, it was found that the decrease of the PL intensity showed a good linear relationship with complementary DNA concentration in a range from 0.25 to 10 μM, and the detection limit was 328.7 nM. Such an optical FRET biosensor functions on PS-based photonic crystal for DNA detection that differs from the traditional FRET, which is used only in liquid. This method will benefit the development of a new optical FRET label-free biosensor on Si substrate and has great potential in biochips based on integrated optical devices. PMID:28489033

  3. Cell-free identification of novel N-myristoylated proteins from complementary DNA resources using bioorthogonal myristic acid analogues.

    PubMed

    Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko

    2014-11-01

    To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Sandwiching spherical 1,2-dioleoyltrimethylammoniumpropane liposome in gold nanoparticle on solid transducer for electrochemical ultrasensitive DNA detection and transfection.

    PubMed

    Shankara Narayanan, Jeyaraman; Bhuvana, Mohanlal; Dharuman, Venkataraman

    2014-08-15

    Cationic N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium propane (DOTAP) liposome is spherically sandwiched in gold nanoparticle (abbreviated as sDOTAP-AuNP) onto a gold electrode surface. The sDOTAP-AuNP is applied for electrochemical label free DNA sensing and Escherichia coli cell transfection for the first time. Complementary target (named as hybridized), non-complementary target (un-hybridized) and single base mismatch target (named as SMM) hybridized surfaces are discriminated sensitively and selectively in presence of [Fe(CN)6](3-/4-). Double strand specific intercalator methylene blue in combination with [Fe(CN)6](3-) is used to enhance target detection limit down to femtomolar concentration. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) techniques are used for characterizing DNA sensing. High Resolution Transmission Electron Microscopy (HRTEM), Fourier Transform Infrared Spectroscopy (FTIR), Atomic Force Microscopy (AFM) and Dynamic Light Scattering (DLS) techniques are used to confirm the spherical nature of the sDOTAP-AuNP-DNA composite in solution and on the solid surface. DNA on the sDOTAP-ssDNA is transferred by potential stripping method (+0.2V (Ag/AgCl)) into buffer solution containing E. coli cells. The transfection is confirmed by the contrast images for the transfected and non-transfected cell from Confocal Laser Scanning Microscopy (CLSM). The results demonstrate effectiveness of the electrochemical DNA transfection method developed and could be applied for other cells. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Percutaneous transendocardial delivery of self-complementary adeno-associated virus 6 achieves global cardiac gene transfer in canines

    PubMed Central

    Bish, Lawrence T.; Sleeper, Meg M.; Brainard, Benjamin; Cole, Stephen; Russell, Nicholas; Withnall, Elanor; Arndt, Jason; Reynolds, Caryn; Davison, Ellen; Sanmiguel, Julio; Wu, Di; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

    2011-01-01

    Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Prior strategies have employed cardio-pulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus or plasmid DNA. While single stranded adeno-associated virus vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented by using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated virus vectors to the canine myocardium. Four vectors were evaluated—single stranded adeno-associated virus 9, self-complementary adeno-associated virus 9, self-complementary adeno-associated virus 8, self-complementary adeno-associated virus 6—so that comparison could be made between single stranded and self complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that self-complementary adeno-associated virus is superior to single stranded adeno-associated virus and that adeno-associated virus 6 is superior to other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15 to 4000 times more abundant in the heart than in any other organ for self-complementary adeno-associated virus 6. Percutaneous transendocardial injection of self-complementary adeno-associated virus 6 is a safe, effective method for achieving efficient cardiac gene transfer. PMID:18813281

  6. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    PubMed

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  7. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  8. Multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole DNA biosensor for label-free detection of genetically modified organisms by QCM and EIS.

    PubMed

    Truong, Thi Ngoc Lien; Tran, Dai Lam; Vu, Thi Hong An; Tran, Vinh Hoang; Duong, Tuan Quang; Dinh, Quang Khieu; Tsukahara, Toshifumi; Lee, Young Hoon; Kim, Jong Seung

    2010-01-15

    In this paper, we describe DNA electrochemical detection for genetically modified organism (GMO) based on multi-wall carbon nanotubes (MWCNTs)-doped polypyrrole (PPy). DNA hybridization is studied by quartz crystal microbalance (QCM) and electrochemical impedance spectroscopy (EIS). An increase in DNA complementary target concentration results in a decrease in the faradic charge transfer resistance (R(ct)) and signifying "signal-on" behavior of MWCNTs-PPy-DNA system. QCM and EIS data indicated that the electroanalytical MWCNTs-PPy films were highly sensitive (as low as 4pM of target can be detected with QCM technique). In principle, this system can be suitable not only for DNA but also for protein biosensor construction.

  9. Cas9-catalyzed DNA Cleavage Generates Staggered Ends: Evidence from Molecular Dynamics Simulations

    NASA Astrophysics Data System (ADS)

    Zuo, Zhicheng; Liu, Jin

    2016-11-01

    The CRISPR-associated endonuclease Cas9 from Streptococcus pyogenes (spCas9) along with a single guide RNA (sgRNA) has emerged as a versatile toolbox for genome editing. Despite recent advances in the mechanism studies on spCas9-sgRNA-mediated double-stranded DNA (dsDNA) recognition and cleavage, it is still unclear how the catalytic Mg2+ ions induce the conformation changes toward the catalytic active state. It also remains controversial whether Cas9 generates blunt-ended or staggered-ended breaks with overhangs in the DNA. To investigate these issues, here we performed the first all-atom molecular dynamics simulations of the spCas9-sgRNA-dsDNA system with and without Mg2+ bound. The simulation results showed that binding of two Mg2+ ions at the RuvC domain active site could lead to structurally and energetically favorable coordination ready for the non-target DNA strand cleavage. Importantly, we demonstrated with our simulations that Cas9-catalyzed DNA cleavage produces 1-bp staggered ends rather than generally assumed blunt ends.

  10. The Mechanism of Double-Strand DNA Break Repair by the Nonhomologous DNA End Joining Pathway

    PubMed Central

    Lieber, Michael R.

    2011-01-01

    Double-strand DNA breaks are common events in eukaryotic cells, and there are two major pathways for repairing them: homologous recombination and nonhomologous DNA end joining (NHEJ). The diverse causes of DSBs result in a diverse chemistry of DNA ends that must be repaired. Across NHEJ evolution, the enzymes of the NHEJ pathway exhibit a remarkable degree of structural tolerance in the range of DNA end substrate configurations upon which they can act. In vertebrate cells, the nuclease, polymerases and ligase of NHEJ are the most mechanistically flexible and multifunctional enzymes in each of their classes. Unlike repair pathways for more defined lesions, NHEJ repair enzymes act iteratively, act in any order, and can function independently of one another at each of the two DNA ends being joined. NHEJ is critical not only for the repair of pathologic DSBs as in chromosomal translocations, but also for the repair of physiologic DSBs created during V(D)J recombination and class switch recombination. Therefore, patients lacking normal NHEJ are not only sensitive to ionizing radiation, but also severely immunodeficient. PMID:20192759

  11. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    PubMed

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Creating complex molecular topologies by configuring DNA four-way junctions

    NASA Astrophysics Data System (ADS)

    Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi

    2016-10-01

    The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.

  13. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  14. Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

    PubMed

    Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

    2006-07-01

    To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

  15. Fabrication and characterization of high-K dielectric integrated silicon nanowire sensor for DNA sensing application (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael

    2016-09-01

    1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.

  16. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa

    PubMed Central

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-01-01

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5’ end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5’ but not 3’ end, explaining how Rpa regulates cleavage polarity. DOI: http://dx.doi.org/10.7554/eLife.09832.001 PMID:26491943

  17. Somatic hypermutation at A/T-rich oligonucleotide substrates shows different strand polarities in Ung-deficient or -proficient backgrounds.

    PubMed

    Zivojnovic, Marija; Delbos, Frédéric; Girelli Zubani, Giulia; Julé, Amélie; Alcais, Alexandre; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2014-06-01

    A/T mutations at immunoglobulin loci are introduced by DNA polymerase η (Polη) during an Msh2/6-dependent repair process which results in A's being mutated 2-fold more often than T's. This patch synthesis is initiated by a DNA incision event whose origin is still obscure. We report here the analysis of A/T oligonucleotide mutation substrates inserted at the heavy chain locus, including or not including internal C's or G's. Surprisingly, the template composed of only A's and T's was highly mutated over its entire 90-bp length, with a 2-fold decrease in mutation from the 5' to the 3' end and a constant A/T ratio of 4. These results imply that Polη synthesis was initiated from a break in the 5'-flanking region of the substrate and proceeded over its entire length. The A/T bias was strikingly altered in an Ung(-/-) background, which provides the first experimental evidence supporting a concerted action of Ung and Msh2/6 pathways to generate mutations at A/T bases. New analysis of Pms2(-/-) animals provided a complementary picture, revealing an A/T mutation ratio of 4. We therefore propose that Ung and Pms2 may exert a mutual backup function for the DNA incision that promotes synthesis by Polη, each with a distinct strand bias. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Somatic Hypermutation at A/T-Rich Oligonucleotide Substrates Shows Different Strand Polarities in Ung-Deficient or -Proficient Backgrounds

    PubMed Central

    Zivojnovic, Marija; Delbos, Frédéric; Girelli Zubani, Giulia; Julé, Amélie; Alcais, Alexandre; Storck, Sébastien

    2014-01-01

    A/T mutations at immunoglobulin loci are introduced by DNA polymerase η (Polη) during an Msh2/6-dependent repair process which results in A's being mutated 2-fold more often than T's. This patch synthesis is initiated by a DNA incision event whose origin is still obscure. We report here the analysis of A/T oligonucleotide mutation substrates inserted at the heavy chain locus, including or not including internal C's or G's. Surprisingly, the template composed of only A's and T's was highly mutated over its entire 90-bp length, with a 2-fold decrease in mutation from the 5′ to the 3′ end and a constant A/T ratio of 4. These results imply that Polη synthesis was initiated from a break in the 5′-flanking region of the substrate and proceeded over its entire length. The A/T bias was strikingly altered in an Ung−/− background, which provides the first experimental evidence supporting a concerted action of Ung and Msh2/6 pathways to generate mutations at A/T bases. New analysis of Pms2−/− animals provided a complementary picture, revealing an A/T mutation ratio of 4. We therefore propose that Ung and Pms2 may exert a mutual backup function for the DNA incision that promotes synthesis by Polη, each with a distinct strand bias. PMID:24710273

  19. A molecular-beacon-based asymmetric PCR assay for easy visualization of amplicons in the diagnosis of trichomoniasis.

