Sample records for complementary dna sequences

  1. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  2. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  3. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  4. Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

    PubMed

    Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

    2003-03-01

    A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

  5. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  6. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    PubMed

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  7. Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

    PubMed

    Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

    2011-08-01

    Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

  8. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  9. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  10. A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

    PubMed

    Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

    2016-08-15

    In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  12. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  13. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  14. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  15. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  16. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  17. Nature and distribution of feline sarcoma virus nucleotide sequences.

    PubMed Central

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  18. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  19. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  20. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  1. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  2. Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

    PubMed

    Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

    2016-01-15

    In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

  3. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

  4. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  5. RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1992-01-01

    The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

  6. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  7. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  8. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  9. Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

    PubMed

    Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

    1996-01-01

    The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

  10. New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

    PubMed

    Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

    2015-03-15

    This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  12. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  13. DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

    PubMed Central

    Barth, Anna; Kobbe, Daniela; Focke, Manfred

    2016-01-01

    Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

  14. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  15. Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

    PubMed

    Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

    2000-07-05

    The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

  16. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

    PubMed

    Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-11-20

    We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  19. DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

    PubMed

    Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

    2007-04-15

    An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

  20. RNA-programmed genome editing in human cells

    PubMed Central

    Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

    2013-01-01

    Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

  1. Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

    PubMed

    Deng, Jiajia; Toh, Chee-Seng

    2013-06-17

    A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

  2. Hiding message into DNA sequence through DNA coding and chaotic maps.

    PubMed

    Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

    2014-09-01

    The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

  3. Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D.A.; Zilinskas, B.A.

    1991-08-01

    The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

  4. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  5. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  6. Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

    PubMed

    Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

    2018-08-27

    A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  8. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  9. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  10. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  11. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  12. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  14. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  15. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  16. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  17. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  18. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  19. Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

    PubMed

    Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

    2012-01-01

    A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

    PubMed

    Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

    2011-01-01

    Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

  1. Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

    PubMed

    Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

    2011-07-21

    Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

  2. Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

    NASA Astrophysics Data System (ADS)

    Zhao, Weian; Brook, Michael A.; Li, Yingfu

    Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

  3. Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

    PubMed Central

    Hardman, Norman

    1974-01-01

    Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

  4. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  5. A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

    PubMed

    Razvi, F; Gargiulo, G; Worcel, A

    1983-08-01

    Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

  6. Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

    ERIC Educational Resources Information Center

    Militello, Kevin T.

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

  7. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  8. Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

    PubMed Central

    Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

    2014-01-01

    Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

  9. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  10. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  11. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  12. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  13. Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

    PubMed Central

    Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2015-01-01

    The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

  14. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  15. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  16. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  17. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  18. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  19. DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.

    PubMed

    Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason

    2017-11-21

    Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.

  20. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  1. A nanophosphor-based method for selective DNA recovery in Synthosomes.

    PubMed

    Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

    2006-01-01

    A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

  2. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    PubMed

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  3. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    NASA Astrophysics Data System (ADS)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  5. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  6. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

    PubMed Central

    Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

    2005-01-01

    Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

  8. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  9. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  10. Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

    USDA-ARS?s Scientific Manuscript database

    A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

  11. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    NASA Astrophysics Data System (ADS)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  12. A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

    PubMed

    Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

    2016-12-01

    Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Cancer.gov

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  14. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

    PubMed

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2016-01-07

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

  15. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    PubMed Central

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2004-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

  16. The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

    PubMed

    Paiva, Anthony M; Sheardy, Richard D

    2005-04-20

    The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

  17. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  18. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  19. Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

    NASA Astrophysics Data System (ADS)

    Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

    2013-03-01

    We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

  20. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

    PubMed Central

    Kurtz, David T.; Feigelson, Philip

    1977-01-01

    A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

  2. High-Throughput Block Optical DNA Sequence Identification.

    PubMed

    Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

    2018-01-01

    Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

    PubMed Central

    Tramontano, A; Macchiato, M F

    1986-01-01

    An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

  4. Properties of an unusual DNA primase from an archaeal plasmid

    PubMed Central

    Beck, Kirsten; Lipps, Georg

    2007-01-01

    Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

  5. A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

    PubMed

    Liu, Ziping; Su, Xingguang

    2017-01-15

    In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  7. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  8. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  9. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    PubMed

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  10. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    PubMed

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  11. An integrated semiconductor device enabling non-optical genome sequencing.

    PubMed

    Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

    2011-07-20

    The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

  12. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

  13. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  14. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    NASA Astrophysics Data System (ADS)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  15. On site DNA barcoding by nanopore sequencing

    PubMed Central

    Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

    2017-01-01

    Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

  16. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  18. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  19. [Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

    PubMed

    Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

    2007-01-01

    Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

  20. FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

    PubMed Central

    Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

    2017-01-01

    Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

  1. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  2. Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, James Weifu; Meller, Amit

    2007-01-01

    Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, whichmore » looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.« less

  3. A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

    2010-01-01

    Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

  4. Single Molecule Nano-Metronome

    PubMed Central

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  5. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  6. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  7. Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

    NASA Astrophysics Data System (ADS)

    Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

    2016-10-01

    In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

  8. Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

    DTIC Science & Technology

    2008-09-22

    the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

  9. Methods for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1995-01-01

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  10. Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

    PubMed

    Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

    2017-09-19

    DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

  11. Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

    PubMed Central

    Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

    1990-01-01

    Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

  12. Quantum dot-based microfluidic biosensor for cancer detection

    NASA Astrophysics Data System (ADS)

    Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

    2015-05-01

    We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

  13. Mutations altering the cleavage specificity of a homing endonuclease

    PubMed Central

    Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

    2002-01-01

    The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

  14. Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

    PubMed

    Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

    2011-03-07

    For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.

    PubMed

    Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng

    2018-05-31

    By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.

  16. Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General Phenomenon Governed by Steric Hindrance in Duplex DNA.

    PubMed

    Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin

    2016-04-19

    G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.

  17. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    PubMed

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Methods for chromosome-specific staining

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1995-09-05

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.

  19. Methods and compositions for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    2003-07-22

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  20. Design of a Sensitive and Selective Electrochemical Aptasensor for the Determination of the Complementary cDNA of miRNA-145 Based on the Intercalation and Electrochemical Reduction of Doxorubicin.

    PubMed

    Mohamadi, Maryam; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

    2017-11-01

    The aim of this research was the determination of a microRNA (miRNA) using a DNA electrochemical aptasensor. In this biosensor, the complementary complementary DNA (cDNA) of miRNA-145 (a sense RNA transcript) was the target strand and the cDNA of miRNA-145 was the probe strand. Both cDNAs can be the product of the reverse transcriptase-polymerase chain reaction of miRNA. The proposed aptasensor's function was based on the hybridization of target strands with probes immobilized on the surface of a working electrode and the subsequent intercalation of doxorubicin (DOX) molecules functioning as the electroactive indicators of any double strands that formed. Electrochemical transduction was performed by measuring the cathodic current resulting from the electrochemical reduction of the intercalated molecules at the electrode surface. In the experiment, because many DOX molecules accumulated on each target strand on the electrode surface, amplification was inherently easy, without a need for enzymatic or complicated amplification strategies. The proposed aptasensor also had the excellent ability to regenerate as a result of the melting of the DNA duplex. Moreover, the use of DNA probe strands obviated the challenges of working with an RNA probe, such as sensitivity to RNase enzyme. In addition to the linear relationship between the electrochemical signal and the concentration of the target strands that ranged from 2.0 to 80.0 nM with an LOD of 0.27 nM, the proposed biosensor was clearly capable of distinguishing between complementary (target strand) and noncomplementary sequences. The presented biosensor was successfully applied for the quantification of DNA strands corresponding to miRNA-145 in human serum samples.

  1. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  2. Isolates of viral hemorrhagic septicemia virus from North America and Europe can be detected and distinguished by DNA probes

    USGS Publications Warehouse

    Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.

    1993-01-01

    Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \

  3. Herpesvirus papio: state and properties of intracellular viral DNA in baboon lymphoblastoid cell lines.

    PubMed

    Falk, L; Lindahl, T; Bjursell, G; Klein, G

    1979-07-15

    Herpesvirus papio (HVP) is an indigenous B-lymphotropic virus of baboons (Papio sp.) present in latent form in baboon lymphoblastoid cell lines. It shares cross-reacting viral capsid and early antigens with the Epstein-Barr virus (EBV), and HVP DNA and EBV DNA show partial sequence homology. EBV-specific complementary RNA was employed here as a probe to investigate the physical state of the HVP DNA component in baboon lymphoblastoid cells after fractionation of cellular DNA by density gradient centrifugation. Five virus-producing cultures contained both free and integrated HVP DNA sequences while one non-producing cell line had two or three viral genome equivalents per cell in an apparently integrated form. Further analysis of one virus-producing line showed that the free HVP DNA fraction was composed of both linear and circular viral DNA. Contour length measurements of HVP circular DNA molecules by electron microscopy revealed that they were similar in length to the EBV circular DNA present in human lymphoblastoid cells.

  4. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    DOEpatents

    Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  5. Mechanism of foreign DNA selection in a bacterial adaptive immune system

    PubMed Central

    Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.

    2012-01-01

    Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690

  6. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  7. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  8. Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

    PubMed

    Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

    2017-02-20

    The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

  9. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  10. DNA attachment to support structures

    DOEpatents

    Balhorn, Rodney L.; Barry, Christopher H.

    2002-01-01

    Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).

  11. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  12. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  13. Intrinsic flexibility of B-DNA: the experimental TRX scale.

    PubMed

    Heddi, Brahim; Oguey, Christophe; Lavelle, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2010-01-01

    B-DNA flexibility, crucial for DNA-protein recognition, is sequence dependent. Free DNA in solution would in principle be the best reference state to uncover the relation between base sequences and their intrinsic flexibility; however, this has long been hampered by a lack of suitable experimental data. We investigated this relationship by compiling and analyzing a large dataset of NMR (31)P chemical shifts in solution. These measurements reflect the BI <--> BII equilibrium in DNA, intimately correlated to helicoidal descriptors of the curvature, winding and groove dimensions. Comparing the ten complementary DNA dinucleotide steps indicates that some steps are much more flexible than others. This malleability is primarily controlled at the dinucleotide level, modulated by the tetranucleotide environment. Our analyses provide an experimental scale called TRX that quantifies the intrinsic flexibility of the ten dinucleotide steps in terms of Twist, Roll, and X-disp (base pair displacement). Applying the TRX scale to DNA sequences optimized for nucleosome formation reveals a 10 base-pair periodic alternation of stiff and flexible regions. Thus, DNA flexibility captured by the TRX scale is relevant to nucleosome formation, suggesting that this scale may be of general interest to better understand protein-DNA recognition.

  14. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    PubMed Central

    2011-01-01

    Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

  15. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

    PubMed

    Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

    2011-08-24

    Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

  16. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  17. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  18. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

    2001-04-03

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  19. Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.

    DTIC Science & Technology

    1991-02-01

    Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides

  20. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  1. Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

    NASA Technical Reports Server (NTRS)

    Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

    1982-01-01

    The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

  2. A comparative study of ancient environmental DNA to pollen and macrofossils from lake sediments reveals taxonomic overlap and additional plant taxa

    NASA Astrophysics Data System (ADS)

    Pedersen, Mikkel Winther; Ginolhac, Aurélien; Orlando, Ludovic; Olsen, Jesper; Andersen, Kenneth; Holm, Jakob; Funder, Svend; Willerslev, Eske; Kjær, Kurt H.

    2013-09-01

    We use 2nd generation sequencing technology on sedimentary ancient DNA (sedaDNA) from a lake in South Greenland to reconstruct the local floristic history around a low-arctic lake and compare the results with those previously obtained from pollen and macrofossils in the same lake. Thirty-eight of thirty-nine samples from the core yielded putative DNA sequences. Using a multiple assignment strategy on the trnL g-h DNA barcode, consisting of two different phylogenetic and one sequence similarity assignment approaches, thirteen families of plants were identified, of which two (Scrophulariaceae and Asparagaceae) are absent from the pollen and macrofossil records. An age model for the sediment based on twelve radiocarbon dates establishes a chronology and shows that the lake record dates back to 10,650 cal yr BP. Our results suggest that sedaDNA analysis from lake sediments, although taxonomically less detailed than pollen and macrofossil analyses can be a complementary tool for establishing the composition of both terrestrial and aquatic local plant communities and a method for identifying additional taxa.

  3. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  4. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  5. Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

    PubMed

    Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

    2008-12-01

    Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

  6. Ultraaccurate genome sequencing and haplotyping of single human cells.

    PubMed

    Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

    2017-11-21

    Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

  7. Quantum dot-based microfluidic biosensor for cancer detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

    2015-05-11

    We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

  8. Dimensions and Global Twist of Single-Layer DNA Origami Measured by Small-Angle X-ray Scattering.

    PubMed

    Baker, Matthew A B; Tuckwell, Andrew J; Berengut, Jonathan F; Bath, Jonathan; Benn, Florence; Duff, Anthony P; Whitten, Andrew E; Dunn, Katherine E; Hynson, Robert M; Turberfield, Andrew J; Lee, Lawrence K

    2018-06-04

    The rational design of complementary DNA sequences can be used to create nanostructures that self-assemble with nanometer precision. DNA nanostructures have been imaged by atomic force microscopy and electron microscopy. Small-angle X-ray scattering (SAXS) provides complementary structural information on the ensemble-averaged state of DNA nanostructures in solution. Here we demonstrate that SAXS can distinguish between different single-layer DNA origami tiles that look identical when immobilized on a mica surface and imaged with atomic force microscopy. We use SAXS to quantify the magnitude of global twist of DNA origami tiles with different crossover periodicities: these measurements highlight the extreme structural sensitivity of single-layer origami to the location of strand crossovers. We also use SAXS to quantify the distance between pairs of gold nanoparticles tethered to specific locations on a DNA origami tile and use this method to measure the overall dimensions and geometry of the DNA nanostructure in solution. Finally, we use indirect Fourier methods, which have long been used for the interpretation of SAXS data from biomolecules, to measure the distance between DNA helix pairs in a DNA origami nanotube. Together, these results provide important methodological advances in the use of SAXS to analyze DNA nanostructures in solution and insights into the structures of single-layer DNA origami.

  9. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes

    NASA Astrophysics Data System (ADS)

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2015-12-01

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b

  10. Preparation of Small RNAs Using Rolling Circle Transcription and Site-Specific RNA Disconnection.

    PubMed

    Wang, Xingyu; Li, Can; Gao, Xiaomeng; Wang, Jing; Liang, Xingguo

    2015-01-13

    A facile and robust RNA preparation protocol was developed by combining rolling circle transcription (RCT) with RNA cleavage by RNase H. Circular DNA with a complementary sequence was used as the template for promoter-free transcription. With the aid of a 2'-O-methylated DNA, the RCT-generated tandem repeats of the desired RNA sequence were disconnected at the exact end-to-end position to harvest the desired RNA oligomers. Compared with the template DNA, more than 4 × 10(3) times the amount of small RNA products were obtained when modest cleavage was carried out during transcription. Large amounts of RNA oligomers could easily be obtained by simply increasing the reaction volume.

  11. DNA in Uninfected and Virus-Infected Cells Complementary to Avian Tumor Virus RNA

    PubMed Central

    Rosenthal, Peter N.; Robinson, Harriet L.; Robinson, William S.; Hanafusa, Teruko; Hanafusa, Hidesaburo

    1971-01-01

    The 70S RNA component of several avian tumor viruses was hybridized with DNA extracted from avian tumor virus-infected and uninfected chicken and Japanese quail cells. Tritium-labeled 70S RNAs from Rous sarcoma virus (RSV), Rous associated virus-1 (RAV-1), RAV-60, and Schmidt-Ruppin-RSV (SR-RSV) hybridize from 3 to 10 times more with DNA from uninfected chicken cells than with DNA from Escherichia coli, calfthymus, or baby hamster kidney cells. After infection of chicken cells with RSV(RAV-1), SR-RSV, or RAV-2, the amount of 70S avian tumor virus [3H]RNA hybridized increases by 1.6 times. The specificity of the hybridization reaction was shown by the specific competition of 70S SR-RSV [3H]RNA with 70S RNA from RSV(RAV-1), and not with RNA from Sendai virus or chicken cells. There was no difference in the hybridization of 70S RNA from RSV (RAV-1), RAV-1, or RAV-60 with DNA either from chicken cells that contain RAV-60 in a nonreplicating form or from chicken cells that do not appear to contain RAV-60. These results indicate that both types of uninfected chicken cells contain DNA that is complementary to RNA from several avian tumor viruses and that the amount of complementary DNA increases in such cells after infection with an avian tumor virus. The RNAs of genetically different avian tumor viruses appear to have indistinguishable base sequences by this technique. PMID:4332808

  12. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  13. Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

    PubMed

    Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

    2003-03-01

    A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

  14. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

    PubMed

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

    2018-02-01

    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  15. DNA Sequence Analysis of a Complementary DNA for Cold-Regulated Arabidopsis Gene cor15 and Characterization of the COR 15 Polypeptide 1

    PubMed Central

    Lin, Chentao; Thomashow, Michael F.

