Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
Procedure for normalization of cDNA libraries
Bonaldo, M.D.; Soares, M.B.
1997-12-30
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.
Complementary DNA libraries: an overview.
Ying, Shao-Yao
2004-07-01
The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Soares, M.B.; Efstratiadis, A.
1997-06-10
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1998-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1998-11-03
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1996-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1996-01-09
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.
1984-08-01
A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain
NASA Astrophysics Data System (ADS)
Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.
1985-12-01
A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Physical mapping of complex genomes
Evans, G.A.
1993-06-15
A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.
Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert
2008-12-01
Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.
Constructing and detecting a cDNA library for mites.
Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui
2015-10-01
RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.
de Bellocq, J Goüy; Leirs, H
2009-09-01
Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.
Role of messenger RNA-ribosome complex in complementary DNA display.
Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke
2013-07-15
In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Woods, D E; Edge, M D; Colten, H R
1984-01-01
Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718
Physical mapping of complex genomes
Evans, Glen A.
1993-01-01
Method for simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts int he pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert int he common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed. In other preferred embodiments, the cosmid clones are arranged in a three dimensional matrix, pooled and compared in threes according to intersecting planes of the three dimensional matrix. Arrangements corresponding to geometries of higher dimensions may also be prepared and used to simultaneously identify overlapping clones in highly complex libraries with relatively few hybridization reactions.
Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.
Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M
1987-01-01
Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929
DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.
Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg
2014-04-15
DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target proteins and is likely to become a standard tool for pharmaceutical hit discovery, lead expansion, and Chemical Biology research. The introduction of new methodologies for library encoding and for compound synthesis in the presence of DNA is an exciting research field and will crucially contribute to the performance and the propagation of the technology.
Loudig, Olivier; Liu, Christina; Rohan, Thomas; Ben-Dov, Iddo Z
2018-05-05
-Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18-24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3' barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3' barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.
Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip
2011-08-01
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.
Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries
Kerschner, Joseph E.; Horsey, Edward; Ahmed, Azad; Erbe, Christy; Khampang, Pawjai; Cioffi, Joseph; Hu, Fen Ze; Post, James Christopher; Ehrlich, Garth D.
2010-01-01
Objectives To investigate genetic differences in middle ear mucosa (MEM) with nontypeable Haemophilus influenzae (NTHi) infection. Genetic upregulation and downregulation occurs in MEM during otitis media (OM) pathogenesis. A comprehensive assessment of these genetic differences using the techniques of complementary DNA (cDNA) library creation has not been performed. Design The cDNA libraries were constructed from NTHi-infected and noninfected chinchilla MEM. Random clones were picked, sequenced bidirectionally, and submitted to the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database, where they were assigned accession numbers. These numbers were used with the basic local alignment search tool (BLAST) to align clones against the nonredundant nucleotide database at NCBI. Results Analysis with the Web-based statistical program FatiGO identified several biological processes with significant differences in numbers of represented genes. Processes involved in immune, stress, and wound responses were more prevalent in the NTHi-infected library. S100 calcium-binding protein A9 (S100A9); secretory leukoprotease inhibitor (SLPI); β2-microglobulin (B2M); ferritin, heavy-chain polypeptide 1 (FTH1); and S100 calcium-binding protein A8 (S100A8) were expressed at significantly higher levels in the NTHi-infected library. Calcium-binding proteins S100A9 and S100A8 serve as markers for inflammation and have antibacterial effects. Secretory leukoprotease inhibitor is an antibacterial protein that inhibits stimuli-induced MUC1, MUC2, and MUC5AC production. Conclusions A number of genes demonstrate changes during the pathogenesis of OM, including SLPI, which has an impact on mucin gene expression; this expression is known to be an important regulator in OM. The techniques described herein provide a framework for future investigations to more thoroughly understand molecular changes in the middle ear, which will likely be important in developing new therapeutic and intervention strategies. PMID:19153305
Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit
NASA Astrophysics Data System (ADS)
Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.
1987-10-01
The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.
Map-based cloning of a gene controlling Omega-3 fatty acid desaturation in Arabidopsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arondel, V.; Lemieux, B.; Hwang, I.
1992-11-20
A gene from the flowering plant Arabidopsis thaliana that encodes an omega-3 desaturase was cloned on the basis of the genetic map position of a mutation affecting membrane and storage lipid fatty acid composition. Yeast artificial chromosomes covering the genetic locus were identified and used to probe a seed complementary DNA library. A complementary DNA clone for the desaturase was identified and introduced into roots of both wild-type and mutant plants by Ti plasmid-mediated transformation. Transgenic tissues of both mutant and wild-type plants had significantly increased amounts of the fatty acid produced by this desaturase. 24 refs., 2 figs., 1more » tabs.« less
Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics
2012-01-01
Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761
Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C
2016-08-01
As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.
Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.
Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg
2017-05-04
DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C; Backeljau, Thierry; De Meyer, Marc
2012-01-01
We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods.
Virgilio, Massimiliano; Jordaens, Kurt; Breman, Floris C.; Backeljau, Thierry; De Meyer, Marc
2012-01-01
We propose a general working strategy to deal with incomplete reference libraries in the DNA barcoding identification of species. Considering that (1) queries with a large genetic distance with their best DNA barcode match are more likely to be misidentified and (2) imposing a distance threshold profitably reduces identification errors, we modelled relationships between identification performances and distance thresholds in four DNA barcode libraries of Diptera (n = 4270), Lepidoptera (n = 7577), Hymenoptera (n = 2067) and Tephritidae (n = 602 DNA barcodes). In all cases, more restrictive distance thresholds produced a gradual increase in the proportion of true negatives, a gradual decrease of false positives and more abrupt variations in the proportions of true positives and false negatives. More restrictive distance thresholds improved precision, yet negatively affected accuracy due to the higher proportions of queries discarded (viz. having a distance query-best match above the threshold). Using a simple linear regression we calculated an ad hoc distance threshold for the tephritid library producing an estimated relative identification error <0.05. According to the expectations, when we used this threshold for the identification of 188 independently collected tephritids, less than 5% of queries with a distance query-best match below the threshold were misidentified. Ad hoc thresholds can be calculated for each particular reference library of DNA barcodes and should be used as cut-off mark defining whether we can proceed identifying the query with a known estimated error probability (e.g. 5%) or whether we should discard the query and consider alternative/complementary identification methods. PMID:22359600
Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.
Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y
1996-01-01
The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.
Naimuddin, Mohammed; Kubo, Tai
2011-12-01
We report an efficient system to produce and display properly folded disulfide-rich proteins facilitated by coupled complementary DNA (cDNA) display and protein disulfide isomerase-assisted folding. The results show that a neurotoxin protein containing four disulfide linkages can be displayed in the folded state. Furthermore, it can be refolded on a solid support that binds efficiently to its natural acetylcholine receptor. Probing the efficiency of the display proteins prepared by these methods provided up to 8-fold higher enrichment by the selective enrichment method compared with cDNA display alone, more than 10-fold higher binding to its receptor by the binding assays, and more than 10-fold higher affinities by affinity measurements. Cotranslational folding was found to have better efficiency than posttranslational refolding between the two investigated methods. We discuss the utilities of efficient display of such proteins in the preparation of superior quality proteins and protein libraries for directed evolution leading to ligand discovery. Copyright © 2011 Elsevier Inc. All rights reserved.
Sugai, Kyoko; Setsuko, Suzuki; Uchiyama, Kentaro; Murakami, Noriaki; Kato, Hidetoshi; Yoshimaru, Hiroshi
2012-02-01
Expressed sequence tag (EST)-derived microsatellite markers were developed for Elaeocarpus photiniifolia, an endemic taxon of the Bonin Islands. Initially, a complementary DNA (cDNA) library was constructed by de novo pyrosequencing of total RNA extracted from a seedling. A total of 267 primer pairs were designed from the library. Of the 48 tested loci, 25 loci were polymorphic among 41 individuals representing the entire geographical range of the species, with the number of alleles per locus and expected heterozygosity ranging from two to 14 and 0.09 to 0.86, respectively. Most loci were transferable to a related species, E. sylvestris. The developed markers will be useful for evaluating the genetic structure of E. photiniifolia.
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel
2014-01-01
Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
Interaction Analysis through Proteomic Phage Display
2014-01-01
Phage display is a powerful technique for profiling specificities of peptide binding domains. The method is suited for the identification of high-affinity ligands with inhibitor potential when using highly diverse combinatorial peptide phage libraries. Such experiments further provide consensus motifs for genome-wide scanning of ligands of potential biological relevance. A complementary but considerably less explored approach is to display expression products of genomic DNA, cDNA, open reading frames (ORFs), or oligonucleotide libraries designed to encode defined regions of a target proteome on phage particles. One of the main applications of such proteomic libraries has been the elucidation of antibody epitopes. This review is focused on the use of proteomic phage display to uncover protein-protein interactions of potential relevance for cellular function. The method is particularly suited for the discovery of interactions between peptide binding domains and their targets. We discuss the largely unexplored potential of this method in the discovery of domain-motif interactions of potential biological relevance. PMID:25295249
Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.
Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy
2017-02-01
Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.
Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L
2017-04-01
During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.
Barnard, G F; Staniunas, R J; Mori, M; Puder, M; Jessup, M J; Steele, G D; Chen, L B
1993-09-01
The levels of a number of ribosomal protein mRNAs are reported to be increased in human colon cancer. We have assessed whether selected ribosomal protein mRNAs are overexpressed in other gastrointestinal malignancies, namely gastric and hepatocellular carcinomas. Subtracted complementary DNA libraries were generated from paired samples of human (a) colorectal carcinoma minus adjacent normal colonic mucosa and (b) hepatocellular carcinoma minus adjacent normal liver. Screening of approximately 3% of these library clones determined that ribosomal protein mRNAs encoding L18 and L37 (not previously reported) and P0 and S6 were overexpressed in one or the other library. Their complementary DNA inserts were then used as probes to evaluate their expression in a larger number of paired tumor/normal surgical samples of human colonic, gastric, and hepatocellular carcinomas, by Northern hybridization. The mRNA signal was greater in the colonic carcinoma than in paired adjacent normal colonic mucosa in 38 of 42 cases for P0 [tumor/normal (T/N) ratio = 3.0 +/- 0.3, mean +/- SE, P < 0.001] (G. F. Barnard, R. J. Staniunas, S. Bao, K. Mafune, J. L. Gollan, G. D. Steele, Jr., and L. B. Chen, Cancer Res., 52: 3067-3072, 1992), in 25 of 28 cases for L18 (T/N ratio = 3.7 +/- 0.5, P < 0.001), in 27 of 28 cases for L37 (T/N ratio = 5.3 +/- 0.4, P < 0.001), and in 24 of 28 cases for S6 (T/N ratio = 3.1 +/- 0.5, P < 0.01). The level of mRNA overexpression of L18 and S6 did not correlate with the Dukes' stage of disease. In hepatocellular carcinoma samples, using the same four ribosomal protein complementary DNA probes, only P0 mRNA was significantly increased (T/N ratio = 2.8 +/- 0.4, n = 6, P = 0.047). In gastric carcinoma samples, none of these mRNAs was increased (mean T/N ratios = 0.9-1.2, n = 6). Therefore, gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein mRNAs as do colonic carcinoma.
Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong
2011-10-11
Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
Seal, S N; Hoet, R M; Raats, J M; Radic, M Z
2000-09-01
To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.
Induction of UO-44 gene expression by tamoxifen in the rat uterus and ovary.
Huynh, H; Ng, C Y; Lim, K B; Ong, C K; Ong, C S; Tran, E; Tuyen Nguyen, T T; Chan, T W
2001-07-01
A complementary DNA, uterine-ovarian-specific gene 44 (UO-44), has been isolated from tamoxifen-induced rat uterine complementary DNA library using differential display techniques. UO-44 transcripts are found to be abundant in the uterus and ovary. UO-44 gene expression in the uterus is strictly regulated by estrogens, tamoxifen, and GH, whereas the pure antiestrogen ICI 182780 is inhibitory. Treatment of ovariectomized rats and hypophysectomized rats with tamoxifen and GH, respectively, resulted in up-regulation of UO-44 expression in a dose-dependent manner. In situ hybridization revealed that UO-44 gene expression was restricted to the luminal and glandular epithelial cells of the uterus and to granulosa cells of medium-size ovarian follicles. Transfection studies showed that UO-44 was a membrane-associated protein. Because estrogens, tamoxifen, and GH are stimulators of uterine luminal epithelial cell growth in vivo, UO-44 protein may serve as a mediator of the effect of these compounds in inducing epithelial proliferation and differentiation in these tissues.
Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B
1987-01-01
The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979
A new age in functional genomics using CRISPR/Cas9 in arrayed library screening.
Agrotis, Alexander; Ketteler, Robin
2015-01-01
CRISPR technology has rapidly changed the face of biological research, such that precise genome editing has now become routine for many labs within several years of its initial development. What makes CRISPR/Cas9 so revolutionary is the ability to target a protein (Cas9) to an exact genomic locus, through designing a specific short complementary nucleotide sequence, that together with a common scaffold sequence, constitute the guide RNA bridging the protein and the DNA. Wild-type Cas9 cleaves both DNA strands at its target sequence, but this protein can also be modified to exert many other functions. For instance, by attaching an activation domain to catalytically inactive Cas9 and targeting a promoter region, it is possible to stimulate the expression of a specific endogenous gene. In principle, any genomic region can be targeted, and recent efforts have successfully generated pooled guide RNA libraries for coding and regulatory regions of human, mouse and Drosophila genomes with high coverage, thus facilitating functional phenotypic screening. In this review, we will highlight recent developments in the area of CRISPR-based functional genomics and discuss potential future directions, with a special focus on mammalian cell systems and arrayed library screening.
Pierce, M L; Ruffner, D E
1998-01-01
Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305
Jézéquel, Laetitia; Loeper, Jacqueline; Pompon, Denis
2008-11-01
Combinatorial libraries coding for mosaic enzymes with predefined crossover points constitute useful tools to address and model structure-function relationships and for functional optimization of enzymes based on multivariate statistics. The presented method, called sequence-independent generation of a chimera-ordered library (SIGNAL), allows easy shuffling of any predefined amino acid segment between two or more proteins. This method is particularly well adapted to the exchange of protein structural modules. The procedure could also be well suited to generate ordered combinatorial libraries independent of sequence similarities in a robotized manner. Sequence segments to be recombined are first extracted by PCR from a single-stranded template coding for an enzyme of interest using a biotin-avidin-based method. This technique allows the reduction of parental template contamination in the final library. Specific PCR primers allow amplification of two complementary mosaic DNA fragments, overlapping in the region to be exchanged. Fragments are finally reassembled using a fusion PCR. The process is illustrated via the construction of a set of mosaic CYP2B enzymes using this highly modular approach.
Lazinski, David W; Camilli, Andrew
2013-01-01
The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.
Krak, Karol; Alvarez, Inés; Caklová, Petra; Costa, Andrea; Chrtek, Jindrich; Fehrer, Judith
2012-02-01
The development of three low-copy nuclear markers for low taxonomic level phylogenies in Asteraceae with emphasis on the subtribe Hieraciinae is reported. Marker candidates were selected by comparing a Lactuca complementary DNA (cDNA) library with public DNA sequence databases. Interspecific variation and phylogenetic signal of the selected genes were investigated for diploid taxa from the subtribe Hieraciinae and compared to a reference phylogeny. Their ability to cross-amplify was assessed for other Asteraceae tribes. All three markers had higher variation (2.1-4.5 times) than the internal transcribed spacer (ITS) in Hieraciinae. Cross-amplification was successful in at least seven other tribes of the Asteraceae. Only three cases indicating the presence of paralogs or pseudogenes were detected. The results demonstrate the potential of these markers for phylogeny reconstruction in the Hieraciinae as well as in other Asteraceae tribes, especially for very closely related species.
Novel transcripts of the estrogen receptor α gene in channel catfish
Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian
2000-01-01
Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.
Lazinski, David W.; Camilli, Andrew
2013-01-01
The amplification of DNA fragments, cloned between user-defined 5′ and 3′ end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3′ termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5′ ends. The hybrid oligonucleotide has a user-defined sequence at its 5′ end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5′ user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA. PMID:23311318
Hu, Qing-bi; He, Yu; Zhou, Xun
2015-01-01
Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182
Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells
Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo
2014-01-01
The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540
Novel encoding methods for DNA-templated chemical libraries.
Li, Gang; Zheng, Wenlu; Liu, Ying; Li, Xiaoyu
2015-06-01
Among various types of DNA-encoded chemical libraries, DNA-templated library takes advantage of the sequence-specificity of DNA hybridization, enabling not only highly effective DNA-templated chemical reactions, but also high fidelity in library encoding. This brief review summarizes recent advances that have been made on the encoding strategies for DNA-templated libraries, and it also highlights their respective advantages and limitations for the preparation of DNA-encoded libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Suard, Y M; Tosi, M; Kraehenbuhl, J P
1982-01-01
Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313
Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde
2018-01-01
Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.
Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E.; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior. PMID:29659610
Rivera, Sinziana F; Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric
2018-01-01
Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior.
Library Construction from Subnanogram DNA for Pelagic Sea Water and Deep-Sea Sediments
Hirai, Miho; Nishi, Shinro; Tsuda, Miwako; Sunamura, Michinari; Takaki, Yoshihiro; Nunoura, Takuro
2017-01-01
Shotgun metagenomics is a low biased technology for assessing environmental microbial diversity and function. However, the requirement for a sufficient amount of DNA and the contamination of inhibitors in environmental DNA leads to difficulties in constructing a shotgun metagenomic library. We herein examined metagenomic library construction from subnanogram amounts of input environmental DNA from subarctic surface water and deep-sea sediments using two library construction kits: the KAPA Hyper Prep Kit and Nextera XT DNA Library Preparation Kit, with several modifications. The influence of chemical contaminants associated with these environmental DNA samples on library construction was also investigated. Overall, shotgun metagenomic libraries were constructed from 1 pg to 1 ng of input DNA using both kits without harsh library microbial contamination. However, the libraries constructed from 1 pg of input DNA exhibited larger biases in GC contents, k-mers, or small subunit (SSU) rRNA gene compositions than those constructed from 10 pg to 1 ng DNA. The lower limit of input DNA for low biased library construction in this study was 10 pg. Moreover, we revealed that technology-dependent biases (physical fragmentation and linker ligation vs. tagmentation) were larger than those due to the amount of input DNA. PMID:29187708
Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio
2017-10-24
High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Saunders, K; Lucy, A; Stanley, J
1992-01-01
The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192
Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira
2013-01-01
Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302
[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
HUNT: launch of a full-length cDNA database from the Helix Research Institute.
Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y
2001-01-01
The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.
Feng, Jiuhuan; Liu, Zhao; Cai, Xiwen; Jan, Chao-Chien
2013-01-01
Conventional karyotypes and various genetic linkage maps have been established in sunflower (Helianthus annuus L., 2n = 34). However, the relationship between linkage groups and individual chromosomes of sunflower remains unknown and has considerable relevance for the sunflower research community. Recently, a set of linkage group-specific bacterial /binary bacterial artificial chromosome (BAC/BIBAC) clones was identified from two complementary BAC and BIBAC libraries constructed for cultivated sunflower cv. HA89. In the present study, we used these linkage group-specific clones (∼100 kb in size) as probes to in situ hybridize to HA89 mitotic chromosomes at metaphase using the BAC- fluorescence in situ hybridization (FISH) technique. Because a characteristic of the sunflower genome is the abundance of repetitive DNA sequences, a high ratio of blocking DNA to probe DNA was applied to hybridization reactions to minimize the background noise. As a result, all sunflower chromosomes were anchored by one or two BAC/BIBAC clones with specific FISH signals. FISH analysis based on tandem repetitive sequences, such as rRNA genes, has been previously reported; however, the BAC-FISH technique developed here using restriction fragment length polymorphism (RFLP)−derived BAC/BIBAC clones as probes to apply genome-wide analysis is new for sunflower. As chromosome-specific cytogenetic markers, the selected BAC/BIBAC clones that encompass the 17 linkage groups provide a valuable tool for identifying sunflower cytogenetic stocks (such as trisomics) and tracking alien chromosomes in interspecific crosses. This work also demonstrates the potential of using a large-insert DNA library for the development of molecular cytogenetic resources. PMID:23316437
Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.
Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N
2013-04-16
In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.
Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki
2015-02-15
Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.
Carpenter, Meredith L.; Buenrostro, Jason D.; Valdiosera, Cristina; Schroeder, Hannes; Allentoft, Morten E.; Sikora, Martin; Rasmussen, Morten; Gravel, Simon; Guillén, Sonia; Nekhrizov, Georgi; Leshtakov, Krasimir; Dimitrova, Diana; Theodossiev, Nikola; Pettener, Davide; Luiselli, Donata; Sandoval, Karla; Moreno-Estrada, Andrés; Li, Yingrui; Wang, Jun; Gilbert, M. Thomas P.; Willerslev, Eske; Greenleaf, William J.; Bustamante, Carlos D.
2013-01-01
Most ancient specimens contain very low levels of endogenous DNA, precluding the shotgun sequencing of many interesting samples because of cost. Ancient DNA (aDNA) libraries often contain <1% endogenous DNA, with the majority of sequencing capacity taken up by environmental DNA. Here we present a capture-based method for enriching the endogenous component of aDNA sequencing libraries. By using biotinylated RNA baits transcribed from genomic DNA libraries, we are able to capture DNA fragments from across the human genome. We demonstrate this method on libraries created from four Iron Age and Bronze Age human teeth from Bulgaria, as well as bone samples from seven Peruvian mummies and a Bronze Age hair sample from Denmark. Prior to capture, shotgun sequencing of these libraries yielded an average of 1.2% of reads mapping to the human genome (including duplicates). After capture, this fraction increased substantially, with up to 59% of reads mapped to human and enrichment ranging from 6- to 159-fold. Furthermore, we maintained coverage of the majority of regions sequenced in the precapture library. Intersection with the 1000 Genomes Project reference panel yielded an average of 50,723 SNPs (range 3,062–147,243) for the postcapture libraries sequenced with 1 million reads, compared with 13,280 SNPs (range 217–73,266) for the precapture libraries, increasing resolution in population genetic analyses. Our whole-genome capture approach makes it less costly to sequence aDNA from specimens containing very low levels of endogenous DNA, enabling the analysis of larger numbers of samples. PMID:24568772
Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu
2014-01-01
Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361
Design and Synthesis of Biaryl DNA-Encoded Libraries.
Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana
2016-10-10
DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).
Microsatellite DNA library for Caiman latirostris.
Zucoloto, Rodrigo Barban; Verdade, Luciano Martins; Coutinho, Luiz Lehmann
2002-12-15
New genetic markers were characterized for the broad-snouted caiman (Caiman latirostris) by constructing libraries enriched for microsatellite DNA. Construction and characterization of these libraries are described in the present study. One microsatellite marker was developed from a (ACC-TGG)(n)enriched microsatellite DNA library, and 12 microsatellite markers were developed from a (AC-TG)(n)enriched microsatellite DNA library. These markers were tested in wild-caught animals, and these tests resulted in ten new polymorphic microsatellites for C. latirostris. Copyright 2002 Wiley-Liss, Inc.
Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.
Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R
2018-07-01
DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50 = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.
Giehr, Pascal; Walter, Jörn
2018-01-01
The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.
High-Resolution Sequence-Function Mapping of Full-Length Proteins
Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.
2015-01-01
Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064
Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.
Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P
2015-01-01
Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd
2013-01-01
The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity.
Wilson, John-James; Sing, Kong-Wah; Sofian-Azirun, Mohd
2013-01-01
The objective of this study was to build a DNA barcode reference library for the true butterflies of Peninsula Malaysia and assess the value of attaching subspecies names to DNA barcode records. A new DNA barcode library was constructed with butterflies from the Museum of Zoology, University of Malaya collection. The library was analysed in conjunction with publicly available DNA barcodes from other Asia-Pacific localities to test the ability of the DNA barcodes to discriminate species and subspecies. Analyses confirmed the capacity of the new DNA barcode reference library to distinguish the vast majority of species (92%) and revealed that most subspecies possessed unique DNA barcodes (84%). In some cases conspecific subspecies exhibited genetic distances between their DNA barcodes that are typically seen between species, and these were often taxa that have previously been regarded as full species. Subspecies designations as shorthand for geographically and morphologically differentiated groups provide a useful heuristic for assessing how such groups correlate with clustering patterns of DNA barcodes, especially as the number of DNA barcodes per species in reference libraries increases. Our study demonstrates the value in attaching subspecies names to DNA barcode records as they can reveal a history of taxonomic concepts and expose important units of biodiversity. PMID:24282514
Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.
Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W
2005-01-01
Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.
Xu, Chao; Dong, Wenpan; Shi, Shuo; Cheng, Tao; Li, Changhao; Liu, Yanlei; Wu, Ping; Wu, Hongkun; Gao, Peng; Zhou, Shiliang
2015-11-01
A well-covered reference library is crucial for successful identification of species by DNA barcoding. The biggest difficulty in building such a reference library is the lack of materials of organisms. Herbarium collections are potentially an enormous resource of materials. In this study, we demonstrate that it is likely to build such reference libraries using the reconstructed (self-primed PCR amplified) DNA from the herbarium specimens. We used 179 rosaceous specimens to test the effects of DNA reconstruction, 420 randomly sampled specimens to estimate the usable percentage and another 223 specimens of true cherries (Cerasus, Rosaceae) to test the coverage of usable specimens to the species. The barcode rbcLb (the central four-sevenths of rbcL gene) and matK was each amplified in two halves and sequenced on Roche GS 454 FLX+. DNA from the herbarium specimens was typically shorter than 300 bp. DNA reconstruction enabled amplification fragments of 400-500 bp without bringing or inducing any sequence errors. About one-third of specimens in the national herbarium of China (PE) were proven usable after DNA reconstruction. The specimens in PE cover all Chinese true cherry species and 91.5% of vascular species listed in Flora of China. It is very possible to build well-covered reference libraries for DNA barcoding of vascular species in China. As exemplified in this study, DNA reconstruction and DNA-labelled next-generation sequencing can accelerate the construction of local reference libraries. By putting the local reference libraries together, a global library for DNA barcoding becomes closer to reality. © 2015 John Wiley & Sons Ltd.
Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J
2017-01-11
We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.
Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.
1994-01-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934
Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L
1994-05-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.
Lam, Kathy N; Charles, Trevor C
2015-01-01
Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.
Application of Biocatalysis to on-DNA Carbohydrate Library Synthesis.