    PubMed

    Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman

    2016-12-15

    The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Design of ultrasensitive bisphenol A-aptamer based on platinum nanoparticles loading to polyethyleneimine-functionalized carbon nanotubes.

    PubMed

    Derikvandi, Zeinab; Abbasi, Amir Reza; Roushani, Mahmoud; Derikvand, Zohreh; Azadbakht, Azadeh

    2016-11-01

    Here, a highly sensitive electrochemical aptasensor based on a novel signal amplification strategy for the determination of bisphenol A (BPA) was developed. Construction of the aptasensor began with the deposition of highly dispersed platinum nanoparticles (PtNPs)/acid-oxidized carbon nanotubes (CNTs-COOH) functionalized with polyethyleneimine (PEI) at the surface of glassy carbon (PtNPs/PEI/CNTs-COOH/GC) electrode. After immobilizing the amine-capped capture probe (ssDNA1) through the covalent amide bonds formed by the carboxyl groups on the nanotubes and the amino groups on the oligonucleotides, we employed a designed complementary BPA-aptamer (ssDNA2) as a detection probe to hybridize with the ssDNA1. By adding BPA as a target, the aptamer specifically bound to BPA and its end folded into a BPA-binding junction. Because of steric/conformational restrictions caused by aptamer-BPA complex formation at the surface of modified electrode, the interfacial electron transfer of [Fe(CN)6](3-/4-) as a probe was blocked. Sensitive quantitative detection of BPA was carried out by monitoring the decrease of differential pulse voltammetric responses of [Fe(CN)6](3-/4-) peak current with increasing BPA concentrations. The newly developed aptasensor embraced a number of attractive features such as ease of fabrication, low detection limit, excellent selectivity, good stability and a wide linear range with respect to BPA. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

    PubMed

    Weterings, Eric; Chen, David J

    2007-10-22

    The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

  2. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  3. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  4. Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

    PubMed

    Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

    2008-12-01

    Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

  5. Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

    PubMed

    Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

    2009-03-15

    Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

  6. Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.

    PubMed

    Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L

    2005-04-01

    The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.

  7. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  8. Reversible Redox Activity by Ion-pH Dually Modulated Duplex Formation of i-Motif DNA with Complementary G-DNA.

    PubMed

    Chang, Soyoung; Kilic, Tugba; Lee, Chang Kee; Avci, Huseyin; Bae, Hojae; Oskui, Shirin Mesbah; Jung, Sung Mi; Shin, Su Ryon; Kim, Seon Jeong

    2018-04-08

    The unique biological features of supramolecular DNA have led to an increasing interest in biomedical applications such as biosensors. We have developed an i-motif and G-rich DNA conjugated single-walled carbon nanotube hybrid materials, which shows reversible conformational switching upon external stimuli such as pH (5 and 8) and presence of ions (Li⁺ and K⁺). We observed reversible electrochemical redox activity upon external stimuli in a quick and robust manner. Given the ease and the robustness of this method, we believe that pH- and ion-driven reversible DNA structure transformations will be utilized for future applications for developing novel biosensors.

  9. The origin of in situ hybridization - A personal history.

    PubMed

    Gall, Joseph G

    2016-04-01

    In situ hybridization is the technique by which specific RNA or DNA molecules are detected in cytological preparations. Basically it involves formation of a hybrid molecule between an endogenous single-stranded RNA or DNA in the cell and a complementary single-stranded RNA or DNA probe. In its original form the probe was labeled with (3)H and the hybrid was detected by autoradiography. The first successful experiments in 1968 involved detection of the highly amplified ribosomal DNA in oocytes of the frog Xenopus, followed soon after by the reiterated "satellite DNA" in mouse and Drosophila chromosomes. Fluorescent probes were developed about ten years later. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.

    PubMed

    Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

    2015-07-20

    Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

    PubMed

    Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

    1997-10-15

    A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

  12. Self-Assembly of Octopus Nanoparticles into Pre-Programmed Finite Clusters

    NASA Astrophysics Data System (ADS)

    Halverson, Jonathan; Tkachenko, Alexei

    2012-02-01

    The precise control of the spatial arrangement of nanoparticles (NP) is often required to take full advantage of their novel optical and electronic properties. NPs have been shown to self-assemble into crystalline structures using either patchy surface regions or complementary DNA strands to direct the assembly. Due to a lack of specificity of the interactions these methods lead to only a limited number of structures. An emerging approach is to bind ssDNA at specific sites on the particle surface making so-called octopus NPs. Using octopus NPs we investigate the inverse problem of the self-assembly of finite clusters. That is, for a given target cluster (e.g., arranging the NPs on the vertices of a dodecahedron) what are the minimum number of complementary DNA strands needed for the robust self-assembly of the cluster from an initially homogeneous NP solution? Based on the results of Brownian dynamics simulations we have compiled a set of design rules for various target clusters including cubes, pyramids, dodecahedrons and truncated icosahedrons. Our approach leads to control over the kinetic pathway and has demonstrated nearly perfect yield of the target.

  13. The yeast Fun30 and human SMARCAD1 chromatin remodelers promote DNA end resection

    PubMed Central

    Costelloe, Thomas; Louge, Raphaël; Tomimatsu, Nozomi; Mukherjee, Bipasha; Martini, Emmanuelle; Khadaroo, Basheer; Dubois, Kenny; Wiegant, Wouter W.; Thierry, Agnès; Burma, Sandeep; van Attikum, Haico; Llorente, Bertrand

    2012-01-01

    Several homology-dependent pathways can repair potentially lethal DNA double-strand breaks (DSBs). The first step common to all homologous recombination reactions is the 5′-3′ degradation of DSB ends that yields 3′ single-stranded DNA (ssDNA) required for loading of checkpoint and recombination proteins. The Mre11-Rad50-Xrs2/NBS1 complex and Sae2/CtIP initiate end resection while long-range resection depends on the exonuclease Exo1 or the helicase-topoisomerase complex Sgs1-Top3-Rmi1 with the endonuclease Dna21-6. DSBs occur in the context of chromatin, but how the resection machinery navigates through nucleosomal DNA is a process that is not well understood7. Here, we show that the yeast S. cerevisiae Fun30 protein and its human counterpart SMARCAD18, two poorly characterized ATP-dependent chromatin remodelers of the Snf2 ATPase family, are novel factors that are directly involved in the DSB response. Fun30 physically associates with DSB ends and directly promotes both Exo1- and Sgs1-dependent end resection through a mechanism involving its ATPase activity. The function of Fun30 in resection facilitates repair of camptothecin (CPT)-induced DNA lesions, and it becomes dispensable when Exo1 is ectopically overexpressed. Interestingly, SMARCAD1 is also recruited to DSBs and the kinetics of recruitment is similar to that of Exo1. Loss of SMARCAD1 impairs end resection, recombinational DNA repair and renders cells hypersensitive to DNA damage resulting from CPT or PARP inhibitor treatments. These findings unveil an evolutionarily conserved role for the Fun30 and SMARCAD1 chromatin remodelers in controlling end resection, homologous recombination and genome stability in the context of chromatin. PMID:22960744

  14. Dysregulation of RNA Interference in Breast Cancer

    DTIC Science & Technology

    2007-07-01

    of miRNA complementary elements in 3-UTR of target mRNAs, the concentration in the seed (6–8 bp) of continuous Watson - Crick base pairing in the 5...treated the transfected cells with the anticancer drug topotecan (TPT) that is known to inhibit DNA topoisomerase I and cause DNA damage (Tanizawa et...as DNA damage caused by TPT, can increase the inhibitory effect mediated by R el at iv e C el l G ro w th R el at iv e C el l G ro w th Negative

  15. The generative power of weighted one-sided and regular sticker systems

    NASA Astrophysics Data System (ADS)

    Siang, Gan Yee; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod

    2014-06-01

    Sticker systems were introduced in 1998 as one of the DNA computing models by using the recombination behavior of DNA molecules. The Watson-Crick complementary principle of DNA molecules is abstractly used in the sticker systems to perform the computation of sticker systems. In this paper, the generative power of weighted one-sided sticker systems and weighted regular sticker systems are investigated. Moreover, the relationship of the families of languages generated by these two variants of sticker systems to the Chomsky hierarchy is also presented.

  16. Willingness to Pay for Complementary Health Care Insurance in Iran.

    PubMed

    Nosratnejad, Shirin; Rashidian, Arash; Akbari Sari, Ali; Moradi, Najme

    2017-09-01

    Complementary health insurance is increasingly used to remedy the limitations and shortcomings of the basic health insurance benefit packages. Hence, it is essential to gather reliable information about the amount of Willingness to Pay (WTP) for health insurance. We assessed the WTP for health insurance in Iran in order to suggest an affordable complementary health insurance. The study sample consisted of 300 household heads all over provinces of Iran in 2013. The method applied was double bounded dichotomous choice and open-ended question approach of contingent valuation. The average WTP for complementary health insurance per person per month by double bounded dichotomous choice and open-ended question method respectively was 199000 and 115300 Rials (8 and 4.6 USD, respectively). Household's heads with higher levels of income and those who worked had more WTP for the health insurance. Besides, the WTP increased in direct proportion to the number of insured members of each household and in inverse proportion to the family size. The WTP value can be used as a premium in a society. As an important finding, the study indicated that the households were willing to pay higher premiums than currently collected for the complementary health insurance coverage in Iran. This offers the policy makers the opportunity to increase the premium and provide good benefits package for insured people of country then better risk pooling.