    1992-01-01

    Previous studies have indicated that changes in gene expression occur in Arabidopsis thaliana L. (Heyn) during cold acclimation and that certain of the cor (cold-regulated) genes encode polypeptides that share the unusual property of remaining soluble upon boiling in aqueous solution. Here, we identify a cDNA clone for a cold-regulated gene encoding one of the “boiling-stable” polypeptides, COR15. DNA sequence analysis indicated that the gene, designated cor15, encodes a 14.7-kilodalton hydrophilic polypeptide having an N-terminal amino acid sequence that closely resembles transit peptides that target proteins to the stromal compartment of chloroplasts. Immunological studies indicated that COR15 is processed in vivo and that the mature polypeptide, COR 15m, is present in the soluble fraction of chloroplasts. Possible functions of COR 15m are discussed. ImagesFigure 1Figure 4Figure 5Figure 6Figure 7 PMID:16668917

  16. Simple diazonium chemistry to develop specific gene sensing platforms.

    PubMed

    Revenga-Parra, M; García-Mendiola, T; González-Costas, J; González-Romero, E; Marín, A García; Pau, J L; Pariente, F; Lorenzo, E

    2014-02-27

    A simple strategy for covalent immobilizing DNA sequences, based on the formation of stable diazonized conducting platforms, is described. The electrochemical reduction of 4-nitrobenzenediazonium salt onto screen-printed carbon electrodes (SPCE) in aqueous media gives rise to terminal grafted amino groups. The presence of primary aromatic amines allows the formation of diazonium cations capable to react with the amines present at the DNA capture probe. As a comparison a second strategy based on the binding of aminated DNA capture probes to the developed diazonized conducting platforms through a crosslinking agent was also employed. The resulting DNA sensing platforms were characterized by cyclic voltammetry, electrochemical impedance spectroscopy and spectroscopic ellipsometry. The hybridization event with the complementary sequence was detected using hexaamineruthenium (III) chloride as electrochemical indicator. Finally, they were applied to the analysis of a 145-bp sequence from the human gene MRP3, reaching a detection limit of 210 pg μL(-1). Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  18. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    PubMed

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  19. Method of artificial DNA splicing by directed ligation (SDL).

    PubMed Central

    Lebedenko, E N; Birikh, K R; Plutalov, O V; Berlin YuA

    1991-01-01

    An approach to directed genetic recombination in vitro has been devised, which allows for joining together, in a predetermined way, a series of DNA segments to give a precisely spliced polynucleotide sequence (DNA splicing by directed ligation, SDL). The approach makes use of amplification, by means of several polymerase chain reactions (PCR), of a chosen set of DNA segments. Primers for the amplifications contain recognition sites of the class IIS restriction endonucleases, which transform blunt ends of the amplification products into protruding ends of unique primary structures, the ends to be used for joining segments together being mutually complementary. Ligation of the mixture of the segments so synthesized gives the desired sequence in an unambiguous way. The suggested approach has been exemplified by the synthesis of a totally processed (intronless) gene encoding human mature interleukin-1 alpha. Images PMID:1662363

  20. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

    2003-10-21

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  1. Controlling charge current through a DNA based molecular transistor

    NASA Astrophysics Data System (ADS)

    Behnia, S.; Fathizadeh, S.; Ziaei, J.

    2017-01-01

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I-V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive.

  2. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  3. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  4. Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

    ERIC Educational Resources Information Center

    Szeberényi, József

    2013-01-01

    Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

  5. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  6. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  7. 27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

    PubMed

    Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

    2018-06-12

    During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

  8. Terahertz spectroscopy for the isothermal detection of bacterial DNA by magnetic bead-based rolling circle amplification.

    PubMed

    Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling

    2017-12-04

    The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.

  9. Making sense of deep sequencing

    PubMed Central

    Goldman, D.; Domschke, K.

    2016-01-01

    This review, the first of an occasional series, tries to make sense of the concepts and uses of deep sequencing of polynucleic acids (DNA and RNA). Deep sequencing, synonymous with next-generation sequencing, high-throughput sequencing and massively parallel sequencing, includes whole genome sequencing but is more often and diversely applied to specific parts of the genome captured in different ways, for example the highly expressed portion of the genome known as the exome and portions of the genome that are epigenetically marked either by DNA methylation, the binding of proteins including histones, or that are in different configurations and thus more or less accessible to enzymes that cleave DNA. Deep sequencing of RNA (RNASeq) reverse-transcribed to complementary DNA is invaluable for measuring RNA expression and detecting changes in RNA structure. Important concepts in deep sequencing include the length and depth of sequence reads, mapping and assembly of reads, sequencing error, haplotypes, and the propensity of deep sequencing, as with other types of ‘big data’, to generate large numbers of errors, requiring monitoring for methodologic biases and strategies for replication and validation. Deep sequencing yields a unique genetic fingerprint that can be used to identify a person, and a trove of predictors of genetic medical diseases. Deep sequencing to identify epigenetic events including changes in DNA methylation and RNA expression can reveal the history and impact of environmental exposures. Because of the power of sequencing to identify and deliver biomedically significant information about a person and their blood relatives, it creates ethical dilemmas and practical challenges in research and clinical care, for example the decision and procedures to report incidental findings that will increasingly and frequently be discovered. PMID:24925306

  10. Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.

    PubMed

    Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping

    2018-06-12

    The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7  cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.

  11. Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

    PubMed Central

    Liu, Yang; Rokita, Steven E.

    2012-01-01

    The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

  12. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    PubMed Central

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  13. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  14. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  15. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  16. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  17. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  18. Divergence, differential methylation and interspersion of melon satellite DNA sequences.

    PubMed Central

    Shmookler Reis, R; Timmis, J N; Ingle, J

    1981-01-01

    Melon (Cucumis melo) satellite DNA consists of two components, Q and S, each with a buoyant density in CsCl of 1.707 g/ml, but differing by 9 degrees C in "melting" temperature. These physical properties appear to be in contradiction, since both depend on G + C content. In order to resolve this anomaly, base compositions were directly determined for isolated fractions. the low-"melting" component S contains 41.8% G + C, with 6% of C present as 5-methylcytosine, whereas Q DNA contains 54% G + C, with 41% of C methylated. Analyses of restriction site loss agreed well with the direct determinations of methylation and divergence, and indicated some clustering of methylated sites in Q DNA. Analysis of restricted main-band DNA by hydridization with RNA complementary to Q satellite DNA ("Southern transfer") showed satellite Q tandem arrays interspersed in DNA of main-band density. Sequence divergence and extent of methylation did not appear to depend on whether a repeat array was present as satellite or interspersed in main-band DNA. Hydridization in situ indicated considerable heterogeneity in the genomic proportion of the Q-DNA sequences in melon fruit nuclei, implying over- and under-representation consistent with extensive unequal recombination in satellite Q tandem arrays. The cucumber, Cucumis sativus, contains less than 8% as much Q-homologous DNA per genome as the melon, suggesting rapid evolutionary gain or loss of these tandem repeat sequences. Images Fig. 2. PLATE 1 Fig. 4. Fig. 10. PMID:6172117

  19. Step-gate polysilicon nanowires field effect transistor compatible with CMOS technology for label-free DNA biosensor.

    PubMed

    Wenga, G; Jacques, E; Salaün, A-C; Rogel, R; Pichon, L; Geneste, F

    2013-02-15

    Currently, detection of DNA hybridization using fluorescence-based detection technique requires expensive optical systems and complex bioinformatics tools. Hence, the development of new low cost devices that enable direct and highly sensitive detection stimulates a lot of research efforts. Particularly, devices based on silicon nanowires are emerging as ultrasensitive electrical sensors for the direct detection of biological species thanks to their high surface to volume ratio. In this study, we propose innovative devices using step-gate polycrystalline silicon nanowire FET (poly-Si NW FETs), achieved with simple and low cost fabrication process, and used as ultrasensitive electronic sensor for DNA hybridization. The poly-SiNWs are synthesized using the sidewall spacer formation technique. The detailed fabrication procedure for a step-gate NWFET sensor is described in this paper. No-complementary and complementary DNA sequences were clearly discriminated and detection limit to 1 fM range is observed. This first result using this nano-device is promising for the development of low cost and ultrasensitive polysilicon nanowires based DNA sensors compatible with the CMOS technology. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. FATHEAD MINNOW VITELLOGENIN: COMPLEMENTARY DNA SEQUENCE AND MESSENGER RNA AND PROTEIN EXPRESSION AFTER 17B-ESTRADIOL TREATMENT

    EPA Science Inventory

    Induction of vitellogenin (VTG) in oviparous animals has been proposed as a sensitive indicator of invironmental contaminants that activate the estrogen receptor. In the present study, a sensitive ribonuclease protection assay (RPA) for VTG messenger RNA (mRNA) was developed for ...

  1. Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

    PubMed

    Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

    2005-01-01

    Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

  2. High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

    PubMed Central

    van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

    2010-01-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

  3. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    PubMed

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  4. Characterization of rat calcitonin mRNA.

    PubMed Central

    Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

    1980-01-01

    A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

  5. Osmylated DNA, a novel concept for sequencing DNA using nanopores

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia

    2015-03-01

    Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.

  6. Estimating the efficiency of fish cross-species cDNA microarray hybridization.

    PubMed

    Cohen, Raphael; Chalifa-Caspi, Vered; Williams, Timothy D; Auslander, Meirav; George, Stephen G; Chipman, James K; Tom, Moshe

    2007-01-01

    Using an available cross-species cDNA microarray is advantageous for examining multigene expression patterns in non-model organisms, saving the need for construction of species-specific arrays. The aim of the present study was to estimate relative efficiency of cross-species hybridizations across bony fishes, using bioinformatics tools. The methodology may serve also as a model for similar evaluations in other taxa. The theoretical evaluation was done by substituting comparative whole-transcriptome sequence similarity information into the thermodynamic hybridization equation. Complementary DNA sequence assemblages of nine fish species belonging to common families or suborders and distributed across the bony fish taxonomic branch were selected for transcriptome-wise comparisons. Actual cross-species hybridizations among fish of different taxonomic distances were used to validate and eventually to calibrate the theoretically computed relative efficiencies.

  7. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

    PubMed

    Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

    2013-05-07

    We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

  8. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  9. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  10. Identification and molecular characterization of a novel circular single-stranded DNA virus associated with yerba mate in Argentina.

    PubMed

    Bejerman, Nicolás; de Breuil, Soledad; Nome, Claudia

    2018-06-06

    A single-stranded DNA (ssDNA) virus was detected in Yerba mate samples showing chlorotic linear patterns, chlorotic rings and vein yellowing. The full-genome sequences of six different isolates of this ssDNA circular virus were obtained, which share > 99% sequence identity with each other. The newly identified virus has been tentatively named as yerba mate-associated circular DNA virus (YMaCV). The 2707 nt-long viral genome has two and three open reading frame on its complementary and virion-sense strands, respectively. The coat protein is more similar to that of mastreviruses (44% identity), whereas the replication-associated protein of YMaCV is more similar (49% identity) to that encoded by a recently described, unclassified ssDNA virus isolated on trees in Brazil. This is the first report of a circular DNA virus associated with yerba mate. Its unique genome organization and phylogenetic relationships indicates that YMaCV represents a distinct evolutionary lineage within the ssDNA viruses and therefore this virus should be classified as a member of a new species within an unassigned genus or family.

  11. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  12. Selection and characterization of a DNA aptamer to crystal violet.

    PubMed

    Chen, Yang; Wang, Jine; Zhang, Yajie; Xu, Lijun; Gao, Tian; Wang, Bing; Pei, Renjun

    2018-06-13

    Aptamers are short single-stranded DNA or RNA, which can be selected in vitro by systematic evolution of ligands by exponential enrichment (SELEX). In order to develop novel light-up probes to substitute G-quadruplex (G4), we selected a DNA aptamer for crystal violet (CV), a triphenylmethane light-up dye, by a modified affinity chromatography-based SELEX. The ssDNA pool was first coupled on streptavidin-coated agarose beads through a biotin labeled complementary oligonucleotide, and then the aptamer sequences would be released from agarose beads by CV affinity. This method is simple, straightforward and effective. The aptamer sequence with a low micromolar dissociation constant (Kd) and good specificity was achieved after 11 rounds of selection. The light-up properties of the CV-aptamer were also investigated, and the CV showed dramatic fluorescence enhancement. The CV-aptamer pair could be further used as a novel light-up fluorescent probe to design biosensors.

  13. Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization

    NASA Astrophysics Data System (ADS)

    James, Carrie Rae

    Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.

  14. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  15. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  16. A Sequence-Dependent DNA Condensation Induced by Prion Protein

    PubMed Central

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

  17. A Sequence-Dependent DNA Condensation Induced by Prion Protein.

    PubMed

    Bera, Alakesh; Biring, Sajal

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

  18. HLA genotyping by next-generation sequencing of complementary DNA.

    PubMed

    Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya

    2017-11-28

    Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.

  19. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    PubMed

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  20. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  1. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  2. Synthesis and application of a triazene-ferrocene modifier for immobilization and characterization of oligonucleotides at electrodes.

    PubMed

    Hansen, Majken N; Farjami, Elaheh; Kristiansen, Martin; Clima, Lilia; Pedersen, Steen Uttrup; Daasbjerg, Kim; Ferapontova, Elena E; Gothelf, Kurt V

    2010-04-16

    A new DNA modifier containing triazene, ferrocene, and activated ester functionalities was synthesized and applied for electrochemical grafting and characterization of DNA at glassy carbon (GC) and gold electrodes. The modifier was synthesized from ferrocenecarboxylic acid by attaching a phenyltriazene derivative to one of the ferrocene Cp rings, while the other Cp ring containing the carboxylic acid was converted to an activated ester. The modifier was conjugated to an amine-modified DNA sequence. For immobilization of the conjugate at Au or GC electrodes, the triazene was activated by dimethyl sulfate for release of the diazonium salt. The salt was reductively converted to the aryl radical which was readily immobilized at the surface. DNA grafted onto electrodes exhibited remarkable hybridization properties, as detected through a reversible shift in the redox potential of the Fc redox label upon repeated hybridization/denaturation procedures with a complementary target DNA sequence. By using a methylene blue (MB) labeled target DNA sequence the hybridization could also be followed through the MB redox potential. Electrochemical studies demonstrated that grafting through the triazene modifier can successfully compete with existing protocols for DNA immobilization through the commonly used alkanethiol linkers and diazonium salts. Furthermore, the triazene modifier provides a practical one-step immobilization procedure.

  3. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  4. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    PubMed

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Simplified Identification of mRNA or DNA in Whole Cells

    NASA Technical Reports Server (NTRS)

    Almeida, Eduardo; Kadambi, Geeta

    2007-01-01

    A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.

  6. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  7. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2001-01-01

    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  8. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  9. A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

    PubMed

    Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

    2017-05-15

    We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

    PubMed Central

    Greenberg, Jay R.; Perry, Robert P.

    1971-01-01

    The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

  11. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  12. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    NASA Astrophysics Data System (ADS)

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

    2014-09-01

    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  13. A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

    PubMed

    Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

    2015-09-11

    Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

  14. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  15. Photonic crystals on copolymer film for label-free detection of DNA hybridization.

    PubMed

    Su, Han; Cheng, Xin R; Endo, Tatsuro; Kerman, Kagan

    2018-04-30

    The presence of a single-nucleotide polymorphism in Apolipoprotein E4 gene is implicated with the increased risk of developing Alzheimer's disease (AD). In this study, detection of AD-related DNA oligonucleotide sequence associated with Apolipoprotein E4 gene sequence was achieved using localized-surface plasmon resonance (LSPR) on 2D-Photonic crystal (2D-PC) and Au-coated 2D-PC surfaces. 2D-PC surfaces were fabricated on a flexible copolymer film using nano-imprint lithography (NIL). The film surface was then coated with a dual-functionalized polymer to react with surface immobilized DNA probe. DNA hybridization was detected by monitoring the optical responses of either a Fresnel decrease in reflectance on 2D-PC surfaces or an increase in LSPR on Au-coated 2D-PC surfaces. The change in response due to DNA hybridization on the modified surfaces was also investigated using mismatched and non-complementary oligonucleotides sequences. The proof-of-concept results are promising towards the development of 2D-PC on copolymer film surfaces as miniaturized and wearable biosensors for various diagnostic and defense applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Porcine parvovirus: DNA sequence and genome organization.