Thomas, Baptiste; Lu, Xiaojie; Birmingham, William R; Huang, Kun; Both, Peter; Reyes Martinez, Juana Elizabeth; Young, Robert J; Davie, Christopher P; Flitsch, Sabine L
2017-05-04
DNA-encoded libraries are increasingly used for the discovery of bioactive lead compounds in high-throughput screening programs against specific biological targets. Although a number of libraries are now available, they cover limited chemical space due to bias in ease of synthesis and the lack of chemical reactions that are compatible with DNA tagging. For example, compound libraries rarely contain complex biomolecules such as carbohydrates with high levels of functionality, stereochemistry, and hydrophilicity. By using biocatalysis in combination with chemical methods, we aimed to significantly expand chemical space and generate generic libraries with potentially better biocompatibility. For DNA-encoded libraries, biocatalysis is particularly advantageous, as it is highly selective and can be performed in aqueous environments, which is an essential feature for this split-and-mix library technology. In this work, we demonstrated the application of biocatalysis for the on-DNA synthesis of carbohydrate-based libraries by using enzymatic oxidation and glycosylation in combination with traditional organic chemistry. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting
2014-09-01
Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.
Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.
2004-01-01
We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987
cDNA library construction of two human Demodexspecies.
Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao
2017-06-01
The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.
Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.
Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero
2003-09-01
The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.
Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...
Molecular architecture of classical cytological landmarks: Centromeres and telomeres
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meyne, J.
1994-11-01
Both the human telomere repeat and the pericentromeric repeat sequence (GGAAT)n were isolated based on evolutionary conservation. Their isolation was based on the premise that chromosomal features as structurally and functionally important as telomeres and centromeres should be highly conserved. Both sequences were isolated by high stringency screening of a human repetitive DNA library with rodent repetitive DNA. The pHuR library (plasmid Human Repeat) used for this project was enriched for repetitive DNA by using a modification of the standard DNA library preparation method. Usually DNA for a library is cut with restriction enzymes, packaged, infected, and the library ismore » screened. A problem with this approach is that many tandem repeats don`t have any (or many) common restriction sites. Therefore, many of the repeat sequences will not be represented in the library because they are not restricted to a viable length for the vector used. To prepare the pHuR library, human DNA was mechanically sheared to a small size. These relatively short DNA fragments were denatured and then renatured to C{sub o}t 50. Theoretically only repetitive DNA sequences should renature under C{sub o}t 50 conditions. The single-stranded regions were digested using S1 nuclease, leaving the double-stranded, renatured repeat sequences.« less
Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar
2018-05-17
Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G
2005-10-01
The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.
Berns, K. I.; Rose, J. A.
1970-01-01
Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749
Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong
2003-07-01
Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.
Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.
Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B
2004-12-15
cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.
Construction of BAC Libraries from Flow-Sorted Chromosomes.
Šafář, Jan; Šimková, Hana; Doležel, Jaroslav
2016-01-01
Cloned DNA libraries in bacterial artificial chromosome (BAC) are the most widely used form of large-insert DNA libraries. BAC libraries are typically represented by ordered clones derived from genomic DNA of a particular organism. In the case of large eukaryotic genomes, whole-genome libraries consist of a hundred thousand to a million clones, which make their handling and screening a daunting task. The labor and cost of working with whole-genome libraries can be greatly reduced by constructing a library derived from a smaller part of the genome. Here we describe construction of BAC libraries from mitotic chromosomes purified by flow cytometric sorting. Chromosome-specific BAC libraries facilitate positional gene cloning, physical mapping, and sequencing in complex plant genomes.
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Aigrain, Louise; Gu, Yong; Quail, Michael A
2016-06-13
The emergence of next-generation sequencing (NGS) technologies in the past decade has allowed the democratization of DNA sequencing both in terms of price per sequenced bases and ease to produce DNA libraries. When it comes to preparing DNA sequencing libraries for Illumina, the current market leader, a plethora of kits are available and it can be difficult for the users to determine which kit is the most appropriate and efficient for their applications; the main concerns being not only cost but also minimal bias, yield and time efficiency. We compared 9 commercially available library preparation kits in a systematic manner using the same DNA sample by probing the amount of DNA remaining after each protocol steps using a new droplet digital PCR (ddPCR) assay. This method allows the precise quantification of fragments bearing either adaptors or P5/P7 sequences on both ends just after ligation or PCR enrichment. We also investigated the potential influence of DNA input and DNA fragment size on the final library preparation efficiency. The overall library preparations efficiencies of the libraries show important variations between the different kits with the ones combining several steps into a single one exhibiting some final yields 4 to 7 times higher than the other kits. Detailed ddPCR data also reveal that the adaptor ligation yield itself varies by more than a factor of 10 between kits, certain ligation efficiencies being so low that it could impair the original library complexity and impoverish the sequencing results. When a PCR enrichment step is necessary, lower adaptor-ligated DNA inputs leads to greater amplification yields, hiding the latent disparity between kits. We describe a ddPCR assay that allows us to probe the efficiency of the most critical step in the library preparation, ligation, and to draw conclusion on which kits is more likely to preserve the sample heterogeneity and reduce the need of amplification.
Manlig, Erika; Wahlberg, Per
2017-01-01
Abstract Sodium bisulphite treatment of DNA combined with next generation sequencing (NGS) is a powerful combination for the interrogation of genome-wide DNA methylation profiles. Library preparation for whole genome bisulphite sequencing (WGBS) is challenging due to side effects of the bisulphite treatment, which leads to extensive DNA damage. Recently, a new generation of methods for bisulphite sequencing library preparation have been devised. They are based on initial bisulphite treatment of the DNA, followed by adaptor tagging of single stranded DNA fragments, and enable WGBS using low quantities of input DNA. In this study, we present a novel approach for quick and cost effective WGBS library preparation that is based on splinted adaptor tagging (SPLAT) of bisulphite-converted single-stranded DNA. Moreover, we validate SPLAT against three commercially available WGBS library preparation techniques, two of which are based on bisulphite treatment prior to adaptor tagging and one is a conventional WGBS method. PMID:27899585
A Fast Solution to NGS Library Prep with Low Nanogram DNA Input
Liu, Pingfang; Lohman, Gregory J.S.; Cantor, Eric; Langhorst, Bradley W.; Yigit, Erbay; Apone, Lynne M.; Munafo, Daniela B.; Stewart, Fiona J.; Evans, Thomas C.; Nichols, Nicole; Dimalanta, Eileen T.; Davis, Theodore B.; Sumner, Christine
2013-01-01
Next Generation Sequencing (NGS) has significantly impacted human genetics, enabling a comprehensive characterization of the human genome as well as a better understanding of many genomic abnormalities. By delivering massive DNA sequences at unprecedented speed and cost, NGS promises to make personalized medicine a reality in the foreseeable future. To date, library construction with clinical samples has been a challenge, primarily due to the limited quantities of sample DNA available. Our objective here was to overcome this challenge by developing NEBNext® Ultra DNA Library Prep Kit, a fast library preparation method. Specifically, we streamlined the workflow utilizing novel NEBNext reagents and adaptors, including a new DNA polymerase that has been optimized to minimize GC bias. As a result of this work, we have developed a simple method for library construction from an amount of DNA as low as 5 ng, which can be used for both intact and fragmented DNA. Moreover, the workflow is compatible with multiple NGS platforms.
Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.
Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi
2003-03-01
A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.
Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.
Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin
2012-09-15
A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.
Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel
2007-04-10
For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
NASA Astrophysics Data System (ADS)
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].
Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C
2017-04-12
Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.
[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].
Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping
2005-03-01
To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Complementation of a red-light-indifferent cyanobacterial mutant.
Chiang, G G; Schaefer, M R; Grossman, A R
1992-01-01
Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650
A Glimpse into the Satellite DNA Library in Characidae Fish (Teleostei, Characiformes)
Utsunomia, Ricardo; Ruiz-Ruano, Francisco J.; Silva, Duílio M. Z. A.; Serrano, Érica A.; Rosa, Ivana F.; Scudeler, Patrícia E. S.; Hashimoto, Diogo T.; Oliveira, Claudio; Camacho, Juan Pedro M.; Foresti, Fausto
2017-01-01
Satellite DNA (satDNA) is an abundant fraction of repetitive DNA in eukaryotic genomes and plays an important role in genome organization and evolution. In general, satDNA sequences follow a concerted evolutionary pattern through the intragenomic homogenization of different repeat units. In addition, the satDNA library hypothesis predicts that related species share a series of satDNA variants descended from a common ancestor species, with differential amplification of different satDNA variants. The finding of a same satDNA family in species belonging to different genera within Characidae fish provided the opportunity to test both concerted evolution and library hypotheses. For this purpose, we analyzed here sequence variation and abundance of this satDNA family in ten species, by a combination of next generation sequencing (NGS), PCR and Sanger sequencing, and fluorescence in situ hybridization (FISH). We found extensive between-species variation for the number and size of pericentromeric FISH signals. At genomic level, the analysis of 1000s of DNA sequences obtained by Illumina sequencing and PCR amplification allowed defining 150 haplotypes which were linked in a common minimum spanning tree, where different patterns of concerted evolution were apparent. This also provided a glimpse into the satDNA library of this group of species. In consistency with the library hypothesis, different variants for this satDNA showed high differences in abundance between species, from highly abundant to simply relictual variants. PMID:28855916
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Polishing the craft of genetic diversity creation in directed evolution.
Tee, Kang Lan; Wong, Tuck Seng
2013-12-01
Genetic diversity creation is a core technology in directed evolution where a high quality mutant library is crucial to its success. Owing to its importance, the technology in genetic diversity creation has seen rapid development over the years and its application has diversified into other fields of scientific research. The advances in molecular cloning and mutagenesis since 2008 were reviewed. Specifically, new cloning techniques were classified based on their principles of complementary overhangs, homologous sequences, overlapping PCR and megaprimers and the advantages, drawbacks and performances of these methods were highlighted. New mutagenesis methods developed for random mutagenesis, focused mutagenesis and DNA recombination were surveyed. The technical requirements of these methods and the mutational spectra were compared and discussed with references to commonly used techniques. The trends of mutant library preparation were summarised. Challenges in genetic diversity creation were discussed with emphases on creating "smart" libraries, controlling the mutagenesis spectrum and specific challenges in each group of mutagenesis methods. An outline of the wider applications of genetic diversity creation includes genome engineering, viral evolution, metagenomics and a study of protein functions. The review ends with an outlook for genetic diversity creation and the prospective developments that can have future impact in this field. © 2013. Published by Elsevier Inc. All rights reserved.
Novel selection methods for DNA-encoded chemical libraries
Chan, Alix I.; McGregor, Lynn M.; Liu, David R.
2015-01-01
Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. PMID:25723146
Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy
2014-10-09
A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.
Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.
Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun
2008-03-15
This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.
Sensitive detection of multiple pathogens using a single DNA probe.
Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh
2016-12-15
A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.
The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Two Years on: Koha 3.0 in Use at the CAMLIS Library, Royal London Homoeopathic Hospital
ERIC Educational Resources Information Center
Bissels, Gerhard; Chandler, Andrea
2010-01-01
Purpose: The purpose of this paper is to describe the further development of the Koha 3.0 library management system (LMS) and the involvement of external software consultants at the Complementary and Alternative Medicine Library and Information Service (CAMLIS), Royal London Homoeopathic Hospital. Design/methodology/approach: The paper takes the…
Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching
2008-01-01
C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the
Development and Synthesis of DNA-Encoded Benzimidazole Library.
Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A
2018-04-25
Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.
1997-01-01
A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.
Shariati, Mohsen
2018-05-15
In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.
Caruccio, Nicholas
2011-01-01
DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.
Novel selection methods for DNA-encoded chemical libraries.
Chan, Alix I; McGregor, Lynn M; Liu, David R
2015-06-01
Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.
Kilimann, M W; DeGennaro, L J
1985-01-01
To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975
Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries
NASA Astrophysics Data System (ADS)
Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.
2017-02-01
The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber, to reanneal the reshuffled library. In the binding chamber (the cooled chamber) specific retaining structures are integrated. These hold back beads functionalized with the target protein, while the chamber is continuously flushed with library molecules. Afterwards the whole system can be flushed with buffer to wash out unspecific bound molecules. Finally the protein-loaded beads with attached molecules can be eluted for further investigation.
A method for high-throughput production of sequence-verified DNA libraries and strain collections.
Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P
2017-02-13
The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens.
Saeidi, Saman; McKain, Michael R; Kellogg, Elizabeth A
2018-03-08
Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.
Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie
2015-06-01
Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.
A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.
Liu, Ziping; Su, Xingguang
2017-01-15
In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima
1998-03-01
An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.
Ligation Bias in Illumina Next-Generation DNA Libraries: Implications for Sequencing Ancient Genomes
Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel; Stagegaard, Julia; Alberdi, Maria T.; Prado, José Luis; Prieto, Alfredo; Willerslev, Eske; Orlando, Ludovic
2013-01-01
Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries. PMID:24205269
Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism
Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang
2013-01-01
Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972
Yang, Wanggui; Chen, Yali; Wong, Man Shing; Lo, Pik Kwan
2012-10-08
One of the most important criteria for the successful DNA-templated polymerization to generate fully synthetic biomimetic polymers is to design the complementary structural monomers, which assemble to the templates strongly and precisely before carrying polymerization. In this study, water-soluble, laterally thymine-substituted donor-acceptor π-conjugated molecules were designed and synthesized to self-assemble with complementary oligoadenines templates, dA(20) and dA(40), into stable and tubular assemblies through noncovalent interactions including π-π stacking, dipole-dipole interactions, and the complementary adenine-thymine (A-T) hydrogen-bonding. UV-vis, fluorescence, circular dichroism (CD), atomic force microscopy (AFM), and transmission electron microscopy (TEM) techniques were used to investigate the formation of highly robust nanofibrous structures. Our results have demonstrated for the first time that the dipole-dipole interactions are stronger and useful to reinforce the assembly of donor-acceptor π-conjugated molecules to DNA templates and the formation of the stable and robust supramolecular nanofibrous complexes together with the complementary hydrogen bonding interactions. This provides an initial step toward DNA-templated polymerization to create fully synthetic DNA-mimetic polymers for biotechnological applications. This study also presents an opportunity to precisely position donor-acceptor type molecules in a controlled manner and tailor-make advanced materials for various biotechnological applications.
Satz, Alexander L; Hochstrasser, Remo; Petersen, Ann C
2017-04-10
To optimize future DNA-encoded library design, we have attempted to quantify the library size at which the signal becomes undetectable. To accomplish this we (i) have calculated that percent yields of individual library members following a screen range from 0.002 to 1%, (ii) extrapolated that ∼1 million copies per library member are required at the outset of a screen, and (iii) from this extrapolation predict that false negative rates will begin to outweigh the benefit of increased diversity at library sizes >10 8 . The above analysis is based upon a large internal data set comprising multiple screens, targets, and libraries; we also augmented our internal data with all currently available literature data. In theory, high false negative rates may be overcome by employing larger amounts of library; however, we argue that using more than currently reported amounts of library (≫10 nmoles) is impractical. The above conclusions may be generally applicable to other DNA encoded library platforms, particularly those platforms that do not allow for library amplification.
A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.
Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza
2016-08-15
In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.
2001-01-01
The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645
Information Literacy and Digital Literacy: Competing or Complementary?
ERIC Educational Resources Information Center
Cordell, Rosanne Marie
2013-01-01
Digital literacy is a more recent concept than information literacy and can relate to multiple categories of library users in multiple types of libraries. Determining the relationship between information literacy and digital literacy is essential before revision of the ACRL "Standards" can proceed.
Twenty-five Years of DNA-Encoded Chemical Libraries.
Neri, Dario
2017-05-04
Reference library: The availability of DNA-encoded chemical libraries containing billions of compounds facilitates the discovery of binding molecules for pharmaceutical applications and for investigating biological processes. This Special Issue highlights the use of this library technology and some of the latest developments in the field. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Optimized Reaction Conditions for Amide Bond Formation in DNA-Encoded Combinatorial Libraries.
Li, Yizhou; Gabriele, Elena; Samain, Florent; Favalli, Nicholas; Sladojevich, Filippo; Scheuermann, Jörg; Neri, Dario
2016-08-08
DNA-encoded combinatorial libraries are increasingly being used as tools for the discovery of small organic binding molecules to proteins of biological or pharmaceutical interest. In the majority of cases, synthetic procedures for the formation of DNA-encoded combinatorial libraries incorporate at least one step of amide bond formation between amino-modified DNA and a carboxylic acid. We investigated reaction conditions and established a methodology by using 1-ethyl-3-(3-(dimethylamino)propyl)carbodiimide, 1-hydroxy-7-azabenzotriazole and N,N'-diisopropylethylamine (EDC/HOAt/DIPEA) in combination, which provided conversions greater than 75% for 423/543 (78%) of the carboxylic acids tested. These reaction conditions were efficient with a variety of primary and secondary amines, as well as with various types of amino-modified oligonucleotides. The reaction conditions, which also worked efficiently over a broad range of DNA concentrations and reaction scales, should facilitate the synthesis of novel DNA-encoded combinatorial libraries.
Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim
2016-04-01
The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.
Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.
Danhorn, Thomas; Young, Curtis R; DeLong, Edward F
2012-11-01
The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.
Display of a maize cDNA library on baculovirus infected insect cells.
Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A
2008-08-12
Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.
Preparation of fosmid libraries and functional metagenomic analysis of microbial community DNA.
Martínez, Asunción; Osburne, Marcia S
2013-01-01
One of the most important challenges in contemporary microbial ecology is to assign a functional role to the large number of novel genes discovered through large-scale sequencing of natural microbial communities that lack similarity to genes of known function. Functional screening of metagenomic libraries, that is, screening environmental DNA clones for the ability to confer an activity of interest to a heterologous bacterial host, is a promising approach for bridging the gap between metagenomic DNA sequencing and functional characterization. Here, we describe methods for isolating environmental DNA and constructing metagenomic fosmid libraries, as well as methods for designing and implementing successful functional screens of such libraries. © 2013 Elsevier Inc. All rights reserved.
Trebitz, Anett S; Hoffman, Joel C; Grant, George W; Billehus, Tyler M; Pilgrim, Erik M
2015-07-22
DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.
NASA Astrophysics Data System (ADS)
Trebitz, Anett S.; Hoffman, Joel C.; Grant, George W.; Billehus, Tyler M.; Pilgrim, Erik M.
2015-07-01
DNA-based identification of mixed-organism samples offers the potential to greatly reduce the need for resource-intensive morphological identification, which would be of value both to bioassessment and non-native species monitoring. The ability to assign species identities to DNA sequences found depends on the availability of comprehensive DNA reference libraries. Here, we compile inventories for aquatic metazoans extant in or threatening to invade the Laurentian Great Lakes and examine the availability of reference mitochondrial COI DNA sequences (barcodes) in the Barcode of Life Data System for them. We found barcode libraries largely complete for extant and threatening-to-invade vertebrates (100% of reptile, 99% of fish, and 92% of amphibian species had barcodes). In contrast, barcode libraries remain poorly developed for precisely those organisms where morphological identification is most challenging; 46% of extant invertebrates lacked reference barcodes with rates especially high among rotifers, oligochaetes, and mites. Lack of species-level identification for many aquatic invertebrates also is a barrier to matching DNA sequences with physical specimens. Attaining the potential for DNA-based identification of mixed-organism samples covering the breadth of aquatic fauna requires a concerted effort to build supporting barcode libraries and voucher collections.
Easy preparation of a large-size random gene mutagenesis library in Escherichia coli.
You, Chun; Percival Zhang, Y-H
2012-09-01
A simple and fast protocol for the preparation of a large-size mutant library for directed evolution in Escherichia coli was developed based on the DNA multimers generated by prolonged overlap extension polymerase chain reaction (POE-PCR). This protocol comprised the following: (i) a linear DNA mutant library was generated by error-prone PCR or shuffling, and a linear vector backbone was prepared by regular PCR; (ii) the DNA multimers were generated based on these two DNA templates by POE-PCR; and (iii) the one restriction enzyme-digested DNA multimers were ligated to circular plasmids, followed by transformation to E. coli. Because the ligation efficiency of one DNA fragment was several orders of magnitude higher than that of two DNA fragments for typical mutant library construction, it was very easy to generate a mutant library with a size of more than 10(7) protein mutants per 50 μl of the POE-PCR product. Via this method, four new fluorescent protein mutants were obtained based on monomeric cherry fluorescent protein. This new protocol was simple and fast because it did not require labor-intensive optimizations in restriction enzyme digestion and ligation, did not involve special plasmid design, and enabled constructing a large-size mutant library for directed enzyme evolution within 1 day. Copyright © 2012 Elsevier Inc. All rights reserved.
DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.
Du, Huang-Chi; Huang, Hongbing
2017-10-18
DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.
Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping
2013-01-14
In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I
2015-12-14
DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.
Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter
2009-10-01
Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.
Audiovisual in Libraries; the Past.
ERIC Educational Resources Information Center
Clement, Evelyn G.
By the first decade of the twentieth century, libraries were collecting pictures, post cards, clippings, recordings, music rolls, and stereographs. Circulation of these materials was often restricted, however. A number of progressive librarians stressed the acceptance of nonprinted materials as complementary to the book medium to the library…
Robust Sub-nanomolar Library Preparation for High Throughput Next Generation Sequencing.
Wu, Wells W; Phue, Je-Nie; Lee, Chun-Ting; Lin, Changyi; Xu, Lai; Wang, Rong; Zhang, Yaqin; Shen, Rong-Fong
2018-05-04
Current library preparation protocols for Illumina HiSeq and MiSeq DNA sequencers require ≥2 nM initial library for subsequent loading of denatured cDNA onto flow cells. Such amounts are not always attainable from samples having a relatively low DNA or RNA input; or those for which a limited number of PCR amplification cycles is preferred (less PCR bias and/or more even coverage). A well-tested sub-nanomolar library preparation protocol for Illumina sequencers has however not been reported. The aim of this study is to provide a much needed working protocol for sub-nanomolar libraries to achieve outcomes as informative as those obtained with the higher library input (≥ 2 nM) recommended by Illumina's protocols. Extensive studies were conducted to validate a robust sub-nanomolar (initial library of 100 pM) protocol using PhiX DNA (as a control), genomic DNA (Bordetella bronchiseptica and microbial mock community B for 16S rRNA gene sequencing), messenger RNA, microRNA, and other small noncoding RNA samples. The utility of our protocol was further explored for PhiX library concentrations as low as 25 pM, which generated only slightly fewer than 50% of the reads achieved under the standard Illumina protocol starting with > 2 nM. A sub-nanomolar library preparation protocol (100 pM) could generate next generation sequencing (NGS) results as robust as the standard Illumina protocol. Following the sub-nanomolar protocol, libraries with initial concentrations as low as 25 pM could also be sequenced to yield satisfactory and reproducible sequencing results.
Sonet, Gontran; Jordaens, Kurt; Braet, Yves; Bourguignon, Luc; Dupont, Eréna; Backeljau, Thierry; De Meyer, Marc; Desmyter, Stijn
2013-01-01
Abstract Fly larvae living on dead corpses can be used to estimate post-mortem intervals. The identification of these flies is decisive in forensic casework and can be facilitated by using DNA barcodes provided that a representative and comprehensive reference library of DNA barcodes is available. We constructed a local (Belgium and France) reference library of 85 sequences of the COI DNA barcode fragment (mitochondrial cytochrome c oxidase subunit I gene), from 16 fly species of forensic interest (Calliphoridae, Muscidae, Fanniidae). This library was then used to evaluate the ability of two public libraries (GenBank and the Barcode of Life Data Systems – BOLD) to identify specimens from Belgian and French forensic cases. The public libraries indeed allow a correct identification of most specimens. Yet, some of the identifications remain ambiguous and some forensically important fly species are not, or insufficiently, represented in the reference libraries. Several search options offered by GenBank and BOLD can be used to further improve the identifications obtained from both libraries using DNA barcodes. PMID:24453564
Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo
2008-09-01
Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.
Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie
2015-06-01
Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
ERIC Educational Resources Information Center
Bissels, Gerhard
2008-01-01
Purpose: The purpose of this paper is to describe the selection process and criteria that led to the implementation of the Koha 3.0 library management system (LMS) at the Complementary and Alternative Medicine Library and Information Service (CAMLIS), Royal London Homoeopathic Hospital. Design/methodology/approach: The paper is a report based on…
Building a DNA barcode library of Alaska's non-marine arthropods.
Sikes, Derek S; Bowser, Matthew; Morton, John M; Bickford, Casey; Meierotto, Sarah; Hildebrandt, Kyndall
2017-03-01
Climate change may result in ecological futures with novel species assemblages, trophic mismatch, and mass extinction. Alaska has a limited taxonomic workforce to address these changes. We are building a DNA barcode library to facilitate a metabarcoding approach to monitoring non-marine arthropods. Working with the Canadian Centre for DNA Barcoding, we obtained DNA barcodes from recently collected and authoritatively identified specimens in the University of Alaska Museum (UAM) Insect Collection and the Kenai National Wildlife Refuge collection. We submitted tissues from 4776 specimens, of which 81% yielded DNA barcodes representing 1662 species and 1788 Barcode Index Numbers (BINs), of primarily terrestrial, large-bodied arthropods. This represents 84% of the species available for DNA barcoding in the UAM Insect Collection. There are now 4020 Alaskan arthropod species represented by DNA barcodes, after including all records in Barcode of Life Data Systems (BOLD) of species that occur in Alaska - i.e., 48.5% of the 8277 Alaskan, non-marine-arthropod, named species have associated DNA barcodes. An assessment of the identification power of the library in its current state yielded fewer species-level identifications than expected, but the results were not discouraging. We believe we are the first to deliberately begin development of a DNA barcode library of the entire arthropod fauna for a North American state or province. Although far from complete, this library will become increasingly valuable as more species are added and costs to obtain DNA sequences fall.
Fang, Yi-Kai; Huang, Kuo-Yang; Huang, Po-Jung; Lin, Rose; Chao, Mei; Tang, Petrus
2015-12-01
Trichomonas vaginalis is the etiologic agent of trichomoniasis, the most common nonviral sexually transmitted disease in the world. This infection affects millions of individuals worldwide annually. Although direct sexual contact is the most common mode of transmission, increasing evidence indicates that T. vaginalis can survive in the external environment and can be transmitted by contaminated utensils. We found that the growth of T. vaginalis under cold conditions is greatly inhibited, but recovers after placing these stressed cells at the normal cultivation temperature of 37 °C. However, the mechanisms by which T. vaginalis regulates this adaptive process are unclear. An expressed sequence tag (EST) database generated from a complementary DNA library of T. vaginalis messenger RNAs expressed under cold-culture conditions (4 °C, TvC) was compared with a previously published normal-cultured EST library (37 °C, TvE) to assess the cold-stress responses of T. vaginalis. A total of 9780 clones were sequenced from the TvC library and were mapped to 2934 genes in the T. vaginalis genome. A total of 1254 genes were expressed in both the TvE and TvC libraries, and 1680 genes were only found in the TvC library. A functional analysis showed that cold temperature has effects on many cellular mechanisms, including increased H2O2 tolerance, activation of the ubiquitin-proteasome system, induction of iron-sulfur cluster assembly, and reduced energy metabolism and enzyme expression. The current study is the first large-scale transcriptomic analysis in cold-stressed T. vaginalis and the results enhance our understanding of this important protist. Copyright © 2014. Published by Elsevier B.V.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James
2013-03-12
A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.