  17. Targeting telomere-containing chromosome ends with a near-infrared femtosecond laser to study the activation of the DNA damage response and DNA damage repair pathways

    PubMed Central

    Silva, Bárbara Alcaraz; Stambaugh, Jessica R.

    2013-01-01

    Abstract. Telomeres are at the ends of chromosomes. Previous evidence suggests that laser-induced deoxyribose nucleic acid (DNA) breaks at chromosome ends during anaphase results in delayed cytokinesis. A possible explanation for this delay is that the DNA damage response (DDR) mechanism has been activated. We describe a live imaging method to study the effects of DDR activation following focal point near-infrared femtosecond laser microirradiation either at a single chromosome end or at a chromosome arm in mitotic anaphase cells. Laser microirradiation is used in combination with dual fluorescent labeling to monitor the co-localization of double-strand break marker γH2AX along with the DDR factors in PtK2 (Potorous tridactylus) cells. Laser-induced DNA breaks in chromosome ends as well as in chromosome arms results in recruitment of the following: poly(ADP-ribose) polymerase 1, checkpoint sensors (p-Chk1, p-Chk2), DNA repair protein Ku70/Ku80, and proliferating cell nuclear antigen. However, phosphorylated p53 at serine 15 is detected only at chromosome ends and not at chromosome arms. Full activation of DDR on damaged chromosome ends may explain previously published results that showed the delay of cytokinesis. PMID:24064949

  18. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  19. Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

    PubMed

    Moreira, Bernardo G; You, Yong; Owczarzy, Richard

    2015-03-01

    Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

  20. SSU rDNA divergence in planktonic foraminifera: molecular taxonomy and biogeographic implications.

    PubMed

    André, Aurore; Quillévéré, Frédéric; Morard, Raphaël; Ujiié, Yurika; Escarguel, Gilles; de Vargas, Colomban; de Garidel-Thoron, Thibault; Douady, Christophe J

    2014-01-01

    The use of planktonic foraminifera in paleoceanography requires taxonomic consistency and precise assessment of the species biogeography. Yet, ribosomal small subunit (SSUr) DNA analyses have revealed that most of the modern morpho-species of planktonic foraminifera are composed of a complex of several distinct genetic types that may correspond to cryptic or pseudo-cryptic species. These genetic types are usually delimitated using partial sequences located at the 3'end of the SSUrDNA, but typically based on empirical delimitation. Here, we first use patristic genetic distances calculated within and among genetic types of the most common morpho-species to show that intra-type and inter-type genetic distances within morpho-species may significantly overlap, suggesting that genetic types have been sometimes inconsistently defined. We further apply two quantitative and independent methods, ABGD (Automatic Barcode Gap Detection) and GMYC (General Mixed Yule Coalescent) to a dataset of published and newly obtained partial SSU rDNA for a more objective assessment of the species status of these genetic types. Results of these complementary approaches are highly congruent and lead to a molecular taxonomy that ranks 49 genetic types of planktonic foraminifera as genuine (pseudo)cryptic species. Our results advocate for a standardized sequencing procedure allowing homogenous delimitations of (pseudo)cryptic species. On the ground of this revised taxonomic framework, we finally provide an integrative taxonomy synthesizing geographic, ecological and morphological differentiations that can occur among the genuine (pseudo)cryptic species. Due to molecular, environmental or morphological data scarcities, many aspects of our proposed integrative taxonomy are not yet fully resolved. On the other hand, our study opens up the potential for a correct interpretation of environmental sequence datasets.

  1. SSU rDNA Divergence in Planktonic Foraminifera: Molecular Taxonomy and Biogeographic Implications

    PubMed Central

    André, Aurore; Quillévéré, Frédéric; Morard, Raphaël; Ujiié, Yurika; Escarguel, Gilles; de Vargas, Colomban; de Garidel-Thoron, Thibault; Douady, Christophe J.

    2014-01-01

    The use of planktonic foraminifera in paleoceanography requires taxonomic consistency and precise assessment of the species biogeography. Yet, ribosomal small subunit (SSUr) DNA analyses have revealed that most of the modern morpho-species of planktonic foraminifera are composed of a complex of several distinct genetic types that may correspond to cryptic or pseudo-cryptic species. These genetic types are usually delimitated using partial sequences located at the 3′end of the SSUrDNA, but typically based on empirical delimitation. Here, we first use patristic genetic distances calculated within and among genetic types of the most common morpho-species to show that intra-type and inter-type genetic distances within morpho-species may significantly overlap, suggesting that genetic types have been sometimes inconsistently defined. We further apply two quantitative and independent methods, ABGD (Automatic Barcode Gap Detection) and GMYC (General Mixed Yule Coalescent) to a dataset of published and newly obtained partial SSU rDNA for a more objective assessment of the species status of these genetic types. Results of these complementary approaches are highly congruent and lead to a molecular taxonomy that ranks 49 genetic types of planktonic foraminifera as genuine (pseudo)cryptic species. Our results advocate for a standardized sequencing procedure allowing homogenous delimitations of (pseudo)cryptic species. On the ground of this revised taxonomic framework, we finally provide an integrative taxonomy synthesizing geographic, ecological and morphological differentiations that can occur among the genuine (pseudo)cryptic species. Due to molecular, environmental or morphological data scarcities, many aspects of our proposed integrative taxonomy are not yet fully resolved. On the other hand, our study opens up the potential for a correct interpretation of environmental sequence datasets. PMID:25119900

  2. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  3. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  4. A Dual Interaction Between the 5'- and 3'-Ends of the Melon Necrotic Spot Virus (MNSV) RNA Genome Is Required for Efficient Cap-Independent Translation.

    PubMed

    Miras, Manuel; Rodríguez-Hernández, Ana M; Romero-López, Cristina; Berzal-Herranz, Alfredo; Colchero, Jaime; Aranda, Miguel A; Truniger, Verónica

    2018-01-01

    In eukaryotes, the formation of a 5'-cap and 3'-poly(A) dependent protein-protein bridge is required for translation of its mRNAs. In contrast, several plant virus RNA genomes lack both of these mRNA features, but instead have a 3'-CITE (for cap-independent translation enhancer), a RNA element present in their 3'-untranslated region that recruits translation initiation factors and is able to control its cap-independent translation. For several 3'-CITEs, direct RNA-RNA long-distance interactions based on sequence complementarity between the 5'- and 3'-ends are required for efficient translation, as they bring the translation initiation factors bound to the 3'-CITE to the 5'-end. For the carmovirus melon necrotic spot virus (MNSV), a 3'-CITE has been identified, and the presence of its 5'-end in cis has been shown to be required for its activity. Here, we analyze the secondary structure of the 5'-end of the MNSV RNA genome and identify two highly conserved nucleotide sequence stretches that are complementary to the apical loop of its 3'-CITE. In in vivo cap-independent translation assays with mutant constructs, by disrupting and restoring sequence complementarity, we show that the interaction between the 3'-CITE and at least one complementary sequence in the 5'-end is essential for virus RNA translation, although efficient virus translation and multiplication requires both connections. The complementary sequence stretches are invariant in all MNSV isolates, suggesting that the dual 5'-3' RNA:RNA interactions are required for optimal MNSV cap-independent translation and multiplication.

  5. Mechanism for CCC DNA synthesis in hepadnaviruses.

    PubMed

    Sohn, Ji A; Litwin, Samuel; Seeger, Christoph

    2009-11-30

    Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5' and 3' ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5' ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5' end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.

  6. Kinetic Self-Assembly of DNA Tiles and Bricks

    DTIC Science & Technology

    2016-08-26

    research, and educa- tion. This is achieved by freeze drying cell-free systems into paper and other porous substrates to create materials with the...different toehold switches on paper . Experiments were performed by freeze drying the recombinant PT7 expression system onto paper discs, along with linear...DNA encoding specific switch RNAs. The paper discs were rehy- drated with or without the complementary RNA trigger 24 hr after drying and then

  7. Two-Dimensional Nanoporous Networks Formed by Liquid-to-Solid Transfer of Hydrogen-Bonded Macrocycles Built from DNA Bases.

    PubMed

    Bilbao, Nerea; Destoop, Iris; De Feyter, Steven; González-Rodríguez, David

    2016-01-11

    We present an approach that makes use of DNA base pairing to produce hydrogen-bonded macrocycles whose supramolecular structure can be transferred from solution to a solid substrate. A hierarchical assembly process ultimately leads to two-dimensional nanostructured porous networks that are able to host size-complementary guests. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    PubMed

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  9. Flow cytometric detection method for DNA samples

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Round Rock, TX

    2011-07-05

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

  10. Flow cytometric detection method for DNA samples

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Livermore, CA

    2006-08-01

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

  11. DNA-carbon nano onion aggregate: triangle, hexagon, six-petal flower to dead-end network

    NASA Astrophysics Data System (ADS)

    Babar, Dipak Gorakh; Pakhira, Bholanath; Sarkar, Sabyasachi

    2017-08-01

    The interaction between calf-thymus (CT) dsDNA and water soluble carbon nano onion (wsCNO) in water follows denaturation of dsDNA (double stranded) to ssDNA (single stranded) as monitored by optical spectroscopy. The ssDNA concomitantly wraps the spiky surface of wsCNO to create triangular aggregate as the building block as observed by time-dependent SEM images. These triangles further aggregate leading to six-petal flower arrangement via hexagon and finally reach a dead end network as imaged by SEM and optical fluorescence microscopy. The dead-end network aggregate lost the intrinsic optical property of DNA suggesting complete loss of its activity.