    PubMed

    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

    1989-10-01

    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  17. Motif-based analysis of large nucleotide data sets using MEME-ChIP

    PubMed Central

    Ma, Wenxiu; Noble, William S; Bailey, Timothy L

    2014-01-01

    MEME-ChIP is a web-based tool for analyzing motifs in large DNA or RNA data sets. It can analyze peak regions identified by ChIP-seq, cross-linking sites identified by cLIP-seq and related assays, as well as sets of genomic regions selected using other criteria. MEME-ChIP performs de novo motif discovery, motif enrichment analysis, motif location analysis and motif clustering, providing a comprehensive picture of the DNA or RNA motifs that are enriched in the input sequences. MEME-ChIP performs two complementary types of de novo motif discovery: weight matrix–based discovery for high accuracy; and word-based discovery for high sensitivity. Motif enrichment analysis using DNA or RNA motifs from human, mouse, worm, fly and other model organisms provides even greater sensitivity. MEME-ChIP’s interactive HTML output groups and aligns significant motifs to ease interpretation. this protocol takes less than 3 h, and it provides motif discovery approaches that are distinct and complementary to other online methods. PMID:24853928

  18. VaDiR: an integrated approach to Variant Detection in RNA.

    PubMed

    Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

    2018-02-01

    Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

  19. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  20. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  1. Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction.

    PubMed

    Lazinski, David W; Camilli, Andrew

    2013-01-01

    The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.

  2. [Definition of the specificity of DNA-methyltransferase M.Bsc4I in cell lysate by blocking of restriction endonucleases and computer modeling].

    PubMed

    Dedkov, V S

    2009-01-01

    The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.

  3. Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

    NASA Astrophysics Data System (ADS)

    Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

    2017-04-01

    An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

  4. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    PubMed

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Creating complex molecular topologies by configuring DNA four-way junctions

    NASA Astrophysics Data System (ADS)

    Liu, Di; Chen, Gang; Akhter, Usman; Cronin, Timothy M.; Weizmann, Yossi

    2016-10-01

    The realization of complex topologies at the molecular level represents a grand challenge in chemistry. This necessitates the manipulation of molecular interactions with high precision. Here we show that single-stranded DNA (ssDNA) knots and links can be created by utilizing the inherent topological properties that pertain to the DNA four-way junction, at which the two helical strands form a node and can be configured conveniently and connected for complex topological construction. Using this strategy, we produced series of ssDNA topoisomers with the same sequences. By finely designing the curvature and torsion, double-stranded DNA knots were accessed by hybridizing and ligating the complementary strands with the knotted ssDNA templates. Furthermore, we demonstrate the use of a constructed ssDNA knot both to probe the topological conversion catalysed by DNA topoisomerase and to study the DNA replication under topological constraint.

  6. Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching

    PubMed Central

    Teo, Yin Nah; Wilson, James N.

    2010-01-01

    We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115

  7. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology

    PubMed Central

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H.

    2011-01-01

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dTn tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5′ end of the dTn tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with 32P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. PMID:21893212

  8. Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

    NASA Astrophysics Data System (ADS)

    Kowalczykowski, Stephen

    2013-03-01

    We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

  9. Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

    PubMed Central

    Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

    2013-01-01

    Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

  10. Mimicking an Enzyme-Based Colorimetric Aptasensor for Antibiotic Residue Detection in Milk Combining Magnetic Loop-DNA Probes and CHA-Assisted Target Recycling Amplification.

    PubMed

    Luan, Qian; Gan, Ning; Cao, Yuting; Li, Tianhua

    2017-07-19

    A mimicking-enzyme-based colorimetric aptasensor was developed for the detection of kanamycin (KANA) in milk using magnetic loop-DNA-NMOF-Pt (m-L-DNA) probes and catalytic hairpin assembly (CHA)-assisted target recycling for signal amplification. The m-L-DNA probes were constructed via hybridization of hairpin DNA H1 (containing aptamer sequence) immobilized magnetic beads (m-H1) and signal DNA (sDNA, partial hybridization with H1) labeled nano Fe-MIL-88NH 2 -Pt (NMOF-Pt-sDNA). In the presence of KANA and complementary hairpin DNA H2, the m-L-DNA probes decomposed and formed an m-H1/KANA intermediate, which triggered the CHA reaction to form a stable duplex strand (m-H1-H2) while releasing KANA again for recycling. Consequently, numerous NMOF-Pt-sDNA as mimicking enzymes can synergistically catalyze 3,3',5,5'-tetramethylbenzidine (TMB) for color development. The aptasensor exhibited high selectivity and sensitivity for KANA in milk with a detection limit of 0.2 pg mL -1 within 30 min. The assay can be conveniently extended for on-site screening of other antibiotics in foods by simply changing the base sequence of the probes.

  11. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  12. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    PubMed

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

    PubMed Central

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-01-01

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

  14. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

    PubMed

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-02-15

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

  15. A Delicate Balance Between Repair and Replication Factors Regulates Recombination Between Divergent DNA Sequences in Saccharomyces cerevisiae

    PubMed Central

    Chakraborty, Ujani; George, Carolyn M.; Lyndaker, Amy M.; Alani, Eric

    2016-01-01

    Single-strand annealing (SSA) is an important homologous recombination mechanism that repairs DNA double strand breaks (DSBs) occurring between closely spaced repeat sequences. During SSA, the DSB is acted upon by exonucleases to reveal complementary sequences that anneal and are then repaired through tail clipping, DNA synthesis, and ligation steps. In baker’s yeast, the Msh DNA mismatch recognition complex and the Sgs1 helicase act to suppress SSA between divergent sequences by binding to mismatches present in heteroduplex DNA intermediates and triggering a DNA unwinding mechanism known as heteroduplex rejection. Using baker’s yeast as a model, we have identified new factors and regulatory steps in heteroduplex rejection during SSA. First we showed that Top3-Rmi1, a topoisomerase complex that interacts with Sgs1, is required for heteroduplex rejection. Second, we found that the replication processivity clamp proliferating cell nuclear antigen (PCNA) is dispensable for heteroduplex rejection, but is important for repairing mismatches formed during SSA. Third, we showed that modest overexpression of Msh6 results in a significant increase in heteroduplex rejection; this increase is due to a compromise in Msh2-Msh3 function required for the clipping of 3′ tails. Thus 3′ tail clipping during SSA is a critical regulatory step in the repair vs. rejection decision; rejection is favored before the 3′ tails are clipped. Unexpectedly, Msh6 overexpression, through interactions with PCNA, disrupted heteroduplex rejection between divergent sequences in another recombination substrate. These observations illustrate the delicate balance that exists between repair and replication factors to optimize genome stability. PMID:26680658

  16. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    PubMed

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  17. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    PubMed Central

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  18. Interactions of the EcoRV restriction endonuclease with fluorescent oligodeoxynucleotides.

    PubMed

    Erskine, S G; Halford, S E

    1995-05-19

    A self-complementary dodecadeoxyribonucleotide that contains the recognition sequence for the R.EcoRV ENase was synthesised with a primary amino group at its 5' terminus. The 5' amino function was labeled with the fluorescent dye 5-[dimethylamino] napthalene-1-sulfonyl chloride. The labeled oligodeoxyribonucleotide in its duplex form was shown to be a suitable substrate for kinetic studies on the ENase and that no significant dye-DNA or dye-protein interactions occurred. Finally, the binding of R.EcoRV to the labeled DNA was followed by detecting the fluorescence resonance energy transfer between the tryptophans of the protein and the fluorescent labels of the DNA.

  19. Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

    PubMed

    Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

    1995-04-03

    The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

  20. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  1. Signatures of selection among sex-determining alleles of the honey bee.

    PubMed

    Hasselmann, Martin; Beye, Martin

    2004-04-06

    Patterns of DNA polymorphisms are a primary tool for dissecting signatures of selection; however, the underlying selective forces are poorly understood for most genes. A classical example of diversifying selection is the complementary sex-determining locus that is found in the very large insect order Hymenoptera (bees, wasps, ants, and sawflies). The gene responsible for sex determination, the complementary sex determiner (csd), has been most recently identified in the honey bee. Females are heterozygous at this locus. Males result when there is only one functional allele present, as a result of either homozygosity (fertilized eggs) or, more commonly, hemizygosity (unfertilized eggs). The homozygotes, diploid males, do not reproduce and have zero fitness, which implies positive selection in favor of rare alleles. Large differences in csd cDNA sequences within and between four populations were found that fall into two major groups, types I and II. Type I consists of several allelic lineages that were maintained over an extended period, an indication of balancing selection. Diversifying selection has operated on several confined parts of the protein, as shown by an excess of nonsynonymous differences. Elevated sequence differences indicate another selected part near a repeat region. These findings have general implications about the understanding of both the function of the multiallelic mechanism and the adaptive processes on the level of nucleotide sequences. Moreover, the first csd sequence data are a notable basis for the avoidance of diploid males in bee selection programs by allele-assisted breeding.

  2. The recognition and modification sites for the bacterial type I restriction systems KpnAI, StySEAI, StySENI and StySGI

    PubMed Central

    Kasarjian, Julie K. A.; Hidaka, Masumi; Horiuchi, Takashi; Iida, Masatake; Ryu, Junichi

    2004-01-01

    Using an in vivo plasmid transformation method, we have determined the DNA sequences recognized by the KpnAI, StySEAI, StySENI and StySGI R-M systems from Klebsiella oxytoca strain M5a1, Salmonella eastbourne, Salmonella enteritidis and Salmonella gelsenkirchen, respectively. These type I restriction-modification systems were originally identified using traditional phage assay, and described here is the plasmid transformation test and computer program used to determine their DNA recognition sequences. For this test, we constructed two sets of plasmids, pL and pE, that contain phage lambda and Escherichia coli K-12 chromosomal DNA fragments, respectively. Further, using the methylation sensitivities of various known type II restriction enzymes, we identified the target adenines for methylation (listed in bold italics below as A or T in case of the complementary strand). The recognition sequence and methylation sites are GAA(6N)TGCC (KpnAI), ACA(6N)TYCA (StySEAI), CGA(6N)TACC (StySENI) and TAAC(7N)RTCG (StySGI). These DNA recognition sequences all have a typical type I bipartite pattern and represent three novel specificities and one isoschizomer (StySENI). For confirmation, oligonucleotides containing each of the predicted sequences were synthesized, cloned into plasmid pMECA and transformed into each strain, resulting in a large reduction in efficiency of transformation (EOT). PMID:15199175

  3. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  4. Theory and modeling of particles with DNA-mediated interactions

    NASA Astrophysics Data System (ADS)

    Licata, Nicholas A.

    2008-05-01

    In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

  5. Functionalization of optical nanotip arrays with an electrochemical microcantilever for multiplexed DNA detection.

    PubMed

    Descamps, Emeline; Duroure, Nathalie; Deiss, Frédérique; Leichlé, Thierry; Adam, Catherine; Mailley, Pascal; Aït-Ikhlef, Ali; Livache, Thierry; Nicu, Liviu; Sojic, Neso

    2013-08-07

    Optical nanotip arrays fabricated on etched fiber bundles were functionalized with DNA spots. Such unconventional substrates (3D and non-planar) are difficult to pattern with standard microfabrication techniques but, using an electrochemical cantilever, up to 400 spots were electrodeposited on the nanostructured optical surface in 5 min. This approach allows each spot to be addressed individually and multiplexed fluorescence detection is demonstrated. Finally, remote fluorescence detection was performed by imaging through the optical fiber bundle itself after hybridisation with the complementary sequence.

  6. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  7. Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

    PubMed Central

    Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

    2014-01-01

    The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

  8. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    PubMed

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The dynamics of genome replication using deep sequencing

    PubMed Central

    Müller, Carolin A.; Hawkins, Michelle; Retkute, Renata; Malla, Sunir; Wilson, Ray; Blythe, Martin J.; Nakato, Ryuichiro; Komata, Makiko; Shirahige, Katsuhiko; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.

    2014-01-01

    Eukaryotic genomes are replicated from multiple DNA replication origins. We present complementary deep sequencing approaches to measure origin location and activity in Saccharomyces cerevisiae. Measuring the increase in DNA copy number during a synchronous S-phase allowed the precise determination of genome replication. To map origin locations, replication forks were stalled close to their initiation sites; therefore, copy number enrichment was limited to origins. Replication timing profiles were generated from asynchronous cultures using fluorescence-activated cell sorting. Applying this technique we show that the replication profiles of haploid and diploid cells are indistinguishable, indicating that both cell types use the same cohort of origins with the same activities. Finally, increasing sequencing depth allowed the direct measure of replication dynamics from an exponentially growing culture. This is the first time this approach, called marker frequency analysis, has been successfully applied to a eukaryote. These data provide a high-resolution resource and methodological framework for studying genome biology. PMID:24089142

  10. A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell.

    PubMed

    Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki

    2015-02-15

    Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Multisegment nanowire sensors for the detection of DNA molecules.

    PubMed

    Wang, Xu; Ozkan, Cengiz S

    2008-02-01

    We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

  12. An in silico DNA cloning experiment for the biochemistry laboratory.

    PubMed

    Elkins, Kelly M

    2011-01-01

    This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.

  13. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  14. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    PubMed

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  15. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  16. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNAmore » when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.« less

  17. Amplified biosensing using the horseradish peroxidase-mimicking DNAzyme as an electrocatalyst.

    PubMed

    Pelossof, Gilad; Tel-Vered, Ran; Elbaz, Johann; Willner, Itamar

    2010-06-01

    The hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme is assembled on Au electrodes. It reveals bioelectrocatalytic properties and electrocatalyzes the reduction of H(2)O(2). The bioelectrocatalytic functions of the hemin/G-quadruplex DNAzyme are used to develop electrochemical sensors that follow the activity of glucose oxidase and biosensors for the detection of DNA or low-molecular-weight substrates (adenosine monophosphate, AMP). Hairpin nucleic structures that include the G-quadruplex sequence in a caged configuration and the nucleic acid sequence complementary to the analyte DNA, or the aptamer sequence for AMP, are immobilized on Au-electrode surfaces. In the presence of the DNA analyte, or AMP, the hairpin structures are opened, and the hemin/G-quadruplex horseradish peroxidase-mimicking DNAzyme structures are generated on the electrode surfaces. The bioelectrocatalytic cathodic currents generated by the functionalized electrodes, upon the electrochemical reduction of H(2)O(2), provide a quantitative measure for the detection of the target analytes. The DNA target was analyzed with a detection limit of 1 x 10(-12) M, while the detection limit for analyzing AMP was 1 x 10(-6) M. Methods to regenerate the sensing surfaces are presented.

  18. DNA Nanostructures as Smart Drug-Delivery Vehicles and Molecular Devices.

    PubMed

    Linko, Veikko; Ora, Ari; Kostiainen, Mauri A

    2015-10-01

    DNA molecules can be assembled into custom predesigned shapes via hybridization of sequence-complementary domains. The folded structures have high spatial addressability and a tremendous potential to serve as platforms and active components in a plethora of bionanotechnological applications. DNA is a truly programmable material, and its nanoscale engineering thus opens up numerous attractive possibilities to develop novel methods for therapeutics. The tailored molecular devices could be used in targeting cells and triggering the cellular actions in the biological environment. In this review we focus on the DNA-based assemblies - primarily DNA origami nanostructures - that could perform complex tasks in cells and serve as smart drug-delivery vehicles in, for example, cancer therapy, prodrug medication, and enzyme replacement therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

    PubMed Central

    2015-01-01

    Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

  20. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  1. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    PubMed Central

    Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

    2010-01-01

    Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

  2. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    PubMed

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1997-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  4. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1999-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  5. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1999-08-31

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

  6. Development of a mass sensitive quartz crystal microbalance (QCM)-based DNA biosensor using a 50 MHz electronic oscillator circuit.

    PubMed

    García-Martinez, Gonzalo; Bustabad, Enrique Alonso; Perrot, Hubert; Gabrielli, Claude; Bucur, Bogdan; Lazerges, Mathieu; Rose, Daniel; Rodriguez-Pardo, Loreto; Fariña, Jose; Compère, Chantal; Vives, Antonio Arnau

    2011-01-01

    This work deals with the design of a high sensitivity DNA sequence detector using a 50 MHz quartz crystal microbalance (QCM) electronic oscillator circuit. The oscillator circuitry is based on Miller topology, which is able to work in damping media. Calibration and experimental study of frequency noise are carried out, finding that the designed sensor has a resolution of 7.1 ng/cm(2) in dynamic conditions (with circulation of liquid). Then the oscillator is proved as DNA biosensor. Results show that the system is able to detect the presence of complementary target DNAs in a solution with high selectivity and sensitivity. DNA target concentrations higher of 50 ng/mL can be detected.