Hoople, Gordon D; Richards, Andrew; Wu, Yan; Pisano, Albert P; Zhang, Kun
2018-03-26
The ability to amplify and sequence either DNA or RNA from small starting samples has only been achieved in the last five years. Unfortunately, the standard protocols for generating genomic or transcriptomic libraries are incompatible and researchers must choose whether to sequence DNA or RNA for a particular sample. Gel-seq solves this problem by enabling researchers to simultaneously prepare libraries for both DNA and RNA starting with 100 - 1000 cells using a simple hydrogel device. This paper presents a detailed approach for the fabrication of the device as well as the biological protocol to generate paired libraries. We designed Gel-seq so that it could be easily implemented by other researchers; many genetics labs already have the necessary equipment to reproduce the Gel-seq device fabrication. Our protocol employs commonly-used kits for both whole-transcript amplification (WTA) and library preparation, which are also likely to be familiar to researchers already versed in generating genomic and transcriptomic libraries. Our approach allows researchers to bring to bear the power of both DNA and RNA sequencing on a single sample without splitting and with negligible added cost.
[Construction of large fragment metagenome library of natural mangrove soil].
Jiang, Yun-Xia; Zheng, Tian-Ling
2007-11-01
Applying our optimized direct extraction method, the percentage of large fragment DNA in the total extracted mangrove soil DNA was significant increased. The large fragment metagenome library derived from natural mangrove soil over four seasons was successfully constructed by the optimized DNA extraction and electro elution purification method. All of the clones had recombinant Cosmids and each differed in their fragment profiles when Cosmid DNA was extracted from 12 randomly picked colonies and digested with BamHI. The average insert size for this library was larger than 35 kbp. This culturing-independent library at least encompassed 335 Mbp valuable genetic information of mangrove soil microbes. It allowed mining of valuable intertidal microbial resource to become a reality. It is a recommended method for those researchers who have still not circumvented the large insert environmental libraries or for those beginning research in this field, so as to avoid them attempting repetitive, fussy work.
Neri, Dario; Lerner, Richard A
2018-06-20
The discovery of organic ligands that bind specifically to proteins is a central problem in chemistry, biology, and the biomedical sciences. The encoding of individual organic molecules with distinctive DNA tags, serving as amplifiable identification bar codes, allows the construction and screening of combinatorial libraries of unprecedented size, thus facilitating the discovery of ligands to many different protein targets. Fundamentally, one links powers of genetics and chemical synthesis. After the initial description of DNA-encoded chemical libraries in 1992, several experimental embodiments of the technology have been reduced to practice. This review provides a historical account of important milestones in the development of DNA-encoded chemical libraries, a survey of relevant ongoing research activities, and a glimpse into the future.
Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N
2014-10-17
Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.
Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario
2014-08-20
DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.
Zirconium(IV)-Catalyzed Ring Opening of on-DNA Epoxides in Water.
Fan, Lijun; Davie, Christopher P
2017-05-04
DNA-encoded library technology (ELT) has spurred wide interest in the pharmaceutical industry as a powerful tool for hit and lead generation. In recent years a number of "DNA-compatible" chemical modifications have been published and used to synthesize vastly diverse screening libraries. Herein we report a newly developed, zirconium tetrakis(dodecyl sulfate) [Zr(DS) 4 ] catalyzed ring-opening of on-DNA epoxides in water with amines, including anilines. Subsequent cyclization of the resulting on-DNA β-amino alcohols leads to a variety of biologically interesting, nonaromatic heterocycles. Under these conditions, a library of 137 million on-DNA β-amino alcohols and their cyclization products was assembled. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Validation of picogram- and femtogram-input DNA libraries for microscale metagenomics
Rinke, Christian; Low, Serene; Woodcroft, Ben J.; ...
2016-09-22
High-throughput sequencing libraries are typically limited by the requirement for nanograms to micrograms of input DNA. This bottleneck impedes the microscale analysis of ecosystems and the exploration of low biomass samples. Current methods for amplifying environmental DNA to bypass this bottleneck introduce considerable bias into metagenomic profiles. For this study, we describe and validate a simple modification of the Illumina Nextera XT DNA library preparation kit which allows creation of shotgun libraries from sub-nanogram amounts of input DNA. Community composition was reproducible down to 100 fg of input DNA based on analysis of a mock community comprising 54 phylogenetically diversemore » Bacteria and Archaea. The main technical issues with the low input libraries were a greater potential for contamination, limited DNA complexity which has a direct effect on assembly and binning, and an associated higher percentage of read duplicates. We recommend a lower limit of 1 pg (~100–1,000 microbial cells) to ensure community composition fidelity, and the inclusion of negative controls to identify reagent-specific contaminants. Applying the approach to marine surface water, pronounced differences were observed between bacterial community profiles of microliter volume samples, which we attribute to biological variation. This result is consistent with expected microscale patchiness in marine communities. We thus envision that our benchmarked, slightly modified low input DNA protocol will be beneficial for microscale and low biomass metagenomics.« less
Validation of picogram- and femtogram-input DNA libraries for microscale metagenomics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rinke, Christian; Low, Serene; Woodcroft, Ben J.
High-throughput sequencing libraries are typically limited by the requirement for nanograms to micrograms of input DNA. This bottleneck impedes the microscale analysis of ecosystems and the exploration of low biomass samples. Current methods for amplifying environmental DNA to bypass this bottleneck introduce considerable bias into metagenomic profiles. For this study, we describe and validate a simple modification of the Illumina Nextera XT DNA library preparation kit which allows creation of shotgun libraries from sub-nanogram amounts of input DNA. Community composition was reproducible down to 100 fg of input DNA based on analysis of a mock community comprising 54 phylogenetically diversemore » Bacteria and Archaea. The main technical issues with the low input libraries were a greater potential for contamination, limited DNA complexity which has a direct effect on assembly and binning, and an associated higher percentage of read duplicates. We recommend a lower limit of 1 pg (~100–1,000 microbial cells) to ensure community composition fidelity, and the inclusion of negative controls to identify reagent-specific contaminants. Applying the approach to marine surface water, pronounced differences were observed between bacterial community profiles of microliter volume samples, which we attribute to biological variation. This result is consistent with expected microscale patchiness in marine communities. We thus envision that our benchmarked, slightly modified low input DNA protocol will be beneficial for microscale and low biomass metagenomics.« less
Validation of picogram- and femtogram-input DNA libraries for microscale metagenomics
Low, Serene; Raina, Jean-Baptiste; Skarshewski, Adam; Le, Xuyen H.; Butler, Margaret K.; Stocker, Roman; Seymour, Justin; Tyson, Gene W.
2016-01-01
High-throughput sequencing libraries are typically limited by the requirement for nanograms to micrograms of input DNA. This bottleneck impedes the microscale analysis of ecosystems and the exploration of low biomass samples. Current methods for amplifying environmental DNA to bypass this bottleneck introduce considerable bias into metagenomic profiles. Here we describe and validate a simple modification of the Illumina Nextera XT DNA library preparation kit which allows creation of shotgun libraries from sub-nanogram amounts of input DNA. Community composition was reproducible down to 100 fg of input DNA based on analysis of a mock community comprising 54 phylogenetically diverse Bacteria and Archaea. The main technical issues with the low input libraries were a greater potential for contamination, limited DNA complexity which has a direct effect on assembly and binning, and an associated higher percentage of read duplicates. We recommend a lower limit of 1 pg (∼100–1,000 microbial cells) to ensure community composition fidelity, and the inclusion of negative controls to identify reagent-specific contaminants. Applying the approach to marine surface water, pronounced differences were observed between bacterial community profiles of microliter volume samples, which we attribute to biological variation. This result is consistent with expected microscale patchiness in marine communities. We thus envision that our benchmarked, slightly modified low input DNA protocol will be beneficial for microscale and low biomass metagenomics. PMID:27688978
Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut
2012-02-01
A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.
Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad
2016-01-15
In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.
Zhang, Hongyan; Lv, Jie; Jia, Zhenhong
2018-01-01
We successfully demonstrate a porous silicon (PS) double Bragg mirror by electrochemical etching at room temperature as a deoxyribonucleic acid (DNA) label-free biosensor for detecting ammonia-oxidizing bacteria (AOB). Compared to various other one-dimension photonic crystal configurations of PS, the double Bragg mirror structure is quite easy to prepare and exhibits interesting optical properties. The width of high reflectivity stop band of the PS double Bragg mirror is about 761 nm with a sharp and deep resonance peak at 1328 nm in the reflectance spectrum, which gives a high sensitivity and distinguishability for sensing performance. The detection sensitivity of such a double Bragg mirror structure is illustrated through the investigation of AOB DNA hybridization in the PS pores. The redshifts of the reflectance spectra show a good linear relationship with both complete complementary and partial complementary DNA. The lowest detection limit for complete complementary DNA is 27.1 nM and the detection limit of the biosensor for partial complementary DNA is 35.0 nM, which provides the feasibility and effectiveness for the detection of AOB in a real environment. The PS double Bragg mirror structure is attractive for widespread biosensing applications and provides great potential for the development of optical applications.
Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms
2009-05-01
base pair) Watson ‐ Crick strand pairs that bind perfectly within pairs, but poorly across pairs. A variety of DNA strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE
NASA Astrophysics Data System (ADS)
Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna
2013-03-01
We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application.
Zhong, Jian; Ye, Zhenqing; Lenz, Samuel W; Clark, Chad R; Bharucha, Adil; Farrugia, Gianrico; Robertson, Keith D; Zhang, Zhiguo; Ordog, Tamas; Lee, Jeong-Heon
2017-12-21
Chromatin immunoprecipitation-sequencing (ChIP-seq) is a widely used epigenetic approach for investigating genome-wide protein-DNA interactions in cells and tissues. The approach has been relatively well established but several key steps still require further improvement. As a part of the procedure, immnoprecipitated DNA must undergo purification and library preparation for subsequent high-throughput sequencing. Current ChIP protocols typically yield nanogram quantities of immunoprecipitated DNA mainly depending on the target of interest and starting chromatin input amount. However, little information exists on the performance of reagents used for the purification of such minute amounts of immunoprecipitated DNA in ChIP elution buffer and their effects on ChIP-seq data. Here, we compared DNA recovery, library preparation efficiency, and ChIP-seq results obtained with several commercial DNA purification reagents applied to 1 ng ChIP DNA and also investigated the impact of conditions under which ChIP DNA is stored. We compared DNA recovery of ten commercial DNA purification reagents and phenol/chloroform extraction from 1 to 50 ng of immunopreciptated DNA in ChIP elution buffer. The recovery yield was significantly different with 1 ng of DNA while similar in higher DNA amounts. We also observed that the low nanogram range of purified DNA is prone to loss during storage depending on the type of polypropylene tube used. The immunoprecipitated DNA equivalent to 1 ng of purified DNA was subject to DNA purification and library preparation to evaluate the performance of four better performing purification reagents in ChIP-seq applications. Quantification of library DNAs indicated the selected purification kits have a negligible impact on the efficiency of library preparation. The resulting ChIP-seq data were comparable with the dataset generated by ENCODE consortium and were highly correlated between the data from different purification reagents. This study provides comparative data on commercial DNA purification reagents applied to nanogram-range immunopreciptated ChIP DNA and evidence for the importance of storage conditions of low nanogram-range purified DNA. We verified consistent high performance of a subset of the tested reagents. These results will facilitate the improvement of ChIP-seq methodology for low-input applications.
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
Design and screening of M13 phage display cDNA libraries.
Georgieva, Yuliya; Konthur, Zoltán
2011-02-17
The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.
NASA Astrophysics Data System (ADS)
Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.
2018-05-01
In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.
Saunders, K; Lucy, A; Stanley, J
1991-01-01
We have analysed DNA from African cassava mosaic virus (ACMV)-infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and detected ACMV-specific DNAs by blot-hybridisation. ACMV DNA forms including the previously characterised single-stranded, open-circular, linear and supercoiled DNAs along with five previously uncharacterised heterogeneous DNAs (H1-H5) were resolved. The heterogeneous DNAs were characterised by their chromatographic properties on BND-cellulose and their ability to hybridise to strand-specific and double-stranded probes. The data suggest a rolling circle mechanism of DNA replication, based on the sizes and strand specificity of the heterogeneous single-stranded DNA forms and their electrophoretic properties in relation to genome length single-stranded DNAs. Second-strand synthesis on a single-stranded virus-sense template is evident from the position of heterogeneous subgenomic complementary-sense DNA (H3) associated with genome-length virus-sense template (VT) DNA. The position of heterogeneous virus-sense DNA (H5), ranging in size from one to two genome lengths, is consistent with its association with genome-length complementary-sense template (CT) DNA, reflecting virus-sense strand displacement during replication from a double-stranded intermediate. The absence of subgenomic complementary-sense DNA associated with the displaced virus-sense strand suggests that replication proceeds via an obligate single-stranded intermediate. The other species of heterogeneous DNAs comprised concatemeric single-stranded virus-sense DNA (H4), and double-stranded or partially single-stranded DNA (H1 and H2). Images PMID:2041773
Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.
Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J
2008-10-15
The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.
Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori
2011-01-01
Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
Open resource metagenomics: a model for sharing metagenomic libraries.
Neufeld, J D; Engel, K; Cheng, J; Moreno-Hagelsieb, G; Rose, D R; Charles, T C
2011-11-30
Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM(2)BL [1]). The CM(2)BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project.
Open resource metagenomics: a model for sharing metagenomic libraries
Neufeld, J.D.; Engel, K.; Cheng, J.; Moreno-Hagelsieb, G.; Rose, D.R.; Charles, T.C.
2011-01-01
Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM2BL [1]). The CM2BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project. PMID:22180823
Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud
2017-11-01
The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.
Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi
2016-04-15
The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.
PuLSE: Quality control and quantification of peptide sequences explored by phage display libraries.
Shave, Steven; Mann, Stefan; Koszela, Joanna; Kerr, Alastair; Auer, Manfred
2018-01-01
The design of highly diverse phage display libraries is based on assumption that DNA bases are incorporated at similar rates within the randomized sequence. As library complexity increases and expected copy numbers of unique sequences decrease, the exploration of library space becomes sparser and the presence of truly random sequences becomes critical. We present the program PuLSE (Phage Library Sequence Evaluation) as a tool for assessing randomness and therefore diversity of phage display libraries. PuLSE runs on a collection of sequence reads in the fastq file format and generates tables profiling the library in terms of unique DNA sequence counts and positions, translated peptide sequences, and normalized 'expected' occurrences from base to residue codon frequencies. The output allows at-a-glance quantitative quality control of a phage library in terms of sequence coverage both at the DNA base and translated protein residue level, which has been missing from toolsets and literature. The open source program PuLSE is available in two formats, a C++ source code package for compilation and integration into existing bioinformatics pipelines and precompiled binaries for ease of use.
Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas
2009-06-01
The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.
Gadkar, Vijay J; Filion, Martin
2013-06-01
In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.
[Current applications of high-throughput DNA sequencing technology in antibody drug research].
Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong
2012-03-01
Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.
Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit
2018-01-01
Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.
Wu, Youjia; Wang, Lei; Zhou, Mei; Ma, Chengbang; Chen, Xiaole; Bai, Bing; Chen, Tianbao; Shaw, Chris
2011-06-01
Amphibian skin secretions are rich sources of biologically-active peptides with antimicrobial peptides predominating in many species. Several studies involving molecular cloning of biosynthetic precursor-encoding cDNAs from skin or skin secretions have revealed that these exhibit highly-conserved domain architectures with an unusually high degree of conserved nucleotide and resultant amino acid sequences within the signal peptides. This high degree of nucleotide sequence conservation has permitted the design of primers complementary to such sites facilitating "shotgun" cloning of skin or skin secretion-derived cDNA libraries from hitherto unstudied species. Here we have used such an approach using a skin secretion-derived cDNA library from an unstudied species of Chinese frog - the Fujian large-headed frog, Limnonectes fujianensis - and have discovered two 16-mer peptides of novel primary structures, named limnonectin-1Fa (SFPFFPPGICKRLKRC) and limnonectin-1Fb (SFHVFPPWMCKSLKKC), that represent the prototypes of a new class of amphibian skin antimicrobial peptide. Unusually these limnonectins display activity only against a Gram-negative bacterium (MICs of 35 and 70 μM) and are devoid of haemolytic activity at concentrations up to 160 μM. Thus the "shotgun" cloning approach described can exploit the unusually high degree of nucleotide conservation in signal peptide-encoding domains of amphibian defensive skin secretion peptide precursor-encoding cDNAs to rapidly expedite the discovery of novel and functional defensive peptides in a manner that circumvents specimen sacrifice without compromising robustness of data. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Chen, Juan; Zhu, Tianjiao; Li, Dehai; Cui, Chengbin; Fang, Yuchun; Liu, Hongbing; Liu, Peipei; Gu, Qianqun; Zhu, Weiming
2006-04-01
To study the bioactive metabolites produced by sponge-derived uncultured symbionts, a metagenomic DNA library of the symbionts of sponge Gelliodes gracilis was constructed. The average size of DNA inserts in the library was 20 kb. This library was screened for antibiotic activity using paper dise assaying. Two clones displayed the antibacterial activity against Micrococcus tetragenus. The metabolites of these two clones were analyzed through HPLC. The result showed that their metabolites were quite different from those of the host E. coli DH5α and the host containing vector pHZ132. This study may present a new approach to exploring bioactive metabolites of sponge symbionts.
Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo
2011-07-21
Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011
LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.
2010-01-01
We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161
Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library
Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.
2013-01-01
A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Jones, Josette; Harris, Marcelline; Bagley-Thompson, Cheryl; Root, Jane
2003-01-01
This poster describes the development of user-centered interfaces in order to extend the functionality of the Virginia Henderson International Nursing Library (VHINL) from library to web based portal to nursing knowledge resources. The existing knowledge structure and computational models are revised and made complementary. Nurses' search behavior is captured and analyzed, and the resulting search models are mapped to the revised knowledge structure and computational model.
Recent advances on the encoding and selection methods of DNA-encoded chemical library.
Shi, Bingbing; Zhou, Yu; Huang, Yiran; Zhang, Jianfu; Li, Xiaoyu
2017-02-01
DNA-encoded chemical library (DEL) has emerged as a powerful and versatile tool for ligand discovery in chemical biology research and in drug discovery. Encoding and selection methods are two of the most important technological aspects of DEL that can dictate the performance and utilities of DELs. In this digest, we have summarized recent advances on the encoding and selection strategies of DEL and also discussed the latest developments on DNA-encoded dynamic library, a new frontier in DEL research. Copyright © 2016 Elsevier Ltd. All rights reserved.
Jiao, Lichao; Yu, Min; Wiedenhoeft, Alex C; He, Tuo; Li, Jianing; Liu, Bo; Jiang, Xiaomei; Yin, Yafang
2018-01-31
DNA barcoding has been proposed as a useful tool for forensic wood identification and development of a reliable DNA reference library is an essential first step. Xylaria (wood collections) are potentially enormous data repositories if DNA information could be extracted from wood specimens. In this study, 31 xylarium wood specimens and 8 leaf specimens of six important commercial species of Pterocarpus were selected to investigate the reliability of DNA barcodes for authentication at the species level and to determine the feasibility of building wood DNA barcode reference libraries from xylarium specimens. Four DNA barcodes (ITS2, matK, ndhF-rpl32 and rbcL) and their combination were tested to evaluate their discrimination ability for Pterocarpus species with both TaxonDNA and tree-based analytical methods. The results indicated that the combination barcode of matK + ndhF-rpl32 + ITS2 yielded the best discrimination for the Pterocarpus species studied. The mini-barcode ndhF-rpl32 (167-173 bps) performed well distinguishing P. santalinus from its wood anatomically inseparable species P. tinctorius. Results from this study verified not only the feasibility of building DNA barcode libraries using xylarium wood specimens, but the importance of using wood rather than leaves as the source tissue, when wood is the botanical material to be identified.
NASA Astrophysics Data System (ADS)
Litovchick, Alexander; Dumelin, Christoph E.; Habeshian, Sevan; Gikunju, Diana; Guié, Marie-Aude; Centrella, Paolo; Zhang, Ying; Sigel, Eric A.; Cuozzo, John W.; Keefe, Anthony D.; Clark, Matthew A.
2015-06-01
A chemical ligation method for construction of DNA-encoded small-molecule libraries has been developed. Taking advantage of the ability of the Klenow fragment of DNA polymerase to accept templates with triazole linkages in place of phosphodiesters, we have designed a strategy for chemically ligating oligonucleotide tags using cycloaddition chemistry. We have utilized this strategy in the construction and selection of a small molecule library, and successfully identified inhibitors of the enzyme soluble epoxide hydrolase.
A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics
ERIC Educational Resources Information Center
Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.
2012-01-01
We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…
Shuffle Optimizer: A Program to Optimize DNA Shuffling for Protein Engineering.
Milligan, John N; Garry, Daniel J
2017-01-01
DNA shuffling is a powerful tool to develop libraries of variants for protein engineering. Here, we present a protocol to use our freely available and easy-to-use computer program, Shuffle Optimizer. Shuffle Optimizer is written in the Python computer language and increases the nucleotide homology between two pieces of DNA desired to be shuffled together without changing the amino acid sequence. In addition we also include sections on optimal primer design for DNA shuffling and library construction, a small-volume ultrasonicator method to create sheared DNA, and finally a method to reassemble the sheared fragments and recover and clone the library. The Shuffle Optimizer program and these protocols will be useful to anyone desiring to perform any of the nucleotide homology-dependent shuffling methods.
Ahn, Seong Kyu; Cho, Pyo Yun; Na, Byoung-Kuk; Hong, Sung-Jong; Nam, Ho-Woo; Sohn, Woon-Mok; Ardelli, Bernadette F; Park, Yun-Kyu; Kim, Tong-Soo; Cha, Seok Ho
2016-01-01
A complementary DNA (cDNA) encoding a glucose transporter of Clonorchis sinensis (CsGLUT) was isolated from the adult C. sinensis cDNA library. The open reading frame of CsGLUT cDNA consists of 1653 base pairs that encode a 550-amino acid residue protein. Hydropathy analysis suggested that CsGLUT possess 12 putative membrane-spanning domains. The Northern blot analysis result using poly(A)(+)RNA showed a strong band at ~2.1 kb for CsGLUT. When expressed in Xenopus oocytes, CsGLUT mediated the transport of radiolabeled deoxy-D-glucose in a time-dependent but sodium-independent manner. Concentration-dependency results showed saturable kinetics and followed the Michaelis-Menten equation. Nonlinear regression analyses yielded a Km value of 588.5 ± 53.0 μM and a Vmax value of 1500.0 ± 67.5 pmol/oocyte/30 min for [1,2-(3)H]2-deoxy-D-glucose. No trans-uptakes of bile acid (taurocholic acid), amino acids (tryptophan and arginine), or p-aminohippuric acid were observed. CsGLUT-mediated transport of deoxyglucose was significantly and concentration-dependently inhibited by radio-unlabeled deoxyglucose and D-glucose. 3-O-Methylglucose at 10 and 100 μM inhibited deoxyglucose uptake by ~50 % without concentration dependence. No inhibitory effects by galactose, mannose, and fructose were observed. This work may contribute to the molecular biological study of carbohydrate metabolism and new drug development of C. sinensis.
Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.
Odelberg, S J; Weiss, R B; Hata, A; White, R
1995-01-01
Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836
Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong
2013-04-08
Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.
ERIC Educational Resources Information Center
Lowry, Glenn R.
The derivation of the concept of participative management from a variety of complementary managerial and motivational theories, and its acceptance and use as a managerial technique in library administration are reviewed in detail. The major contributions to the development of the concept of participative management, including Maslow's hierarchy of…
Satz, Alexander L
2016-07-11
Simulated screening of DNA encoded libraries indicates that the presence of truncated byproducts complicates the relationship between library member enrichment and equilibrium association constant (these truncates result from incomplete chemical reactions during library synthesis). Further, simulations indicate that some patterns observed in reported experimental data may result from the presence of truncated byproducts in the library mixture and not structure-activity relationships. Potential experimental methods of minimizing the presence of truncates are assessed via simulation; the relationship between enrichment and equilibrium association constant for libraries of differing purities is investigated. Data aggregation techniques are demonstrated that allow for more accurate analysis of screening results, in particular when the screened library contains significant quantities of truncates.
Chemical Space of DNA-Encoded Libraries.
Franzini, Raphael M; Randolph, Cassie
2016-07-28
In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
Cryptic Hepatitis B and E in Patients With Acute Hepatitis of Unknown Etiology.
Ganova-Raeva, Lilia; Punkova, Lili; Campo, David S; Dimitrova, Zoya; Skums, Pavel; Vu, Nga H; Dat, Do T; Dalton, Harry R; Khudyakov, Yury
2015-12-15
Up to 30% of acute viral hepatitis has no known etiology. To determine the disease etiology in patients with acute hepatitis of unknown etiology (HUE), serum specimens were obtained from 38 patients residing in the United Kingdom and Vietnam and from 26 healthy US blood donors. All specimens tested negative for known viral infections causing hepatitis, using commercially available serological and nucleic acid assays. Specimens were processed by sequence-independent complementary DNA amplification and next-generation sequencing (NGS). Sufficient material for individual NGS libraries was obtained from 12 HUE cases and 26 blood donors; the remaining HUE cases were sequenced as a pool. Read mapping was done by targeted and de novo assembly. Sequences from hepatitis B virus (HBV) were detected in 7 individuals with HUE (58.3%) and the pooled library, and hepatitis E virus (HEV) was detected in 2 individuals with HUE (16.7%) and the pooled library. Both HEV-positive cases were coinfected with HBV. HBV sequences belonged to genotypes A, D, or G, and HEV sequences belonged to genotype 3. No known hepatotropic viruses were detected in the tested normal human sera. NGS-based detection of HBV and HEV infections is more sensitive than using commercially available assays. HBV and HEV may be cryptically associated with HUE. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Eberwine, James; Bartfai, Tamas
2011-01-01
We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451
Primer-Free Aptamer Selection Using A Random DNA Library
Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary
2010-01-01
Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences using high efficiency partitioning are met with problems regarding PCR amplification 10. We have developed a primer-free (PF) selection method that significantly simplifies SELEX procedures and effectively eliminates primer-interference problems 11, 12. The protocols work in a straightforward manner. The central random region of the library is purified without extraneous flanking sequences and is bound to a suitable target (for example to a purified protein or complex mixtures such as cell lines). Then the bound sequences are obtained, reunited with flanking sequences, and re-amplified to generate selected sub-libraries. As an example, here we selected aptamers to S100B, a protein marker for melanoma. Binding assays showed Kd s in the 10-7 - 10-8 M range after a few rounds of selection, and we demonstrate that the aptamers function effectively in a sandwich binding format. PMID:20689511
Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.
Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi
2016-01-07
Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.
Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon
2007-06-01
A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.
Libraries of Synthetic TALE-Activated Promoters: Methods and Applications.
Schreiber, T; Tissier, A
2016-01-01
The discovery of proteins with programmable DNA-binding specificities triggered a whole array of applications in synthetic biology, including genome editing, regulation of transcription, and epigenetic modifications. Among those, transcription activator-like effectors (TALEs) due to their natural function as transcription regulators, are especially well-suited for the development of orthogonal systems for the control of gene expression. We describe here the construction and testing of libraries of synthetic TALE-activated promoters which are under the control of a single TALE with a given DNA-binding specificity. These libraries consist of a fixed DNA-binding element for the TALE, a TATA box, and variable sequences of 19 bases upstream and 43 bases downstream of the DNA-binding element. These libraries were cloned using a Golden Gate cloning strategy making them usable as standard parts in a modular cloning system. The broad range of promoter activities detected and the versatility of these promoter libraries make them valuable tools for applications in the fine-tuning of expression in metabolic engineering projects or in the design and implementation of regulatory circuits. © 2016 Elsevier Inc. All rights reserved.
Systematic cloning of human minisatellites from ordered array charomid libraries.
Armour, J A; Povey, S; Jeremiah, S; Jeffreys, A J
1990-11-01
We present a rapid and efficient method for the isolation of minisatellite loci from human DNA. The method combines cloning a size-selected fraction of human MboI DNA fragments in a charomid vector with hybridization screening of the library in ordered array. Size-selection of large MboI fragments enriches for the longer, more variable minisatellites and reduces the size of the library required. The library was screened with a series of multi-locus probes known to detect a large number of hypervariable loci in human DNA. The gridded library allowed both the rapid processing of positive clones and the comparative evaluation of the different multi-locus probes used, in terms of both the relative success in detecting hypervariable loci and the degree of overlap between the sets of loci detected. We report 23 new human minisatellite loci isolated by this method, which map to 14 autosomes and the sex chromosomes.
Yeast Pif1 Accelerates Annealing of Complementary DNA Strands
2015-01-01
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406
Yeast Pif1 accelerates annealing of complementary DNA strands.
Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D
2014-12-09
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.
BOKP: A DNA Barcode Reference Library for Monitoring Herbal Drugs in the Korean Pharmacopeia
Liu, Jinxin; Shi, Linchun; Song, Jingyuan; Sun, Wei; Han, Jianping; Liu, Xia; Hou, Dianyun; Yao, Hui; Li, Mingyue; Chen, Shilin
2017-01-01
Herbal drug authentication is an important task in traditional medicine; however, it is challenged by the limitations of traditional authentication methods and the lack of trained experts. DNA barcoding is conspicuous in almost all areas of the biological sciences and has already been added to the British pharmacopeia and Chinese pharmacopeia for routine herbal drug authentication. However, DNA barcoding for the Korean pharmacopeia still requires significant improvements. Here, we present a DNA barcode reference library for herbal drugs in the Korean pharmacopeia and developed a species identification engine named KP-IDE to facilitate the adoption of this DNA reference library for the herbal drug authentication. Using taxonomy records, specimen records, sequence records, and reference records, KP-IDE can identify an unknown specimen. Currently, there are 6,777 taxonomy records, 1,054 specimen records, 30,744 sequence records (ITS2 and psbA-trnH) and 285 reference records. Moreover, 27 herbal drug materials were collected from the Seoul Yangnyeongsi herbal medicine market to give an example for real herbal drugs authentications. Our study demonstrates the prospects of the DNA barcode reference library for the Korean pharmacopeia and provides future directions for the use of DNA barcoding for authenticating herbal drugs listed in other modern pharmacopeias. PMID:29326593
Ludgate, Jackie L; Wright, James; Stockwell, Peter A; Morison, Ian M; Eccles, Michael R; Chatterjee, Aniruddha
2017-08-31
Formalin fixed paraffin embedded (FFPE) tumor samples are a major source of DNA from patients in cancer research. However, FFPE is a challenging material to work with due to macromolecular fragmentation and nucleic acid crosslinking. FFPE tissue particularly possesses challenges for methylation analysis and for preparing sequencing-based libraries relying on bisulfite conversion. Successful bisulfite conversion is a key requirement for sequencing-based methylation analysis. Here we describe a complete and streamlined workflow for preparing next generation sequencing libraries for methylation analysis from FFPE tissues. This includes, counting cells from FFPE blocks and extracting DNA from FFPE slides, testing bisulfite conversion efficiency with a polymerase chain reaction (PCR) based test, preparing reduced representation bisulfite sequencing libraries and massively parallel sequencing. The main features and advantages of this protocol are: An optimized method for extracting good quality DNA from FFPE tissues. An efficient bisulfite conversion and next generation sequencing library preparation protocol that uses 50 ng DNA from FFPE tissue. Incorporation of a PCR-based test to assess bisulfite conversion efficiency prior to sequencing. We provide a complete workflow and an integrated protocol for performing DNA methylation analysis at the genome-scale and we believe this will facilitate clinical epigenetic research that involves the use of FFPE tissue.
Kuzmina, Maria L; Braukmann, Thomas W A; Fazekas, Aron J; Graham, Sean W; Dewaard, Stephanie L; Rodrigues, Anuar; Bennett, Bruce A; Dickinson, Timothy A; Saarela, Jeffery M; Catling, Paul M; Newmaster, Steven G; Percy, Diana M; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R; Zakharov, Evgeny V; Hebert, Paul D N
2017-12-01
Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa.
Kuzmina, Maria L.; Braukmann, Thomas W. A.; Fazekas, Aron J.; Graham, Sean W.; Dewaard, Stephanie L.; Rodrigues, Anuar; Bennett, Bruce A.; Dickinson, Timothy A.; Saarela, Jeffery M.; Catling, Paul M.; Newmaster, Steven G.; Percy, Diana M.; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P.; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.
2017-01-01
Premise of the study: Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Methods: Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Results: Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Discussion: Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa. PMID:29299394
Watanabe, T; Sadamoto, Hitoshi; Aonuma, H
2011-10-01
Serotonin (5-HT) modulates various aspects of behaviours such as aggressive behaviour and circadian behaviour in the cricket. To elucidate the molecular basis of the cricket 5-HT system, we identified 5-HT-related genes in the field cricket Gryllus bimaculatus DeGeer. Complementary DNA of tryptophan hydroxylase and phenylalanine-tryptophan hydroxylase, which convert tryptophan into 5-hydroxy-L-tryptophan (5-HTP), and that of aromatic L-amino acid decarboxylase, which converts 5-HTP into 5-HT, were isolated from a cricket brain cDNA library. In addition, four 5-HT receptor genes (5-HT(1A) , 5-HT(1B) , 5-HT(2α) , and 5-HT(7) ) were identified. Expression analysis of the tryptophan hydroxylase gene TRH and phenylalanine-tryptophan hydroxylase gene TPH, which are selectively involved in neuronal and peripheral 5-HT synthesis in Drosophila, suggested that two 5-HT synthesis pathways co-exist in the cricket neuronal tissues. The four 5-HT receptor genes were expressed in various tissues at differential expression levels, suggesting that the 5-HT system is widely distributed in the cricket. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.
Molecular basis of the dopaminergic system in the cricket Gryllus bimaculatus.
Watanabe, Takayuki; Sadamoto, Hisayo; Aonuma, Hitoshi
2013-12-01
In insects, dopamine modulates various aspects of behavior such as learning and memory, arousal and locomotion, and is also a precursor of melanin. To elucidate the molecular basis of the dopaminergic system in the field cricket Gryllus bimaculatus DeGeer, we identified genes involved in dopamine biosynthesis, signal transduction, and dopamine re-uptake in the cricket. Complementary DNA of two isoforms of tyrosine hydroxylase (TH), which convert tyrosine into L-3,4-dihydroxyphenylalanine, was isolated from the cricket brain cDNA library. In addition, four dopamine receptor genes (Dop1, Dop2, Dop3, and DopEcR) and a high-affinity dopamine transporter gene were identified. The two TH isoforms contained isoform-specific regions in the regulatory ACT domain and showed differential expression patterns in different tissues. In addition, the dopamine receptor genes had a receptor subtype-specific distribution: the Dop1, Dop2, and DopEcR genes were broadly expressed in various tissues at differential expression levels, and the Dop3 gene was restrictedly expressed in neuronal tissues and the testicles. Our findings provide a fundamental basis for understanding the dopaminergic regulation of diverse physiological processes in the cricket.
Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger
Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui
2010-01-01
In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376
Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun
2016-12-15
A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.
Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E
2016-06-20
Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kim, Mi Ae; Rhee, Jae-Sung; Kim, Tae Ha; Lee, Jung Sick; Choi, Ah-Young; Choi, Beom-Soon; Choi, Ik-Young; Sohn, Young Chang
2017-03-09
In order to characterize the female or male transcriptome of the Pacific abalone and further increase genomic resources, we sequenced the mRNA of full-length complementary DNA (cDNA) libraries derived from pooled tissues of female and male Haliotis discus hannai by employing the Iso-Seq protocol of the PacBio RSII platform. We successfully assembled whole full-length cDNA sequences and constructed a transcriptome database that included isoform information. After clustering, a total of 15,110 and 12,145 genes that coded for proteins were identified in female and male abalones, respectively. A total of 13,057 putative orthologs were retained from each transcriptome in abalones. Overall Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analyzed in each database showed a similar composition between sexes. In addition, a total of 519 and 391 isoforms were genome-widely identified with at least two isoforms from female and male transcriptome databases. We found that the number of isoforms and their alternatively spliced patterns are variable and sex-dependent. This information represents the first significant contribution to sex-preferential genomic resources of the Pacific abalone. The availability of whole female and male transcriptome database and their isoform information will be useful to improve our understanding of molecular responses and also for the analysis of population dynamics in the Pacific abalone.
Kim, Mi Ae; Rhee, Jae-Sung; Kim, Tae Ha; Lee, Jung Sick; Choi, Ah-Young; Choi, Beom-Soon; Choi, Ik-Young; Sohn, Young Chang
2017-01-01
In order to characterize the female or male transcriptome of the Pacific abalone and further increase genomic resources, we sequenced the mRNA of full-length complementary DNA (cDNA) libraries derived from pooled tissues of female and male Haliotis discus hannai by employing the Iso-Seq protocol of the PacBio RSII platform. We successfully assembled whole full-length cDNA sequences and constructed a transcriptome database that included isoform information. After clustering, a total of 15,110 and 12,145 genes that coded for proteins were identified in female and male abalones, respectively. A total of 13,057 putative orthologs were retained from each transcriptome in abalones. Overall Gene Ontology terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analyzed in each database showed a similar composition between sexes. In addition, a total of 519 and 391 isoforms were genome-widely identified with at least two isoforms from female and male transcriptome databases. We found that the number of isoforms and their alternatively spliced patterns are variable and sex-dependent. This information represents the first significant contribution to sex-preferential genomic resources of the Pacific abalone. The availability of whole female and male transcriptome database and their isoform information will be useful to improve our understanding of molecular responses and also for the analysis of population dynamics in the Pacific abalone. PMID:28282934
Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai
2017-02-16
Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our results provide a cDNA expression library for further screening of T cell stimulating or inhibiting antigens of E. maxima. Moreover, our results provide six candidate protective antigens for developing new vaccines against E. maxima.
DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.
MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M
2015-09-14
The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR make implementation of DESPS straightforward, and may prompt the chemistry community to revisit the synthesis of more complex and diverse libraries.
Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.
2011-01-01
Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).
Rhodes, Johanna; Beale, Mathew A; Fisher, Matthew C
2014-01-01
The industry of next-generation sequencing is constantly evolving, with novel library preparation methods and new sequencing machines being released by the major sequencing technology companies annually. The Illumina TruSeq v2 library preparation method was the most widely used kit and the market leader; however, it has now been discontinued, and in 2013 was replaced by the TruSeq Nano and TruSeq PCR-free methods, leaving a gap in knowledge regarding which is the most appropriate library preparation method to use. Here, we used isolates from the pathogenic fungi Cryptococcus neoformans var. grubii and sequenced them using the existing TruSeq DNA v2 kit (Illumina), along with two new kits: the TruSeq Nano DNA kit (Illumina) and the NEBNext Ultra DNA kit (New England Biolabs) to provide a comparison. Compared to the original TruSeq DNA v2 kit, both newer kits gave equivalent or better sequencing data, with increased coverage. When comparing the two newer kits, we found little difference in cost and workflow, with the NEBNext Ultra both slightly cheaper and faster than the TruSeq Nano. However, the quality of data generated using the TruSeq Nano DNA kit was superior due to higher coverage at regions of low GC content, and more SNPs identified. Researchers should therefore evaluate their resources and the type of application (and hence data quality) being considered when ultimately deciding on which library prep method to use.
Litovchick, Alexander; Dumelin, Christoph E.; Habeshian, Sevan; Gikunju, Diana; Guié, Marie-Aude; Centrella, Paolo; Zhang, Ying; Sigel, Eric A.; Cuozzo, John W.; Keefe, Anthony D.; Clark, Matthew A.
2015-01-01
A chemical ligation method for construction of DNA-encoded small-molecule libraries has been developed. Taking advantage of the ability of the Klenow fragment of DNA polymerase to accept templates with triazole linkages in place of phosphodiesters, we have designed a strategy for chemically ligating oligonucleotide tags using cycloaddition chemistry. We have utilized this strategy in the construction and selection of a small molecule library, and successfully identified inhibitors of the enzyme soluble epoxide hydrolase. PMID:26061191
Tahir, Muhammad Ali; Hameed, Sadaf; Munawar, Anam; Amin, Imran; Mansoor, Shahid; Khan, Waheed S; Bajwa, Sadia Zafar
2017-11-01
The emergence of nanotechnology has opened new horizons for constructing efficient recognition interfaces. This is the first report where the potential of a multiwalled carbon nanotube based zinc nanocomposite (MWCNTs-Zn NPs) investigated for the detection of an agricultural pathogen i.e. Chili leaf curl betasatellite (ChLCB). Atomic force microscope analyses revealed the presence of multiwalled carbon nanotubes (MWCNTs) having a diameter of 50-100nm with zinc nanoparticles (Zn-NPs) of 25-500nm. In this system, these bunches of Zn-NPs anchored along the whole lengths of MWCNTs were used for the immobilization of probe DNA strands. The electrochemical performance of DNA biosensor was assessed in the absence and presence of the complementary DNA during cyclic and differential pulse voltammetry scans. Target binding events occurring on the interface surface patterned with single-stranded DNA was quantitatively translated into electrochemical signals due to hybridization process. In the presence of complementary target DNA, as the result of duplex formation, there was a decrease in the peak current from 1.89×10 -04 to 5.84×10 -05 A. The specificity of this electrochemical DNA biosensor was found to be three times as compared to non-complementary DNA. This material structuring technique can be extended to design interfaces for the recognition of the other plant viruses and biomolecules. Copyright © 2017 Elsevier B.V. All rights reserved.
Plans and progress for building a Great Lakes fauna DNA barcode reference library
DNA reference libraries provide researchers with an important tool for assessing regional biodiversity by allowing unknown genetic sequences to be assigned identities, while also providing a means for taxonomists to validate identifications. Expanding the representation of Great...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook
2014-09-03
A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less
Isolation of a DNA Probe for Lactobacillus curvatus
Petrick, Hendrik A. R.; Ambrosio, Riccardo E.; Holzapfel, Wilhelm H.
1988-01-01
A genomic library of Lactobacillus curvatus DSM 20019 was constructed in bacteriophage λ gt11. A 1.2-kilobase DNA probe specific for L. curvatus was isolated from this library. When this probe was hybridized to DNA from Lactobacillus isolates from different sources classified by conventional techniques, differing degrees of hybridization were obtained. This could imply that these isolates may have been incorrectly classified. Images PMID:16347554
Eberwine, James; Bartfai, Tamas
2011-03-01
We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Properties of an unusual DNA primase from an archaeal plasmid
Beck, Kirsten; Lipps, Georg
2007-01-01
Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343
Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-01-01
To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.
Formation of template-switching artifacts by linear amplification.
Chakravarti, Dhrubajyoti; Mailander, Paula C
2008-07-01
Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.
Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko
2006-01-01
To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.
Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko
2006-01-01
OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010
McCormick, M K; Campbell, E; Deaven, L; Moyzis, R
1993-01-01
Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075
An efficient and sensitive method for preparing cDNA libraries from scarce biological samples
Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor
2015-01-01
The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322
[Construction of fetal mesenchymal stem cell cDNA subtractive library].
Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao
2002-04-01
To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.
Synthesis and cell-free cloning of DNA libraries using programmable microfluidics
Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud
2016-01-01
Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354
Identification of genes differentially expressed in association with acquired cisplatin resistance
Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G
2000-01-01
The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653
[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].
Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi
2013-01-01
Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.
Highly multiplexed targeted DNA sequencing from single nuclei.
Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E
2016-02-01
Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.
Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru
2013-01-01
In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.
Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru
2013-01-01
In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800
Chemical Biology Probes from Advanced DNA-encoded Libraries.
Salamon, Hazem; Klika Škopić, Mateja; Jung, Kathrin; Bugain, Olivia; Brunschweiger, Andreas
2016-02-19
The identification of bioactive compounds is a crucial step toward development of probes for chemical biology studies. Screening of DNA-encoded small molecule libraries (DELs) has emerged as a validated technology to interrogate vast chemical space. DELs consist of chimeric molecules composed of a low-molecular weight compound that is conjugated to a DNA identifier tag. They are screened as pooled libraries using selection to identify "hits." Screening of DELs has identified numerous bioactive compounds. Some of these molecules were instrumental in gaining a deeper understanding of biological systems. One of the main challenges in the field is the development of synthesis methodology for DELs.
Universal ligation-detection-reaction microarray applied for compost microbes
Hultman, Jenni; Ritari, Jarmo; Romantschuk, Martin; Paulin, Lars; Auvinen, Petri
2008-01-01
Background Composting is one of the methods utilised in recycling organic communal waste. The composting process is dependent on aerobic microbial activity and proceeds through a succession of different phases each dominated by certain microorganisms. In this study, a ligation-detection-reaction (LDR) based microarray method was adapted for species-level detection of compost microbes characteristic of each stage of the composting process. LDR utilises the specificity of the ligase enzyme to covalently join two adjacently hybridised probes. A zip-oligo is attached to the 3'-end of one probe and fluorescent label to the 5'-end of the other probe. Upon ligation, the probes are combined in the same molecule and can be detected in a specific location on a universal microarray with complementary zip-oligos enabling equivalent hybridisation conditions for all probes. The method was applied to samples from Nordic composting facilities after testing and optimisation with fungal pure cultures and environmental clones. Results Probes targeted for fungi were able to detect 0.1 fmol of target ribosomal PCR product in an artificial reaction mixture containing 100 ng competing fungal ribosomal internal transcribed spacer (ITS) area or herring sperm DNA. The detection level was therefore approximately 0.04% of total DNA. Clone libraries were constructed from eight compost samples. The LDR microarray results were in concordance with the clone library sequencing results. In addition a control probe was used to monitor the per-spot hybridisation efficiency on the array. Conclusion This study demonstrates that the LDR microarray method is capable of sensitive and accurate species-level detection from a complex microbial community. The method can detect key species from compost samples, making it a basis for a tool for compost process monitoring in industrial facilities. PMID:19116002
A Novel Approach to Dissect the Abscission Process in Arabidopsis1[C][W][OA
González-Carranza, Zinnia Haydee; Shahid, Ahmad Ali; Zhang, Li; Liu, Yang; Ninsuwan, Unchalee; Roberts, Jeremy Alan
2012-01-01
Abscission is the consequence of a specialized layer of cells undergoing a complex series of molecular and biochemical events. Analysis of the specific molecular changes associated with abscission is hampered by contamination from neighboring nonseparating tissues. Moreover, studies of abscission frequently involve the examination of events that take place in isolated segments of tissue exposed to nonphysiological concentrations of ethylene or indole-3-acetic acid for protracted periods (more than 24 h) of time. To resolve these problems, we have adopted the use of a transgenic line of Arabidopsis (Arabidopsis thaliana) where the promoter of an abscission-specific polygalacturonase gene (At2g41850/ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE2) has been fused to a green fluorescent protein reporter. RNA was extracted from green fluorescent protein-tagged cells, released from abscising floral organs, and used to generate a complementary DNA library. This library was used to probe a microarray, and a population of abscission-related transcripts was studied in detail. Seven novel abscission-related genes were identified, four of which encode proteins of unknown function. Reverse transcription-polymerase chain reaction analyses and promoter fusions to the β-glucuronidase reporter gene confirmed the expression of these genes in the abscission zone and revealed other places of expression during seedling development. Three of these genes were studied further by crossing reporter lines to the abscission mutants inflorescence deficient in abscission (ida) and blade-on-petiole1 (bop1)/bop2 and an IDA-overexpressing line. Phenotypic analysis of an At3g14380 transfer DNA insertion line indicates that this gene plays a functional role in floral organ shedding. This strategy has enabled us to uncover new genes involved in abscission, and their possible contribution to the process is discussed. PMID:22992509
Deng, Jiajia; Toh, Chee-Seng
2013-06-17
A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.
Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C
1999-06-01
To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.
Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K
2013-10-15
Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
1999-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.
2000-01-01
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.
Method for performing site-specific affinity fractionation for use in DNA sequencing
Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.
1999-05-18
A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.
Tak, Manvi; Gupta, Vinay; Tomar, Monika
2014-09-15
Zinc oxide (ZnO) nanostructures possessing flower-like morphology have been synthesised onto platinized silicon substrate by simple and economical hydrothermal method. The interaction of physically immobilized single stranded thiolated DNA (ss th-DNA) probe of N. meningitides onto the nanostructured ZnO (ZNF) matrix surface have been investigated using cyclic voltammetry (CV) and electrochemical impeadance spectroscopy (EIS). The electrochemical sensing response behaviour of the DNA bioelectrode (ss th-DNA/ZNF/Pt/Si) has been studied by both differential pulse voltammetric (DPV) as well as impedimetric techniques. The fabricated DNA biosensor can quantify wide range of the complementary target ss th-DNA in the range 5-240 ng μl(-1) with good linearity (R=0.98), high sensitivity (168.64 μA ng(-1) μl cm(-2)) and low detection limit of about 5 ng μl(-1). Results emphasise that the fabricated flower-like ZnO nanostructures offer a useful platform for the immobilization of DNA molecules and could be exploited for efficient detection of complementary target single stranded DNA corresponding to N. meningitides. Copyright © 2014 Elsevier B.V. All rights reserved.
ORF phage display to identify cellular proteins with different functions.
Li, Wei
2012-09-01
Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.
Algorithms for optimizing cross-overs in DNA shuffling.
He, Lu; Friedman, Alan M; Bailey-Kellogg, Chris
2012-03-21
DNA shuffling generates combinatorial libraries of chimeric genes by stochastically recombining parent genes. The resulting libraries are subjected to large-scale genetic selection or screening to identify those chimeras with favorable properties (e.g., enhanced stability or enzymatic activity). While DNA shuffling has been applied quite successfully, it is limited by its homology-dependent, stochastic nature. Consequently, it is used only with parents of sufficient overall sequence identity, and provides no control over the resulting chimeric library. This paper presents efficient methods to extend the scope of DNA shuffling to handle significantly more diverse parents and to generate more predictable, optimized libraries. Our CODNS (cross-over optimization for DNA shuffling) approach employs polynomial-time dynamic programming algorithms to select codons for the parental amino acids, allowing for zero or a fixed number of conservative substitutions. We first present efficient algorithms to optimize the local sequence identity or the nearest-neighbor approximation of the change in free energy upon annealing, objectives that were previously optimized by computationally-expensive integer programming methods. We then present efficient algorithms for more powerful objectives that seek to localize and enhance the frequency of recombination by producing "runs" of common nucleotides either overall or according to the sequence diversity of the resulting chimeras. We demonstrate the effectiveness of CODNS in choosing codons and allocating substitutions to promote recombination between parents targeted in earlier studies: two GAR transformylases (41% amino acid sequence identity), two very distantly related DNA polymerases, Pol X and β (15%), and beta-lactamases of varying identity (26-47%). Our methods provide the protein engineer with a new approach to DNA shuffling that supports substantially more diverse parents, is more deterministic, and generates more predictable and more diverse chimeric libraries.
A nanophosphor-based method for selective DNA recovery in Synthosomes.
Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich
2006-01-01
A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
Milnthorpe, Andrew T; Soloviev, Mikhail
2011-04-15
The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used.
2011-01-01
Background The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. Results We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Conclusion Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used. PMID:21496233
Improving cell mixture deconvolution by identifying optimal DNA methylation libraries (IDOL).