  12. Studying DNA looping by single-molecule FRET.

    PubMed

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  13. Studying DNA Looping by Single-Molecule FRET

    PubMed Central

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

  14. Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

    PubMed

    Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

    2011-01-21

    In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    PubMed

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  16. Initiation and Reinitiation of DNA Synthesis during Replication of Bacteriophage T7*

    PubMed Central

    Dressler, David; Wolfson, John; Magazin, Marilyn

    1972-01-01

    In its first round of replication, the T7 chromosome follows a simple pattern, as viewed in the electron microscope. The iniation of DNA synthesis occurs about 17% from the genetic left end of the viral DNA rod. Bidirectional DNA synthesis from this origin then generates a replicating intermediate that we call an “eye form.” In the eye form, when synthesis in the leftward direction reaches the left end of the viral chromosome, the molecule is converted into a Y-shaped replicating rod. The remaining growing point continues synthesis rightward, until presumably it runs off the right end of the DNA rod, thus terminating replication. Numerous T7 chromosomes were found in which a second round of replication had begun before the first round had finished. Analysis of these reinitiated DNA molecules showed that the second round of replication, like the first, began 17% from the end of the chromosome and involved bidirectional DNA synthesis. Images PMID:4554539

  17. Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

    PubMed Central

    Winnacker, E L

    1975-01-01

    Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

  18. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

    PubMed

    Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

    1999-05-01

    Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

  19. Mitochondrial targeting of recombinant RNAs modulates the level of a heteroplasmic mutation in human mitochondrial DNA associated with Kearns Sayre Syndrome

    PubMed Central

    Comte, Caroline; Tonin, Yann; Heckel-Mager, Anne-Marie; Boucheham, Abdeldjalil; Smirnov, Alexandre; Auré, Karine; Lombès, Anne; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2013-01-01

    Mitochondrial mutations, an important cause of incurable human neuromuscular diseases, are mostly heteroplasmic: mutated mitochondrial DNA is present in cells simultaneously with wild-type genomes, the pathogenic threshold being generally >70% of mutant mtDNA. We studied whether heteroplasmy level could be decreased by specifically designed oligoribonucleotides, targeted into mitochondria by the pathway delivering RNA molecules in vivo. Using mitochondrially imported RNAs as vectors, we demonstrated that oligoribonucleotides complementary to mutant mtDNA region can specifically reduce the proportion of mtDNA bearing a large deletion associated with the Kearns Sayre Syndrome in cultured transmitochondrial cybrid cells. These findings may be relevant to developing of a new tool for therapy of mtDNA associated diseases. PMID:23087375

  20. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  1. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    PubMed

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  2. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    PubMed Central

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  3. End-to-end distance and contour length distribution functions of DNA helices

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-06-01

    I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

  4. One ring to bring them all--the role of Ku in mammalian non-homologous end joining.

    PubMed

    Grundy, Gabrielle J; Moulding, Hayley A; Caldecott, Keith W; Rulten, Stuart L

    2014-05-01

    The repair of DNA double strand breaks is essential for cell survival and several conserved pathways have evolved to ensure their rapid and efficient repair. The non-homologous end joining pathway is initiated when Ku binds to the DNA break site. Ku is an abundant nuclear heterodimer of Ku70 and Ku80 with a toroidal structure that allows the protein to slide over the broken DNA end and bind with high affinity. Once locked into placed, Ku acts as a tool-belt to recruit multiple interacting proteins, forming one or more non-homologous end joining complexes that act in a regulated manner to ensure efficient repair of DNA ends. Here we review the structure and functions of Ku and the proteins with which it interacts during non-homologous end joining. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons

    PubMed Central

    Tan, Carlyn Rose C.; Zhou, Lanlan

    2016-01-01

    Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned. PMID:27516729

  6. DNA methylation dynamics during in vivo differentiation of blood and skin stem cells

    PubMed Central

    Bock, Christoph; Beerman, Isabel; Lien, Wen-Hui; Smith, Zachary D.; Gu, Hongcang; Boyle, Patrick; Gnirke, Andreas; Fuchs, Elaine; Rossi, Derrick J.; Meissner, Alexander

    2012-01-01

    DNA methylation is a mechanism of epigenetic regulation that is common to all vertebrates. Functional studies underscore its relevance for tissue homeostasis, but the global dynamics of DNA methylation during in vivo differentiation remain underexplored. Here we report high-resolution DNA methylation maps of adult stem cell differentiation in mouse, focusing on 19 purified cell populations of the blood and skin lineages. DNA methylation changes were locus-specific and relatively modest in magnitude. They frequently overlapped with lineage-associated transcription factors and their binding sites, suggesting that DNA methylation may protect cells from aberrant transcription factor activation. DNA methylation and gene expression provided complementary information, and combining the two enabled us to infer the cellular differentiation hierarchy of the blood lineage directly from genomic data. In summary, these results demonstrate that in vivo differentiation of adult stem cells is associated with small but informative changes in the genomic distribution of DNA methylation. PMID:22841485

  7. Circulating Tumor Cells Versus Circulating Tumor DNA in Colorectal Cancer: Pros and Cons.

    PubMed

    Tan, Carlyn Rose C; Zhou, Lanlan; El-Deiry, Wafik S

    2016-06-01

    Circulating tumor cells (CTCs) and circulating tumor DNA (ctDNA) are emerging noninvasive multifunctional biomarkers in liquid biopsy allowing for early diagnosis, accurate prognosis, therapeutic target selection, spatiotemporal monitoring of metastasis, as well as monitoring response and resistance to treatment. CTCs and ctDNA are released from different tumor types at different stages and contribute complementary information for clinical decision. Although big strides have been taken in technology development for detection, isolation and characterization of CTCs and sensitive and specific detection of ctDNA, CTC-, and ctDNA-based liquid biopsies may not be widely adopted for routine cancer patient care until the suitability, accuracy, and reliability of these tests are validated and more standardized protocols are corroborated in large, independent, prospectively designed trials. This review covers CTC- and ctDNA-related technologies and their application in colorectal cancer. The promise of CTC-and ctDNA-based liquid biopsies is envisioned.

  8. Universal ligation-detection-reaction microarray applied for compost microbes

    PubMed Central

    Hultman, Jenni; Ritari, Jarmo; Romantschuk, Martin; Paulin, Lars; Auvinen, Petri

    2008-01-01

    Background Composting is one of the methods utilised in recycling organic communal waste. The composting process is dependent on aerobic microbial activity and proceeds through a succession of different phases each dominated by certain microorganisms. In this study, a ligation-detection-reaction (LDR) based microarray method was adapted for species-level detection of compost microbes characteristic of each stage of the composting process. LDR utilises the specificity of the ligase enzyme to covalently join two adjacently hybridised probes. A zip-oligo is attached to the 3'-end of one probe and fluorescent label to the 5'-end of the other probe. Upon ligation, the probes are combined in the same molecule and can be detected in a specific location on a universal microarray with complementary zip-oligos enabling equivalent hybridisation conditions for all probes. The method was applied to samples from Nordic composting facilities after testing and optimisation with fungal pure cultures and environmental clones. Results Probes targeted for fungi were able to detect 0.1 fmol of target ribosomal PCR product in an artificial reaction mixture containing 100 ng competing fungal ribosomal internal transcribed spacer (ITS) area or herring sperm DNA. The detection level was therefore approximately 0.04% of total DNA. Clone libraries were constructed from eight compost samples. The LDR microarray results were in concordance with the clone library sequencing results. In addition a control probe was used to monitor the per-spot hybridisation efficiency on the array. Conclusion This study demonstrates that the LDR microarray method is capable of sensitive and accurate species-level detection from a complex microbial community. The method can detect key species from compost samples, making it a basis for a tool for compost process monitoring in industrial facilities. PMID:19116002

  9. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  10. 2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

    PubMed

    Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

    2017-08-01

    We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Stasiak, Andrzej

    2016-09-01

    Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

  12. [Definition of the specificity of DNA-methyltransferase M.Bsc4I in cell lysate by blocking of restriction endonucleases and computer modeling].

    PubMed

    Dedkov, V S

    2009-01-01

    The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.

  13. Dynamic Properties of DNA-Programmable Nanoparticle Crystallization.

    PubMed

    Yu, Qiuyan; Zhang, Xuena; Hu, Yi; Zhang, Zhihao; Wang, Rong

    2016-08-23

    The dynamics of DNA hybridization is very important in DNA-programmable nanoparticle crystallization. Here, coarse-grained molecular dynamics is utilized to explore the structural and dynamic properties of DNA hybridizations for a self-complementary DNA-directed nanoparticle self-assembly system. The hexagonal close-packed (HCP) and close-packed face-centered cubic (FCC) ordered structures are identified for the systems of different grafted DNA chains per nanoparticle, which are in good agreement with the experimental results. Most importantly, the dynamic crystallization processes of DNA hybridizations are elucidated by virtue of the mean square displacement, the percentage of hybridizations, and the lifetime of DNA bonds. The lifetime can be modeled by the DNA dehybridization, which has an exponential form. The lifetime of DNA bonds closely depends on the temperature. A suitable temperature for the DNA-nanoparticle crystallization is obtained in the work. Moreover, a too large volume fraction hinders the self-assembly process due to steric effects. This work provides some essential information for future design of nanomaterials.

  14. Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D.A.; Zilinskas, B.A.

    1991-08-01

    The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

  15. Inhibition of adenovirus 5 replication in COS-1 cells by antisense RNAs against the viral E1a region.

    PubMed

    Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I

    1989-12-07

    To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.

  16. [Antisense polynucleotides and prospects for their use in fighting viruses].

    PubMed

    Tikhonenko, T I

    1989-01-01

    Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.