  7. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

    The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

  8. Molecular genetic analysis of the V kappa Ser group associated with two mouse light chain genetic markers. Complementary DNA cloning and southern hybridization analysis

    PubMed Central

    1985-01-01

    Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938

  9. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers. © 2013 Elsevier B.V. All rights reserved.

  10. DNA-COMPACT: DNA COMpression Based on a Pattern-Aware Contextual Modeling Technique

    PubMed Central

    Li, Pinghao; Wang, Shuang; Kim, Jihoon; Xiong, Hongkai; Ohno-Machado, Lucila; Jiang, Xiaoqian

    2013-01-01

    Genome data are becoming increasingly important for modern medicine. As the rate of increase in DNA sequencing outstrips the rate of increase in disk storage capacity, the storage and data transferring of large genome data are becoming important concerns for biomedical researchers. We propose a two-pass lossless genome compression algorithm, which highlights the synthesis of complementary contextual models, to improve the compression performance. The proposed framework could handle genome compression with and without reference sequences, and demonstrated performance advantages over best existing algorithms. The method for reference-free compression led to bit rates of 1.720 and 1.838 bits per base for bacteria and yeast, which were approximately 3.7% and 2.6% better than the state-of-the-art algorithms. Regarding performance with reference, we tested on the first Korean personal genome sequence data set, and our proposed method demonstrated a 189-fold compression rate, reducing the raw file size from 2986.8 MB to 15.8 MB at a comparable decompression cost with existing algorithms. DNAcompact is freely available at https://sourceforge.net/projects/dnacompact/for research purpose. PMID:24282536

  11. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    PubMed Central

    Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

  12. Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

    PubMed

    Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

    2014-06-01

    The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

  13. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification.

    PubMed

    Huang, Ke-Jing; Liu, Yu-Jie; Zhang, Ji-Zong; Cao, Jun-Tao; Liu, Yan-Ming

    2015-05-15

    We have developed a sensitive sensing platform for 17β-estradiol by combining the aptamer probe and hybridization reaction. In this assay, 2-dimensional cobalt sulfide nanosheet (CoS) was synthesized by a simple hydrothermal method with L-cysteine as sulfur donor. An electrochemical aptamer biosensor was constructed by assembling a thiol group tagged 17β-estradiol aptamer on CoS and gold nanoparticles (AuNPs) modified electrode. Methylene blue was applied as a tracer and a guanine-rich complementary DNA sequence was designed to bind with the unbound 17β-estradiol aptamer for signal amplification. The binding of guanine-rich DNA to the aptamer was inhibited when the aptamer captured 17β-estradiol. Using guanine-rich DNA in the assay greatly amplified the redox signal of methylene blue bound to the detection probe. The CoS/AuNPs film formed on the biosensor surface appeared to be a good conductor for accelerating the electron transfer. The method demonstrated a high sensitivity of detection with the dynamic concentration range spanning from 1.0×10(-9) to 1.0×10(-12) M and a detection limit of 7.0×10(-13) M. Besides, the fabricated biosensor exhibited good selectivity toward 17β-estradiol even when interferents were presented at 100-fold concentrations. Our attempt will extend the application of the CoS nanosheet and this signal amplification assay to biosensing areas. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction

    PubMed Central

    Lazinski, David W.; Camilli, Andrew

    2013-01-01

    The amplification of DNA fragments, cloned between user-defined 5′ and 3′ end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3′ termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5′ ends. The hybrid oligonucleotide has a user-defined sequence at its 5′ end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5′ user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA. PMID:23311318

  15. The genetic diversity of Epstein-Barr virus in the setting of transplantation relative to non-transplant settings: A feasibility study.

    PubMed

    Allen, Upton D; Hu, Pingzhao; Pereira, Sergio L; Robinson, Joan L; Paton, Tara A; Beyene, Joseph; Khodai-Booran, Nasser; Dipchand, Anne; Hébert, Diane; Ng, Vicky; Nalpathamkalam, Thomas; Read, Stanley

    2016-02-01

    This study examines EBV strains from transplant patients and patients with IM by sequencing major EBV genes. We also used NGS to detect EBV DNA within total genomic DNA, and to evaluate its genetic variation. Sanger sequencing of major EBV genes was used to compare SNVs from samples taken from transplant patients vs. patients with IM. We sequenced EBV DNA from a healthy EBV-seropositive individual on a HiSeq 2000 instrument. Data were mapped to the EBV reference genomes (AG876 and B95-8). The number of EBNA2 SNVs was higher than for EBNA1 and the other genes sequenced within comparable reference coordinates. For EBNA2, there was a median of 15 SNV among transplant samples compared with 10 among IM samples (p = 0.036). EBNA1 showed little variation between samples. For NGS, we identified 640 and 892 variants at an unadjusted p value of 5 × 10(-8) for AG876 and B95-8 genomes, respectively. We used complementary sequence strategies to examine EBV genetic diversity and its application to transplantation. The results provide the framework for further characterization of EBV strains and related outcomes after organ transplantation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Miniaturization Technologies for Efficient Single-Cell Library Preparation for Next-Generation Sequencing.

    PubMed

    Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C

    2016-08-01

    As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.

  17. Diverse Applications of Environmental DNA Methods in Parasitology.

    PubMed

    Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

    2015-10-01

    Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  18. Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

    PubMed Central

    Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

    1981-01-01

    Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

  19. Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

    PubMed

    Calvet, J P; Meyer, L M; Pederson, T

    1982-07-30

    Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

  20. Structural Insights into the HIV-1 Minus-strand Strong-stop DNA*

    PubMed Central

    Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

    2016-01-01

    An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3′-end of the genomic RNA with the complementary r region at the 3′-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). PMID:26668324

  1. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Complexes of mismatched and complementary DNA with minor groove binders. Structures at nucleotide resolution via an improved hydroxyl radical cleavage methodology.

    PubMed

    Bialonska, Dobroslawa; Song, Kenneth; Bolton, Philip H

    2011-11-27

    Tumor cell lines can replicate faster than normal cells and many also have defective DNA repair pathways. This has lead to the investigation of the inhibition of DNA repair proteins as a means of therapeutic intervention. An alternative approach is to hide or mask damaged DNA from the repair systems. We have developed a protocol to investigate the structures of the complexes of damaged DNA with drug like molecules. Nucleotide resolution structural information can be obtained using an improved hydroxyl radical cleavage protocol. The use of a dT(n) tail increases the length of the smallest fragments of interest and allows efficient co-precipitation of the fragments with poly(A). The use of a fluorescent label, on the 5' end of the dT(n) tail, in conjunction with modified cleavage reaction conditions, avoids the lifetime and other problems with (32)P labeling. The structures of duplex DNAs containing AC and CC mismatches in the presence and absence of minor groove binders have been investigated as have those of the fully complementary DNA. The results indicate that the structural perturbations of the mismatches are localized, are sequence dependent and that the presence of a mismatch can alter the binding of drug like molecules. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  4. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    PubMed

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-19

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  5. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome

    DOE PAGES

    Spurrell, Cailyn H.; Dickel, Diane E.; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. Here in this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters.

  6. Cospeciation of Psyllids and Their Primary Prokaryotic Endosymbionts

    PubMed Central

    Thao, MyLo L.; Moran, Nancy A.; Abbot, Patrick; Brennan, Eric B.; Burckhardt, Daniel H.; Baumann, Paul

    2000-01-01

    Psyllids are plant sap-feeding insects that harbor prokaryotic endosymbionts in specialized cells within the body cavity. Four-kilobase DNA fragments containing 16S and 23S ribosomal DNA (rDNA) were amplified from the primary (P) endosymbiont of 32 species of psyllids representing three psyllid families and eight subfamilies. In addition, 0.54-kb fragments of the psyllid nuclear gene wingless were also amplified from 26 species. Phylogenetic trees derived from 16S-23S rDNA and from the host wingless gene are very similar, and tests of compatibility of the data sets show no significant conflict between host and endosymbiont phylogenies. This result is consistent with a single infection of a shared psyllid ancestor and subsequent cospeciation of the host and the endosymbiont. In addition, the phylogenies based on DNA sequences generally agreed with psyllid taxonomy based on morphology. The 3′ end of the 16S rDNA of the P endosymbionts differs from that of other members of the domain Bacteria in the lack of a sequence complementary to the mRNA ribosome binding site. The rate of sequence change in the 16S-23S rDNA of the psyllid P endosymbiont was considerably higher than that of other bacteria, including other fast-evolving insect endosymbionts. The lineage consisting of the P endosymbionts of psyllids was given the designation Candidatus Carsonella (gen. nov.) with a single species, Candidatus Carsonella ruddii (sp. nov.). PMID:10877784

  7. Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection

    PubMed Central

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2008-01-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive and multiplex format, an alternative surface enhanced Raman scattering (SERS) based probe was designed and fabricated to covalently attach both DNA probing sequence and non-fluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the non-fluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA (ssDNA) to its complementary targets was successfully accomplished with a long-term goal to use non-fluorescent RTags in a Raman-based DNA microarray platform. PMID:17465531

  8. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

    PubMed

    Cui, Chenghua; Shu, Wei; Li, Peining

    2016-01-01

    Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

  10. Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

    PubMed Central

    Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

    2010-01-01

    The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

  11. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  12. Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae.

    PubMed

    Deguchi, T; Fukuoka, A; Yasuda, M; Nakano, M; Ozeki, S; Kanematsu, E; Nishino, Y; Ishihara, S; Ban, Y; Kawada, Y

    1997-03-01

    We determined a partial sequence of the Klebsiella pneumoniae parC gene, including the region analogous to the quinolone resistance-determining region of the Escherichia coli gyrA gene, and examined 26 clinical strains of K. pneumoniae for an association of alterations in GyrA and ParC with susceptibilities to quinolones. The study suggests that in K. pneumoniae DNA gyrase is a primary target of quinolones and that ParC alterations play a complementary role in the development of higher-level fluoroquinolone resistance.

  13. Reliable method for generating double-stranded DNA vectors containing site-specific base modifications.

    PubMed

    Brégeon, Damien; Doetsch, Paul W

    2004-11-01

    Cells of all living organisms are continuously exposed to physical and chemical agents that damage DNA and alter the integrity of their genomes. Despite the relatively high efficiency of the different repair pathways, some lesions remain in DNA when it is replicated or transcribed. Lesion bypass by DNA and RNA polymerases has been the subject of numerous investigations. However, knowledge of the in vivo mechanism of transcription lesion bypass is very limited because no robust methodology is available. Here we describe a protocol based on the synthesis of a complementary strand of a circular, single-stranded DNA molecule, which allows for the production of large amounts of double-stranded DNA containing a lesion at a specific position in a transcribed sequence. Such constructs can subsequently be used for lesion bypass studies in vivo by RNA polymerase and to ascertain how these events can be affected by the genetic background of the cells.

  14. Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

    NASA Astrophysics Data System (ADS)

    Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

    2008-09-01

    We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

  15. Direct Determination of the Equilibrium Unbinding Potential Profile for a Short DNA Duplex from Force Spectroscopy Data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Noy, A

    2004-05-04

    Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less

  16. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    PubMed

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph

    2007-06-01

    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  17. Cytochrome P450 1C1 complementary DNA cloning, sequence analysis and constitutive expression induced by benzo-a-pyrene in Nile tilapia (Oreochromis niloticus).

    PubMed

    Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao

    2012-03-01

    CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  19. Sequence-Specific DNA Photosplitting of Crosslinked DNAs Containing the 3-Cyanovinylcarbazole Nucleoside by Using DNA Strand Displacement.

    PubMed

    Nakamura, Shigetaka; Kawabata, Hayato; Fujimoto, Kenzo

    2016-08-17

    An oligodeoxynucleotide (ODN) containing the ultrafast reversible 3-cyanovinylcarbazole ((CNV) K) photo-crosslinker was photo-crosslinked to a complementary strand upon exposure to 366 nm irradiation and photosplit by use of 312 nm irradiation. In this paper we report that the photoreaction of (CNV) K on irradiation at 366 nm involves a photostationary state and that its reaction can be controlled by temperature. Guided by this new insight, we proposed and have now demonstrated previously unknown photosplitting of (CNV) K aided by DNA strand displacement as an alternative to heating. The photo-crosslinked double-stranded DNA (dsDNA) underwent >80 % photosplitting aided by DNA strand displacement on irradiation at 366 nm without heating. In this photosplitting based on DNA strand displacement, the relative thermal stability of the invader strand with respect to the template strands plays an important role, and an invader strand/template strand system that is more stable than the passenger strand/template strand system induces photosplitting without heating. This new strand-displacement-aided photosplitting occurred in a sequence-specific manner through irradiation at 366 nm in the presence of an invader strand. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1997-08-26

    A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

  1. Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

    PubMed

    Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

    2018-05-24

    Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

  2. Dynamic maps of UV damage formation and repair for the human genome

    PubMed Central

    Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

    2017-01-01

    Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS–Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS–Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage. PMID:28607063

  3. Dynamic maps of UV damage formation and repair for the human genome.

    PubMed

    Hu, Jinchuan; Adebali, Ogun; Adar, Sheera; Sancar, Aziz

    2017-06-27

    Formation and repair of UV-induced DNA damage in human cells are affected by cellular context. To study factors influencing damage formation and repair genome-wide, we developed a highly sensitive single-nucleotide resolution damage mapping method [high-sensitivity damage sequencing (HS-Damage-seq)]. Damage maps of both cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts [(6-4)PPs] from UV-irradiated cellular and naked DNA revealed that the effect of transcription factor binding on bulky adducts formation varies, depending on the specific transcription factor, damage type, and strand. We also generated time-resolved UV damage maps of both CPDs and (6-4)PPs by HS-Damage-seq and compared them to the complementary repair maps of the human genome obtained by excision repair sequencing to gain insight into factors that affect UV-induced DNA damage and repair and ultimately UV carcinogenesis. The combination of the two methods revealed that, whereas UV-induced damage is virtually uniform throughout the genome, repair is affected by chromatin states, transcription, and transcription factor binding, in a manner that depends on the type of DNA damage.

  4. Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

    PubMed Central

    Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

    2013-01-01

    Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

  5. Complementary DNA cloning and organ expression of cytochrome P450 1C2 in carp (Cyprinus carpio).

    PubMed

    Kaminishi, Yoshio; El-Kady, Mohamed A H; Mitsuo, Ryoichi; Itakura, Takao

    2007-01-01

    Cytochrome P450 (CYP) genes, which make up a large gene superfamily, are known to play an important role in drug metabolism. The CYP1 family, one of the gene families of the CYP superfamily, has three subfamilies of genes whose sequences have been deposited in the GenBank/EMBL thus far: CYP1A, CYP1B, and CYP1C. Mammals as well as fish confront numerous foreign chemicals in the environment that may accumulate to toxic levels unless they are metabolized and eliminated by processes largely mediated by CYP enzymes. A new complementary DNA of the CYP1C subfamily encoding CYP1C2 was isolated from the carp liver after a single intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 198 bp, an open reading frame of 1575 bp coding for 524 amino acids and a stop codon, and a 3' noncoding region of 531 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The amino acid sequence deduced from the carp CYP1C2 sequence showed a similarity of 76.6% with that deduced from our previously reported carp CYP1C1. It exhibited similarities of 77.3, 73.7, and 76.4% with those deduced from scup CYP1C2, scup CYP1C1, and Japanese eel CYP1C1 sequences, respectively. Carp CYP1C2 cDNA showed similarities with reported CYP1Bs of teleosts and mammals, namely, 47.6, 45.3, 45.7, 44.0, and 44.6% for carp, plaice, human, rat, and mouse CYP1B1s, respectively, while it exhibited a similarity of 49.0% with carp CYP1B2. The carp CYP1C2 sequence was aligned with the CYP1 sequences and has been deposited in the GenBank/EMBL data bank with the accession number AY437777. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of CYP1C with CYP1B than with CYP1A. The tree showed possibile existence of CYP1C subfamily genes in mammalian species. Northern blot analysis of the liver, intestines, kidneys, and gills revealed a distinct induced expression only in the kidneys, with no detectable constitutive expression in the other organs studied.

  6. A label-free, fluorescence based assay for microarray

    NASA Astrophysics Data System (ADS)

    Niu, Sanjun

    DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.

  7. Solid phase sequencing of biopolymers

    DOEpatents

    Cantor, Charles; Koster, Hubert

    2010-09-28

    This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

  8. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  9. Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.

    PubMed

    Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A

    1984-04-05

    Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.