Koestler, Devin C; Jones, Meaghan J; Usset, Joseph; Christensen, Brock C; Butler, Rondi A; Kobor, Michael S; Wiencke, John K; Kelsey, Karl T
2016-03-08
Confounding due to cellular heterogeneity represents one of the foremost challenges currently facing Epigenome-Wide Association Studies (EWAS). Statistical methods leveraging the tissue-specificity of DNA methylation for deconvoluting the cellular mixture of heterogenous biospecimens offer a promising solution, however the performance of such methods depends entirely on the library of methylation markers being used for deconvolution. Here, we introduce a novel algorithm for Identifying Optimal Libraries (IDOL) that dynamically scans a candidate set of cell-specific methylation markers to find libraries that optimize the accuracy of cell fraction estimates obtained from cell mixture deconvolution. Application of IDOL to training set consisting of samples with both whole-blood DNA methylation data (Illumina HumanMethylation450 BeadArray (HM450)) and flow cytometry measurements of cell composition revealed an optimized library comprised of 300 CpG sites. When compared existing libraries, the library identified by IDOL demonstrated significantly better overall discrimination of the entire immune cell landscape (p = 0.038), and resulted in improved discrimination of 14 out of the 15 pairs of leukocyte subtypes. Estimates of cell composition across the samples in the training set using the IDOL library were highly correlated with their respective flow cytometry measurements, with all cell-specific R (2)>0.99 and root mean square errors (RMSEs) ranging from [0.97 % to 1.33 %] across leukocyte subtypes. Independent validation of the optimized IDOL library using two additional HM450 data sets showed similarly strong prediction performance, with all cell-specific R (2)>0.90 and R M S E<4.00 %. In simulation studies, adjustments for cell composition using the IDOL library resulted in uniformly lower false positive rates compared to competing libraries, while also demonstrating an improved capacity to explain epigenome-wide variation in DNA methylation within two large publicly available HM450 data sets. Despite consisting of half as many CpGs compared to existing libraries for whole blood mixture deconvolution, the optimized IDOL library identified herein resulted in outstanding prediction performance across all considered data sets and demonstrated potential to improve the operating characteristics of EWAS involving adjustments for cell distribution. In addition to providing the EWAS community with an optimized library for whole blood mixture deconvolution, our work establishes a systematic and generalizable framework for the assembly of libraries that improve the accuracy of cell mixture deconvolution.
Determination of helix orientations in a flexible DNA by multi-frequency EPR spectroscopy.
Grytz, C M; Kazemi, S; Marko, A; Cekan, P; Güntert, P; Sigurdsson, S Th; Prisner, T F
2017-11-15
Distance measurements are performed between a pair of spin labels attached to nucleic acids using Pulsed Electron-Electron Double Resonance (PELDOR, also called DEER) spectroscopy which is a complementary tool to other structure determination methods in structural biology. The rigid spin label Ç, when incorporated pairwise into two helical parts of a nucleic acid molecule, allows the determination of both the mutual orientation and the distance between those labels, since Ç moves rigidly with the helix to which it is attached. We have developed a two-step protocol to investigate the conformational flexibility of flexible nucleic acid molecules by multi-frequency PELDOR. In the first step, a library with a broad collection of conformers, which are in agreement with topological constraints, NMR restraints and distances derived from PELDOR, was created. In the second step, a weighted structural ensemble of these conformers was chosen, such that it fits the multi-frequency PELDOR time traces of all doubly Ç-labelled samples simultaneously. This ensemble reflects the global structure and the conformational flexibility of the two-way DNA junction. We demonstrate this approach on a flexible bent DNA molecule, consisting of two short helical parts with a five adenine bulge at the center. The kink and twist motions between both helical parts were quantitatively determined and showed high flexibility, in agreement with a Förster Resonance Energy Transfer (FRET) study on a similar bent DNA motif. The approach presented here should be useful to describe the relative orientation of helical motifs and the conformational flexibility of nucleic acid structures, both alone and in complexes with proteins and other molecules.
Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy
2015-03-15
This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.
Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András
2003-01-01
A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.
DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA
Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo
1971-01-01
The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808
Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers
Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.
2013-01-01
Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-01-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-02-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.
Porcine circovirus: transcription and rolling-circle DNA replication
USDA-ARS?s Scientific Manuscript database
This review summarizes the molecular studies pertaining to porcine circovirus (PCV) transcription and DNA replication. The genome of PCV is circular, single-stranded DNA and contains 1759-1768 nucleotides. Both the genome-strand (packaged in the virus particle) and the complementary-strand (synthesi...
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R
2006-10-01
Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).
Library construction for next-generation sequencing: Overviews and challenges
Head, Steven R.; Komori, H. Kiyomi; LaMere, Sarah A.; Whisenant, Thomas; Van Nieuwerburgh, Filip; Salomon, Daniel R.; Ordoukhanian, Phillip
2014-01-01
High-throughput sequencing, also known as next-generation sequencing (NGS), has revolutionized genomic research. In recent years, NGS technology has steadily improved, with costs dropping and the number and range of sequencing applications increasing exponentially. Here, we examine the critical role of sequencing library quality and consider important challenges when preparing NGS libraries from DNA and RNA sources. Factors such as the quantity and physical characteristics of the RNA or DNA source material as well as the desired application (i.e., genome sequencing, targeted sequencing, RNA-seq, ChIP-seq, RIP-seq, and methylation) are addressed in the context of preparing high quality sequencing libraries. In addition, the current methods for preparing NGS libraries from single cells are also discussed. PMID:24502796
Sproul, John S; Maddison, David R
2017-11-01
Despite advances that allow DNA sequencing of old museum specimens, sequencing small-bodied, historical specimens can be challenging and unreliable as many contain only small amounts of fragmented DNA. Dependable methods to sequence such specimens are especially critical if the specimens are unique. We attempt to sequence small-bodied (3-6 mm) historical specimens (including nomenclatural types) of beetles that have been housed, dried, in museums for 58-159 years, and for which few or no suitable replacement specimens exist. To better understand ideal approaches of sample preparation and produce preparation guidelines, we compared different library preparation protocols using low amounts of input DNA (1-10 ng). We also explored low-cost optimizations designed to improve library preparation efficiency and sequencing success of historical specimens with minimal DNA, such as enzymatic repair of DNA. We report successful sample preparation and sequencing for all historical specimens despite our low-input DNA approach. We provide a list of guidelines related to DNA repair, bead handling, reducing adapter dimers and library amplification. We present these guidelines to facilitate more economical use of valuable DNA and enable more consistent results in projects that aim to sequence challenging, irreplaceable historical specimens. © 2017 John Wiley & Sons Ltd.
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Wu, Jian; Dai, Wei; Wu, Lin; Wang, Jinke
2018-02-13
Next-generation sequencing (NGS) is fundamental to the current biological and biomedical research. Construction of sequencing library is a key step of NGS. Therefore, various library construction methods have been explored. However, the current methods are still limited by some shortcomings. This study developed a new NGS library construction method, Single strand Adaptor Library Preparation (SALP), by using a novel single strand adaptor (SSA). SSA is a double-stranded oligonucleotide with a 3' overhang of 3 random nucleotides, which can be efficiently ligated to the 3' end of single strand DNA by T4 DNA ligase. SALP can be started with any denatured DNA fragments such as those sheared by Tn5 tagmentation, enzyme digestion and sonication. When started with Tn5-tagmented chromatin, SALP can overcome a key limitation of ATAC-seq and become a high-throughput NGS library construction method, SALP-seq, which can be used to comparatively characterize the chromatin openness state of multiple cells unbiasly. In this way, this study successfully characterized the comparative chromatin openness states of four different cell lines, including GM12878, HepG2, HeLa and 293T, with SALP-seq. Similarly, this study also successfully characterized the chromatin openness states of HepG2 cells with SALP-seq by using 10 5 to 500 cells. This study developed a new NGS library construction method, SALP, by using a novel kind of single strand adaptor (SSA), which should has wide applications in the future due to its unique performance.
Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.
Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd
2015-01-01
Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455
NASA Astrophysics Data System (ADS)
Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian
2010-07-01
In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.
Sex determination based on amelogenin DNA by modified electrode with gold nanoparticle.
Mazloum-Ardakani, Mohammad; Rajabzadeh, Nooshin; Benvidi, Ali; Heidari, Mohammad Mehdi
2013-12-15
We have developed a simple and renewable electrochemical biosensor based on carbon paste electrode (CPE) for the detection of DNA synthesis and hybridization. CPE was modified with gold nanoparticles (AuNPs), which are helpful for immobilization of thiolated bioreceptors. AuNPs were characterized by scanning electron microscopy (SEM). Self-assembled monolayers (SAMs) of thiolated single-stranded DNA (SH-ssDNA) of the amelogenin gene was formed on CPE. The immobilization of the probe and its hybridization with the target DNA was optimized using different experimental conditions. The modified electrode was characterized by electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). The electrochemical response of ssDNA hybridization and DNA synthesis was measured using differential pulse voltammetry (DPV) with methylene blue (MB) as an electroactive indicator. The new biosensor can distinguish between complementary and non-complementary strands of amelogenin ssDNA. Genomic DNA was extracted from blood and was detected based on changes in the MB reduction signal. These results demonstrated that the new biosensor could be used for sex determination. The proposed biosensor in this study could be used for detection and discrimination of polymerase chain reaction (PCR) products of amelogenin DNA. Copyright © 2013 Elsevier Inc. All rights reserved.
DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.
Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S
2007-04-15
An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.
USDA-ARS?s Scientific Manuscript database
Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
Design, synthesis and selection of DNA-encoded small-molecule libraries.
Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A
2009-09-01
Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.
Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy
2016-07-18
Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy target for adulteration. Developing a quality control protocol for medicinal plant raw drugs by incorporating DNA barcoding as a component is essential to ensure safety to the consumers.
A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders
Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong
2016-01-01
Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078
The Hemiptera (Insecta) of Canada: Constructing a Reference Library of DNA Barcodes
Gwiazdowski, Rodger A.; Foottit, Robert G.; Maw, H. Eric L.; Hebert, Paul D. N.
2015-01-01
DNA barcode reference libraries linked to voucher specimens create new opportunities for high-throughput identification and taxonomic re-evaluations. This study provides a DNA barcode library for about 45% of the recognized species of Canadian Hemiptera, and the publically available R workflow used for its generation. The current library is based on the analysis of 20,851 specimens including 1849 species belonging to 628 genera and 64 families. These individuals were assigned to 1867 Barcode Index Numbers (BINs), sequence clusters that often coincide with species recognized through prior taxonomy. Museum collections were a key source for identified specimens, but we also employed high-throughput collection methods that generated large numbers of unidentified specimens. Many of these specimens represented novel BINs that were subsequently identified by taxonomists, adding barcode coverage for additional species. Our analyses based on both approaches includes 94 species not listed in the most recent Canadian checklist, representing a potential 3% increase in the fauna. We discuss the development of our workflow in the context of prior DNA barcode library construction projects, emphasizing the importance of delineating a set of reference specimens to aid investigations in cases of nomenclatural and DNA barcode discordance. The identification for each specimen in the reference set can be annotated on the Barcode of Life Data System (BOLD), allowing experts to highlight questionable identifications; annotations can be added by any registered user of BOLD, and instructions for this are provided. PMID:25923328
Arculeo, Marco; Bonello, Juan J.; Bonnici, Leanne; Cannas, Rita; Carbonara, Pierluigi; Cau, Alessandro; Charilaou, Charis; El Ouamari, Najib; Fiorentino, Fabio; Follesa, Maria Cristina; Garofalo, Germana; Golani, Daniel; Guarniero, Ilaria; Hanner, Robert; Hemida, Farid; Kada, Omar; Lo Brutto, Sabrina; Mancusi, Cecilia; Morey, Gabriel; Schembri, Patrick J.; Serena, Fabrizio; Sion, Letizia; Stagioni, Marco; Tursi, Angelo; Vrgoc, Nedo; Steinke, Dirk; Tinti, Fausto
2017-01-01
Cartilaginous fish are particularly vulnerable to anthropogenic stressors and environmental change because of their K-selected reproductive strategy. Accurate data from scientific surveys and landings are essential to assess conservation status and to develop robust protection and management plans. Currently available data are often incomplete or incorrect as a result of inaccurate species identifications, due to a high level of morphological stasis, especially among closely related taxa. Moreover, several diagnostic characters clearly visible in adult specimens are less evident in juveniles. Here we present results generated by the ELASMOMED Consortium, a regional network aiming to sample and DNA-barcode the Mediterranean Chondrichthyans with the ultimate goal to provide a comprehensive DNA barcode reference library. This library will support and improve the molecular taxonomy of this group and the effectiveness of management and conservation measures. We successfully barcoded 882 individuals belonging to 42 species (17 sharks, 24 batoids and one chimaera), including four endemic and several threatened ones. Morphological misidentifications were found across most orders, further confirming the need for a comprehensive DNA barcoding library as a valuable tool for the reliable identification of specimens in support of taxonomist who are reviewing current identification keys. Despite low intraspecific variation among their barcode sequences and reduced samples size, five species showed preliminary evidence of phylogeographic structure. Overall, the ELASMOMED initiative further emphasizes the key role accurate DNA barcoding libraries play in establishing reliable diagnostic species specific features in otherwise taxonomically problematic groups for biodiversity management and conservation actions. PMID:28107413
Preparation of Low-Input and Ligation-Free ChIP-seq Libraries Using Template-Switching Technology.
Bolduc, Nathalie; Lehman, Alisa P; Farmer, Andrew
2016-10-10
Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) has become the gold standard for mapping of transcription factors and histone modifications throughout the genome. However, for ChIP experiments involving few cells or targeting low-abundance transcription factors, the small amount of DNA recovered makes ligation of adapters very challenging. In this unit, we describe a ChIP-seq workflow that can be applied to small cell numbers, including a robust single-tube and ligation-free method for preparation of sequencing libraries from sub-nanogram amounts of ChIP DNA. An example ChIP protocol is first presented, resulting in selective enrichment of DNA-binding proteins and cross-linked DNA fragments immobilized on beads via an antibody bridge. This is followed by a protocol for fast and easy cross-linking reversal and DNA recovery. Finally, we describe a fast, ligation-free library preparation protocol, featuring DNA SMART technology, resulting in samples ready for Illumina sequencing. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Methods for transforming and expression screening of filamentous fungal cells with a DNA library
Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie
2015-06-02
The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.
Quantum dot-based microfluidic biosensor for cancer detection
NASA Astrophysics Data System (ADS)
Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar
2015-05-01
We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.
Lai, Wei-An; Lin, Chih-Heng; Yang, Yuh-Shyong; Lu, Michael S-C
2012-05-15
This work presents miniaturized CMOS (complementary metal oxide semiconductor) sensors for non-faradic impedimetric detection of AIV (avian influenza virus) oligonucleotides. The signal-to-noise ratio is significantly improved by monolithic sensor integration to reduce the effect of parasitic capacitances. The use of sub-μm interdigitated microelectrodes is also beneficial for promoting the signal coupling efficiency. Capacitance changes associated with surface modification, functionalization, and DNA hybridization were extracted from the measured frequency responses based on an equivalent-circuit model. Hybridization of the AIV H5 capture and target DNA probes produced a capacitance reduction of -13.2 ± 2.1% for target DNA concentrations from 1 fM to 10 fM, while a capacitance increase was observed when H5 target DNA was replaced with non-complementary H7 target DNA. With the demonstrated superior sensing capabilities, this miniaturized CMOS sensing platform shows great potential for label-free point-of-care biosensing applications. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Singh, Swati; Kumar, Ashok; Khare, Shashi; Mulchandani, Ashok; Rajesh
2014-11-01
A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to its complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml-1 with a limit of detection of 0.16 ng ml-1.
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.
Verma, Digvijay; Satyanarayana, T
2011-09-01
An improved single-step protocol has been developed for extracting pure community humic substance-free DNA from alkaline soils and sediments. The method is based on direct cell lysis in the presence of powdered activated charcoal and polyvinylpolypyrrolidone followed by precipitation with polyethyleneglycol and isopropanol. The strategy allows simultaneous isolation and purification of DNA while minimizing the loss of DNA with respect to other available protocols for metagenomic DNA extraction. Moreover, the purity levels are significant, which are difficult to attain with any of the methods reported in the literature for DNA extraction from soils. The DNA thus extracted was free from humic substances and, therefore, could be processed for restriction digestion, PCR amplification as well as for the construction of metagenomic libraries.
Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-12
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-12-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.
Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.
Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K
2018-06-04
The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.
Maggi, Elaine C; Gravina, Silvia; Cheng, Haiying; Piperdi, Bilal; Yuan, Ziqiang; Dong, Xiao; Libutti, Steven K; Vijg, Jan; Montagna, Cristina
2018-01-01
The goal of this study was to develop a method for whole genome cell-free DNA (cfDNA) methylation analysis in humans and mice with the ultimate goal to facilitate the identification of tumor derived DNA methylation changes in the blood. Plasma or serum from patients with pancreatic neuroendocrine tumors or lung cancer, and plasma from a murine model of pancreatic adenocarcinoma was used to develop a protocol for cfDNA isolation, library preparation and whole-genome bisulfite sequencing of ultra low quantities of cfDNA, including tumor-specific DNA. The protocol developed produced high quality libraries consistently generating a conversion rate >98% that will be applicable for the analysis of human and mouse plasma or serum to detect tumor-derived changes in DNA methylation.
Differential cDNA cloning by enzymatic degrading subtraction (EDS).
Zeng, J; Gorski, R A; Hamer, D
1994-01-01
We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268
Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun
2010-04-01
Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.
Huntriss, John; Lu, Jianping; Hemmings, Karen; Bayne, Rosemary; Anderson, Richard; Rutherford, Anthony; Balen, Adam; Elder, Kay; Picton, Helen M
2017-01-01
Gametocyte-specific factor 1 has been shown in other species to be required for the silencing of retrotransposons via the Piwi-interacting RNA (piRNA) pathway. In this study, we aimed to isolate and assess expression of transcripts of the gametocyte-specific factor 1 (GTSF1) gene in the human female germline and in preimplantation embryos. Complementary DNA (cDNA) libraries from human fetal ovaries and testes, human oocytes and preimplantation embryos and ovarian follicles isolated from an adult ovarian cortex biopsy were used to as templates for PCR, cloning and sequencing, and real time PCR experiments of GTSF1 expression. GTSF1 cDNA clones that covered the entire coding region were isolated from human oocytes and preimplantation embryos. GTSF1 mRNA expression was detected in archived cDNAs from staged human ovarian follicles, germinal vesicle (GV) stage oocytes, metaphase II oocytes, and morula and blastocyst stage preimplantation embryos. Within the adult female germline, expression was highest in GV oocytes. GTSF1 mRNA expression was also assessed in human fetal ovary and was observed to increase during gestation, from 8 to 21 weeks, during which time oogonia enter meiosis and primordial follicle formation first occurs. In human fetal testis, GTSF1 expression also increased from 8 to 19 weeks. To our knowledge, this report is the first to describe the expression of the human GTSF1 gene in human gametes and preimplantation embryos.
Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B
2011-12-01
High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.
Holland, Erika G; Buhr, Diane L; Acca, Felicity E; Alderman, Dawn; Bovat, Kristin; Busygina, Valeria; Kay, Brian K; Weiner, Michael P; Kiss, Margaret M
2013-08-30
Affinity maturation is an important part of the recombinant antibody development process. There are several well-established approaches for generating libraries of mutated antibody genes for affinity maturation, but these approaches are generally too laborious or expensive to allow high-throughput, parallel processing of multiple antibodies. Here, we describe a scalable approach that enables the generation of libraries with greater than 10(8) clones from a single Escherichia coli transformation. In our method, a mutated DNA fragment is produced using PCR conditions that promote nucleotide misincorporation into newly synthesized DNA. In the PCR reaction, one of the primers contains at least three phosphorothioate linkages at its 5' end, and treatment of the PCR product with a 5' to 3' exonuclease is used to preferentially remove the strand synthesized with the non-modified primer, resulting in a single-stranded DNA fragment. This fragment then serves as a megaprimer to prime DNA synthesis on a uracilated, circular, single-stranded template in a Kunkel-like mutagenesis reaction that biases nucleotide base-changes between the megaprimer and uracilated DNA sequence in favor of the in vitro synthesized megaprimer. This method eliminates the inefficient subcloning steps that are normally required for the construction of affinity maturation libraries from randomly mutagenized antibody genes. Copyright © 2013. Published by Elsevier B.V.
Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E
2016-11-01
Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Applications of Fourier transform Raman and infrared spectroscopy in forensic sciences
NASA Astrophysics Data System (ADS)
Kuptsov, Albert N.
2000-02-01
First in the world literature comprehensive digital complementary vibrational spectra collection of polymer materials and search system was developed. Non-destructive combined analysis using complementary FT-Raman and FTIR spectra followed by cross-parallel searching on digital spectral libraries, was applied in different fields of forensic sciences. Some unique possibilities of Raman spectroscopy has been shown in the fields of examination of questioned documents, paper, paints, polymer materials, gemstones and other physical evidences.
DNA-Encoded Dynamic Combinatorial Chemical Libraries.
Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin
2015-06-26
Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Genomic clones for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kott, M.; Venta, P.J.; Larsen, J.
1987-05-01
A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less
Rapid and Easy Protocol for Quantification of Next-Generation Sequencing Libraries.
Hawkins, Steve F C; Guest, Paul C
2018-01-01
The emergence of next-generation sequencing (NGS) over the last 10 years has increased the efficiency of DNA sequencing in terms of speed, ease, and price. However, the exact quantification of a NGS library is crucial in order to obtain good data on sequencing platforms developed by the current market leader Illumina. Different approaches for DNA quantification are available currently and the most commonly used are based on analysis of the physical properties of the DNA through spectrophotometric or fluorometric methods. Although these methods are technically simple, they do not allow exact quantification as can be achieved using a real-time quantitative PCR (qPCR) approach. A qPCR protocol for DNA quantification with applications in NGS library preparation studies is presented here. This can be applied in various fields of study such as medical disorders resulting from nutritional programming disturbances.
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won
2012-01-01
Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
Topological Interaction by Entanglement of DNA
NASA Astrophysics Data System (ADS)
Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul
2012-02-01
We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.
Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong
2015-11-20
We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.
2011-01-01
Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559
Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.
Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor
2009-09-01
Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.
Rapid amplification of 5' complementary DNA ends (5' RACE).
2005-08-01
This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.
Wang, Guannan; Su, Xingguang
2010-06-01
A novel, highly sensitive technology for the detection, enrichment, and separation of trace amounts of target DNA was developed on the basis of amino-modified fluorescent magnetic composite nanoparticles (AFMN). In this study, the positively charged amino-modified composite nanoparticles conjugate with the negatively charged capture DNA through electrostatic binding. The optimal combination of AFMN and capture DNA was measured by dynamic light scattering (DLS) and UV-vis absorption spectroscopy. The highly sensitive detection of trace amounts of target DNA was achieved through enrichment by means of AFMN. The detection limit for target DNA is 0.4 pM, which could be further improved by using a more powerful magnet. Because of their different melting temperatures, single-base mismatched target DNA could be separated from perfectly complementary target DNA. In addition, the photoluminescence (PL) signals of perfectly complementary target DNA and single-base mismatched DNA as well as the hybridization kinetics of different concentrations of target DNA at different reaction times have also been studied. Most importantly, the detection, enrichment, and separation ability of AFMN was further verified with milk. Simple and satisfactory results were obtained, which show the great potential in the fields of mutation identification and clinical diagnosis.
[DNA structure from A to Z--biological implications of structural diversity of DNA].
Bukowiecka-Matusiak, Małgorzata; Woźniak, Lucyna A
2006-01-01
Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.
An Electrochemical DNA Microbiosensor Based on Succinimide-Modified Acrylic Microspheres
Ulianas, Alizar; Heng, Lee Yook; Hanifah, Sharina Abu; Ling, Tan Ling
2012-01-01
An electrochemical microbiosensor for DNA has been fabricated based on new acrylic microspheres modified with reactive N-acryloxysuccinimide (NAS) functional groups. Hydrophobic poly(n-butylacrylate-N-acryloxysuccinimide) microspheres were synthesized in an emulsion form with a simple one-step photopolymerization technique. Aminated DNA probe was attached to the succinimde functional group of the acrylic microspheres via covalent bonding. The hybridization of the immobilized DNA probe with the complementary DNA was studied by differential pulse voltametry using anthraquninone-2-sulfonic acid monohydrate sodium salt (AQMS) as the electroactive hybridization label. The influences of many factors such as duration of DNA probe immobilization and hybridization, pH, type of ions, buffer concentrations, ionic strength, operational temperature and non-complementary DNA on the biosensor performance were evaluated. Under optimized conditions, the DNA microbiosensor demonstrated a linear response range to target DNA over a wide concentration range of 1.0 × 10−16 and 1.0 × 10−8 M with a lower limit of detection (LOD) of 9.46 × 10−17 M (R2 = 0.97). This DNA microbiosensor showed good reproducibility with 2.84% RSD (relative standard deviation) (n = 3). Application of the NAS-modified acrylic microspheres in the construction of DNA microbiosensor had improved the overall analytical performance of the resultant DNA microbiosensor when compared with other reported DNA biosensors using other nano-materials for membranes and microspheres as DNA immobilization matrices. PMID:22778594
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Insights into DNA-mediated interparticle interactions from a coarse-grained model
NASA Astrophysics Data System (ADS)
Ding, Yajun; Mittal, Jeetain
2014-11-01
DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.
Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio
2009-08-01
Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.
Development of High Throughput Process for Constructing 454 Titanium and Illumina Libraries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deshpande, Shweta; Hack, Christopher; Tang, Eric
2010-05-28
We have developed two processes with the Biomek FX robot to construct 454 titanium and Illumina libraries in order to meet the increasing library demands. All modifications in the library construction steps were made to enable the adaptation of the entire processes to work with the 96-well plate format. The key modifications include the shearing of DNA with Covaris E210 and the enzymatic reaction cleaning and fragment size selection with SPRI beads and magnetic plate holders. The construction of 96 Titanium libraries takes about 8 hours from sheared DNA to ssDNA recovery. The processing of 96 Illumina libraries takes lessmore » time than that of the Titanium library process. Although both processes still require manual transfer of plates from robot to other work stations such as thermocyclers, these robotic processes represent about 12- to 24-folds increase of library capacity comparing to the manual processes. To enable the sequencing of many libraries in parallel, we have also developed sets of molecular barcodes for both library types. The requirements for the 454 library barcodes include 10 bases, 40-60percent GC, no consecutive same base, and no less than 3 bases difference between barcodes. We have used 96 of the resulted 270 barcodes to construct libraries and pool to test the ability of accurately assigning reads to the right samples. When allowing 1 base error occurred in the 10 base barcodes, we could assign 99.6percent of the total reads and 100percent of them were uniquely assigned. As for the Illumina barcodes, the requirements include 4 bases, balanced GC, and at least 2 bases difference between barcodes. We have begun to assess the ability to assign reads after pooling different number of libraries. We will discuss the progress and the challenges of these scale-up processes.« less
Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng
2012-01-01
To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944
Tian, Yang; Li, Yan Hong
2017-01-01
To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Next-generation sequencing library construction on a surface.