  17. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Treesearch

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  18. Exploring protein-DNA interactions in 3D using in situ construction, manipulation, and visualization of individual DNA-dumbbells with optical traps, microfluidics, and fluorescence microscopy

    PubMed Central

    Forget, Anthony L.; Dombrowski, Christopher C.; Amitani, Ichiro; Kowalczykowski, Stephen C.

    2015-01-01

    In this Protocol, we describe a procedure to generate ‘DNA-dumbbells’ — single molecules of DNA with a microscopic bead attached at each end — and techniques for manipulating individual DNA-dumbbells. We also detail the design and fabrication of a microfluidic device (flow cell) used in conjunction with dual optical trapping to manipulate DNA-dumbbells and to visualize individual protein–DNA complexes by single-molecule epifluorescence microscopy. Our design of the flow cell enables the rapid movement of trapped molecules between laminar flow channels and a flow-free ‘reservoir’. The reservoir provides the means to examine formation of DNA–protein complexes in solution in the absence of external flow forces, while still maintaining a predetermined end-to-end extension of the DNA. These features facilitate examination of the role of three-dimensional DNA conformation and dynamics in protein–DNA interactions. Preparation of flow cells and reagents requires two days each; in situ DNA-dumbbell assembly and imaging of single protein–DNA complexes requires another day. PMID:23411634

  19. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  20. [Vasopressin (ADH)].

    PubMed

    Hirai, A; Uchida, D; Yoshida, S

    1992-12-01

    Vasopressin is thought to play an important role, not only in the metabolism of water and electrolytes, but also in the regulation of renal hemodynamics. This year, great progress has been achieved in molecular biology of vasopressin receptors. First, the cloning of a complementary DNA, encoding the rat liver V1a arginine vasopressin receptor, was reported. The liver cDNA encodes a protein with seven putative transmembrane domains, which binds arginine vasopressin and related compounds with affinities similar to the native rat V1a receptor. The messenger RNA, corresponding to the cDNA, is distributed in rat tissues, known to contain V1a receptors. Second, the cloning of a complementary DNA encoding the rat kidney V2 arginine vasopressin receptor was also successful. The kidney cDNA encodes a protein with a transmembrane topography characteristic of G protein-coupled receptors. The receptor messenger RNA is detected only in the kidney. Last year, an orally active and specific vasopressin V1 receptor antagonist, OPC-21268 was first reported. The i.v. or p.o. administration of OPC-21268 dose-dependently inhibited vasopressin-induced vasoconstriction, while that induced by angiotensin II was not affected. OPC-21268 may have clinical potentials in certain hypertensive cardiovascular disorders. In addition, an orally active and specific vasopressin V2 receptor antagonist, OPC-31260 was also reported. Oral administration of OPC-31260 inhibited antidiuretic action of arginine vasopressin. OPC-31260 is thought to be useful in the treatment of certain disorders, such as the syndrome of inappropriate secretion of ADH (SIADH).

  1. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  2. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  3. Two-dimensional self-assembly of DNA-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David

    2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.

  4. Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

    PubMed

    Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

    2010-03-01

    There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

  5. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction.

    PubMed

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-24

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

    PubMed

    Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

    2010-04-15

    The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

  7. Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection

    PubMed Central

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2008-01-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531

  8. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Herpesvirus papio: state and properties of intracellular viral DNA in baboon lymphoblastoid cell lines.

    PubMed

    Falk, L; Lindahl, T; Bjursell, G; Klein, G

    1979-07-15

    Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.

  10. A pair of new BAC and BIBAC vectors that facilitate BAC/BIBAC library construction and intact large genomic DNA insert exchange.

    PubMed

    Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong

    2011-10-11

    Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.

  11. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    PubMed

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G+C-rich human DNA molecules, more likely results from a large-scale intrinsic curvature due to a persistent distribution of DNA curvature sites than from some increased flexibility.

  12. Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

    PubMed

    Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

    2015-07-29

    In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

  13. A novel, simple and rapid nondenaturing FISH (ND-FISH) technique for the detection of plant telomeres. Potential used and possible target structures detected.

    PubMed

    Cuadrado, Angeles; Golczyk, Hieronim; Jouve, Nicolás

    2009-01-01

    We report a new technique-nondenaturing FISH (ND-FISH)-for the rapid detection of plant telomeres without the need for prior denaturation of the chromosomes. In its development, two modified, synthetic oligonucleotides, 21 nt in length, fluorescently labelled at their 5' and 3' ends and complementary to either the cytidine-rich (C(3)TA(3)) or guanosine-rich (T(3)AG(3)) telomeric DNA strands, were used as probes. The high binding affinity of these probes and the short hybridization time required allows the visualization of plant telomeres in less than an hour. In tests, both probes gave strong signals visualized as double spots at both chromosome ends; this was true of both the mitotic and meiotic chromosomes of barley, wheat, rye, maize, Brachypodium distachyon and Rhoeo spathacea. They were also able to detect telomere motifs at certain intercalary sites in the chromosomes of R. spathacea. To investigate the nature of the target structures detected, the chromosomes were treated with RNase A and single strand-specific nuclease S1 before ND-FISH experiments. Signal formation was resistant to standard enzymatic treatment, but sensitive when much higher enzyme concentrations were used. The results are discussed in relation to current knowledge of telomere structure.

  14. Antisense RNAs transcribed from the upstream region of the precore/core promoter of hepatitis B virus.

    PubMed

    Moriyama, Kosei; Hayashida, Kazuhiro; Shimada, Mitsuo; Nakano, Shuji; Nakashima, Yoshiyuki; Fukumaki, Yasuyuki

    2003-07-01

    The bidirectional activity of the precore/core promoter of hepatitis B virus (HBV) has been demonstrated in cultured cell lines. However, HBV antisense transcripts (asRNAs) have not been demonstrated in vivo. In the present study using liver tissue from patients with chronic hepatitis, an anchored 5'RACE mapping the 5' ends at position 1680/1681, 1655 or 1609/1602 was carried out. In limited cases, RLM-3'RACE detected asRNAs to terminate at four or five consecutive dT residues in the 0.7 kb downstream region. PCR of oligo(dT)-primed cDNA did not amplify a typical polyadenylated asRNA. RT-PCR using various primers did not detect any spliced forms. Competitive RT-PCR estimated the copy numbers of the asRNAs to be 0.05-0.4 % of total sense RNAs. All sequenced asRNAs had ORF6 but, in one patient, the asRNA initiating at position 1680/1681 had additional initiation and termination codons in front of ORF6. Therefore, asRNAs are transcribed by RNA polymerase III at a low level, encompass a dispensable ORF6 gene and might be retained in the nucleus. The endogenous asRNAs complementary to the common ends of all sense RNAs suggest antisense-mediated self-regulation of hepadnavirus.

  15. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  16. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  18. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  19. Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

    PubMed

    Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

    2007-10-01

    Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

  20. Uncoupling of sexual reproduction from homologous recombination in homozygous Oenothera species.

    PubMed

    Rauwolf, U; Greiner, S; Mráček, J; Rauwolf, M; Golczyk, H; Mohler, V; Herrmann, R G; Meurer, J

    2011-07-01

    Salient features of the first meiotic division are independent segregation of chromosomes and homologous recombination (HR). In non-sexually reproducing, homozygous species studied to date HR is absent. In this study, we constructed the first linkage maps of homozygous, bivalent-forming Oenothera species and provide evidence that HR was exclusively confined to the chromosome ends of all linkage groups in our population. Co-segregation of complementary DNA-based markers with the major group of AFLP markers indicates that HR has only a minor role in generating genetic diversity of this taxon despite its efficient adaptation capability. Uneven chromosome condensation during meiosis in Oenothera may account for restriction of HR. The use of plants with ancient chromosomal arm arrangement demonstrates that limitation of HR occurred before and independent from species hybridizations and reciprocal translocations of chromosome arms-a phenomenon, which is widespread in the genus. We propose that consecutive loss of HR favored the evolution of reciprocal translocations, beneficial superlinkage groups and ultimately permanent translocation heterozygosity.

  1. Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

    PubMed

    Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

    2008-11-04

    We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

  2. Uncoupling of sexual reproduction from homologous recombination in homozygous Oenothera species

    PubMed Central

    Rauwolf, U; Greiner, S; Mráček, J; Rauwolf, M; Golczyk, H; Mohler, V; Herrmann, R G; Meurer, J

    2011-01-01

    Salient features of the first meiotic division are independent segregation of chromosomes and homologous recombination (HR). In non-sexually reproducing, homozygous species studied to date HR is absent. In this study, we constructed the first linkage maps of homozygous, bivalent-forming Oenothera species and provide evidence that HR was exclusively confined to the chromosome ends of all linkage groups in our population. Co-segregation of complementary DNA-based markers with the major group of AFLP markers indicates that HR has only a minor role in generating genetic diversity of this taxon despite its efficient adaptation capability. Uneven chromosome condensation during meiosis in Oenothera may account for restriction of HR. The use of plants with ancient chromosomal arm arrangement demonstrates that limitation of HR occurred before and independent from species hybridizations and reciprocal translocations of chromosome arms—a phenomenon, which is widespread in the genus. We propose that consecutive loss of HR favored the evolution of reciprocal translocations, beneficial superlinkage groups and ultimately permanent translocation heterozygosity. PMID:21448231

  3. FANCI-FANCD2 stabilizes the RAD51-DNA complex by binding RAD51 and protects the 5′-DNA end

    PubMed Central

    Sato, Koichi; Shimomuki, Mayo; Katsuki, Yoko; Takahashi, Daisuke; Kobayashi, Wataru; Ishiai, Masamichi; Miyoshi, Hiroyuki; Takata, Minoru; Kurumizaka, Hitoshi