  10. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    PubMed Central

    2012-01-01

    Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695

  11. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

    PubMed

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

    2008-05-01

    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  12. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  13. Asymmetry and Extent of In Vivo Transcripition of R-Plasmid Deoxyribonucleic Acid in Escherichia coli

    PubMed Central

    Vapnek, Daniel; Spingler, Elizabeth

    1974-01-01

    Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013

  14. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    PubMed

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  15. Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

    PubMed

    Berends Sexton, T; Jones, J T; Mullet, J E

    1990-05-01

    A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

  16. Pyrosequencing for Microbial Identification and Characterization

    PubMed Central

    Cummings, Patrick J.; Ahmed, Ray; Durocher, Jeffrey A.; Jessen, Adam; Vardi, Tamar; Obom, Kristina M.

    2013-01-01

    Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns. PMID:23995536

  17. Pyrosequencing for microbial identification and characterization.

    PubMed

    Cummings, Patrick J; Ahmed, Ray; Durocher, Jeffrey A; Jessen, Adam; Vardi, Tamar; Obom, Kristina M

    2013-08-22

    Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

  18. Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

    PubMed

    Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

    2015-06-01

    The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

  19. Retrospective MicroRNA Sequencing: Complementary DNA Library Preparation Protocol Using Formalin-fixed Paraffin-embedded RNA Specimens.

    PubMed

    Loudig, Olivier; Liu, Christina; Rohan, Thomas; Ben-Dov, Iddo Z

    2018-05-05

    -Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18-24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3' barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3' barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.

  20. DNA hybridization detection on electrical microarrays using coulostatic pulse technique.

    PubMed

    Dharuman, V; Nebling, E; Grunwald, T; Albers, J; Blohm, L; Elsholz, B; Wörl, R; Hintsche, R

    2006-12-15

    We demonstrated a novel application of transient coulostatic pulse technique for the detection of label free DNA hybridization on nm-sized gold interdigitated ultramicroelectrode arrays (Au-IDA) made in silicon technology. The array consists of eight different positions with an Au-IDA pair at each position arranged on the Si-based Biochip. Immobilization of capture probes onto the Au-IDA was accomplished by self-assembling of thiol-modified oligonucleotides. Target hybridization was indicated by a change in the magnitude of the time dependant potential relaxation curve in presence of electroactive Fe(CN)(6)(3-) in the phosphate buffer solution. While complementary DNA hybridization showed 50% increase in the relaxation potential, the non-complementary DNA showed a negligible change. A constant behaviour was noted for all positions. The dsDNA specific intercalating molecule, methylene blue, was found to be enhancing the discrimination effect. The changes in the relaxation potential curves were further corroborated following the ELISA like experiments using ExtraAvidine alkaline phosphatase labelling and redox recycling of para-aminophenol phosphate at IDAs. The coulostatic pulse technique was shown to be useful for identifying DNA sequences from brain tumour gene CK20, human herpes simplex virus, cytomegalovirus, Epstein-Barr virus and M13 phage. Compared to the hybridization of short chain ONTs (27 mers), the hybridization of long chain M13 phage DNA showed three times higher increase in the relaxation curves. The method is fast enough to monitor hybridization interactions in milli or microsecond time scales and is well suitable for miniaturization and integration compared to the common impedance techniques for developing capacitative DNA sensors.

  1. Gene and genon concept: coding versus regulation

    PubMed Central

    2007-01-01

    We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various pieces, as steered by the genon. It emerges finally as an uninterrupted nucleic acid sequence at mRNA level just prior to translation, in faithful correspondence with the amino acid sequence to be produced as a polypeptide. After translation, the genon has fulfilled its role and expires. The distinction between the protein coding information as materialised in the final polypeptide and the processing information represented by the genon allows us to set up a new information theoretic scheme. The standard sequence information determined by the genetic code expresses the relation between coding sequence and product. Backward analysis asks from which coding region in the DNA a given polypeptide originates. The (more interesting) forward analysis asks in how many polypeptides of how many different types a given DNA segment is expressed. This concerns the control of the expression process for which we have introduced the genon concept. Thus, the information theoretic analysis can capture the complementary aspects of coding and regulation, of gene and genon. PMID:18087760

  2. Orthogonal Polynomials Associated with Complementary Chain Sequences

    NASA Astrophysics Data System (ADS)

    Behera, Kiran Kumar; Sri Ranga, A.; Swaminathan, A.

    2016-07-01

    Using the minimal parameter sequence of a given chain sequence, we introduce the concept of complementary chain sequences, which we view as perturbations of chain sequences. Using the relation between these complementary chain sequences and the corresponding Verblunsky coefficients, the para-orthogonal polynomials and the associated Szegő polynomials are analyzed. Two illustrations, one involving Gaussian hypergeometric functions and the other involving Carathéodory functions are also provided. A connection between these two illustrations by means of complementary chain sequences is also observed.

  3. Characterisation of divergent flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil

    PubMed Central

    Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira

    2013-01-01

    Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302

  4. Shark (Scyliorhinus torazame) metallothionein: cDNA cloning, genomic sequence, and expression analysis.

    PubMed

    Cho, Young Sun; Choi, Buyl Nim; Ha, En-Mi; Kim, Ki Hong; Kim, Sung Koo; Kim, Dong Soo; Nam, Yoon Kwon

    2005-01-01

    Novel metallothionein (MT) complementary DNA and genomic sequences were isolated from a cartilaginous shark species, Scyliorhinus torazame. The full-length open reading frame (ORF) of shark MT cDNA encoded 68 amino acids with a high cysteine content (29%). The genomic ORF sequence (932 bp) of shark MT isolated by polymerase chain reaction (PCR) comprised 3 exons with 2 interventing introns. Shark MT sequence shared many conserved features with other vertebrate MTs: overall amino acid identities of shark MT ranged from 47% to 57% with fish MTs, and 41% to 62% with mammalian MTs. However, in addition to these conserved characteristics, shark MT sequence exhibited some unique characteristics. It contained 4 extra amino acids (Lys-Ala-Gly-Arg) at the end of the beta-domain, which have not been reported in any other vertebrate MTs. The last amino acid residue at the C-terminus was Ser, which also has not been reported in fish and mammalian MTs. The MT messenger RNA levels in shark liver and kidney, assessed by semiquantitative reverse transcriptase PCR and RNA blot hybridization, were significantly affected by experimental exposures to heavy metals (cadmium, copper, and zinc). Generally, the transcriptional activation of shark MT gene was dependent on the dose (0-10 mg/kg body weight for injection and 0-20 microM for immersion) and duration (1-10 days); zinc was a more potent inducer than copper and cadmium.

  5. A PDDA/poly(2,6-pyridinedicarboxylic acid)-CNTs composite film DNA electrochemical sensor and its application for the detection of specific sequences related to PAT gene and NOS gene.

    PubMed

    Yang, Tao; Zhang, Wei; Du, Meng; Jiao, Kui

    2008-05-30

    2,6-Pyridinedicarboxylic acid (PDC) was electropolymerized on the glassy carbon electrode (GCE) surface combined with carboxylic group-functionalized single-walled carbon nanotubes (SWNTs) by cyclic voltammetry (CV) to form PDC-SWNTs composite film, which was rich in negatively charged carboxylic group. Then, poly(diallyldimethyl ammonium chloride) (PDDA), a linear cationic polyelectrolyte, was electrostatically adsorbed on the PDC-SWNTs/GCE surface. DNA probes with negatively charged phosphate group at the 5' end were immobilized on the PDDA/PDC-SWNTs/GCE due to the strong electrostatic attraction between PDDA and phosphate group of DNA. It has been found that modification of the electrode with PDC-SWNTs film has enhanced the effective electrode surface area and electron-transfer ability, in addition to providing negatively charged groups for the electrostatic assembly of cationic polyelectrolyte. PDDA plays a key role in the attachment of DNA probes to the PDC-SWNTs composite film and acts as a bridge to connect DNA with PDC-SWNTs film. The cathodic peak current of methylene blue (MB), an electroactive label, decreased obviously after the hybridization of DNA probe (ssDNA) with the complementary DNA (cDNA). This peak current change was used to monitor the recognition of the specific sequences related to PAT gene in the transgenic corn and the polymerase chain reaction (PCR) amplification of NOS gene from the sample of transgenic soybean with satisfactory results. Under optimal conditions, the dynamic detection range of the sensor to PAT gene target sequence was from 1.0x10(-11) to 1.0x10(-6) mol/L with the detection limit of 2.6x10(-12) mol/L.

  6. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  7. Labeling TiO2 nanoparticles with dyes for optical fluorescence microscopy and determination of TiO2-DNA nanoconjugate stability.

    PubMed

    Thurn, Kenneth T; Paunesku, Tatjana; Wu, Aiguo; Brown, Eric M B; Lai, Barry; Vogt, Stefan; Maser, Jörg; Aslam, Mohammed; Dravid, Vinayak; Bergan, Raymond; Woloschak, Gayle E

    2009-06-01

    Visualization of nanoparticles without intrinsic optical fluorescence properties is a significant problem when performing intracellular studies. Such is the case with titanium dioxide (TiO2) nanoparticles. These nanoparticles, when electronically linked to single-stranded DNA oligonucleotides, have been proposed to be used both as gene knockout devices and as possible tumor imaging agents. By interacting with complementary target sequences in living cells, these photoinducible TiO2-DNA nanoconjugates have the potential to cleave intracellular genomic DNA in a sequence specific and inducible manner. The nanoconjugates also become detectable by magnetic resonance imaging with the addition of gadolinium Gd(III) contrast agents. Herein two approaches for labeling TiO2 nanoparticles and TiO2-DNA nanoconjugates with optically fluorescent agents are described. This permits direct quantification of fluorescently labeled TiO2 nanoparticle uptake in a large population of living cells (>10(4) cells). X-ray fluorescence microscopy (XFM) is combined with fluorescent microscopy to determine the relative intracellular stability of the nanoconjugates and used to quantify intracellular nanoparticles. Imaging the DNA component of the TiO2-DNA nanoconjugate by fluorescent confocal microscopy within the same cell shows an overlap with the titanium signal as mapped by XFM. This strongly implies the intracellular integrity of the TiO2-DNA nanoconjugates in malignant cells.

  8. Polymorphic design of DNA origami structures through mechanical control of modular components.

    PubMed

    Lee, Chanseok; Lee, Jae Young; Kim, Do-Nyun

    2017-12-12

    Scaffolded DNA origami enables the bottom-up fabrication of diverse DNA nanostructures by designing hundreds of staple strands, comprised of complementary sequences to the specific binding locations of a scaffold strand. Despite its exceptionally high design flexibility, poor reusability of staples has been one of the major hurdles to fabricate assorted DNA constructs in an effective way. Here we provide a rational module-based design approach to create distinct bent shapes with controllable geometries and flexibilities from a single, reference set of staples. By revising the staple connectivity within the desired module, we can control the location, stiffness, and included angle of hinges precisely, enabling the construction of dozens of single- or multiple-hinge structures with the replacement of staple strands up to 12.8% only. Our design approach, combined with computational shape prediction and analysis, can provide a versatile and cost-effective procedure in the design of DNA origami shapes with stiffness-tunable units.

  9. Specific functions of the Rep and Rep׳ proteins of porcine circovirus during copy-release and rolling-circle DNA replication.

    PubMed

    Cheung, Andrew K

    2015-07-01

    The roles of two porcine circovirus replication initiator proteins, Rep and Rep׳, in generating copy-release and rolling-circle DNA replication intermediates were determined. Rep uses the supercoiled closed-circular genome (ccc) to initiate leading-strand synthesis (identical to copy-release replication) and generates the single-stranded circular (ssc) genome from the displaced DNA strand. In the process, a minus-genome primer (MGP) necessary for complementary-strand synthesis, from ssc to ccc, is synthesized. Rep׳ cleaves the growing nascent-strand to regenerate the parent ccc molecule. In the process, a Rep׳-DNA hybrid containing the right palindromic sequence (at the origin of DNA replication) is generated. Analysis of the virus particle showed that it is composed of four components: ssc, MGP, capsid protein and a novel Rep-related protein (designated Protein-3). Copyright © 2015. Published by Elsevier Inc.

  10. Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

    PubMed

    Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao

    2017-05-08

    The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Continuous expression in tobacco leaves of a Brassica napus PEND homologue blocks differentiation of plastids and development of palisade cells.

    PubMed

    Wycliffe, Paul; Sitbon, Folke; Wernersson, Jonny; Ezcurra, Inés; Ellerström, Mats; Rask, Lars

    2005-10-01

    Brassica napus complementary deoxyribonucleic acid (cDNA) clones encoding a DNA-binding protein, BnPEND, were isolated by Southwestern screening. A distinctive feature of the protein was a bZIP-like sequence in the amino-terminal portion, which, after expression in Escherichia coli, bound DNA. BnPEND transcripts were present in B. napus roots and flower buds, and to a lesser extent in stems, flowers and young leaves. Treatment in the dark for 72 h markedly increased the amount of BnPEND transcript in leaves of all ages. Sequence comparison showed that BnPEND was similar to a presumed transcription factor from B. napus, GSBF1, a protein deduced from an Arabidopsis thaliana cDNA (BX825084) and the PEND protein from Pisum sativum, believed to anchor the plastid DNA to the envelope early during plastid development. Homology to expressed sequence tag (EST) sequences from additional species suggested that BnPEND homologues are widespread among the angiosperms. Transient expression of BnPEND fused with green fluorescent protein (GFP) in Nicotiana benthamiana epidermal cells showed that BnPEND is a plastid protein, and that the 15 amino acids at the amino-terminal contain information about plastid targeting. Expression of BnPEND in Nicotiana tabacum from the Cauliflower Mosaic Virus 35S promoter gave stable transformants with different extents of white to light-green areas in the leaves, and even albino plants. In the white areas, but not in adjacent green tissue, the development of palisade cells and chloroplasts was disrupted. Our data demonstrate that the BnPEND protein, when over-expressed at an inappropriate stage, functionally blocks the development of plastids and leads to altered leaf anatomy, possibly by preventing the release of plastid DNA from the envelope.

  12. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  13. Differences in expression of retinal pigment epithelium mRNA between normal canines

    PubMed Central

    2004-01-01

    Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

  14. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA.

    PubMed

    Wang, Jiajia; Jia, Zhenhong

    2018-02-23

    A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  15. Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1.

    PubMed

    Nishimasu, Hiroshi; Yamano, Takashi; Gao, Linyi; Zhang, Feng; Ishitani, Ryuichiro; Nureki, Osamu

    2017-07-06

    The RNA-guided Cpf1 nuclease cleaves double-stranded DNA targets complementary to the CRISPR RNA (crRNA), and it has been harnessed for genome editing technologies. Recently, Acidaminococcus sp. BV3L6 (AsCpf1) was engineered to recognize altered DNA sequences as the protospacer adjacent motif (PAM), thereby expanding the target range of Cpf1-mediated genome editing. Whereas wild-type AsCpf1 recognizes the TTTV PAM, the RVR (S542R/K548V/N552R) and RR (S542R/K607R) variants can efficiently recognize the TATV and TYCV PAMs, respectively. However, their PAM recognition mechanisms remained unknown. Here we present the 2.0 Å resolution crystal structures of the RVR and RR variants bound to a crRNA and its target DNA. The structures revealed that the RVR and RR variants primarily recognize the PAM-complementary nucleotides via the substituted residues. Our high-resolution structures delineated the altered PAM recognition mechanisms of the AsCpf1 variants, providing a basis for the further engineering of CRISPR-Cpf1. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome.

    PubMed

    Spurrell, Cailyn H; Dickel, Diane E; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. In this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. UVA irradiation of BrU-substituted DNA in the presence of Hoechst 33258.

    PubMed

    Saha, Abhijit; Kizaki, Seiichiro; Han, Ji Hoon; Yu, Zutao; Sugiyama, Hiroshi

    2018-01-01

    Given that our knowledge of DNA repair is limited because of the complexity of the DNA system, a technique called UVA micro-irradiation has been developed that can be used to visualize the recruitment of DNA repair proteins at double-strand break (DSB) sites. Interestingly, Hoechst 33258 was used under micro-irradiation to sensitize 5-bromouracil ( Br U)-labelled DNA, causing efficient DSBs. However, the molecular basis of DSB formation under UVA micro-irradiation remains unknown. Herein, we investigated the mechanism of DSB formation under UVA micro-irradiation conditions. Our results suggest that the generation of a uracil-5-yl radical through electron transfer from Hoechst 33258 to Br U caused DNA cleavage preferentially at self-complementary 5'-AA Br U Br U-3' sequences to induce DSB. We also investigated the DNA cleavage in the context of the nucleosome to gain a better understanding of UVA micro-irradiation in a cell-like model. We found that DNA cleavage occurred in both core and linker DNA regions although its efficiency reduced in core DNA. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. High-Resolution Sequence-Function Mapping of Full-Length Proteins

    PubMed Central

    Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.