Feng, Kuan; Costa, Justin; Edwards, Jeremy S
2018-05-30
Next-generation sequencing (NGS) has revolutionized almost all fields of biology, agriculture and medicine, and is widely utilized to analyse genetic variation. Over the past decade, the NGS pipeline has been steadily improved, and the entire process is currently relatively straightforward. However, NGS instrumentation still requires upfront library preparation, which can be a laborious process, requiring significant hands-on time. Herein, we present a simple but robust approach to streamline library preparation by utilizing surface bound transposases to construct DNA libraries directly on a flowcell surface. The surface bound transposases directly fragment genomic DNA while simultaneously attaching the library molecules to the flowcell. We sequenced and analysed a Drosophila genome library generated by this surface tagmentation approach, and we showed that our surface bound library quality was comparable to the quality of the library from a commercial kit. In addition to the time and cost savings, our approach does not require PCR amplification of the library, which eliminates potential problems associated with PCR duplicates. We described the first study to construct libraries directly on a flowcell. We believe our technique could be incorporated into the existing Illumina sequencing pipeline to simplify the workflow, reduce costs, and improve data quality.
A comparative study of ChIP-seq sequencing library preparation methods.
Sundaram, Arvind Y M; Hughes, Timothy; Biondi, Shea; Bolduc, Nathalie; Bowman, Sarah K; Camilli, Andrew; Chew, Yap C; Couture, Catherine; Farmer, Andrew; Jerome, John P; Lazinski, David W; McUsic, Andrew; Peng, Xu; Shazand, Kamran; Xu, Feng; Lyle, Robert; Gilfillan, Gregor D
2016-10-21
ChIP-seq is the primary technique used to investigate genome-wide protein-DNA interactions. As part of this procedure, immunoprecipitated DNA must undergo "library preparation" to enable subsequent high-throughput sequencing. To facilitate the analysis of biopsy samples and rare cell populations, there has been a recent proliferation of methods allowing sequencing library preparation from low-input DNA amounts. However, little information exists on the relative merits, performance, comparability and biases inherent to these procedures. Notably, recently developed single-cell ChIP procedures employing microfluidics must also employ library preparation reagents to allow downstream sequencing. In this study, seven methods designed for low-input DNA/ChIP-seq sample preparation (Accel-NGS® 2S, Bowman-method, HTML-PCR, SeqPlex™, DNA SMART™, TELP and ThruPLEX®) were performed on five replicates of 1 ng and 0.1 ng input H3K4me3 ChIP material, and compared to a "gold standard" reference PCR-free dataset. The performance of each method was examined for the prevalence of unmappable reads, amplification-derived duplicate reads, reproducibility, and for the sensitivity and specificity of peak calling. We identified consistent high performance in a subset of the tested reagents, which should aid researchers in choosing the most appropriate reagents for their studies. Furthermore, we expect this work to drive future advances by identifying and encouraging use of the most promising methods and reagents. The results may also aid judgements on how comparable are existing datasets that have been prepared with different sample library preparation reagents.
Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun
2014-08-01
Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.
ERIC Educational Resources Information Center
Militello, Kevin T.
2013-01-01
Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…
Electron transfer of plurimodified DNA SAMs.
Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff
2007-07-17
An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.
Current and future resources for functional metagenomics.
Lam, Kathy N; Cheng, Jiujun; Engel, Katja; Neufeld, Josh D; Charles, Trevor C
2015-01-01
Functional metagenomics is a powerful experimental approach for studying gene function, starting from the extracted DNA of mixed microbial populations. A functional approach relies on the construction and screening of metagenomic libraries-physical libraries that contain DNA cloned from environmental metagenomes. The information obtained from functional metagenomics can help in future annotations of gene function and serve as a complement to sequence-based metagenomics. In this Perspective, we begin by summarizing the technical challenges of constructing metagenomic libraries and emphasize their value as resources. We then discuss libraries constructed using the popular cloning vector, pCC1FOS, and highlight the strengths and shortcomings of this system, alongside possible strategies to maximize existing pCC1FOS-based libraries by screening in diverse hosts. Finally, we discuss the known bias of libraries constructed from human gut and marine water samples, present results that suggest bias may also occur for soil libraries, and consider factors that bias metagenomic libraries in general. We anticipate that discussion of current resources and limitations will advance tools and technologies for functional metagenomics research.
Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R
2015-01-01
Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.
Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta
2012-10-01
Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.
Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.
Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L
2004-04-01
Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.
Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics
Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte
2015-01-01
The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165
Fujita, Masahiro; Hiramine, Hayato; Pan, Pengju; Hikima, Takaaki; Maeda, Mizuo
2016-02-02
The thermoresponsive structural transition of poly(N-isopropylacrylamide) (PNIPAAm)-b-DNA copolymers was explored. Molecular assembly of the block copolymers was facilitated by adding salt, and this assembly was not nucleated by the association between DNA strands but by the coil-globule transition of PNIPAAm blocks. Below the lower critical solution temperature (LCST) of PNIPAAm, the copolymer solution remained transparent even at high salt concentrations, regardless of whether DNA was hybridized with its complementary partner to form a double-strand (or single-strand) structure. At the LCST, the hybridized copolymer assembled in spherical nanoparticles, surrounded by double-stranded DNA; subsequently, the non-cross-linking aggregation occurred, while the nanoparticles were dispersed if the salt concentration was low or DNA blocks were unhybridized. When the DNA duplex was denatured to a single-stranded state by heating, the aggregated nanoparticles redispersed owing to the recovery of the steric repulsion of the DNA strands. The changes in the steric and electrostatic effects by hybridization and the addition of salt did not result in any specific attraction between DNA strands but merely decreased the repulsive interactions. The van der Waals attraction between the nanoparticles overcame such repulsive interactions so that the non-cross-linking aggregation of the micellar particles was mediated.
Belyanskaya, Svetlana L; Ding, Yun; Callahan, James F; Lazaar, Aili L; Israel, David I
2017-05-04
DNA-encoded chemical library technology was developed with the vision of its becoming a transformational platform for drug discovery. The hope was that a new paradigm for the discovery of low-molecular-weight drugs would be enabled by combining the vast molecular diversity achievable with combinatorial chemistry, the information-encoding attributes of DNA, the power of molecular biology, and a streamlined selection-based discovery process. Here, we describe the discovery and early clinical development of GSK2256294, an inhibitor of soluble epoxide hydrolase (sEH, EPHX2), by using encoded-library technology (ELT). GSK2256294 is an orally bioavailable, potent and selective inhibitor of sEH that has a long half life and produced no serious adverse events in a first-time-in-human clinical study. To our knowledge, GSK2256294 is the first molecule discovered from this technology to enter human clinical testing and represents a realization of the vision that DNA-encoded chemical library technology can efficiently yield molecules with favorable properties that can be readily progressed into high-quality drugs. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Genomic sequencing of Pleistocene cave bears
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noonan, James P.; Hofreiter, Michael; Smith, Doug
2005-04-01
Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome,more » the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.« less
Double stranded nucleic acid biochips
Chernov, Boris; Golova, Julia
2006-05-23
This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.
Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis
Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.
1999-01-01
With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stapleton, Mark; Liao, Guochun; Brokstein, Peter
2002-08-12
Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less
Frequent gene flow blurred taxonomic boundaries of sections in Lilium L. (Liliaceae)
Liu, Shih-Hui; Chiang, Tzen-Yuh
2017-01-01
Gene flow between species may last a long time in plants. Reticulation inevitably causes difficulties in phylogenetic reconstruction. In this study, we looked into the genetic divergence and phylogeny of 20 Lilium species based on multilocus analyses of 8 genes of chloroplast DNA (cpDNA), the internally transcribed nuclear ribosomal DNA (nrITS) spacer and 20 loci extracted from the expressed sequence tag (EST) libraries of L. longiflorum Thunb. and L. formosanum Wallace. The phylogeny based on the combined data of the maternally inherited cpDNA and nrITS was largely consistent with the taxonomy of Lilium sections. This phylogeny was deemed the hypothetical species tree and uncovered three groups, i.e., Cluster A consisting of 4 taxa from the sections Pseudolirium and Liriotypus, Cluster B consisting of the 4 taxa from the sections Leucolirion, Archelirion and Daurolirion, and Cluster C comprising 10 taxa mostly from the sections Martagon and Sinomartagon. In contrast, systematic inconsistency occurred across the EST loci, with up to 19 genes (95%) displaying tree topologies deviating from the hypothetical species tree. The phylogenetic incongruence was likely attributable to the frequent genetic exchanges between species/sections, as indicated by the high levels of genetic recombination and the IMa analyses with the EST loci. Nevertheless, multilocus analysis could provide complementary information among the loci on the species split and the extent of gene flow between the species. In conclusion, this study not only detected frequent gene flow among Lilium sections that resulted in phylogenetic incongruence but also reconstructed a hypothetical species tree that gave insights into the nature of the complex relationships among Lilium species. PMID:28841664
Kristiansen, Anja; Lindholst, Sabine; Feilberg, Anders; Nielsen, Per H.; Neufeld, Josh D.; Nielsen, Jeppe L.
2011-01-01
Biofiltration has proven an efficient tool for the elimination of volatile organic compounds (VOCs) and ammonia from livestock facilities, thereby reducing nuisance odors and ammonia emissions to the local environment. The active microbial communities comprising these filter biofilms have not been well characterized. In this study, a trickle biofilter treating air from a pig facility was investigated and proved efficient in removing carboxylic acids (>70% reduction), mainly attributed to the primary filter section within which reduced organic sulfur compounds were also depleted (up to 50%). The secondary filter eliminated several aromatic compounds: phenol (81%), p-cresol (89%), 4-ethylphenol (68%), indole (48%), and skatole (69%). The active butyric acid degrading bacterial community of an air filter sample was identified by DNA stable-isotope probing (DNA-SIP) and microautoradiography, combined with fluorescence in situ hybridization (MAR-FISH). The predominant 16S rRNA gene sequences from a clone library derived from “heavy” DNA from [13C4]butyric acid incubations were Microbacterium, Gordonia, Dietzia, Rhodococcus, Propionibacterium, and Janibacter, all from the Actinobacteria. Actinobacteria were confirmed and quantified by MAR-FISH as being the major bacterial phylum assimilating butyric acid along with several Burkholderiales-related Betaproteobacteria. The active bacterial community assimilating dimethyl disulfide (DMDS) was characterized by DNA-SIP and MAR-FISH and found to be associated with the Actinobacteria, along with a few representatives of Flavobacteria and Sphingobacteria. Interestingly, ammonia-oxidizing Betaproteobacteria were also implicated in DMDS degradation, as were fungi. Thus, multiple isotope-based methods provided complementary data, enabling high-resolution identification and quantitative assessments of odor-eliminating Actinobacteria-dominated populations of these biofilter environments. PMID:22003018
Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André
2005-07-01
The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.
Kristiansen, Anja; Lindholst, Sabine; Feilberg, Anders; Nielsen, Per H; Neufeld, Josh D; Nielsen, Jeppe L
2011-12-01
Biofiltration has proven an efficient tool for the elimination of volatile organic compounds (VOCs) and ammonia from livestock facilities, thereby reducing nuisance odors and ammonia emissions to the local environment. The active microbial communities comprising these filter biofilms have not been well characterized. In this study, a trickle biofilter treating air from a pig facility was investigated and proved efficient in removing carboxylic acids (>70% reduction), mainly attributed to the primary filter section within which reduced organic sulfur compounds were also depleted (up to 50%). The secondary filter eliminated several aromatic compounds: phenol (81%), p-cresol (89%), 4-ethylphenol (68%), indole (48%), and skatole (69%). The active butyric acid degrading bacterial community of an air filter sample was identified by DNA stable-isotope probing (DNA-SIP) and microautoradiography, combined with fluorescence in situ hybridization (MAR-FISH). The predominant 16S rRNA gene sequences from a clone library derived from "heavy" DNA from [(13)C(4)]butyric acid incubations were Microbacterium, Gordonia, Dietzia, Rhodococcus, Propionibacterium, and Janibacter, all from the Actinobacteria. Actinobacteria were confirmed and quantified by MAR-FISH as being the major bacterial phylum assimilating butyric acid along with several Burkholderiales-related Betaproteobacteria. The active bacterial community assimilating dimethyl disulfide (DMDS) was characterized by DNA-SIP and MAR-FISH and found to be associated with the Actinobacteria, along with a few representatives of Flavobacteria and Sphingobacteria. Interestingly, ammonia-oxidizing Betaproteobacteria were also implicated in DMDS degradation, as were fungi. Thus, multiple isotope-based methods provided complementary data, enabling high-resolution identification and quantitative assessments of odor-eliminating Actinobacteria-dominated populations of these biofilter environments.
Schäffer, Christian; Todea, Ana Maria; Gouzerh, Pierre; Müller, Achim
2012-01-11
The addition of dinuclear {Mo(2)} units to a dynamic library containing molybdates results in the spontaneous self-assembly of a giant spherical metal-oxide species of the type {(Mo)Mo(5)}(12){Mo(2)}(30) while the required pentagonal {(Mo)Mo(5)} building blocks are "immediately" formed. This journal is © The Royal Society of Chemistry 2012
Potential of mean force of DNA guided assemblies past Debye-Hückel regime
NASA Astrophysics Data System (ADS)
Girard, Martin; Seo, Soyoung; Li, Yaohua; Mirkin, Chad; Olvera de La Cruz, Monica
Many of the bioinspired systems make use of biopolymers such as polypeptides or DNA. The latter is widely used in self-assembled systems, from colloidal crystals to origami construction. In these systems, salt is commonly required to screen the electrostatic repulsion between the strands. In the classical Debye-Hückel picture, salt ions are point particles and the screening distance is a decreasing monotonic function of salt concentration. This picture breaks down at moderate salt concentrations, where the behavior becomes non-monotonic. In this talk, we will show results for potential of mean force of DNA grafted colloids obtained through multiscale molecular dynamics. In this picture, the highly charged DNA causes non-trivial behavior at moderate salt concentrations (c 0 . 3 - 0 . 7 M), namely increase of repulsion for non-complementary DNA strands while repulsion decreases for complementary strands. We will show spatial cluster distribution as function of size and charge as well as implications for experimental systems.
Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka
2013-07-15
Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A
2015-08-13
The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.
2015-01-01
The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure–activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality. PMID:26288689
Construction of a general human chromosome jumping library, with application to cystic fibrosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, F.S.; Drumm, M.L.; Cole, J.L.
1987-02-27
In many genetic disorders, the responsible gene and its protein product are unknown. The technique known as reverse genetics, in which chromosomal map positions and genetically linked DNA markers are used to identify and clone such genes, is complicated by the fact that the molecular distances from the closest DNA markers to the gene itself are often too large to traverse by standard cloning techniques. To address this situation, a general human chromosome jumping library was constructed that allows the cloning of DNA sequences approximately 100 kilobases away from any starting point in genomic DNA. As an illustration of itsmore » usefulness, this library was searched for a jumping clone, starting at the met oncogene, which is a marker tightly linked to the cystic fibrosis gene that is located on human chromosome 7. Mapping of the new genomic fragment by pulsed field gel electrophoresis confirmed that it resides on chromosome 7 within 240 kilobases downstream of the met gene. The use of chromosome jumping should be applicable to any genetic locus for which a closely linked DNA marker is available.« less
Senthilkumar, Palanisamy; Thirugnanasambantham, Krishnaraj; Mandal, Abul Kalam Azad
2012-12-01
Tea (Camellia sinensis (L.) O. Kuntze) is an economically important plant cultivated for its leaves. Infection of Pestalotiopsis theae in leaves causes gray blight disease and enormous loss to the tea industry. We used suppressive subtractive hybridization (SSH) technique to unravel the differential gene expression pattern during gray blight disease development in tea. Complementary DNA from P. theae-infected and uninfected leaves of disease tolerant cultivar UPASI-10 was used as tester and driver populations respectively. Subtraction efficiency was confirmed by comparing abundance of β-actin gene. A total of 377 and 720 clones with insert size >250 bp from forward and reverse library respectively were sequenced and analyzed. Basic Local Alignment Search Tool analysis revealed 17 sequences in forward SSH library have high degree of similarity with disease and hypersensitive response related genes and 20 sequences with hypothetical proteins while in reverse SSH library, 23 sequences have high degree of similarity with disease and stress response-related genes and 15 sequences with hypothetical proteins. Functional analysis indicated unknown (61 and 59 %) or hypothetical functions (23 and 18 %) for most of the differentially regulated genes in forward and reverse SSH library, respectively, while others have important role in different cellular activities. Majority of the upregulated genes are related to hypersensitive response and reactive oxygen species production. Based on these expressed sequence tag data, putative role of differentially expressed genes were discussed in relation to disease. We also demonstrated the efficiency of SSH as a tool in enriching gray blight disease related up- and downregulated genes in tea. The present study revealed that many genes related to disease resistance were suppressed during P. theae infection and enhancing these genes by the application of inducers may impart better disease tolerance to the plants.
Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir
2013-01-01
An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied Microbiology.
DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures
Barth, Anna; Kobbe, Daniela; Focke, Manfred
2016-01-01
Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Swati; Kumar, Ashok, E-mail: rajesh-csir@yahoo.com, E-mail: ashokigib@rediffmail.com; Academy of Scientific and Innovative Research
A specific and ultrasensitive, label free single-walled carbon nanotubes (SWNTs) based chemiresistive genosensor was fabricated for the early detection of Streptococcus pyogenes infection in human causing rheumatic heart disease. The mga gene of S. pyogenes specific 24 mer ssDNA probe was covalently immobilized on SWNT through a molecular bilinker, 1-pyrenemethylamine, using carbodiimide coupling reaction. The sensor was characterized by the current-voltage (I-V) characteristic curve and scanning electron microscopy. The sensing performance of the sensor was studied with respect to changes in conductance in SWNT channel based on hybridization of the target S. pyogenes single stranded genomic DNA (ssG-DNA) to itsmore » complementary 24 mer ssDNA probe. The sensor shows negligible response to non-complementary Staphylococcus aureus ssG-DNA, confirming the specificity of the sensor only with S. pyogenes. The genosensor exhibited a linear response to S. pyogenes G-DNA from 1 to1000 ng ml{sup −1} with a limit of detection of 0.16 ng ml{sup −1}.« less
Quantum dot-based microfluidic biosensor for cancer detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli
2015-05-11
We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less
USDA-ARS?s Scientific Manuscript database
For map-based cloning of genes conferring important traits in the hexaploid wheat line 92R137, a bacterial artificial chromosome (BAC) library, including two sub libraries, was constructed using the genomic DNA of 92R137 digested with restriction enzymes HindIII and BamHI. The BAC library was compos...
Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection
NASA Astrophysics Data System (ADS)
Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.
2017-09-01
Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.
Controlled assembly of artificial protein-protein complexes via DNA duplex formation.
Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J
2015-03-18
DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.
Shinozuka, Hiroshi; Forster, John W
2016-01-01
Background. Multiplexed sequencing is commonly performed on massively parallel short-read sequencing platforms such as Illumina, and the efficiency of library normalisation can affect the quality of the output dataset. Although several library normalisation approaches have been established, none are ideal for highly multiplexed sequencing due to issues of cost and/or processing time. Methods. An inexpensive and high-throughput library quantification method has been developed, based on an adaptation of the melting curve assay. Sequencing libraries were subjected to the assay using the Bio-Rad Laboratories CFX Connect(TM) Real-Time PCR Detection System. The library quantity was calculated through summation of reduction of relative fluorescence units between 86 and 95 °C. Results.PCR-enriched sequencing libraries are suitable for this quantification without pre-purification of DNA. Short DNA molecules, which ideally should be eliminated from the library for subsequent processing, were differentiated from the target DNA in a mixture on the basis of differences in melting temperature. Quantification results for long sequences targeted using the melting curve assay were correlated with those from existing methods (R (2) > 0.77), and that observed from MiSeq sequencing (R (2) = 0.82). Discussion.The results of multiplexed sequencing suggested that the normalisation performance of the described method is equivalent to that of another recently reported high-throughput bead-based method, BeNUS. However, costs for the melting curve assay are considerably lower and processing times shorter than those of other existing methods, suggesting greater suitability for highly multiplexed sequencing applications.
A Novel Approach to Assay DNA Methylation in Prostate Cancer
2016-10-01
prepared into libraries according to standard protocols using Bioo Scientific’s DNA Sample Kit (cat. no. 514101, Austin , TX , USA). Libraries were...Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release; Distribution Unlimited...ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S
Covalent antibody display—an in vitro antibody-DNA library selection system
Reiersen, Herald; Løbersli, Inger; Løset, Geir Å.; Hvattum, Else; Simonsen, Bjørg; Stacy, John E.; McGregor, Duncan; FitzGerald, Kevin; Welschof, Martin; Brekke, Ole H.; Marvik, Ole J.
2005-01-01
The endonuclease P2A initiates the DNA replication of the bacteriophage P2 by making a covalent bond with its own phosphate backbone. This enzyme has now been exploited as a new in vitro display tool for antibody fragments. We have constructed genetic fusions of P2A with single-chain antibodies (scFvs). Linear DNA of these fusion proteins were processed in an in vitro coupled transcription–translation mixture of Escherichia coli S30 lysate. Complexes of scFv–P2A fusion proteins covalently bound to their own DNA were isolated after panning on immobilized antigen, and the enriched DNAs were recovered by PCR and prepared for the subsequent cycles of panning. We have demonstrated the enrichment of scFvs from spiked libraries and the specific selection of different anti-tetanus toxoid scFvs from a V-gene library with 50 million different members prepared from human lymphocytes. This covalent antibody display technology offers a complete in vitro selection system based exclusively on DNA–protein complexes. PMID:15653626
Czar, Michael J; Cai, Yizhi; Peccoud, Jean
2009-07-01
Chemical synthesis of custom DNA made to order calls for software streamlining the design of synthetic DNA sequences. GenoCAD (www.genocad.org) is a free web-based application to design protein expression vectors, artificial gene networks and other genetic constructs composed of multiple functional blocks called genetic parts. By capturing design strategies in grammatical models of DNA sequences, GenoCAD guides the user through the design process. By successively clicking on icons representing structural features or actual genetic parts, complex constructs composed of dozens of functional blocks can be designed in a matter of minutes. GenoCAD automatically derives the construct sequence from its comprehensive libraries of genetic parts. Upon completion of the design process, users can download the sequence for synthesis or further analysis. Users who elect to create a personal account on the system can customize their workspace by creating their own parts libraries, adding new parts to the libraries, or reusing designs to quickly generate sets of related constructs.
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas
2014-04-01
The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Construction and application of EST library from Setaria italica in response to dehydration stress.
Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying
2007-07-01
Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.
Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella
2017-02-23
Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.
O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R
2017-10-17
Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure-a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery-imagine being able to evolve molecules for light harvesting, or catalysts for CO 2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous "DNA robots" have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery
2017-01-01
Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a system that can translate instructions coded as a sequence of DNA bases into a chemical structure—a process analogous to the action of the ribosome in living organisms but with the potential to create a much more chemically diverse set of products. It is also possible to ensure that each product molecule is tagged with its identifying DNA sequence. Compound libraries synthesized in this way can be exposed to selection against suitable targets, enriching successful molecules. The encoding DNA can then be amplified using the polymerase chain reaction and decoded by DNA sequencing. More importantly, the DNA instruction sequences can be mutated and reused during multiple rounds of amplification, translation, and selection. In other words, DTS could be used as the foundation for a system of synthetic molecular evolution, which could allow us to efficiently search a vast chemical space. This has huge potential to revolutionize materials discovery—imagine being able to evolve molecules for light harvesting, or catalysts for CO2 fixation. The field of DTS has developed to the point where a wide variety of reactions can be performed on a DNA template. Complex architectures and autonomous “DNA robots” have been implemented for the controlled assembly of BBs, and these mechanisms have in turn enabled the one-pot synthesis of large combinatorial libraries. Indeed, DTS libraries are being exploited by pharmaceutical companies and have already found their way into drug lead discovery programs. This Account explores the processes involved in DTS and highlights the challenges that remain in creating a general system for molecular discovery by evolution. PMID:28915003
Encoded libraries of chemically modified peptides.
Heinis, Christian; Winter, Greg
2015-06-01
The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.
Dasari, Surendra; Chambers, Matthew C.; Martinez, Misti A.; Carpenter, Kristin L.; Ham, Amy-Joan L.; Vega-Montoto, Lorenzo J.; Tabb, David L.
2012-01-01
Spectral libraries have emerged as a viable alternative to protein sequence databases for peptide identification. These libraries contain previously detected peptide sequences and their corresponding tandem mass spectra (MS/MS). Search engines can then identify peptides by comparing experimental MS/MS scans to those in the library. Many of these algorithms employ the dot product score for measuring the quality of a spectrum-spectrum match (SSM). This scoring system does not offer a clear statistical interpretation and ignores fragment ion m/z discrepancies in the scoring. We developed a new spectral library search engine, Pepitome, which employs statistical systems for scoring SSMs. Pepitome outperformed the leading library search tool, SpectraST, when analyzing data sets acquired on three different mass spectrometry platforms. We characterized the reliability of spectral library searches by confirming shotgun proteomics identifications through RNA-Seq data. Applying spectral library and database searches on the same sample revealed their complementary nature. Pepitome identifications enabled the automation of quality analysis and quality control (QA/QC) for shotgun proteomics data acquisition pipelines. PMID:22217208
Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.
Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun
2018-06-26
Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.
Establishing a community-wide DNA barcode library as a new tool for arctic research.
Wirta, H; Várkonyi, G; Rasmussen, C; Kaartinen, R; Schmidt, N M; Hebert, P D N; Barták, M; Blagoev, G; Disney, H; Ertl, S; Gjelstrup, P; Gwiazdowicz, D J; Huldén, L; Ilmonen, J; Jakovlev, J; Jaschhof, M; Kahanpää, J; Kankaanpää, T; Krogh, P H; Labbee, R; Lettner, C; Michelsen, V; Nielsen, S A; Nielsen, T R; Paasivirta, L; Pedersen, S; Pohjoismäki, J; Salmela, J; Vilkamaa, P; Väre, H; von Tschirnhaus, M; Roslin, T
2016-05-01
DNA sequences offer powerful tools for describing the members and interactions of natural communities. In this study, we establish the to-date most comprehensive library of DNA barcodes for a terrestrial site, including all known macroscopic animals and vascular plants of an intensively studied area of the High Arctic, the Zackenberg Valley in Northeast Greenland. To demonstrate its utility, we apply the library to identify nearly 20 000 arthropod individuals from two Malaise traps, each operated for two summers. Drawing on this material, we estimate the coverage of previous morphology-based species inventories, derive a snapshot of faunal turnover in space and time and describe the abundance and phenology of species in the rapidly changing arctic environment. Overall, 403 terrestrial animal and 160 vascular plant species were recorded by morphology-based techniques. DNA barcodes (CO1) offered high resolution in discriminating among the local animal taxa, with 92% of morphologically distinguishable taxa assigned to unique Barcode Index Numbers (BINs) and 93% to monophyletic clusters. For vascular plants, resolution was lower, with 54% of species forming monophyletic clusters based on barcode regions rbcLa and ITS2. Malaise catches revealed 122 BINs not detected by previous sampling and DNA barcoding. The insect community was dominated by a few highly abundant taxa. Even closely related taxa differed in phenology, emphasizing the need for species-level resolution when describing ongoing shifts in arctic communities and ecosystems. The DNA barcode library now established for Zackenberg offers new scope for such explorations, and for the detailed dissection of interspecific interactions throughout the community. © 2015 John Wiley & Sons Ltd.