    2016-01-01

    The FANCI-FANCD2 (I-D) complex is considered to work with RAD51 to protect the damaged DNA in the stalled replication fork. However, the means by which this DNA protection is accomplished have remained elusive. In the present study, we found that the I-D complex directly binds to RAD51, and stabilizes the RAD51-DNA filament. Unexpectedly, the DNA binding activity of FANCI, but not FANCD2, is explicitly required for the I-D complex-mediated RAD51-DNA filament stabilization. The RAD51 filament stabilized by the I-D complex actually protects the DNA end from nucleolytic degradation by an FA-associated nuclease, FAN1. This DNA end protection is not observed with the RAD51 mutant from FANCR patient cells. These results clearly answer the currently enigmatic question of how RAD51 functions with the I-D complex to prevent genomic instability at the stalled replication fork. PMID:27694619

  4. Multiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification.

    PubMed

    Wang, Yi; Wang, Yan; Zhang, Lu; Liu, Dongxin; Luo, Lijuan; Li, Hua; Cao, Xiaolong; Liu, Kai; Xu, Jianguo; Ye, Changyun

    2016-01-01

    We have devised a novel isothermal amplification technology, termed endonuclease restriction-mediated real-time multiple cross displacement amplification (ET-MCDA), which facilitated multiplex, rapid, specific and sensitive detection of nucleic-acid sequences at a constant temperature. The ET-MCDA integrated multiple cross displacement amplification strategy, restriction endonuclease cleavage and real-time fluorescence detection technique. In the ET-MCDA system, the functional cross primer E-CP1 or E-CP2 was constructed by adding a short sequence at the 5' end of CP1 or CP2, respectively, and the new E-CP1 or E-CP2 primer was labeled at the 5' end with a fluorophore and in the middle with a dark quencher. The restriction endonuclease Nb.BsrDI specifically recognized the short sequence and digested the newly synthesized double-stranded terminal sequences (5' end short sequences and their complementary sequences), which released the quenching, resulting on a gain of fluorescence signal. Thus, the ET-MCDA allowed real-time detection of single or multiple targets in only a single reaction, and the positive results were observed in as short as 12 min, detecting down to 3.125 fg of genomic DNA per tube. Moreover, the analytical specificity and the practical application of the ET-MCDA were also successfully evaluated in this study. Here, we provided the details on the novel ET-MCDA technique and expounded the basic ET-MCDA amplification mechanism.

  5. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    NASA Astrophysics Data System (ADS)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  6. Label-free DNA biosensor based on resistance change of platinum nanoparticles assemblies.

    PubMed

    Skotadis, Evangelos; Voutyras, Konstantinos; Chatzipetrou, Marianneza; Tsekenis, Georgios; Patsiouras, Lampros; Madianos, Leonidas; Chatzandroulis, Stavros; Zergioti, Ioanna; Tsoukalas, Dimitris

    2016-07-15

    A novel nanoparticle based biosensor for the fast and simple detection of DNA hybridization events is presented. The sensor utilizes hybridized DNA's charge transport properties, combining them with metallic nanoparticle networks that act as nano-gapped electrodes. The DNA hybridization events can be detected by a significant reduction in the sensor's resistance due to the conductive bridging offered by hybridized DNA. By modifying the nanoparticle surface coverage, which can be controlled experimentally being a function of deposition time, and the structural properties of the electrodes, an optimized biosensor for the in situ detection of DNA hybridization events is ultimately fabricated. The fabricated biosensor exhibits a wide response range, covering four orders of magnitude, a limit of detection of 1nM and can detect a single base pair mismatch between probe and complementary DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Diverse Applications of Environmental DNA Methods in Parasitology.

    PubMed

    Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

    2015-10-01

    Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  8. Suppression of Non-Homologous End Joining Repair by Overexpression of HMGA2

    PubMed Central

    Li, Angela Y.J.; Boo, Lee Ming; Wang, Shih-Ya; Lin, H. Helen; Wang, Clay C.C.; Yen, Yun; Chen, Benjamin P.C.; Chen, David J.; Ann, David K.

    2009-01-01

    Understanding the molecular details associated with aberrant high mobility group A2 (HMGA2) gene expression is key to establishing the mechanism(s) underlying its oncogenic potential and impact on the development of therapeutic strategies. Here, we report the involvement of HMGA2 in impairing DNA-dependent protein kinase (DNA-PK) during the non-homologous end joining (NHEJ) process. We demonstrated that HMGA2-expressing cells displayed deficiency in overall and precise DNA end-joining repair and accumulated more endogenous DNA damage. Proper and timely activation of DNA-PK, consisting of Ku70, Ku80 and DNA-PKcs subunits, is essential for the repair of DNA double strand breaks (DSBs) generated endogenously or by exposure to genotoxins. In cells overexpressing HMGA2, accumulation of histone 2A variant X phosphorylation at Ser-139 (γ-H2AX) was associated with hyper-phosphorylation of DNA-PKcs at Thr-2609 and Ser-2056 before and after the induction of DSBs. Also, the steady-state complex of Ku and DNA ends was altered by HMGA2. Microirradiation and real-time imaging in living cells revealed that HMGA2 delayed the release of DNA-PKcs from DSB sites, similar to observations found in DNA-PKcs mutants. Moreover, HMGA2 alone was sufficient to induce chromosomal aberrations, a hallmark of deficiency in NHEJ-mediated DNA repair. In summary, a novel role for HMGA2 to interfere with NHEJ processes was uncovered, implicating HMGA2 in the promotion of genome instability and tumorigenesis. PMID:19549901

  9. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  10. DNA nanostructure-based drug delivery nanosystems in cancer therapy.

    PubMed

    Wu, Dandan; Wang, Lei; Li, Wei; Xu, Xiaowen; Jiang, Wei

    2017-11-25

    DNA as a novel biomaterial can be used to fabricate different kinds of DNA nanostructures based on its principle of GC/AT complementary base pairing. Studies have shown that DNA nanostructure is a nice drug carrier to overcome big obstacles existing in cancer therapy such as systemic toxicity and unsatisfied drug efficacy. Thus, different types of DNA nanostructure-based drug delivery nanosystems have been designed in cancer therapy. To improve treating efficacy, they are also developed into more functional drug delivery nanosystems. In recent years, some important progresses have been made. The objective of this review is to make a retrospect and summary about these different kinds of DNA nanostructure-based drug delivery nanosystems and their latest progresses: (1) active targeting; (2) mutidrug co-delivery; (3) construction of stimuli-responsive/intelligent nanosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Mutations altering the cleavage specificity of a homing endonuclease

    PubMed Central

    Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

    2002-01-01

    The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

  12. Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

    PubMed

    Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

    2017-05-30

    A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

  13. Chromosome ends: different sequences may provide conserved functions.

    PubMed

    Louis, Edward J; Vershinin, Alexander V

    2005-07-01

    The structures of specific chromosome regions, centromeres and telomeres, present a number of puzzles. As functions performed by these regions are ubiquitous and essential, their DNA, proteins and chromatin structure are expected to be conserved. Recent studies of centromeric DNA from human, Drosophila and plant species have demonstrated that a hidden universal centromere-specific sequence is highly unlikely. The DNA of telomeres is more conserved consisting of a tandemly repeated 6-8 bp Arabidopsis-like sequence in a majority of organisms as diverse as protozoan, fungi, mammals and plants. However, there are alternatives to short DNA repeats at the ends of chromosomes and for telomere elongation by telomerase. Here we focus on the similarities and diversity that exist among the structural elements, DNA sequences and proteins, that make up terminal domains (telomeres and subtelomeres), and how organisms use these in different ways to fulfil the functions of end-replication and end-protection. Copyright (c) 2005 Wiley Periodicals, Inc.

  14. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    PubMed

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  15. Dissecting the hybridization of oligonucleotides to structured complementary sequences.

    PubMed

    Peracchi, Alessio

    2016-06-01

    When oligonucleotides hybridize to long target molecules, the process is slowed by the secondary structure in the targets. The phenomenon has been analyzed in several previous studies, but many details remain poorly understood. I used a spectrofluorometric strategy, focusing on the formation/breaking of individual base pairs, to study the kinetics of association between a DNA hairpin and >20 complementary oligonucleotides ('antisenses'). Hybridization rates differed by over three orders of magnitude. Association was toehold-mediated, both for antisenses binding to the target's ends and for those designed to interact with the loop. Binding of these latter, besides being consistently slower, was affected to variable, non-uniform extents by the asymmetric loop structure. Divalent metal ions accelerated hybridization, more pronouncedly when nucleation occurred at the loop. Incorporation of locked nucleic acid (LNA) residues in the antisenses substantially improved the kinetics only when LNAs participated to the earliest hybridization steps. The effects of individual LNAs placed along the antisense indicated that the reaction transition state occurred after invading at least the first base pair of the stem. The experimental approach helps dissect hybridization reactions involving structured nucleic acids. Toehold-dependent, nucleation-invasion models appear fully appropriate for describing such reactions. Estimating the stability of nucleation complexes formed at internal toeholds is the major hurdle for the quantitative prediction of hybridization rates. While analyzing the mechanisms of a fundamental biochemical process (hybridization), this work also provides suggestions for the improvement of technologies that rely on such process. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1.

    PubMed

    Nishimasu, Hiroshi; Yamano, Takashi; Gao, Linyi; Zhang, Feng; Ishitani, Ryuichiro; Nureki, Osamu

    2017-07-06

    The RNA-guided Cpf1 nuclease cleaves double-stranded DNA targets complementary to the CRISPR RNA (crRNA), and it has been harnessed for genome editing technologies. Recently, Acidaminococcus sp. BV3L6 (AsCpf1) was engineered to recognize altered DNA sequences as the protospacer adjacent motif (PAM), thereby expanding the target range of Cpf1-mediated genome editing. Whereas wild-type AsCpf1 recognizes the TTTV PAM, the RVR (S542R/K548V/N552R) and RR (S542R/K607R) variants can efficiently recognize the TATV and TYCV PAMs, respectively. However, their PAM recognition mechanisms remained unknown. Here we present the 2.0 Å resolution crystal structures of the RVR and RR variants bound to a crRNA and its target DNA. The structures revealed that the RVR and RR variants primarily recognize the PAM-complementary nucleotides via the substituted residues. Our high-resolution structures delineated the altered PAM recognition mechanisms of the AsCpf1 variants, providing a basis for the further engineering of CRISPR-Cpf1. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    PubMed

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  19. An electrochemiluminescent DNA sensor based on nano-gold enhancement and ferrocene quenching.