    2015-01-01

    Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064

  19. Identification and characterization of the reptilian GnRH-II gene in the leopard gecko, Eublepharis macularius, and its evolutionary considerations.

    PubMed

    Ikemoto, Tadahiro; Park, Min Kyun

    2003-10-16

    To elucidate the molecular phylogeny and evolution of a particular peptide, one must analyze not the limited primary amino acid sequences of the low molecular weight mature polypeptide, but rather the sequences of the corresponding precursors from various species. Of all the structural variants of gonadotropin-releasing hormone (GnRH), GnRH-II (chicken GnRH-II, or cGnRH-II) is remarkably conserved without any sequence substitutions among vertebrates, but its precursor sequences vary considerably. We have identified and characterized the full-length complementary DNA (cDNA) encoding the GnRH-II precursor and determined its genomic structure, consisting of four exons and three introns, in a reptilian species, the leopard gecko Eublepharis macularius. This is the first report about the GnRH-II precursor cDNA/gene from reptiles. The deduced leopard gecko prepro-GnRH-II polypeptide had the highest identities with the corresponding polypeptides of amphibians. The GnRH-II precursor mRNA was detected in more than half of the tissues and organs examined. This widespread expression is consistent with the previous findings in several species, though the roles of GnRH outside the hypothalamus-pituitary-gonadal axis remain largely unknown. Molecular phylogenetic analysis combined with sequence comparison showed that the leopard gecko is more similar to fishes and amphibians than to eutherian mammals with respect to the GnRH-II precursor sequence. These results strongly suggest that the divergence of the GnRH-II precursor sequences seen in eutherian mammals may have occurred along with amniote evolution.

  20. Diagnosis of EGFR exon21 L858R point mutation as lung cancer biomarker by electrochemical DNA biosensor based on reduced graphene oxide /functionalized ordered mesoporous carbon/Ni-oxytetracycline metallopolymer nanoparticles modified pencil graphite electrode.

    PubMed

    Shoja, Yalda; Kermanpur, Ahmad; Karimzadeh, Fathallah

    2018-08-15

    In this present work we made a novel, fast, selective and sensitive electrochemical genobiosensor to detection of EGFR exon 21 point mutation based on two step electropolymerization of Ni(II)-oxytetracycline conducting metallopolymer nanoparticles (Ni-OTC NPs) on the surface of pencil graphite electrode (PGE) which was modified by reduced graphene oxide/carboxyl functionalized ordered mesoporous carbon (rGO/f-OMC) nanocomposite. ssDNA capture probe with amine groups at the5' end which applied as recognition element was immobilized on the rGO/f-OMC/PGE surface via the strong amide bond. Ni-OTC metallopolymer NPs were electropolymerized to rGO/ssDNA-OMC/PGE surface and then hybridization fallows through the peak current change in differential pulse voltammetry (DPV) using Ni-OTC NPs as a redox label. The biosensor was characterized by field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), FT-IR spectroscopy, energy dispersive X-ray spectroscopy (EDX), cyclic voltammetry and Nitrogen adsorption-desorption analysis. The Ni-OTC current response verified only the complementary sequence indicating a significant reduction current signal in comparison to single point mismatched and non-complementary and sequences. Under optimal conditions, the prepared biosensor showed long-term stability (21 days) with a wide linear range from 0.1 µM to 3 µM with high sensitivity (0.0188 mA/µM) and low detection limit (120 nM). Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Deep sequencing methods for protein engineering and design.

    PubMed

    Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A

    2017-08-01

    The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. DNA-programmable multiplexing for scalable, renewable redox protein bio-nanoelectronics.

    PubMed

    Withey, Gary D; Kim, Jin Ho; Xu, Jimmy

    2008-11-01

    A universal, site-addressable DNA linking strategy is deployed for the programmable assembly of multifunctional, long-lasting redox protein nanoelectronic devices. This addressable linker, the first incorporated into a redox enzyme-nanoelectronic system, promotes versatility and renewability by allowing the reconfiguration and replacement of enzymes at will. The linker is transferable to all redox proteins due to the simple conjugation chemistry involved. The efficacy of this linking strategy is assessed using two model enzymes, glucose oxidase (GOx) and alcohol dehydrogenase (ADH), self-assembled onto separate nanoelectrode regions comprised of a highly ordered carbon nanotube (CNT) array. The sequence-specificity of DNA hybridization provides the means of encoding spatial address to the self-assembling process that conjugates enzymes tagged with single-stranded DNA (ssDNA) to the tips of designated CNTs functionalized with the complementary strands. In this study, we demonstrate the feasibility of multiplexed, scalable, reconfigurable and renewable transduction of redox protein signals by virtue of DNA addressing.

  3. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    PubMed

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  4. The genome of Eimeria spp., with special reference to Eimeria tenella--a coccidium from the chicken.

    PubMed

    Shirley, M W

    2000-04-10

    Eimeria spp. contain at least four genomes. The nuclear genome is best studied in the avian species Eimeria tenella and comprises about 60 Mbp DNA contained within ca. 14 chromosomes; other avian and lupine species appear to possess a nuclear genome of similar size. In addition, sequence data and hybridisation studies have provided direct evidence for extrachromosomal mitochondrial and plastid DNA genomes, and double-stranded RNA segments have also been described. The unique phenotype of "precocious" development that characterises some selected lines of Eimeria spp. not only provides the basis for the first generation of live attenuated vaccines, but offers a significant entrée into studies on the regulation of an apicomplexan life-cycle. With a view to identifying loci implicated in the trait of precocious development, a genetic linkage map of the genome of E. tenella is being constructed in this laboratory from analyses of the inheritance of over 400 polymorphic DNA markers in the progeny of a cross between complementary drug-resistant and precocious parents. Other projects that impinge directly or indirectly on the genome and/or genetics of Eimeria spp. are currently in progress in several laboratories, and include the derivation of expressed sequence tag data and the development of ancillary technologies such as transfection techniques. No large-scale genomic DNA sequencing projects have been reported.

  5. Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

    PubMed

    Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

    2006-07-01

    To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

  6. Fabrication and characterization of high-K dielectric integrated silicon nanowire sensor for DNA sensing application (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael

    2016-09-01

    1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.

  7. Determining orientation and direction of DNA sequences

    DOEpatents

    Goodwin, Edwin H.; Meyne, Julianne

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  8. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

    1990-09-01

    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  9. Submicroscopic interstitial deletion of the X chromosome explains a complex genetic syndrome dominated by Norrie disease.

    PubMed

    Gal, A; Wieringa, B; Smeets, D F; Bleeker-Wagemakers, L; Ropers, H H

    1986-01-01

    Norrie disease (ND), an X-linked recessive disorder, is characterized by congenital blindness followed by bulbar atrophy. We have examined a three-generation family in which ND is part of a complex X-linked syndrome with severe mental retardation, hypogonadism, growth disturbances, and increased susceptibility to infections as additional features. This syndrome is apparently due to an interstitial deletion, as evidenced by the failure of the L1.28 DNA probe (DXS7 locus, Xp11.3) to detect complementary DNA sequences on the defective X chromosome of an affected male and of several obligatory heterozygotes. Attempts to further define this deletion with other DNA probes from the proximal short arm of the X chromosome or by prometaphase chromosome analysis were unsuccessful.

  10. Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

    PubMed

    Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

    2008-06-15

    To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

  11. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  12. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  13. An improved DNA force field for ssDNA interactions with gold nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Xiankai; Huai, Ping; Fan, Chunhai

    The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones “protecting” hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thusmore » the “protection” by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.« less

  14. An improved DNA force field for ssDNA interactions with gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo

    2014-06-01

    The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.

  15. An improved DNA force field for ssDNA interactions with gold nanoparticles.

    PubMed

    Jiang, Xiankai; Gao, Jun; Huynh, Tien; Huai, Ping; Fan, Chunhai; Zhou, Ruhong; Song, Bo

    2014-06-21

    The widespread applications of single-stranded DNA (ssDNA) conjugated gold nanoparticles (AuNPs) have spurred an increasing interest in the interactions between ssDNA and AuNPs. Despite extensive studies using the most sophisticated experimental techniques, the detailed molecular mechanisms still remain largely unknown. Large scale molecular dynamics (MD) simulations can thus be used to supplement experiments by providing complementary information about ssDNA-AuNP interactions. However, up to now, all modern force fields for DNA were developed based on the properties of double-stranded DNA (dsDNA) molecules, which have hydrophilic outer backbones "protecting" hydrophobic inner nucleobases from water. Without the double-helix structure of dsDNA and thus the "protection" by the outer backbone, the nucleobases of ssDNA are directly exposed to solvent, and their behavior in water is very different from that of dsDNA, especially at the interface with nanoparticles. In this work, we have improved the force field of ssDNA for use with nanoparticles, such as AuNPs, based on recent experimental results and quantum mechanics calculations. With the new improved force field, we demonstrated that a poly(A) sequence adsorbed on a AuNP surface is much more stable than a poly(T) sequence, which is consistent with recent experimental observations. On the contrary, the current standard force fields, including AMBER03, CHARMM27, and OPLSAA, all gave erroneous results as compared to experiments. The current improved force field is expected to have wide applications in the study of ssDNA with nanomaterials including AuNPs, which might help promote the development of ssDNA-based biosensors and other bionano-devices.

  16. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  17. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    NASA Astrophysics Data System (ADS)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  18. High-sensitive electrochemical detection of point mutation based on polymerization-induced enzymatic amplification.

    PubMed

    Feng, Kejun; Zhao, Jingjin; Wu, Zai-Sheng; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2011-03-15

    Here a highly sensitive electrochemical method is described for the detection of point mutation in DNA. Polymerization extension reaction is applied to specifically initiate enzymatic electrochemical amplification to improve the sensitivity and enhance the performance of point mutation detection. In this work, 5'-thiolated DNA probe sequences complementary to the wild target DNA are assembled on the gold electrode. In the presence of wild target DNA, the probe is extended by DNA polymerase over the free segment of target as the template. After washing with NaOH solution, the target DNA is removed while the elongated probe sequence remains on the sensing surface. Via hybridizing to the designed biotin-labeled detection probe, the extended sequence is capable of capturing detection probe. After introducing streptavidin-conjugated alkaline phosphatase (SA-ALP), the specific binding between streptavidin and biotin mediates a catalytic reaction of ascorbic acid 2-phosphate (AA-P) substrate to produce a reducing agent ascorbic acid (AA). Then the silver ions in solution are reduced by AA, leading to the deposition of silver metal onto the electrode surface. The amount of deposited silver which is determined by the amount of wild target can be quantified by the linear sweep voltammetry (LSV). The present approach proved to be capable of detecting the wild target DNA down to a detection limit of 1.0×10(-14) M in a wide target concentration range and identifying -28 site (A to G) of the β-thalassemia gene, demonstrating that this scheme offers a highly sensitive and specific approach for point mutation detection. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. High-density fiber optic biosensor arrays

    NASA Astrophysics Data System (ADS)

    Epstein, Jason R.; Walt, David R.

    2002-02-01

    Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

  20. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

    NASA Astrophysics Data System (ADS)

    Kikuchi, Shoshi

    2009-02-01

    Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

  2. Sensitive and specific miRNA detection method using SplintR Ligase

    PubMed Central

    Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

    2016-01-01

    We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

  3. Ultrasensitive signal-on DNA biosensor based on nicking endonuclease assisted electrochemistry signal amplification.

    PubMed

    Liu, Zhongyuan; Zhang, Wei; Zhu, Shuyun; Zhang, Ling; Hu, Lianzhe; Parveen, Saima; Xu, Guobao

    2011-11-15

    Combining the advantages of signal-on strategy and nicking endonuclease assisted electrochemistry signal amplification (NEAESA), a new sensitive and signal-on electrochemical DNA biosensor for the sequence specific DNA detection based on NEAESA has been developed for the first time. A Hairpin-shape probe (HP), containing the target DNA recognition sequence, is thiol-modified at 5' end and immobilized on gold electrode via Au-S bonding. Subsequently, the HP modified electrode is hybridized with target DNA to form a duplex. Then the nicking endonuclease is added and nicks the HP strand in the duplex. After nicking, 3'-ferrocene (Fc)-labeled part complementary probe (Fc-PCP) is introduced on the electrode surface by hybridizing with the thiol-modified HP fragment, which results in the generation of electrochemical signal. Hence, the DNA biosensor is constructed successfully. The present DNA biosensor shows a wide linear range of 5.0×10(-13)-5.0×10(-8)M for detecting target DNA, with a low detection limit of 0.167pM. The proposed strategy does not require any amplifying labels (enzymes, DNAzymes, nanoparticles, etc.) for biorecognition events, which avoids false-positive results to occur frequently. Moreover, the strategy has the benefits of simple preparation, convenient operation, good selectivity, and high sensitivity. With the advantages mentioned above, this simple and sensitive strategy has the potential to be integrated in portable, low cost and simplified devices for diagnostic applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bateman, J.B.; Kojis, T.; Heinzmann, C.

    1993-09-01

    Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

  5. Strand-invading linear probe combined with unmodified PNA.

    PubMed

    Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko

    2016-09-15

    Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Programmable RNA Cleavage and Recognition by a Natural CRISPR-Cas9 System from Neisseria meningitidis.

    PubMed

    Rousseau, Beth A; Hou, Zhonggang; Gramelspacher, Max J; Zhang, Yan

    2018-03-01

    The microbial CRISPR systems enable adaptive defense against mobile elements and also provide formidable tools for genome engineering. The Cas9 proteins are type II CRISPR-associated, RNA-guided DNA endonucleases that identify double-stranded DNA targets by sequence complementarity and protospacer adjacent motif (PAM) recognition. Here we report that the type II-C CRISPR-Cas9 from Neisseria meningitidis (Nme) is capable of programmable, RNA-guided, site-specific cleavage and recognition of single-stranded RNA targets and that this ribonuclease activity is independent of the PAM sequence. We define the mechanistic feature and specificity constraint for RNA cleavage by NmeCas9 and also show that nuclease null dNmeCas9 binds to RNA target complementary to CRISPR RNA. Finally, we demonstrate that NmeCas9-catalyzed RNA cleavage can be blocked by three families of type II-C anti-CRISPR proteins. These results fundamentally expand the targeting capacities of CRISPR-Cas9 and highlight the potential utility of NmeCas9 as a single platform to target both RNA and DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Identification of Paracoccidioides brasiliensis by gold nanoprobes

    NASA Astrophysics Data System (ADS)

    Martins, Jaciara F. S.; Castilho, Maiara L.; Cardoso, Maria A. G.; Carreiro, Andrea P.; Martin, Airton A.; Raniero, Leandro

    2012-01-01

    Paracoccidioides brasiliensis (P. brasiliensis) is a thermal dimorphic fungus and causal agent of paracoccidioidomycosis. Epidemiological data shows that it is mainly concentrated in Central and South America countries, with most registered cases in Colombia, Brazil, and Venezuela. The histopathological similarity with others fungal infection makes the diagnosis of P. brasiliensis more complicated. Therefore, the aim of this work was to find a positive and negative test for P. brasiliensis using gold nanoprobes as a new tool for P. brasiliensis detection. Gold nanoparticles were synthesized by reduction of gold chloride with sodium citrate. The results of this procedure is a wine-red solution with a maximum absorption in the range of ~520-530nm. A specific P. brasiliensis sequence of oligonucleotide was bonded to the nanoparticles, which maintained the wine-red color. The color changes from red to blue for negative diagnostic and is unchanged for a positive test. The H-bond interaction of DNA with the complementary DNA keeps strands together and forms double helical structure, maintaining the colloid stability. However, for non-complimentary DNA sequence the nanoprobes merge into a cluster, changing the light absorption.

  8. IN SITU DEMONSTRATION OF DNA HYBRIDIZING WITH CHROMOSOMAL AND NUCLEAR SAP RNA IN CHIRONOMUS TENTANS

    PubMed Central

    Lambert, B.; Wieslander, L.; Daneholt, B.; Egyházi, E.; Ringborg, U.

    1972-01-01

    Cytological hybridization combined with microdissection of Chironomus tentans salivary gland cells was used to locate DNA complementary to newly synthesized RNA from chromosomes and nuclear sap and from a single chromosomal puff, the Balbiani ring 2 (BR 2). Salivary glands were incubated with tritiated nucleosides. The labeled RNA was extracted from microdissected nuclei and hybridized to denatured squash preparations of salivary gland cells under conditions which primarily allow repeated sequences to interact. The bound RNA, resistant to ribonuclease treatment, was detected radioautographically. It was found that BR 2 RNA hybridizes specifically with the BR 2 region of chromosome IV. Nuclear sap RNA was fractionated into high and low molecular-weight RNA; the former hybridizes with the BR 2 region of chromosome IV, the latter in a diffuse distribution over the whole chromosome set. RNA from chromosome I hybridizes diffusely with all chromosomes. Nucleolar RNA hybridizes specifically with the nucleolar organizers, contained in chromosomes II and III. It is concluded that the BR 2 region of chromosome IV contains repeated DNA sequences and that nuclear sap contains BR 2 RNA. PMID:5025107

  9. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

    PubMed Central

    2012-01-01

    Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

  10. 2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

    PubMed

    Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

    2017-08-01

    We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. A fluorometric lateral flow assay for visual detection of nucleic acids using a digital camera readout.