Current and future resources for functional metagenomics
Lam, Kathy N.; Cheng, Jiujun; Engel, Katja; Neufeld, Josh D.; Charles, Trevor C.
2015-01-01
Functional metagenomics is a powerful experimental approach for studying gene function, starting from the extracted DNA of mixed microbial populations. A functional approach relies on the construction and screening of metagenomic libraries—physical libraries that contain DNA cloned from environmental metagenomes. The information obtained from functional metagenomics can help in future annotations of gene function and serve as a complement to sequence-based metagenomics. In this Perspective, we begin by summarizing the technical challenges of constructing metagenomic libraries and emphasize their value as resources. We then discuss libraries constructed using the popular cloning vector, pCC1FOS, and highlight the strengths and shortcomings of this system, alongside possible strategies to maximize existing pCC1FOS-based libraries by screening in diverse hosts. Finally, we discuss the known bias of libraries constructed from human gut and marine water samples, present results that suggest bias may also occur for soil libraries, and consider factors that bias metagenomic libraries in general. We anticipate that discussion of current resources and limitations will advance tools and technologies for functional metagenomics research. PMID:26579102
Rashid, Jahwarhar Izuan Abdul; Yusof, Nor Azah; Abdullah, Jaafar; Hashim, Uda; Hajian, Reza
2014-12-01
This work describes the incorporation of SiNWs/AuNPs composite as a sensing material for DNA detection on indium tin-oxide (ITO) coated glass slide. The morphology of SiNWs/AuNPs composite as the modifier layer on ITO was studied by scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX). The morphological studies clearly showed that SiNWs were successfully decorated with 20 nm-AuNPs using self-assembly monolayer (SAM) technique. The effective surface area for SiNWs/AuNPs-modified ITO enhanced about 10 times compared with bare ITO electrode. SiNWs/AuNPs nanocomposite was further explored as a matrix for DNA probe immobilization in detection of dengue virus as a bio-sensing model to evaluate its performance in electrochemical sensors. The hybridization of complementary DNA was monitored by differential pulse voltammetry (DPV) using methylene blue (MB) as the redox indicator. The fabricated biosensor was able to discriminate significantly complementary, non-complementary and single-base mismatch oligonucleotides. The electrochemical biosensor was sensitive to target DNA related to dengue virus in the range of 9.0-178.0 ng/ml with detection limit of 3.5 ng/ml. In addition, SiNWs/AuNPs-modified ITO, regenerated up to 8 times and its stability was up to 10 weeks at 4°C in silica gel. Copyright © 2014 Elsevier B.V. All rights reserved.
Use of RecA protein to enrich for homologous genes in a genomic library
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taidi-Laskowski, B.; Grumet, F.C.; Tyan, D.
1988-08-25
RecA protein-coated probe has been utilized to enrich genomic digests for desired genes in order to facilitate cloning from genomic libraries. Using a previously cloned HLA-B27 gene as the recA-coated enrichment probe, the authors obtained a mean 108x increase in the ratio of specific to nonspecific plaques in lambda libraries screened for B27 variant alleles of estimated 99% homology to the probe. Class I genes of lesser homology were less enriched. Loss of genomic DNA during the enrichment procedure can, however, restrict application of this technique whenever starting genomic DNA is very limited. Nevertheless, the impressive reduction in cloning effortmore » and material makes recA enrichment a useful new tool for cloning homologous genes from genomic DNA.« less
Metagenomic Analysis of Viral Communities in (Hado)Pelagic Sediments
Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken
2013-01-01
In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 106 to 1011 viruses/cm3 of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24−30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10−3 in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95−99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses. PMID:23468952
Metagenomic analysis of viral communities in (hado)pelagic sediments.
Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken
2013-01-01
In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 10(6) to 10(11) viruses/cm(3) of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24-30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10(-3) in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95-99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses.
[Cosmid libraries containing DNA from human chromosome 13].
Kapanadze, B I; Brodianskiĭ, V M; Baranova, A V; Sevat'ianov, S Iu; Fedorova, N D; Kurskov, M M; Kostina, M A; Mironov, A A; Sineokiĭ, S P; Zakhar'ev, V M; Grafodatskiĭ, A S; Modianov, N N; Iankovskiĭ, N K
1996-03-01
We characterized two cosmid libraries constructed from flow-sorted chromosome 13 at the Imperial Cancer Research Fund (ICRF), UK (13,000 clones) and Los Alamos National Laboratory (LANL), USA (17,000 clones). After storage for two years, clones showed high viability (95%) and structural stability. EcoR I and Hind III restriction patterns were studied in more than 500 ICRF and 200 LANL cosmids. The average size of inserts was shown to be 35-37 kb in both the libraries. Most cosmids (83% and 93% of ICRF and LANL libraries, respectively) exceed the lower size limit of DNA fragments that can be packaged and represent a good source for physical mapping of chromosome 13. Total length of inserts is four and five genome equivalents in the ICRF and LANL libraries, respectively. ICRF cosmids showed hybridization to 22 of 24 unique probes tested, which corresponds to a 90% probability of having any DNA fragment represented in the library. More than 1 Mb of chromosome 13 is overlapped by 90 cosmids of 22 groups revealed. A chromosomal region of more than 150 kb, containing the ATP1AL1 gene for alpha-1 peptide of Na+, K(+)-ATPase, is covered by 12 cosmids forming a contig. The results of restriction and hybridization analyses are stored in a CLONE database. These data and all the cosmids described are publicly available.
Carbohydrate active enzymes revealed in Coptotermes formosanus transcriptome
USDA-ARS?s Scientific Manuscript database
A normalized cDNA library of Coptotermes formosanus was constructed using mixed RNA isolated from workers, soldiers, nymphs and alates of both sexes. Sequencing of this library generated 131,637 EST and 25,939 unigenes were assembled. Carbohydrate active enzymes (CAZymes) revealed in this library we...
Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F
2011-05-19
Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be immediately applied to large scale screening and discovery of novel protein-protein interactions. All libraries are freely available for distribution to the research community.
Ahour, F; Shamsi, A
2017-09-01
Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11 M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.
2011-01-01
Background When a specimen belongs to a species not yet represented in DNA barcode reference libraries there is disagreement over the effectiveness of using sequence comparisons to assign the query accurately to a higher taxon. Library completeness and the assignment criteria used have been proposed as critical factors affecting the accuracy of such assignments but have not been thoroughly investigated. We explored the accuracy of assignments to genus, tribe and subfamily in the Sphingidae, using the almost complete global DNA barcode reference library (1095 species) available for this family. Costa Rican sphingids (118 species), a well-documented, diverse subset of the family, with each of the tribes and subfamilies represented were used as queries. We simulated libraries with different levels of completeness (10-100% of the available species), and recorded assignments (positive or ambiguous) and their accuracy (true or false) under six criteria. Results A liberal tree-based criterion assigned 83% of queries accurately to genus, 74% to tribe and 90% to subfamily, compared to a strict tree-based criterion, which assigned 75% of queries accurately to genus, 66% to tribe and 84% to subfamily, with a library containing 100% of available species (but excluding the species of the query). The greater number of true positives delivered by more relaxed criteria was negatively balanced by the occurrence of more false positives. This effect was most sharply observed with libraries of the lowest completeness where, for example at the genus level, 32% of assignments were false positives with the liberal criterion versus < 1% when using the strict. We observed little difference (< 8% using the liberal criterion) however, in the overall accuracy of the assignments between the lowest and highest levels of library completeness at the tribe and subfamily level. Conclusions Our results suggest that when using a strict tree-based criterion for higher taxon assignment with DNA barcodes, the likelihood of assigning a query a genus name incorrectly is very low, if a genus name is provided it has a high likelihood of being accurate, and if no genus match is available the query can nevertheless be assigned to a subfamily with high accuracy regardless of library completeness. DNA barcoding often correctly assigned sphingid moths to higher taxa when species matches were unavailable, suggesting that barcode reference libraries can be useful for higher taxon assignments long before they achieve complete species coverage. PMID:21806794
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-09-24
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-01-01
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490
The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested
What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan
2017-12-01
Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.
Zhou, Juanjuan; Liao, Hua; Li, Shan; Zhou, Chenhui; Huang, Yan; Li, Xuerong; Liang, Chi; Yu, Xinbing
2015-08-01
Clonorchis sinensis triosephosphate isomerase (CsTIM) is a key regulatory enzyme of glycolysis and gluconeogenesis, which catalyzes the interconversion of glyceraldehyde 3-phosphate to dihydroxyacetone phosphate. In this study, the biochemical characterizations of CsTIM have been examined. A full-length complementary DNA (cDNA; Cs105350) sequence encoding CsTIM was obtained from our C. sinensis cDNA library. The open reading frame of CsTIM contains 759 bp which encodes 252 amino acids. The amino acid sequence of CsTIM shares 60-65% identity with other species. Western blot analysis displayed that recombinant CsTIM (rCsTIM) can be probed by anti-rCsTIM rat serum and anti-C. sinensis excretory/secretory products (anti-CsESPs) rat serum. Quantitative reverse transcription (RT)-PCR and western blotting analysis revealed that CsTIM messenger RNA (mRNA) and protein were differentially expressed in development cycle stages of the parasite, including adult worm, metacercaria, excysted metacercaria, and egg. In addition, immunolocalization assay showed that CsTIM was located in the seminal vesicle, eggs, and testicle. Moreover, rCsTIM exhibited active enzyme activity in catalytic reactions. The Michaelis constant (K m) of rCsTIM was 0.33 mM, when using glyceraldehyde 3-phosphate as the substrate. The optimal temperature and pH of CsTIM were 37 °C and 7.5-9.5, respectively. Collectively, these results suggest that CsTIM is an important protein involved in glycometabolism, and CsTIM possibly take part in many biological functions in the growth and development of C. sinensis.
Mills, Heath J.; Martinez, Robert J.; Story, Sandra; Sobecky, Patricia A.
2004-01-01
In this study, the composition of the metabolically active fraction of the microbial community occurring in Gulf of Mexico marine sediments (water depth, 550 to 575 m) with overlying filamentous bacterial mats was determined. The mats were mainly composed of either orange- or white-pigmented Beggiatoa spp. Complementary 16S ribosomal DNA (crDNA) was obtained from rRNA extracted from three different sediment depths (0 to 2, 6 to 8, and 10 to 12 cm) that had been subjected to reverse transcription-PCR amplification. Domain-specific 16S PCR primers were used to construct 12 different 16S crDNA libraries containing 333 Archaea and 329 Bacteria clones. Analysis of the Archaea clones indicated that all sediment depths associated with overlying orange- and white-pigmented microbial mats were almost exclusively dominated by ANME-2 (95% of total Archaea clones), a lineage related to the methanogenic order Methanosarcinales. In contrast, bacterial diversity was considerably higher, with the dominant phylotype varying by sediment depth. An equivalent number of clones detected at 0 to 2 cm, representing a total of 93%, were related to the γ and δ classes of Proteobacteria, whereas clones related to δ-Proteobacteria dominated the metabolically active fraction of the bacterial community occurring at 6 to 8 cm (79%) and 10 to 12 cm (85%). This is the first phylogenetics-based evaluation of the presumptive metabolically active fraction of the Bacteria and Archaea community structure investigated along a sediment depth profile in the northern Gulf of Mexico, a hydrocarbon-rich cold-seep region. PMID:15345432
Gaid, Mariam M; Sircar, Debabrata; Müller, Andreas; Beuerle, Till; Liu, Benye; Ernst, Ludger; Hänsch, Robert; Beerhues, Ludger
2012-11-01
Although a number of plant natural products are derived from benzoic acid, the biosynthesis of this structurally simple precursor is poorly understood. Hypericum calycinum cell cultures accumulate a benzoic acid-derived xanthone phytoalexin, hyperxanthone E, in response to elicitor treatment. Using a subtracted complementary DNA (cDNA) library and sequence information about conserved coenzyme A (CoA) ligase motifs, a cDNA encoding cinnamate:CoA ligase (CNL) was isolated. This enzyme channels metabolic flux from the general phenylpropanoid pathway into benzenoid metabolism. HcCNL preferred cinnamic acid as a substrate but failed to activate benzoic acid. Enzyme activity was strictly dependent on the presence of Mg²⁺ and K⁺ at optimum concentrations of 2.5 and 100 mM, respectively. Coordinated increases in the Phe ammonia-lyase and HcCNL transcript levels preceded the accumulation of hyperxanthone E in cell cultures of H. calycinum after the addition of the elicitor. HcCNL contained a carboxyl-terminal type 1 peroxisomal targeting signal made up by the tripeptide Ser-Arg-Leu, which directed an amino-terminal reporter fusion to the peroxisomes. Masking the targeting signal by carboxyl-terminal reporter fusion led to cytoplasmic localization. A phylogenetic tree consisted of two evolutionarily distinct clusters. One cluster was formed by CoA ligases related to benzenoid metabolism, including HcCNL. The other cluster comprised 4-coumarate:CoA ligases from spermatophytes, ferns, and mosses, indicating divergence of the two clades prior to the divergence of the higher plant lineages.
Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun
2013-01-01
In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105
Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun
2013-05-24
In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.
Construction of C35 gene bait recombinants and T47D cell cDNA library.
Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge
2017-11-20
C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M
2017-06-01
The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.
Determination of a Screening Metric for High Diversity DNA Libraries.
Guido, Nicholas J; Handerson, Steven; Joseph, Elaine M; Leake, Devin; Kung, Li A
2016-01-01
The fields of antibody engineering, enzyme optimization and pathway construction rely increasingly on screening complex variant DNA libraries. These highly diverse libraries allow researchers to sample a maximized sequence space; and therefore, more rapidly identify proteins with significantly improved activity. The current state of the art in synthetic biology allows for libraries with billions of variants, pushing the limits of researchers' ability to qualify libraries for screening by measuring the traditional quality metrics of fidelity and diversity of variants. Instead, when screening variant libraries, researchers typically use a generic, and often insufficient, oversampling rate based on a common rule-of-thumb. We have developed methods to calculate a library-specific oversampling metric, based on fidelity, diversity, and representation of variants, which informs researchers, prior to screening the library, of the amount of oversampling required to ensure that the desired fraction of variant molecules will be sampled. To derive this oversampling metric, we developed a novel alignment tool to efficiently measure frequency counts of individual nucleotide variant positions using next-generation sequencing data. Next, we apply a method based on the "coupon collector" probability theory to construct a curve of upper bound estimates of the sampling size required for any desired variant coverage. The calculated oversampling metric will guide researchers to maximize their efficiency in using highly variant libraries.
Characterization of complementary electric field coupled resonant surfaces
NASA Astrophysics Data System (ADS)
Hand, Thomas H.; Gollub, Jonah; Sajuyigbe, Soji; Smith, David R.; Cummer, Steven A.
2008-11-01
We present angle-resolved free-space transmission and reflection measurements of a surface composed of complementary electric inductive-capacitive (CELC) resonators. By measuring the reflection and transmission coefficients of a CELC surface with different polarizations and particle orientations, we show that the CELC only responds to in-plane magnetic fields. This confirms the Babinet particle duality between the CELC and its complement, the electric field coupled LC resonator. Characterization of the CELC structure serves to expand the current library of resonant elements metamaterial designers can draw upon to make unique materials and surfaces.
Vartanian, Jean-Pierre; Wain-Hobson, Simon
2002-05-28
Nuclear mtDNA sequences (numts) are a widespread family of paralogs evolving as pseudogenes in chromosomal DNA [Zhang, D. E. & Hewitt, G. M. (1996) TREE 11, 247-251 and Bensasson, D., Zhang, D., Hartl, D. L. & Hewitt, G. M. (2001) TREE 16, 314-321]. When trying to identify the species origin of an unknown DNA sample by way of an mtDNA locus, PCR may amplify both mtDNA and numts. Indeed, occasionally numts dominate confounding attempts at species identification [Bensasson, D., Zhang, D. X. & Hewitt, G. M. (2000) Mol. Biol. Evol. 17, 406-415; Wallace, D. C., et al. (1997) Proc. Natl. Acad. Sci. USA 94, 14900-14905]. Rhesus and cynomolgus macaque mtDNA haplotypes were identified in a study of oral polio vaccine samples dating from the late 1950s [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046]. They were accompanied by a number of putative numts. To confirm that these putative numts were of macaque origin, a library of numts corresponding to a small segment of 12S rDNA locus has been made by using DNA from a Chinese rhesus macaque. A broad distribution was found with up to 30% sequence variation. Phylogenetic analysis showed that the evolutionary trajectories of numts and bona fide mtDNA haplotypes do not overlap with the signal exception of the host species; mtDNA fragments are continually crossing over into the germ line. In the case of divergent mtDNA sequences from old oral polio vaccine samples [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046], all were closely related to numts in the Chinese macaque library.
Lloyd, Sonja J; LaPatra, Scott E; Snekvik, Kevin R; St-Hilaire, Sophie; Cain, Kenneth D; Call, Douglas R
2008-11-20
Strawberry disease (SD) in the USA is a skin disorder of unknown etiology that occurs in rainbow trout Oncorhynchus mykiss and is characterized by bright red inflammatory lesions. To identify a candidate bacterial agent responsible for SD, we constructed 16S rDNA libraries from 7 SD lesion samples and 2 apparently healthy skin samples from SD-affected fish. A 16S rDNA sequence highly similar to members of the order Rickettsiales was present in 3 lesion libraries at 1%, 32% and 54% prevalence, but this sequence was not found in either healthy tissue library. Based on phylogenetic analysis, this Rickettsia-like organism (RLO) sequence is most closely related to 16S rDNA sequences of bacteria that may form a novel lineage within the Rickettsiales. We used nested PCR assays to screen 25 SD-affected fish for RLO or Flavobacterium psychrophilum DNA. Sixteen lesion samples were positive for the RLO sequence and 4 of the matched healthy samples were positive resulting in a significant association between SD lesions and presence of RLO DNA. While F. psychrophilum is reportedly associated with 'cold water strawberry disease' in the UK, we found no significant association between SD lesions and the presence of F. psychrophilum DNA. The statistical association between SD lesions and presence of RLO DNA is not proof of etiology, but these data suggest that RLO may play a role in SD in southern Idaho, USA.
2009-01-01
Background This study reports progress in assembling a DNA barcode reference library for Ephemeroptera, Plecoptera, and Trichoptera ("EPTs") from a Canadian subarctic site, which is the focus of a comprehensive biodiversity inventory using DNA barcoding. These three groups of aquatic insects exhibit a moderate level of species diversity, making them ideal for testing the feasibility of DNA barcoding for routine biotic surveys. We explore the correlation between the morphological species delineations, DNA barcode-based haplotype clusters delimited by a sequence threshold (2%), and a threshold-free approach to biodiversity quantification--phylogenetic diversity. Results A DNA barcode reference library is built for 112 EPT species for the focal region, consisting of 2277 COI sequences. Close correspondence was found between EPT morphospecies and haplotype clusters as designated using a standard threshold value. Similarly, the shapes of taxon accumulation curves based upon haplotype clusters were very similar to those generated using phylogenetic diversity accumulation curves, but were much more computationally efficient. Conclusion The results of this study will facilitate other lines of research on northern EPTs and also bode well for rapidly conducting initial biodiversity assessments in unknown EPT faunas. PMID:20003245
NASA Astrophysics Data System (ADS)
Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong
2010-07-01
We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.
DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR
A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...
Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy
2015-01-01
Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids. PMID:25870978
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C
2008-06-15
To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.
Novel interactive partners of neuroligin 3: new aspects for pathogenesis of autism.
Shen, Chen; Huo, Li-rong; Zhao, Xin-liang; Wang, Pei-rong; Zhong, Nanbert
2015-05-01
Autism is a neurodevelopmental disorder with a strong genetic predisposition. Neurolign 3 (NLGN3) as a postsynaptic transmembrane protein, functions in both neuron synaptogenesis and glia-neuron communications. Previously, a gain of function mutation (R451C) in NLGN3 was identified in autistic patients, which illustrates the involvement of NLGN3 in autism pathogenesis. As proper synaptic targeting and functioning are controlled by intracellular protein interactions, in the current study, we tried to discover the intracellular regulation network in which NLGN3 might be involved by a yeast two-hybrid-based interactor identification. Fifty-one protein candidate partners were identified after screening a human fetal complementary DNA (cDNA) library with an intracellular fragment of NLGN3. The interactions of NLGN3 with a subset of candidates, including EEF1A1, FLNA, ITPRIP, CYP11A1, MT-CO2, GPR175, ACOT2, and QPRT, were further validated in human neuroblastoma cells or brain tissues. Furthermore, our study suggested that NLGN3 was functioning in cytosolic calcium balance and participating in calcium-regulated cellular processes. Our findings of novel NLGN3 binding partners provide evidences of involvement of NLGN3 in multiple biological pathways, especially calcium regulating and mitochondrial function, thus suggesting further significance. This new data not only leads to a better understanding of the physiological functions of NLGN3, but also provide new aspects for pathogenesis of autism.
Castañón, Jesús; Román, José Pablo; Jessop, Theodore C; de Blas, Jesús; Haro, Rubén
2018-06-01
DNA-encoded libraries (DELs) have emerged as an efficient and cost-effective drug discovery tool for the exploration and screening of very large chemical space using small-molecule collections of unprecedented size. Herein, we report an integrated automation and informatics system designed to enhance the quality, efficiency, and throughput of the production and affinity selection of these libraries. The platform is governed by software developed according to a database-centric architecture to ensure data consistency, integrity, and availability. Through its versatile protocol management functionalities, this application captures the wide diversity of experimental processes involved with DEL technology, keeps track of working protocols in the database, and uses them to command robotic liquid handlers for the synthesis of libraries. This approach provides full traceability of building-blocks and DNA tags in each split-and-pool cycle. Affinity selection experiments and high-throughput sequencing reads are also captured in the database, and the results are automatically deconvoluted and visualized in customizable representations. Researchers can compare results of different experiments and use machine learning methods to discover patterns in data. As of this writing, the platform has been validated through the generation and affinity selection of various libraries, and it has become the cornerstone of the DEL production effort at Lilly.
The construction of an EST database for Bombyx mori and its application
Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu
2003-01-01
To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147
Thaitrong, Numrin; Kim, Hanyoup; Renzi, Ronald F; Bartsch, Michael S; Meagher, Robert J; Patel, Kamlesh D
2012-12-01
We have developed an automated quality control (QC) platform for next-generation sequencing (NGS) library characterization by integrating a droplet-based digital microfluidic (DMF) system with a capillary-based reagent delivery unit and a quantitative CE module. Using an in-plane capillary-DMF interface, a prepared sample droplet was actuated into position between the ground electrode and the inlet of the separation capillary to complete the circuit for an electrokinetic injection. Using a DNA ladder as an internal standard, the CE module with a compact LIF detector was capable of detecting dsDNA in the range of 5-100 pg/μL, suitable for the amount of DNA required by the Illumina Genome Analyzer sequencing platform. This DMF-CE platform consumes tenfold less sample volume than the current Agilent BioAnalyzer QC technique, preserving precious sample while providing necessary sensitivity and accuracy for optimal sequencing performance. The ability of this microfluidic system to validate NGS library preparation was demonstrated by examining the effects of limited-cycle PCR amplification on the size distribution and the yield of Illumina-compatible libraries, demonstrating that as few as ten cycles of PCR bias the size distribution of the library toward undesirable larger fragments. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F
2013-02-15
Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.
Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F
2009-07-01
XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.
Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L
2012-01-01
A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.
McWilliams, D; Callahan, R C; Boime, I
1977-01-01
A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681
Thomason, Lynn C; Costantino, Nina; Court, Donald L
2016-09-13
Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single-strand regions may be created during DNA replication or by single-strand exonuclease digestion of linear duplex DNA. Previously, in vitro studies reported that these recombinases promote the single-strand annealing of two complementary DNAs and also strand invasion of a single DNA strand into duplex DNA to create a three-stranded region. Here, in vivo experiments show that recombinase-mediated annealing of complementary single-stranded DNA is the predominant recombination pathway in E. coli. Copyright © 2016 Thomason et al.
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H
2016-12-01
Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2008-01-01
Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…
Travis, G H; Sutcliffe, J G
1988-01-01
To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033
Comparison of the canine and human acid {beta}-galactosidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.
Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less
Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bates, R.C.; Snyder, C.E.; Banerjee, P.T.
1984-02-01
Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less
Genetic Constructor: An Online DNA Design Platform.
Bates, Maxwell; Lachoff, Joe; Meech, Duncan; Zulkower, Valentin; Moisy, Anaïs; Luo, Yisha; Tekotte, Hille; Franziska Scheitz, Cornelia Johanna; Khilari, Rupal; Mazzoldi, Florencio; Chandran, Deepak; Groban, Eli
2017-12-15
Genetic Constructor is a cloud Computer Aided Design (CAD) application developed to support synthetic biologists from design intent through DNA fabrication and experiment iteration. The platform allows users to design, manage, and navigate complex DNA constructs and libraries, using a new visual language that focuses on functional parts abstracted from sequence. Features like combinatorial libraries and automated primer design allow the user to separate design from construction by focusing on functional intent, and design constraints aid iterative refinement of designs. A plugin architecture enables contributions from scientists and coders to leverage existing powerful software and connect to DNA foundries. The software is easily accessible and platform agnostic, free for academics, and available in an open-source community edition. Genetic Constructor seeks to democratize DNA design, manufacture, and access to tools and services from the synthetic biology community.