    PubMed

    Yao, Wu; Wang, Lun; Wang, Haiyan; Zhang, Xiaolei; Li, Ling; Zhang, Na; Pan, Le; Xing, Nannan

    2013-02-15

    An electrochemiluminescent DNA (ECL-DNA) sensor based on nano-gold signal enhancement (i.e. gold nanoparticles, GNP) and ferrocene signal quenching was investigated. The Au electrode was first modified with GNPs through electrodeposition method, followed by subsequent immobilization of single-stranded probe DNA labeled with ruthenium complex. The resulting sensor produced a higher ECL signal due to its higher density of self-assembled probe DNAs on the surface. Upon the hybridization of probe DNA with complementary target DNA labeled with ferrocene, ECL intensity decreased significantly due to spatial separation of ECL label from the electrode surface. As a result, the ECL signal was simultaneously quenched by ferrocene. The effects of both nano-gold electrodeposition time and ferrocene on the performance of ECL-DNA sensor were studied in detail and possible reasons for these effects were suggested as well. The reported ECL-DNA sensor showed great sensitivity and may provide an alternative approach for DNA detection in diagnostics and gene analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

    2010-01-01

    Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

  1. Determination and analysis of site-specific 125I decay-induced DNA double-strand break end-group structures.

    PubMed

    Datta, Kamal; Weinfeld, Michael; Neumann, Ronald D; Winters, Thomas A

    2007-02-01

    End groups contribute to the structural complexity of radiation-induced DNA double-strand breaks (DSBs). As such, end-group structures may affect a cell's ability to repair DSBs. The 3'-end groups of strand breaks caused by gamma radiation, or oxidative processes, under oxygenated aqueous conditions have been shown to be distributed primarily between 3'-phosphoglycolate and 3'-phosphate, with 5'-phosphate ends in both cases. In this study, end groups of the high-LET-like DSBs caused by 125I decay were investigated. Site-specific DNA double-strand breaks were produced in plasmid pTC27 in the presence or absence of 2 M DMSO by 125I-labeled triplex-forming oligonucleotide targeting. End-group structure was assessed enzymatically as a function of the DSB end to serve as a substrate for ligation and various forms of end labeling. Using this approach, we have demonstrated 3'-hydroxyl (3'-OH) and 3'-phosphate (3'-P) end groups and 5'-ends (> or = 42%) terminated by phosphate. A 32P postlabeling assay failed to detect 3'-phosphoglycolate in a restriction fragment terminated by the 125I-induced DNA double-strand break, and this is likely due to restricted oxygen diffusion during irradiation as a frozen aqueous solution. Even so, end-group structure and relative distribution varied as a function of the free radical scavenging capacity of the irradiation buffer.

  2. DNA Nanostructures as Smart Drug-Delivery Vehicles and Molecular Devices.

    PubMed

    Linko, Veikko; Ora, Ari; Kostiainen, Mauri A

    2015-10-01

    DNA molecules can be assembled into custom predesigned shapes via hybridization of sequence-complementary domains. The folded structures have high spatial addressability and a tremendous potential to serve as platforms and active components in a plethora of bionanotechnological applications. DNA is a truly programmable material, and its nanoscale engineering thus opens up numerous attractive possibilities to develop novel methods for therapeutics. The tailored molecular devices could be used in targeting cells and triggering the cellular actions in the biological environment. In this review we focus on the DNA-based assemblies - primarily DNA origami nanostructures - that could perform complex tasks in cells and serve as smart drug-delivery vehicles in, for example, cancer therapy, prodrug medication, and enzyme replacement therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  4. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  5. Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

    PubMed Central

    Kurtz, David T.; Feigelson, Philip

    1977-01-01

    A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

  6. Functions of Fun30 Chromatin Remodeler in Regulating Cellular Resistance to Genotoxic Stress

    PubMed Central

    Bi, Xin; Yu, Qun; Siler, Jasmine; Li, Chong; Khan, Ali

    2015-01-01

    The Saccharomyces cerevisiae Fun30 chromatin remodeler has recently been shown to facilitate long-range resection of DNA double strand break (DSB) ends, which proceeds homologous recombination (HR). This is believed to underlie the role of Fun30 in promoting cellular resistance to DSB inducing agent camptothecin. We show here that Fun30 also contributes to cellular resistance to genotoxins methyl methanesulfonate (MMS) and hydroxyurea (HU) that can stall the progression of DNA replication. We present evidence implicating DNA end resection in Fun30-dependent MMS-resistance. On the other hand, we show that Fun30 deletion suppresses the MMS- and HU-sensitivity of cells lacking the Rad5/Mms2/Ubc13-dependent error-free DNA damage tolerance mechanism. This suppression is not the result of a reduction in DNA end resection, and is dependent on the key HR component Rad51. We further show that Fun30 negatively regulates the recovery of rad5Δ mutant from MMS induced G2/M arrest. Therefore, Fun30 has two functions in DNA damage repair: one is the promotion of cellular resistance to genotoxic stress by aiding in DNA end resection, and the other is the negative regulation of a Rad51-dependent, DNA end resection-independent mechanism for countering replicative stress. The latter becomes manifest when Rad5 dependent DNA damage tolerance is impaired. In addition, we find that the putative ubiquitin-binding CUE domain of Fun30 serves to restrict the ability of Fun30 to hinder MMS- and HU-tolerance in the absence of Rad5. PMID:25806814

  7. A single-molecule sequencing assay for the comprehensive profiling of T4 DNA ligase fidelity and bias during DNA end-joining.

    PubMed

    Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js

    2018-05-08

    DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.

  8. Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

    PubMed Central

    Chan, K. C. Allen; Jiang, Peiyong; Sun, Kun; Cheng, Yvonne K. Y.; Tong, Yu K.; Cheng, Suk Hang; Wong, Ada I. C.; Hudecova, Irena; Leung, Tak Y.; Chiu, Rossa W. K.; Lo, Yuk Ming Dennis

    2016-01-01

    Plasma DNA obtained from a pregnant woman was sequenced to a depth of 270× haploid genome coverage. Comparing the maternal plasma DNA sequencing data with the parental genomic DNA data and using a series of bioinformatics filters, fetal de novo mutations were detected at a sensitivity of 85% and a positive predictive value of 74%. These results represent a 169-fold improvement in the positive predictive value over previous attempts. Improvements in the interpretation of the sequence information of every base position in the genome allowed us to interrogate the maternal inheritance of the fetus for 618,271 of 656,676 (94.2%) heterozygous SNPs within the maternal genome. The fetal genotype at each of these sites was deduced individually, unlike previously, where the inheritance was determined for a collection of sites within a haplotype. These results represent a 90-fold enhancement in the resolution in determining the fetus’s maternal inheritance. Selected genomic locations were more likely to be found at the ends of plasma DNA molecules. We found that a subset of such preferred ends exhibited selectivity for fetal- or maternal-derived DNA in maternal plasma. The ratio of the number of maternal plasma DNA molecules with fetal preferred ends to those with maternal preferred ends showed a correlation with the fetal DNA fraction. Finally, this second generation approach for noninvasive fetal whole-genome analysis was validated in a pregnancy diagnosed with cardiofaciocutaneous syndrome with maternal plasma DNA sequenced to 195× coverage. The causative de novo BRAF mutation was successfully detected through the maternal plasma DNA analysis. PMID:27799561

  9. Modeling Non-homologous End Joining

    NASA Technical Reports Server (NTRS)

    Li, Yongfeng

    2013-01-01

    Non-homologous end joining (NHEJ) is the dominant DNA double strand break (DSB) repair pathway and involves several NHEJ proteins such as Ku, DNA-PKcs, XRCC4, Ligase IV and so on. Once DSBs are generated, Ku is first recruited to the DNA end, followed by other NHEJ proteins for DNA end processing and ligation. Because of the direct ligation of break ends without the need for a homologous template, NHEJ turns out to be an error-prone but efficient repair pathway. Some mechanisms have been proposed of how the efficiency of NHEJ repair is affected. The type of DNA damage is an important factor of NHEJ repair. For instance, the length of DNA fragment may determine the recruitment efficiency of NHEJ protein such as Ku [1], or the complexity of the DNA breaks [2] is accounted for the choice of NHEJ proteins and subpathway of NHEJ repair. On the other hand, the chromatin structure also plays a role of the accessibility of NHEJ protein to the DNA damage site. In this talk, some mathematical models of NHEJ, that consist of series of biochemical reactions complying with the laws of chemical reaction (e.g. mass action, etc.), will be introduced. By mathematical and numerical analysis and parameter estimation, the models are able to capture the qualitative biological features and show good agreement with experimental data. As conclusions, from the viewpoint of modeling, how the NHEJ proteins are recruited will be first discussed for connection between the classical sequential model [4] and recently proposed two-phase model [5]. Then how the NHEJ repair pathway is affected, by the length of DNA fragment [6], the complexity of DNA damage [7] and the chromatin structure [8], will be addressed

  10. Electrosynthesis and characterization of nanostructured polyquinone for use in detection and quantification of naturally occurring dsDNA.