    PubMed

    Magiati, Maria; Sevastou, Areti; Kalogianni, Despina P

    2018-06-04

    A fluorometric lateral flow assay has been developed for the detection of nucleic acids. The fluorophores phycoerythrin (PE) and fluorescein isothiocyanate (FITC) were used as labels, while a common digital camera and a colored vinyl-sheet, acting as a cut-off optical filter, are used for fluorescence imaging. After DNA amplification by polymerase chain reaction (PCR), the biotinylated PCR product is hybridized to its complementary probe that carries a poly(dA) tail at 3΄ edge and then applied to the lateral flow strip. The hybrids are captured to the test zone of the strip by immobilized poly(dT) sequences and detected by streptavidin-fluorescein and streptavidin-phycoerythrin conjugates, through streptavidin-biotin interaction. The assay is widely applicable, simple, cost-effective, and offers a large multiplexing potential. Its performance is comparable to assays based on the use of streptavidin-gold nanoparticles conjugates. As low as 7.8 fmol of a ssDNA and 12.5 fmol of an amplified dsDNA target were detectable. Graphical abstract Schematic presentation of a fluorometric lateral flow assay based on fluorescein and phycoerythrin fluorescent labels for the detection of single-stranded (ssDNA) and double-stranded DNA (dsDNA) sequences and using a digital camera readout. SA: streptavidin, BSA: Bovine Serum Albumin, B: biotin, FITC: fluorescein isothiocyanate, PE: phycoerythrin, TZ: test zone, CZ: control zone.

  12. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

    PubMed

    Abdulmawjood, A; Roth, S; Bülte, M

    2002-10-01

    For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

  13. Newer Gene Editing Technologies toward HIV Gene Therapy

    PubMed Central

    Manjunath, N.; Yi, Guohua; Dang, Ying; Shankar, Premlata

    2013-01-01

    Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy. PMID:24284874

  14. Development of a Reporter System to Explore MMEJ in the Context of Replacing Large Genomic Fragments.

    PubMed

    Yanik, Mert; Ponnam, Surya Prakash Goud; Wimmer, Tobias; Trimborn, Lennart; Müller, Carina; Gambert, Isabel; Ginsberg, Johanna; Janise, Annabella; Domicke, Janina; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut

    2018-06-01

    Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  15. cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

    PubMed

    Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

    2003-12-01

    A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

  16. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2002-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  17. Use of continuous/contiguous stacking hybridization as a diagnostic tool

    DOEpatents

    Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

    2000-01-01

    A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

  18. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  19. Generation and Analysis of Expressed Sequence Tags (ESTs) from Halophyte Atriplex canescens to Explore Salt-Responsive Related Genes

    PubMed Central

    Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu

    2014-01-01

    Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361

  20. Stepwise nanoassembly of a single hairpin probe and its biosensing.

    PubMed

    Xu, Jianguo; Zheng, Tingting; Le, Jingqing; Jia, Lee

    2018-09-01

    Herein, we describe a novel trigger-induced DNA nanoassembly method using only one loop-stem shaped hairpin probe (HP) that consists of three different functional regions as a single building unit. The Region I is designed complementary to the trigger, while the Region II and Region III are projected to complementary with each other. When hybridized with the trigger, a toehold mediated strand displacement (TMSD) occurred on the strand of Region I, leading to the release of Region III for further hybridization with the Region II on another HP molecule and in turn inducing a stepwise growth of HP with the aid of polymerase. Unlike the conventional assembly approaches that rely on the sophisticated sequence design and complex operation, the single-HP nanoassembly is easy and fast. Moreover, because many HPs are opened during the assembly process, we exemplified the nanoassembly strategy by re-designing a new labeled hairpin probe to analyze the Kras oncogene with a high sensitivity and specificity. The present study demonstrated a novel promising DNA nanoassembly strategy for biological applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Simplified Microarray Technique for Identifying mRNA in Rare Samples

    NASA Technical Reports Server (NTRS)

    Almeida, Eduardo; Kadambi, Geeta

    2007-01-01

    Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.

  2. Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.

    PubMed

    Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu

    2017-11-10

    The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.

  3. DNA recognition by peptide nucleic acid-modified PCFs: from models to real samples

    NASA Astrophysics Data System (ADS)

    Selleri, S.; Coscelli, E.; Poli, F.; Passaro, D.; Cucinotta, A.; Lantano, C.; Corradini, R.; Marchelli, R.

    2010-04-01

    The increased concern, emerged in the last few years, on food products safety has stimulated the research on new techniques for traceability of raw food materials. DNA analysis is one of the most powerful tools for the certification of food quality, and it is presently performed through the polymerase chain reaction technique. Photonic crystal fibers, due to the presence of an array of air holes running along their length, can be exploited for performing DNA recognition by derivatizing hole surfaces and checking hybridization of complementary nucledotide chains in the sample. In this paper the application of a suspended core photonic crystal fiber in the recognition of DNA sequences is discussed. The fiber is characterized in terms of electromagnetic properties by means of a full-vector modal solver based on the finite element method. Then, the performances of the fiber in the recognition of mall synthetic oligonucleotides are discussed, together with a test of the possibility to extend this recognition to samples of DNA of applicative interest, such as olive leaves.

  4. A G-quadruplex-based Label-free Fluorometric Aptasensor for Adenosine Triphosphate Detection.

    PubMed

    Li, Li Juan; Tian, Xue; Kong, Xiang Juan; Chu, Xia

    2015-01-01

    A G-quadruplex-based, label-free fluorescence assay was demonstrated for the detection of adenosine triphosphate (ATP). A double-stranded DNA (dsDNA), hybridized by ATP-aptamer and its complementary sequence, was employed as a substrate for ATP binding. SYBR Green I (SG I) was a fluorescent probe and exonuclease III (Exo III) was a nuclease to digest the dsDNA. Consequently, in the absence of ATP, the dsDNA was inset with SG I and was digested by Exo III, resulting in a low background signal. In the presence of ATP, the aptamer in dsDNA folded into a G-quadruplex structure that resisted the digestion of Exo III. SG I was inserted into the structure, showing high fluorescence. Owing to a decrease of the background noise, a high signal-to-noise ratio could be obtained. This sensor can detect ATP with a concentration ranging from 50 μM to 5 mM, and possesses a capacity for the sensitive determination of other targets.

  5. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    PubMed Central

    Sun, Jingjing; Tang, Xinjing

    2015-01-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

  6. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

    PubMed

    Sun, Jingjing; Tang, Xinjing

    2015-05-28

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, O.P.

    Potato leafroll virus (PLRV) was aphid-transmitted from potato (Solanum tuberosum cultivar Russett Burbank) to ground cherry (Physalis floridana), where it was maintained by serial aphid transmission. Serological and plant differential tests indicated that the isolate was not contaminated with beet western yellows virus. Purified PLRV RNA was poly(A)-tailed in vitro and used as a template for reverse transcriptase, primed with oligo(dT). Alkaline gel electrophoresis of /sup 32/P-labeled first-strand complementary DNA (cDNA) indicated a major size range of 0.1 to 3.5 kilobases (kb). A small percentage of transcripts corresponded to full length PLRV RNA. Following RNase H and DNA polymerase I-mediatedmore » second strand synthesis, double-stranded cDNA was cloned into the Pst I site of the plasmid pUC9 using oligo (dC)-oligo(dG) tailing methodology. Escherichia coli JM109 transformants were screened with first-strand /sup 32/P-cDNA in colony hybridization experiments to confirm that recombinants contained PLRV-specific sequences.« less

  8. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  9. A Sensitive DNA Capacitive Biosensor Using Interdigitated Electrodes

    PubMed Central

    Wang, Lei; Veselinovic, Milena; Yang, Lang; Geiss, Brian J.; Dandy, David S.; Chen, Tom

    2017-01-01

    This paper presents a label-free affinity-based capacitive biosensor using interdigitated electrodes. Using an optimized process of DNA probe preparation to minimize the effect of contaminants in commercial thiolated DNA probe, the electrode surface was functionalized with the 24-nucleotide DNA probes based on the West Nile virus sequence (Kunjin strain). The biosensor has the ability to detect complementary DNA fragments with a detection limit down to 20 DNA target molecules (1.5 aM range), making it suitable for a practical point-of-care (POC) platform for low target count clinical applications without the need for amplification. The reproducibility of the biosensor detection was improved with efficient covalent immobilization of purified single-stranded DNA probe oligomers on cleaned gold microelectrodes. In addition to the low detection limit, the biosensor showed a dynamic range of detection from 1 μL−1 to 105 μL−1 target molecules (20 to 2 million targets), making it suitable for sample analysis in a typical clinical application environment. The binding results presented in this paper were validated using fluorescent oligomers. PMID:27619528

  10. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  11. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    PubMed

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  12. Highly sensitive DNA sensors based on cerium oxide nanorods

    NASA Astrophysics Data System (ADS)

    Nguyet, Nguyen Thi; Hai Yen, Le Thi; Van Thu, Vu; lan, Hoang; Trung, Tran; Vuong, Pham Hung; Tam, Phuong Dinh

    2018-04-01

    In this work, a CeO2 nanorod (NR)-based electrochemical DNA sensor was developed to identify Salmonella that causes food-borne infections. CeO2 NRs were synthesized without templates via a simple and unexpensive hydrothermal approach at 170 °C for 12 h by using CeO(NO3)3·6H2O as a Ce source. The DNA probe was immobilized onto the CeO2 NR-modified electrode through covalent attachment. The characteristics of the hybridized DNA were analyzed through electrochemical impedance spectroscopy (EIS) with [Fe(CN)6]3-/4- as a redox probe. Experimental results showed that electron transfer resistance (Ret) increased after the DNA probe was attached to the electrode surface and increased further after the DNA probe hybridized with its complementary sequence. A linear response of Ret to the target DNA concentration was found from 0.01 μM to 2 μM. The detection limit and sensitivity of the DNA sensor were 0.01 μM and 3362.1 Ω μM-1 cm-2, respectively. Various parameters, such as pH value, ionic strength, DNA probe concentration, and hybridization time, influencing DNA sensor responses were also investigated.

  13. Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

    PubMed

    Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

    2014-03-04

    Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

  14. Ancient DNA analysis identifies marine mollusc shells as new metagenomic archives of the past.

    PubMed

    Der Sarkissian, Clio; Pichereau, Vianney; Dupont, Catherine; Ilsøe, Peter C; Perrigault, Mickael; Butler, Paul; Chauvaud, Laurent; Eiríksson, Jón; Scourse, James; Paillard, Christine; Orlando, Ludovic

    2017-09-01

    Marine mollusc shells enclose a wealth of information on coastal organisms and their environment. Their life history traits as well as (palaeo-) environmental conditions, including temperature, food availability, salinity and pollution, can be traced through the analysis of their shell (micro-) structure and biogeochemical composition. Adding to this list, the DNA entrapped in shell carbonate biominerals potentially offers a novel and complementary proxy both for reconstructing palaeoenvironments and tracking mollusc evolutionary trajectories. Here, we assess this potential by applying DNA extraction, high-throughput shotgun DNA sequencing and metagenomic analyses to marine mollusc shells spanning the last ~7,000 years. We report successful DNA extraction from shells, including a variety of ancient specimens, and find that DNA recovery is highly dependent on their biomineral structure, carbonate layer preservation and disease state. We demonstrate positive taxonomic identification of mollusc species using a combination of mitochondrial DNA genomes, barcodes, genome-scale data and metagenomic approaches. We also find shell biominerals to contain a diversity of microbial DNA from the marine environment. Finally, we reconstruct genomic sequences of organisms closely related to the Vibrio tapetis bacteria from Manila clam shells previously diagnosed with Brown Ring Disease. Our results reveal marine mollusc shells as novel genetic archives of the past, which opens new perspectives in ancient DNA research, with the potential to reconstruct the evolutionary history of molluscs, microbial communities and pathogens in the face of environmental changes. Other future applications include conservation of endangered mollusc species and aquaculture management. © 2017 John Wiley & Sons Ltd.

  15. Fabrication of an electrochemical DNA-based biosensor for Bacillus cereus detection in milk and infant formula.

    PubMed

    Izadi, Zahra; Sheikh-Zeinoddin, Mahmoud; Ensafi, Ali A; Soleimanian-Zad, Sabihe

    2016-06-15

    This paper describes fabrication of a DNA-based Au-nanoparticle modified pencil graphite electrode (PGE) biosensor for detection of Bacillus cereus, causative agent of two types of food-borne disease, i.e., emetic and diarrheal syndrome. The sensing element of the biosensor was comprised of gold nanoparticles (GNPs) self-assembled with single-stranded DNA (ssDNA) of nheA gene immobilized with thiol linker on the GNPs modified PGE. The size, shape and dispersion of the GNPs were characterized by field emission scanning electron microscope (FESEM). Detection of B. cereus was carried out based on an increase in the charge transfer resistance (Rct) of the biosensor due to hybridization of the ss-DNA with target DNA. An Atomic force microscope (AFM) was used to confirm the hybridization. The biosensor sensitivity in pure cultures of B. cereus was found to be 10(0) colony forming units per milliliter (CFU/mL) with a detection limit of 9.4 × 10(-12) mol L(-1). The biosensor could distinguish complementary from mismatch DNA sequence. The proposed biosensor exhibited a rapid detection, low cost, high sensitivity to bacterial contamination and could exclusively and specifically detect the target DNA sequence of B. cereus from other bacteria that can be found in dairy products. Moreover, the DNA biosensor exhibited high reproducibility and stability, thus it may be used as a suitable biosensor to detect B. cereus and to become a portable system for food quality control. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

    NASA Astrophysics Data System (ADS)

    Liebovitch, Larry

    1998-03-01

    The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

  17. Cytotoxic chromosomal targeting by CRISPR/Cas systems can reshape bacterial genomes and expel or remodel pathogenicity islands.

    PubMed

    Vercoe, Reuben B; Chang, James T; Dy, Ron L; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R; Fineran, Peter C

    2013-04-01

    In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.

  18. Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

    PubMed

    Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

    2017-05-23

    A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. High-density, microsphere-based fiber optic DNA microarrays.

    PubMed

    Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

    2003-05-01

    A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

  20. The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

    PubMed

    Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

    2017-04-01

    During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

  1. Visible light-sensitive APTES-bound ZnO nanowire toward a potent nanoinjector sensing biomolecules in a living cell

    NASA Astrophysics Data System (ADS)

    Lee, Jooran; Choi, Sunyoung; Bae, Seon Joo; Yoon, Seok Min; Choi, Joon Sig; Yoon, Minjoong

    2013-10-01

    Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes.Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes. Electronic supplementary information (ESI) available: Synthesis of APTES-modified ZnO nanowires, DNA functionalization and spectroscopic measurements with additional fluorescence image ad fluorescence decay times, cell culture, injection of a single nanowire into living cells, subcellular imaging and determination of cytotoxicity. See DOI: 10.1039/c3nr03042c

  2. Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries

    PubMed Central

    Kerschner, Joseph E.; Horsey, Edward; Ahmed, Azad; Erbe, Christy; Khampang, Pawjai; Cioffi, Joseph; Hu, Fen Ze; Post, James Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives To investigate genetic differences in middle ear mucosa (MEM) with nontypeable Haemophilus influenzae (NTHi) infection. Genetic upregulation and downregulation occurs in MEM during otitis media (OM) pathogenesis. A comprehensive assessment of these genetic differences using the techniques of complementary DNA (cDNA) library creation has not been performed. Design The cDNA libraries were constructed from NTHi-infected and noninfected chinchilla MEM. Random clones were picked, sequenced bidirectionally, and submitted to the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database, where they were assigned accession numbers. These numbers were used with the basic local alignment search tool (BLAST) to align clones against the nonredundant nucleotide database at NCBI. Results Analysis with the Web-based statistical program FatiGO identified several biological processes with significant differences in numbers of represented genes. Processes involved in immune, stress, and wound responses were more prevalent in the NTHi-infected library. S100 calcium-binding protein A9 (S100A9); secretory leukoprotease inhibitor (SLPI); β2-microglobulin (B2M); ferritin, heavy-chain polypeptide 1 (FTH1); and S100 calcium-binding protein A8 (S100A8) were expressed at significantly higher levels in the NTHi-infected library. Calcium-binding proteins S100A9 and S100A8 serve as markers for inflammation and have antibacterial effects. Secretory leukoprotease inhibitor is an antibacterial protein that inhibits stimuli-induced MUC1, MUC2, and MUC5AC production. Conclusions A number of genes demonstrate changes during the pathogenesis of OM, including SLPI, which has an impact on mucin gene expression; this expression is known to be an important regulator in OM. The techniques described herein provide a framework for future investigations to more thoroughly understand molecular changes in the middle ear, which will likely be important in developing new therapeutic and intervention strategies. PMID:19153305

  3. The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

    NASA Astrophysics Data System (ADS)

    Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

    1989-06-01

    The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

  4. A combined de novo protein sequencing and cDNA library approach to the venomic analysis of Chinese spider Araneus ventricosus.