NASA Astrophysics Data System (ADS)
Khadsai, Sudarat; Rutnakornpituk, Boonjira; Vilaivan, Tirayut; Nakkuntod, Maliwan; Rutnakornpituk, Metha
2016-09-01
Magnetite nanoparticles (MNPs) were surface modified with anionic poly( N-acryloyl glycine) (PNAG) and streptavidin for specific interaction with biotin-conjugated pyrrolidinyl peptide nucleic acid (PNA). Hydrodynamic size ( D h) of PNAG-grafted MNPs varied from 334 to 496 nm depending on the loading ratio of the MNP to NAG in the reaction. UV-visible and fluorescence spectrophotometries were used to confirm the successful immobilization of streptavidin and PNA on the MNPs. About 291 pmol of the PNA/mg MNP was immobilized on the particle surface. The PNA-functionalized MNPs were effectively used as solid supports to differentiate between fully complementary and non-complementary/single-base mismatch DNA using the PNA probe. These novel anionic MNPs can be efficiently applicable for use as a magnetically guidable support for DNA base discrimination.
Arrays of nucleic acid probes on biological chips
Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.
1998-11-17
DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.
Surveying the repair of ancient DNA from bones via high-throughput sequencing.
Mouttham, Nathalie; Klunk, Jennifer; Kuch, Melanie; Fourney, Ron; Poinar, Hendrik
2015-07-01
DNA damage in the form of abasic sites, chemically altered nucleotides, and strand fragmentation is the foremost limitation in obtaining genetic information from many ancient samples. Upon cell death, DNA continues to endure various chemical attacks such as hydrolysis and oxidation, but repair pathways found in vivo no longer operate. By incubating degraded DNA with specific enzyme combinations adopted from these pathways, it is possible to reverse some of the post-mortem nucleic acid damage prior to downstream analyses such as library preparation, targeted enrichment, and high-throughput sequencing. Here, we evaluate the performance of two available repair protocols on previously characterized DNA extracts from four mammoths. Both methods use endonucleases and glycosylases along with a DNA polymerase-ligase combination. PreCR Repair Mix increases the number of molecules converted to sequencing libraries, leading to an increase in endogenous content and a decrease in cytosine-to-thymine transitions due to cytosine deamination. However, the effects of Nelson Repair Mix on repair of DNA damage remain inconclusive.
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
He, Bifang; Tjhung, Katrina F; Bennett, Nicholas J; Chou, Ying; Rau, Andrea; Huang, Jian; Derda, Ratmir
2018-01-19
Understanding the composition of a genetically-encoded (GE) library is instrumental to the success of ligand discovery. In this manuscript, we investigate the bias in GE-libraries of linear, macrocyclic and chemically post-translationally modified (cPTM) tetrapeptides displayed on the M13KE platform, which are produced via trinucleotide cassette synthesis (19 codons) and NNK-randomized codon. Differential enrichment of synthetic DNA {S}, ligated vector {L} (extension and ligation of synthetic DNA into the vector), naïve libraries {N} (transformation of the ligated vector into the bacteria followed by expression of the library for 4.5 hours to yield a "naïve" library), and libraries chemically modified by aldehyde ligation and cysteine macrocyclization {M} characterized by paired-end deep sequencing, detected a significant drop in diversity in {L} → {N}, but only a minor compositional difference in {S} → {L} and {N} → {M}. Libraries expressed at the N-terminus of phage protein pIII censored positively charged amino acids Arg and Lys; libraries expressed between pIII domains N1 and N2 overcame Arg/Lys-censorship but introduced new bias towards Gly and Ser. Interrogation of biases arising from cPTM by aldehyde ligation and cysteine macrocyclization unveiled censorship of sequences with Ser/Phe. Analogous analysis can be used to explore library diversity in new display platforms and optimize cPTM of these libraries.
An improved yeast transformation method for the generation of very large human antibody libraries.
Benatuil, Lorenzo; Perez, Jennifer M; Belk, Jonathan; Hsieh, Chung-Ming
2010-04-01
Antibody library selection by yeast display technology is an efficient and highly sensitive method to identify binders to target antigens. This powerful selection tool, however, is often hampered by the typically modest size of yeast libraries (approximately 10(7)) due to the limited yeast transformation efficiency, and the full potential of the yeast display technology for antibody discovery and engineering can only be realized if it can be coupled with a mean to generate very large yeast libraries. We describe here a yeast transformation method by electroporation that allows for the efficient generation of large antibody libraries up to 10(10) in size. Multiple components and conditions including CaCl(2), MgCl(2), sucrose, sorbitol, lithium acetate, dithiothreitol, electroporation voltage, DNA input and cell volume have been tested to identify the best combination. By applying this developed protocol, we have constructed a 1.4 x 10(10) human spleen antibody library essentially in 1 day with a transformation efficiency of 1-1.5 x 10(8) transformants/microg vector DNA. Taken together, we have developed a highly efficient yeast transformation method that enables the generation of very large and productive human antibody libraries for antibody discovery, and we are now routinely making 10(9) libraries in a day for antibody engineering purposes.
NASA Astrophysics Data System (ADS)
Liang, R.; Lau, M.; Vishnivetskaya, T. A.; Lloyd, K. G.; Pfiffner, S. M.; Rivkina, E.; Onstott, T. C.
2017-12-01
The prevalence of microorganisms in frozen permafrost has been well documented in ancient sediment up to several million years old. However, the long term survivability and metabolic activity of microbes over geological timespans remain underexplored. Siberian permafrost sediment was collected at various depths (1.4m, 11.8 m and 24.8m) to represent a wide range of geological time from thousands to millions of years. Extracellular (eDNA) and intracellular DNA (iDNA) was simultaneously recovered for sequencing to characterize the potentially extinct and extant microbial community. Additionally, aspartic acid racemization assay (D/L Asp) was used to infer the metabolic activity of microbes in ancient permafrost. As compared with the young sample (1.4m), DNA yield and content of aspartic acid dramatically decreased in old samples (11.8m and 24.8m). However, D/L Asp and eDNA/iDNA significantly increased with the geological age. Such findings suggested that ancient microbiomes might be subjected to racemization or even DNA/proteins degradation at subzero temperature over the wide geological time scale. Preliminary characterization of microbial community indicated that the majority of sequences in old samples were identified as bacteria and only a small fraction was identified as archaea from the iDNA pool. While the eDNA and iDNA fractions shared similar dominant taxa at phylum level, the relative abundance of Proteobacteria in eDNA library was much higher than iDNA. By contrast, the phylum affiliated with Firmicutes was more numerically abundant in the iDNA fraction. More dramatic differences were observed between eDNA and iDNA library at lower taxonomic levels. Particularly, the microbial lineages affiliated with the genera Methanoregula, Desulfosporosinus and Syntrophomonas were only detected in the iDNA library. Such taxonomic difference between the relic eDNA and iDNA suggested that numerous species become locally "extinct" whereas many other taxa might survive in ancient sediment. Ultimately, when coupling our current findings to the D/L Asp in cellular proteins and metaproteomics, a better understanding will be achieved about the microbial activity of the extant microbial community and their roles in biogeochemical cycling in ancient permafrost.
Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.
2009-01-01
Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733
Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis
Cozens, Christopher
2018-01-01
Abstract Engineering proteins for designer functions and biotechnological applications almost invariably requires (or at least benefits from) multiple mutations to non-contiguous residues. Several methods for multiple site-directed mutagenesis exist, but there remains a need for fast and simple methods to efficiently introduce such mutations – particularly for generating large, high quality libraries for directed evolution. Here, we present Darwin Assembly, which can deliver high quality libraries of >108 transformants, targeting multiple (>10) distal sites with minimal wild-type contamination (<0.25% of total population) and which takes a single working day from purified plasmid to library transformation. We demonstrate its efficacy with whole gene codon reassignment of chloramphenicol acetyl transferase, mutating 19 codons in a single reaction in KOD DNA polymerase and generating high quality, multiple-site libraries in T7 RNA polymerase and Tgo DNA polymerase. Darwin Assembly uses commercially available enzymes, can be readily automated, and offers a cost-effective route to highly complex and customizable library generation. PMID:29409059
USDA-ARS?s Scientific Manuscript database
Communities of soil nematodes impact ecosystem functions, including plant growth, decomposition, and nutrient cycling, all of which are vital processes in agriculture. We used complementary morphological and DNA metabarcoding analyses to characterize soil nematode communities in three cropping syste...
Horse cDNA clones encoding two MHC class I genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbis, D.P.; Maher, J.K.; Stanek, J.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening
2017-01-01
DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing. PMID:28199790
An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening.
MacConnell, Andrew B; Price, Alexander K; Paegel, Brian M
2017-03-13
DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomkinson, B.; Jonsson, A-K
1991-01-01
Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less
Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun
2008-03-01
We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.
Morinière, Jérôme; Hendrich, Lars; Balke, Michael; Beermann, Arne J; König, Tobias; Hess, Monika; Koch, Stefan; Müller, Reinhard; Leese, Florian; Hebert, Paul D N; Hausmann, Axel; Schubart, Christoph D; Haszprunar, Gerhard
2017-11-01
Mayflies, stoneflies and caddisflies (Ephemeroptera, Plecoptera and Trichoptera) are prominent representatives of aquatic macroinvertebrates, commonly used as indicator organisms for water quality and ecosystem assessments. However, unambiguous morphological identification of EPT species, especially their immature life stages, is a challenging, yet fundamental task. A comprehensive DNA barcode library based upon taxonomically well-curated specimens is needed to overcome the problematic identification. Once available, this library will support the implementation of fast, cost-efficient and reliable DNA-based identifications and assessments of ecological status. This study represents a major step towards a DNA barcode reference library as it covers for two-thirds of Germany's EPT species including 2,613 individuals belonging to 363 identified species. As such, it provides coverage for 38 of 44 families (86%) and practically all major bioindicator species. DNA barcode compliant sequences (≥500 bp) were recovered from 98.74% of the analysed specimens. Whereas most species (325, i.e., 89.53%) were unambiguously assigned to a single Barcode Index Number (BIN) by its COI sequence, 38 species (18 Ephemeroptera, nine Plecoptera and 11 Trichoptera) were assigned to a total of 89 BINs. Most of these additional BINs formed nearest neighbour clusters, reflecting the discrimination of geographical subclades of a currently recognized species. BIN sharing was uncommon, involving only two species pairs of Ephemeroptera. Interestingly, both maximum pairwise and nearest neighbour distances were substantially higher for Ephemeroptera compared to Plecoptera and Trichoptera, possibly indicating older speciation events, stronger positive selection or faster rate of molecular evolution. © 2017 John Wiley & Sons Ltd.
Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid
Hardman, Norman
1974-01-01
Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738
‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups
Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo
2008-01-01
We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535
A human transcription factor in search mode.
Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos
2016-01-08
Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Amplification of chromosomal DNA in situ
Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.
2002-01-01
Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.
Extending the spectrum of DNA sequences retrieved from ancient bones and teeth
Glocke, Isabelle; Meyer, Matthias
2017-01-01
The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.
Konermann, Silvana; Brigham, Mark D; Trevino, Alexandro E; Joung, Julia; Abudayyeh, Omar O; Barcena, Clea; Hsu, Patrick D; Habib, Naomi; Gootenberg, Jonathan S; Nishimasu, Hiroshi; Nureki, Osamu; Zhang, Feng
2015-01-29
Systematic interrogation of gene function requires the ability to perturb gene expression in a robust and generalizable manner. Here we describe structure-guided engineering of a CRISPR-Cas9 complex to mediate efficient transcriptional activation at endogenous genomic loci. We used these engineered Cas9 activation complexes to investigate single-guide RNA (sgRNA) targeting rules for effective transcriptional activation, to demonstrate multiplexed activation of ten genes simultaneously, and to upregulate long intergenic non-coding RNA (lincRNA) transcripts. We also synthesized a library consisting of 70,290 guides targeting all human RefSeq coding isoforms to screen for genes that, upon activation, confer resistance to a BRAF inhibitor. The top hits included genes previously shown to be able to confer resistance, and novel candidates were validated using individual sgRNA and complementary DNA overexpression. A gene expression signature based on the top screening hits correlated with markers of BRAF inhibitor resistance in cell lines and patient-derived samples. These results collectively demonstrate the potential of Cas9-based activators as a powerful genetic perturbation technology.
Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W
2015-04-11
Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.
Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James
2012-01-03
We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society
From the Cover: A polymer library approach to suicide gene therapy for cancer
NASA Astrophysics Data System (ADS)
Anderson, Daniel G.; Peng, Weidan; Akinc, Akin; Hossain, Naushad; Kohn, Anat; Padera, Robert; Langer, Robert; Sawicki, Janet A.
2004-11-01
Optimal gene therapy for cancer must (i) deliver DNA to tumor cells with high efficiency, (ii) induce minimal toxicity, and (iii) avoid gene expression in healthy tissues. To this end, we generated a library of >500 degradable, poly(-amino esters) for potential use as nonviral DNA vectors. Using high-throughput methods, we screened this library in vitro for transfection efficiency and cytotoxicity. We tested the best performing polymer, C32, in mice for toxicity and DNA delivery after intratumor and i.m. injection. C32 delivered DNA intratumorally 4-fold better than one of the best commercially available reagents, jetPEI (polyethyleneimine), and 26-fold better than naked DNA. Conversely, the highest transfection levels after i.m. administration were achieved with naked DNA, followed by polyethyleneimine; transfection was rarely observed with C32. Additionally, polyethyleneimine induced significant local toxicity after i.m. injection, whereas C32 demonstrated no toxicity. Finally, we used C32 to deliver a DNA construct encoding the A chain of diphtheria toxin (DT-A) to xenografts derived from LNCaP human prostate cancer cells. This construct regulates toxin expression both at the transcriptional level by the use of a chimeric-modified enhancer/promoter sequence of the human prostate-specific antigen gene and by DNA recombination mediated by Flp recombinase. C32 delivery of the A chain of diphtheria toxin DNA to LNCaP xenografts suppressed tumor growth and even caused 40% of tumors to regress in size. Because C32 transfects tumors locally at high levels, transfects healthy muscle poorly, and displays no toxicity, it may provide a vehicle for the local treatment of cancer. prostate | cationic polymers
Sin, Jeong-Im
2009-01-01
Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332
Sin, Jeong-Im
2009-09-01
Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.
Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej
2018-05-24
Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.
BASIC: A Simple and Accurate Modular DNA Assembly Method.
Storch, Marko; Casini, Arturo; Mackrow, Ben; Ellis, Tom; Baldwin, Geoff S
2017-01-01
Biopart Assembly Standard for Idempotent Cloning (BASIC) is a simple, accurate, and robust DNA assembly method. The method is based on linker-mediated DNA assembly and provides highly accurate DNA assembly with 99 % correct assemblies for four parts and 90 % correct assemblies for seven parts [1]. The BASIC standard defines a single entry vector for all parts flanked by the same prefix and suffix sequences and its idempotent nature means that the assembled construct is returned in the same format. Once a part has been adapted into the BASIC format it can be placed at any position within a BASIC assembly without the need for reformatting. This allows laboratories to grow comprehensive and universal part libraries and to share them efficiently. The modularity within the BASIC framework is further extended by the possibility of encoding ribosomal binding sites (RBS) and peptide linker sequences directly on the linkers used for assembly. This makes BASIC a highly versatile library construction method for combinatorial part assembly including the construction of promoter, RBS, gene variant, and protein-tag libraries. In comparison with other DNA assembly standards and methods, BASIC offers a simple robust protocol; it relies on a single entry vector, provides for easy hierarchical assembly, and is highly accurate for up to seven parts per assembly round [2].
Dorraj, Ghamar Soltan; Rassaee, Mohammad Javad; Latifi, Ali Mohammad; Pishgoo, Bahram; Tavallaei, Mahmood
2015-08-20
Troponin T and I are ideal markers which are highly sensitive and specific for myocardial injury and have shown better efficacy than earlier markers. Since aptamers are ssDNA or RNA that bind to a wide variety of target molecules, the purpose of this research was to select an aptamer from a 79bp single-stranded DNA (ssDNA) random library that was used to bind the Human Cardiac Troponin I from a synthetic nucleic acids library by systematic evolution of ligands exponential enrichment (Selex) based on several selection and amplification steps. Human Cardiac Troponin I protein was coated onto the surface of streptavidin magnetic beads to extract specific aptamer from a large and diverse random ssDNA initial oligonucleotide library. As a result, several aptamers were selected and further examined for binding affinity and specificity. Finally TnIApt 23 showed beast affinity in nanomolar range (2.69nM) toward the target protein. A simple and rapid colorimetric detection assay for Human Cardiac Troponin I using the novel and specific aptamer-AuNPs conjugates based on dot blot assay was developed. The detection limit for this protein using aptamer-AuNPs-based assay was found to be 5ng/ml. Copyright © 2015 Elsevier B.V. All rights reserved.
Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela
2013-10-30
Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.
Simulations Using Random-Generated DNA and RNA Sequences
ERIC Educational Resources Information Center
Bryce, C. F. A.
1977-01-01
Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…
Although the process of glycolysis is highly conserved in eukaryotes, several glycolytic enzymes have unique structural or functional features in spermatogenic cells. We previously identified and characterized the mouse complementary DNA (cDNA) and a gene for 1 of these enzymes, ...
Comparison of multiple gene assembly methods for metabolic engineering
Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries
2007-01-01
A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...
Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner
USDA-ARS?s Scientific Manuscript database
A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...
Webster, Gordon; Watt, Lynsey C; Rinna, Joachim; Fry, John C; Evershed, Richard P; Parkes, R John; Weightman, Andrew J
2006-09-01
Marine sediment slurries enriched for anaerobic, sulfate-reducing prokaryotic communities utilizing glucose and acetate were used to provide the first comparison between stable-isotope probing (SIP) of phospholipid fatty acids (PLFA) and DNA (16S rRNA and dsrA genes) biomarkers. Different 13C-labelled substrates (glucose, acetate and pyruvate) at low concentrations (100 microM) were used over a 7-day incubation to follow and identify carbon flow into different members of the community. Limited changes in total PLFA and bacterial 16S rRNA gene DGGE profiles over 7 days suggested the presence of a stable bacterial community. A broad range of PLFA were rapidly labelled (within 12 h) in the 13C-glucose slurry but this changed with time, suggesting the presence of an active glucose-utilizing population and later development of another population able to utilize glucose metabolites. The identity of the major glucose-utilizers was unclear as 13C-enriched PLFA were common (16:0, 16:1, 18:1omega7, highest incorporation) and there was little difference between 12C- and 13C-DNA 16S rRNA gene denaturing gradient gel electrophoresis (DGGE) profiles. Seemingly glucose, a readily utilizable substrate, resulted in widespread incorporation consistent with the higher extent of 13C-incorporation (approximately 10 times) into PLFA compared with 13C-acetate or 13C-pyruvate. 13C-PLFA in the 13C-acetate and 13C-pyruvate slurries were similar to each other and to those that developed in the 13C-glucose slurry after 4 days. These were more diagnostic, with branched odd-chain fatty acids (i15:0, a15:0 and 15:1omega6) possibly indicating the presence of Desulfococcus or Desulfosarcina sulfate-reducing bacteria (SRB) and sequences related to these SRB were in the 13C-acetate-DNA dsrA gene library. The 13C-acetate-DNA 16S rRNA gene library also contained sequences closely related to SRB, but these were the acetate-utilizing Desulfobacter sp., as well as a broad range of uncultured Bacteria. In contrast, analysis of DGGE bands from 13C-DNA demonstrated that the candidate division JS1 and Firmicutes were actively assimilating 13C-acetate. Denaturing gradient gel electrophoresis also confirmed the presence of JS1 in the 13C-DNA from the 13C-glucose slurry. These results demonstrate that JS1, originally found in deep subsurface sediments, is more widely distributed in marine sediments and provides the first indication of its metabolism; incorporation of acetate and glucose (or glucose metabolites) under anaerobic, sulfate-reducing conditions. Here we demonstrate that PLFA- and DNA-SIP can be used together in a sedimentary system, with low concentrations of 13C-substrate and overlapping incubation times (up to 7 days) to provide complementary, although not identical, information on carbon flow and the identity of active members of an anaerobic prokaryotic community.
Cuozzo, John W; Centrella, Paolo A; Gikunju, Diana; Habeshian, Sevan; Hupp, Christopher D; Keefe, Anthony D; Sigel, Eric A; Soutter, Holly H; Thomson, Heather A; Zhang, Ying; Clark, Matthew A
2017-05-04
We have identified and characterized novel potent inhibitors of Bruton's tyrosine kinase (BTK) from a single DNA-encoded library of over 110 million compounds by using multiple parallel selection conditions, including variation in target concentration and addition of known binders to provide competition information. Distinct binding profiles were observed by comparing enrichments of library building block combinations under these conditions; one enriched only at high concentrations of BTK and was competitive with ATP, and another enriched at both high and low concentrations of BTK and was not competitive with ATP. A compound representing the latter profile showed low nanomolar potency in biochemical and cellular BTK assays. Results from kinetic mechanism of action studies were consistent with the selection profiles. Analysis of the co-crystal structure of the most potent compound demonstrated a novel binding mode that revealed a new pocket in BTK. Our results demonstrate that profile-based selection strategies using DNA-encoded libraries form the basis of a new methodology to rapidly identify small molecule inhibitors with novel binding modes to clinically relevant targets. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kits for Characterization of Chromosomal Inversions Using Probes
NASA Technical Reports Server (NTRS)
Ray, F. Andrew (Inventor)
2017-01-01
A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Mapping of Drug-like Chemical Universe with Reduced Complexity Molecular Frameworks.
Kontijevskis, Aleksejs
2017-04-24
The emergence of the DNA-encoded chemical libraries (DEL) field in the past decade has attracted the attention of the pharmaceutical industry as a powerful mechanism for the discovery of novel drug-like hits for various biological targets. Nuevolution Chemetics technology enables DNA-encoded synthesis of billions of chemically diverse drug-like small molecule compounds, and the efficient screening and optimization of these, facilitating effective identification of drug candidates at an unprecedented speed and scale. Although many approaches have been developed by the cheminformatics community for the analysis and visualization of drug-like chemical space, most of them are restricted to the analysis of a maximum of a few millions of compounds and cannot handle collections of 10 8 -10 12 compounds typical for DELs. To address this big chemical data challenge, we developed the Reduced Complexity Molecular Frameworks (RCMF) methodology as an abstract and very general way of representing chemical structures. By further introducing RCMF descriptors, we constructed a global framework map of drug-like chemical space and demonstrated how chemical space occupied by multi-million-member drug-like Chemetics DNA-encoded libraries and virtual combinatorial libraries with >10 12 members could be analyzed and mapped without a need for library enumeration. We further validate the approach by performing RCMF-based searches in a drug-like chemical universe and mapping Chemetics library selection outputs for LSD1 targets on a global framework chemical space map.
Process of labeling specific chromosomes using recombinant repetitive DNA
Moyzis, R.K.; Meyne, J.
1988-02-12
Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.
Genotype Specification Language.
Wilson, Erin H; Sagawa, Shiori; Weis, James W; Schubert, Max G; Bissell, Michael; Hawthorne, Brian; Reeves, Christopher D; Dean, Jed; Platt, Darren
2016-06-17
We describe here the Genotype Specification Language (GSL), a language that facilitates the rapid design of large and complex DNA constructs used to engineer genomes. The GSL compiler implements a high-level language based on traditional genetic notation, as well as a set of low-level DNA manipulation primitives. The language allows facile incorporation of parts from a library of cloned DNA constructs and from the "natural" library of parts in fully sequenced and annotated genomes. GSL was designed to engage genetic engineers in their native language while providing a framework for higher level abstract tooling. To this end we define four language levels, Level 0 (literal DNA sequence) through Level 3, with increasing abstraction of part selection and construction paths. GSL targets an intermediate language based on DNA slices that translates efficiently into a wide range of final output formats, such as FASTA and GenBank, and includes formats that specify instructions and materials such as oligonucleotide primers to allow the physical construction of the GSL designs by individual strain engineers or an automated DNA assembly core facility.
Liew, Pauline Woanying; Jong, Bor Chyan
2008-05-01
Two culture-independent methods, namely ribosomal DNA libraries and denaturing gradient gel electrophoresis (DGGE), were adopted to examine the microbial community of a Malaysian light crude oil. In this study, both 16S and 18S rDNAs were PCR-amplified from bulk DNA of crude oil samples, cloned, and sequenced. Analyses of restriction fragment length polymorphism (RFLP) and phylogenetics clustered the 16S and 18S rDNA sequences into seven and six groups, respectively. The ribosomal DNA sequences obtained showed sequence similarity between 90 to 100% to those available in the GenBank database. The closest relatives documented for the 16S rDNAs include member species of Thermoincola and Rhodopseudomonas, whereas the closest fungal relatives include Acremonium, Ceriporiopsis, Xeromyces, Lecythophora, and Candida. Others were affiliated to uncultured bacteria and uncultured ascomycete. The 16S rDNA library demonstrated predomination by a single uncultured bacterial type by >80% relative abundance. The predomination was confirmed by DGGE analysis.
Rosa, A M M; Prazeres, D M F; Paulo, P M R
2017-06-28
Fluorescence correlation spectroscopy (FCS) was used to characterize the molecular interactions between the four components of a DNA recognition system. A fluorescent DNA probe was used to assess: (i) the hybridization with a complementary biotin-labeled target, (ii) the complexation of the resulting hybrid and an anti-biotin antibody, and (iii) the binding of the latter complex to a ZZ-CBM fusion protein that combines small synthetic IgG Fc-binding Z domains with a carbohydrate binding module (CBM). These binding interactions were monitored by exposing the fluorescent DNA probe to different amounts and combinations of the other molecules in solution. Through the analysis of FCS autocorrelation curves, an association constant (K a ) of 2.9 × 10 7 M -1 was estimated for DNA·DNA hybridization, and the presence of (non-) complementary target DNA in solution could be discriminated. The specific capture of biotinylated DNA hybrids by anti-biotin IgG was verified, with an apparent K a of 2.5 × 10 6 M -1 . The increment in the diffusion time measured when the DNA·DNA:antibody complexes were in contact with the ZZ-CBM fusion protein suggested that the binding occurs at a stoichiometric ratio of DNA/antibody complex to fusion larger than 1 : 1. The FCS-derived information obtained is useful to gain insight into molecular interactions involved in diagnostic assays.
Sequence of Spider Aciniform and Piriform Silks
2001-09-19
7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length
2017-06-01
Milestone Achieved: HRPO/ACURO Approval 6 Finished Major Task 2 CRISPR knockout/RNAseq Viral infection/prep 3-6 CRISPR KO virus library prep...finished; RNA-Seq: ~75% Cell manipulation 3-6 CRISPR KO virus infection: 50%; Single cDNA infections: finished Bioinformatics 1 CRISPR KO library...characterization 1-3 Finished Update: production of iPSC clones harboring DC mutations generated by CRISPR : Design 1 Finished Update: production of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
2015-01-01
Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129