    PubMed

    Hernández, Loreto A; Del Valle, María A; Armijo, Francisco

    2016-05-15

    The detection of naturally occurring desoxyribonucleic acid (DNA) has become a subject of study by the projections that would generate to be able to sense the genetic material for the detection of future diseases. Bearing this in mind, to provide new measuring strategies, in the current work the preparation of a low-cost electrode, modified with poly(1-amino-9,10-anthraquinone) nanowires using a SiO2 template, is carried out; the assembly is next modified by covalently attaching ssDNA strands. It must be noted that all this is accomplished by using solely electrochemical techniques, according to methodology developed for this purpose. SEM images of the modified surface show high order and homogeneity in the distribution of modified nanowires over the electrode surface. In turn, after the hybridization with its complementary strand, the voltammetric responses enable corroborating the linear relationship between hybridization at different DNA concentrations and normalized current response, obtaining a limit of detection (LOD) 5.7·10(-12)gL(-1) and limit of quantification (LOQ) 1.9·10(-11)gL(-1). The working dynamic range is between 1.4·10(-7) and 8.5·10(-9)gL(-1) with a correlation coefficient 0.9998. The successful obtaining of the modified electrode allows concluding that the high order reached by the nanostructures, guides the subsequent single strand of DNA (ssDNA) covalent attachment, which after hybridization with its complementary strand brings about a considerable current increase. This result allows foreseeing a guaranteed breakthrough with regard to the use of the biosensor in real samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

    PubMed Central

    Suard, Y M; Tosi, M; Kraehenbuhl, J P

    1982-01-01

    Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

  12. A large Raman scattering cross-section molecular embedded SERS aptasensor for ultrasensitive Aflatoxin B1 detection using CS-Fe3O4 for signal enrichment

    NASA Astrophysics Data System (ADS)

    Chen, Quansheng; Yang, Mingxiu; Yang, Xiaojing; Li, Huanhuan; Guo, Zhiming; Rahma, M. H.

    2018-01-01

    With growing concern on oil safety problems, developing a simple and sensitive method to detect Aflatoxin B1 (AFB1), a common mycotoxin in peanut oil, is very necessary. In this study, Surface-enhanced Raman Scattering (SERS) aptasensor was developed for ultrasensitive AFB1 detection using the amino-terminal AFB1 aptamer (NH2-DNA1); and thiol-terminal AFB1 complementary aptamer (SH-DNA2) conjugated magnetic-beads (CS-Fe3O4) as enrichment nanoprobe and AuNR@DNTB@Ag nanorods (ADANRs) as reporter nanoprobe respectively. 5,5‧-Dithiobis(2-nitrobenzoicacid) (DNTB) with large Raman scattering cross-section and no fluorescence interference was embedded in Au and Ag core/shell nanorods as Raman reporter molecules. CS-Fe3O4 possessed excellent biocompatibility and superparamagnetism for rapid signal enrichment. Therefore, NH2-DNA1-CS-Fe3O4 and SH-DNA2-ADANRs were fabricated via the hybrid reaction between aptamers and complementary aptamers. When there is AFB1, AFB1 would competitively combine with the NH2-DNA1-CS-Fe3O4 inducing the dissociation of SH-DNA2-ADANRs from CS-Fe3O4 and further decreasing the SERS signal. Based on this developed SERS aptasensor, a low limit of 0.0036 ng/mL and an effective linear detection range from 0.01 to 100 ng/mL with the correlation coefficient up to 0.986 for AFB1 detection were obtained. Moreover, the specificity of this SERS aptasensor was demonstrated by detecting other two mycotoxins and its accuracy for AFB1 detection in real peanut oil was further confirmed by standard addition recovery test.

  13. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  14. Modeling non-homologous end joining.

    PubMed

    Li, Yongfeng; Cucinotta, Francis A

    2011-08-21

    Non-homologous end joining (NHEJ) is an important DNA repair pathway for DNA double-strand breaks. Several proteins, including Ku, DNA-PKcs, Artemis, XRCC4/Ligase IV and XLF, are involved in the NHEJ for the DNA damage detection, DNA free end processing and ligation. The classical model of NHEJ is a sequential model in which DNA-PKcs is first recruited by the Ku bound DNA prior to any other repair proteins. Recent experimental study (McElhinny et al., 2000; Costantini et al., 2007; Mari et al., 2006; Yano and Chen, 2008) suggested that the recruitment ordering is not crucial. In this work, by proposing a mathematical model in terms of biochemical reaction network and performing stability and related analysis, we demonstrate theoretically that if DSB repair pathway independent of DNA-PKcs exists, then the classical sequential model and new two-phase model are essentially indistinguishable in the sense that DSB can be repaired thoroughly in both models when the repair proteins are sufficient. Published by Elsevier Ltd.

  15. Free energy profiles for unwrapping the outer superhelical turn of nucleosomal DNA

    PubMed Central

    Sakuraba, Shun; Ishida, Hisashi

    2018-01-01

    The eukaryotic genome is packaged into a nucleus in the form of chromatin. The fundamental structural unit of chromatin is a protein-DNA complex, the nucleosome, where 146 or 147 base pairs of DNA wrap 1.75 times around a histone core. To function in cellular processes, however, nucleosomal DNA must be unwrapped. Although this unwrapping has been experimentally investigated, details of the process at an atomic level are not yet well understood. Here, we used molecular dynamics simulation with an enhanced sampling method to calculate the free energy profiles for unwrapping the outer superhelical turn of nucleosomal DNA. A free energy change of about 11.5 kcal/mol for the unwrapping agrees well with values obtained in single molecule experiments. This simulation revealed a variety of conformational states, indicating there are many potential paths to outer superhelicdal turn unwrapping, but the dominant path is likely asymmetric. At one end of the DNA, the first five bps unwrap, after which a second five bps unwrap at the same end with no increase in free energy. The unwrapping then starts at the other end of the DNA, where 10 bps are unwrapped. During further unwrapping of 15 bps, the unwrapping advances at one of the ends, after which the other end of the DNA unwraps to complete the unwrapping of the outer superhelical turn. These results provide insight into the construction, disruption, and repositioning of nucleosomes, which are continuously ongoing during cellular processes. PMID:29505570

  16. Telomeres and telomerase.

    PubMed Central

    Chan, Simon R W L; Blackburn, Elizabeth H

    2004-01-01

    Telomeres are the protective DNA-protein complexes found at the ends of eukaryotic chromosomes. Telomeric DNA consists of tandem repeats of a simple, often G-rich, sequence specified by the action of telomerase, and complete replication of telomeric DNA requires telomerase. Telomerase is a specialized cellular ribonucleoprotein reverse transcriptase. By copying a short template sequence within its intrinsic RNA moiety, telomerase synthesizes the telomeric DNA strand running 5' to 3' towards the distal end of the chromosome, thus extending it. Fusion of a telomere, either with another telomere or with a broken DNA end, generally constitutes a catastrophic event for genomic stability. Telomerase acts to prevent such fusions. The molecular consequences of telomere failure, and the molecular contributors to telomere function, with an emphasis on telomerase, are discussed here. PMID:15065663

  17. Connector tube for a turbine rotor cooling circuit

    DOEpatents

    Li, Ming Cheng

    2003-06-24

    A tubular connector adapted to extend between two tubular components comprising a tubular body having an internal diameter, a first free end including an annular radial flange having a tapered surface adapted to engage a complementary seating surface on a first of the two tubular components, the internal diameter remaining constant through the first free end; and a second free end having an annular bulbous shape adapted to seat within a cylindrical end of a second of the two tubular components.

  18. Connector tube for a turbine rotor cooling circuit

    DOEpatents

    Li, Ming Cheng

    2002-01-01

    A tubular connector adapted to extend between two tubular components comprising a tubular body having an internal diameter, a first free end including an annular radial flange having a tapered surface adapted to engage a complementary seating surface on a first of the two tubular components, the internal diameter remaining constant through the first free end; and a second free end having an annular bulbous shape adapted to seat within a cylindrical end of a second of the two tubular components.

  19. Helmet latching and attaching ring

    NASA Technical Reports Server (NTRS)

    Chase, E. W.; Viikinsalo, S. J. (Inventor)

    1970-01-01

    A neck ring releasably secured to a pressurized garment carries an open-ended ring normally in the engagement position fitted into an annular groove and adapted to fit into a complementary annular groove formed in a helmet. Camming means formed on the inner surface at the end of the helmet engages the open-ended ring to retract the same and allow for one motion donning even when the garment is pressurized. A projection on the end of the split ring is engageable to physically retract the split ring.

  20. Functional Specificity of Extracellular Nucleases of Shewanella oneidensis MR-1

    PubMed Central

    Heun, Magnus; Binnenkade, Lucas; Kreienbaum, Maximilian

    2012-01-01

    Bacterial species such as Shewanella oneidensis MR-1 require extracellular nucleolytic activity for the utilization of extracellular DNA (eDNA) as a source of nutrients and for the turnover of eDNA as a structural matrix component during biofilm formation. We have previously characterized two extracellular nucleases of S. oneidensis MR-1, ExeM and ExeS. Although both are involved in biofilm formation, they are not specifically required for the utilization of eDNA as a nutrient. Here we identified and characterized EndA, a third extracellular nuclease of Shewanella. The heterologously overproduced and purified protein was highly active and rapidly degraded linear and supercoiled DNAs of various origins. Divalent metal ions (Mg2+ or Mn2+) were required for function. endA is cotranscribed with phoA, an extracellular phosphatase, and is not upregulated upon phosphostarvation. Deletion of endA abolished both extracellular degradation of DNA by S. oneidensis MR-1 and the ability to use eDNA as a sole source of phosphorus. PhoA is not strictly required for the exploitation of eDNA as a nutrient. The activity of EndA prevents the formation of large cell aggregates during planktonic growth. However, in contrast to the findings for ExeM, endA deletion had only minor effects on biofilm formation. The findings strongly suggest that the extracellular nucleases of S. oneidensis exert specific functions required under different conditions. PMID:22492434

Top