    PubMed

    Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping

    2013-01-14

    In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  5. DNA sequence-level analyses reveal potential phenotypic modifiers in a large family with psychiatric disorders.

    PubMed

    Ryan, Niamh M; Lihm, Jayon; Kramer, Melissa; McCarthy, Shane; Morris, Stewart W; Arnau-Soler, Aleix; Davies, Gail; Duff, Barbara; Ghiban, Elena; Hayward, Caroline; Deary, Ian J; Blackwood, Douglas H R; Lawrie, Stephen M; McIntosh, Andrew M; Evans, Kathryn L; Porteous, David J; McCombie, W Richard; Thomson, Pippa A

    2018-06-07

    Psychiatric disorders are a group of genetically related diseases with highly polygenic architectures. Genome-wide association analyses have made substantial progress towards understanding the genetic architecture of these disorders. More recently, exome- and whole-genome sequencing of cases and families have identified rare, high penetrant variants that provide direct functional insight. There remains, however, a gap in the heritability explained by these complementary approaches. To understand how multiple genetic variants combine to modify both severity and penetrance of a highly penetrant variant, we sequenced 48 whole genomes from a family with a high loading of psychiatric disorder linked to a balanced chromosomal translocation. The (1;11)(q42;q14.3) translocation directly disrupts three genes: DISC1, DISC2, DISC1FP and has been linked to multiple brain imaging and neurocognitive outcomes in the family. Using DNA sequence-level linkage analysis, functional annotation and population-based association, we identified common and rare variants in GRM5 (minor allele frequency (MAF) > 0.05), PDE4D (MAF > 0.2) and CNTN5 (MAF < 0.01) that may help explain the individual differences in phenotypic expression in the family. We suggest that whole-genome sequencing in large families will improve the understanding of the combined effects of the rare and common sequence variation underlying psychiatric phenotypes.

  6. Investigation of FANCA gene in Fanconi anaemia patients in Iran

    PubMed Central

    Saffar Moghadam, Ali Akbar; Mahjoubi, Frouzandeh; Reisi, Nahid; Vosough, Parvaneh

    2016-01-01

    Background & objectives: Fanconi anaemia (FA) is a syndrome with a predisposition to bone marrow failure, congenital anomalies and malignancies. It is characterized by cellular hypersensitivity to cross-linking agents such as mitomycin C (MMC). In the present study, a new approach was selected to investigate FANCA (Fanconi anaemia complementation group A) gene in patients clinically diagnosed with cellular hypersensitivity to DNA cross-linking agent MMC. Methods: Chromosomal breakage analysis was performed to prove the diagnosis of Fanconi anaemia in 318 families. Of these, 70 families had a positive result. Forty families agreed to molecular genetic testing. In total, there were 27 patients with unknown complementary types. Genomic DNA was extracted and total RNA was isolated from fresh whole blood of the patients. The first-strand cDNA was synthesized and the cDNA of each patient was then tested with 21 pairs of overlapping primers. High resolution melting curve analysis was used to screen FANCA, and LinReg software version 1.7 was utilized for analysis of expression. Results: In total, six sequence alterations were identified, which included two stop codons, two frames-shift mutations, one large deletion and one amino acid exchange. FANCA expression was downregulated in patients who had sequence alterations. Interpretation & conclusions: The results of the present study show that high resolution melting (HRM) curve analysis may be useful in the detection of sequence alteration. It is simpler and more costeffective than the multiplex ligation-dependent probe amplification (MLPA) procedure. PMID:27121516

  7. Investigation of FANCA gene in Fanconi anaemia patients in Iran.

    PubMed

    Moghadam, Ali Akbar Saffar; Mahjoubi, Frouzandeh; Reisi, Nahid; Vosough, Parvaneh

    2016-02-01

    Fanconi anaemia (FA) is a syndrome with a predisposition to bone marrow failure, congenital anomalies and malignancies. It is characterized by cellular hypersensitivity to cross-linking agents such as mitomycin C (MMC). In the present study, a new approach was selected to investigate FANCA (Fanconi anaemia complementation group A) gene in patients clinically diagnosed with cellular hypersensitivity to DNA cross-linking agent MMC. Chromosomal breakage analysis was performed to prove the diagnosis of Fanconi anaemia in 318 families. Of these, 70 families had a positive result. Forty families agreed to molecular genetic testing. In total, there were 27 patients with unknown complementary types. Genomic DNA was extracted and total RNA was isolated from fresh whole blood of the patients. The first-strand cDNA was synthesized and the cDNA of each patient was then tested with 21 pairs of overlapping primers. High resolution melting curve analysis was used to screen FANCA, and LinReg software version 1.7 was utilized for analysis of expression. In total, six sequence alterations were identified, which included two stop codons, two frames-shift mutations, one large deletion and one amino acid exchange. FANCA expression was downregulated in patients who had sequence alterations. The results of the present study show that high resolution melting (HRM) curve analysis may be useful in the detection of sequence alteration. It is simpler and more cost-effective than the multiplex ligation-dependent probe amplification (MLPA) procedure.

  8. Procedure for normalization of cDNA libraries

    DOEpatents

    Bonaldo, M.D.; Soares, M.B.

    1997-12-30

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

  9. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    PubMed

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2017-06-15

    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  10. Characterization of a species-specific repetitive DNA from a highly endangered wild animal, Rhinoceros unicornis, and assessment of genetic polymorphism by microsatellite associated sequence amplification (MASA).

    PubMed

    Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S

    1999-03-04

    We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.

  11. Evidence for a Single-Stranded Adenovirus-Associated Virus Genome: Isolation and Separation of Complementary Single Strands

    PubMed Central

    Berns, K. I.; Rose, J. A.

    1970-01-01

    Single-stranded adenovirus-associated virus type 2 deoxyribonucleic acid (AAV-2 DNA) has been isolated from the virion after enzymatic pretreatment of the particles by heating at 53 C for 1 hr in 0.015 m NaCl plus 0.0015 m sodium citrate in the presence of 1% sodium dodecyl sulfate. Double-stranded AAV-2 DNA present as a marker is not denatured by this treatment. AAV-2 single-stranded DNA is composed of two complementary species which can be separated in neutral CsCl when 5-bromodeoxyuridine has been substituted for thymidine in the DNA. The present report is the first documented instance of the separation of complementary strands of an animal virus DNA. PMID:5429749

  12. Monoterpene synthases from common sage (Salvia officinalis)

    DOEpatents

    Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  13. Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

    PubMed

    Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

    2018-01-01

    Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

  14. Complementation of a red-light-indifferent cyanobacterial mutant.

    PubMed Central

    Chiang, G G; Schaefer, M R; Grossman, A R

    1992-01-01

    Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

  15. A Single Electrochemical Probe Used for Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Mills, Dawn M.; Calvo-Marzal, Percy; Pinzon, Jeffer M.; Armas, Stephanie; Kolpashchikov, Dmitry M.; Chumbimuni-Torres, Karin Y.

    2017-01-01

    Electrochemical hybridization sensors have been explored extensively for analysis of specific nucleic acids. However, commercialization of the platform is hindered by the need for attachment of separate oligonucleotide probes complementary to a RNA or DNA target to an electrode’s surface. Here we demonstrate that a single probe can be used to analyze several nucleic acid targets with high selectivity and low cost. The universal electrochemical four-way junction (4J)-forming (UE4J) sensor consists of a universal DNA stem-loop (USL) probe attached to the electrode’s surface and two adaptor strands (m and f) which hybridize to the USL probe and the analyte to form a 4J associate. The m adaptor strand was conjugated with a methylene blue redox marker for signal ON sensing and monitored using square wave voltammetry. We demonstrated that a single sensor can be used for detection of several different DNA/RNA sequences and can be regenerated in 30 seconds by a simple water rinse. The UE4J sensor enables a high selectivity by recognition of a single base substitution, even at room temperature. The UE4J sensor opens a venue for a re-useable universal platform that can be adopted at low cost for the analysis of DNA or RNA targets. PMID:29371782

  16. Probabilistic simple sticker systems

    NASA Astrophysics Data System (ADS)

    Selvarajoo, Mathuri; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod

    2017-04-01

    A model for DNA computing using the recombination behavior of DNA molecules, known as a sticker system, was introduced by by L. Kari, G. Paun, G. Rozenberg, A. Salomaa, and S. Yu in the paper entitled DNA computing, sticker systems and universality from the journal of Acta Informatica vol. 35, pp. 401-420 in the year 1998. A sticker system uses the Watson-Crick complementary feature of DNA molecules: starting from the incomplete double stranded sequences, and iteratively using sticking operations until a complete double stranded sequence is obtained. It is known that sticker systems with finite sets of axioms and sticker rules generate only regular languages. Hence, different types of restrictions have been considered to increase the computational power of sticker systems. Recently, a variant of restricted sticker systems, called probabilistic sticker systems, has been introduced [4]. In this variant, the probabilities are initially associated with the axioms, and the probability of a generated string is computed by multiplying the probabilities of all occurrences of the initial strings in the computation of the string. Strings for the language are selected according to some probabilistic requirements. In this paper, we study fundamental properties of probabilistic simple sticker systems. We prove that the probabilistic enhancement increases the computational power of simple sticker systems.

  17. Cloning metallothionein gene in Zacco platypus and its potential as an exposure biomarker against cadmium.

    PubMed

    Lee, Sangwoo; Kim, Cheolmin; Kim, Jungkon; Kim, Woo-Keun; Shin, Hyun Suk; Lim, Eun-Suk; Lee, Jin Wuk; Kim, Sunmi; Kim, Ki-Tae; Lee, Sung-Kyu; Choi, Cheol Young; Choi, Kyungho

    2015-07-01

    Zacco platypus, pale chub, is an indigenous freshwater fish of East Asia including Korea and has many useful characteristics as indicator species for water pollution. While utility of Z. platypus as an experimental species has been recognized, genetic-level information is very limited and warrants extensive research. Metallothionein (MT) is widely used and well-known biomarker for heavy metal exposure in many experimental species. In the present study, we cloned MT in Z. platypus and evaluated its utility as a biomarker for metal exposure. For this purpose, we sequenced complete complementary DNA (cDNA) of MT in Z. platypus and carried out phylogenetic analysis with its sequences. The transcription-level responses of MT gene following the exposure to CdCl2 were also assessed to validate the utility of this gene as an exposure biomarker. Analysis of cDNA sequence of MT gene demonstrated high conformity with those of other fish. MT messenger RNA (mRNA) expression and enzymatic MT content significantly increased following CdCl2 exposure in a concentration-dependent manner. The level of CdCl2 that resulted in significant MT changes in Z. platypus was within the range that was reported from other fish. The MT gene of Z. platypus sequenced in the present study can be used as a useful biomarker for heavy metal exposure in the aquatic environment of Korea and other countries where this freshwater fish species represents the ecosystem.

  18. Transcriptional dynamics of the developing sweet cherry (Prunus avium L.) fruit: sequencing, annotation and expression profiling of exocarp-associated genes

    PubMed Central

    Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz

    2014-01-01

    The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533

  19. Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

    PubMed Central

    Suard, Y M; Tosi, M; Kraehenbuhl, J P

    1982-01-01

    Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

  20. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    PubMed

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

    PubMed Central

    Kilimann, M W; DeGennaro, L J

    1985-01-01

    To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosatelli, M.C.; Faa, V.; Sardu, R.

    This study reports the molecular characterization of [beta]-thalassemia in the Sardinian population. Three thousand [beta]-thalassemia chromosomes from prospective parents presenting at the genetic service were initially analyzed by dot blot analysis with oligonucleotide probes complementary to the most common [beta]-thalassemia mutations in the Mediterranean at-risk populations. The mutation which remained uncharacterized by this approach were defined by denaturing gradient gel electrophoresis (DGGE) followed by direct sequence analysis on amplified DNA. The authors reconfirmed that the predominant mutation in the Sardinian population is the codon 39 nonsense mutation, which accounts for 95.7% of the [beta]-thalassemia chromosomes. The other two relatively commonmore » mutations are frameshifts at codon 6 (2.1%) and at codon 76 (0.7%), relatively uncommon in other Mediterranean-origin populations. In this study they have detected a novel [beta]-thalassemia mutation, i.e., a frameshift at codon 1, in three [beta]-thalassemia chromosomes. The DGGE procedure followed by direct sequencing on amplified DNA is a powerful approach for the characterization of unknown mutations in this genetic system.« less

  3. Complementary molecular information changes our perception of food web structure

    PubMed Central

    Wirta, Helena K.; Hebert, Paul D. N.; Kaartinen, Riikka; Prosser, Sean W.; Várkonyi, Gergely; Roslin, Tomas

    2014-01-01

    How networks of ecological interactions are structured has a major impact on their functioning. However, accurately resolving both the nodes of the webs and the links between them is fraught with difficulties. We ask whether the new resolution conferred by molecular information changes perceptions of network structure. To probe a network of antagonistic interactions in the High Arctic, we use two complementary sources of molecular data: parasitoid DNA sequenced from the tissues of their hosts and host DNA sequenced from the gut of adult parasitoids. The information added by molecular analysis radically changes the properties of interaction structure. Overall, three times as many interaction types were revealed by combining molecular information from parasitoids and hosts with rearing data, versus rearing data alone. At the species level, our results alter the perceived host specificity of parasitoids, the parasitoid load of host species, and the web-wide role of predators with a cryptic lifestyle. As the northernmost network of host–parasitoid interactions quantified, our data point exerts high leverage on global comparisons of food web structure. However, how we view its structure will depend on what information we use: compared with variation among networks quantified at other sites, the properties of our web vary as much or much more depending on the techniques used to reconstruct it. We thus urge ecologists to combine multiple pieces of evidence in assessing the structure of interaction webs, and suggest that current perceptions of interaction structure may be strongly affected by the methods used to construct them. PMID:24449902

  4. DNA impedance biosensor for detection of cancer, TP53 gene mutation, based on gold nanoparticles/aligned carbon nanotubes modified electrode.

    PubMed

    Fayazfar, H; Afshar, A; Dolati, M; Dolati, A

    2014-07-11

    For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.

  5. Csa-19, a radiation-responsive human gene, identified by an unbiased two-gel cDNA library screening method in human cancer cells

    NASA Technical Reports Server (NTRS)

    Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.

    1997-01-01

    A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.

  6. Development of EST-SSR markers for Elaeocarpus photiniifolia (Elaeocarpaceae), an endemic taxon of the Bonin Islands.

    PubMed

    Sugai, Kyoko; Setsuko, Suzuki; Uchiyama, Kentaro; Murakami, Noriaki; Kato, Hidetoshi; Yoshimaru, Hiroshi

    2012-02-01

    Expressed sequence tag (EST)-derived microsatellite markers were developed for Elaeocarpus photiniifolia, an endemic taxon of the Bonin Islands. Initially, a complementary DNA (cDNA) library was constructed by de novo pyrosequencing of total RNA extracted from a seedling. A total of 267 primer pairs were designed from the library. Of the 48 tested loci, 25 loci were polymorphic among 41 individuals representing the entire geographical range of the species, with the number of alleles per locus and expected heterozygosity ranging from two to 14 and 0.09 to 0.86, respectively. Most loci were transferable to a related species, E. sylvestris. The developed markers will be useful for evaluating the genetic structure of E. photiniifolia.

  7. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    PubMed

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  8. DNA biosensors implemented on PNA-functionalized microstructured optical fibers Bragg gratings

    NASA Astrophysics Data System (ADS)

    Candiani, A.; Giannetti, S.; Cucinotta, A.; Bertucci, A.; Manicardi, A.; Konstantaki, M.; Margulis, W.; Pissadakis, S.; Corradini, R.; Selleri, S.

    2013-05-01

    A novel DNA sensing platform based on a Peptide Nucleic Acid - functionalized Microstructured Optical Fibers gratings has been demonstrated. The inner surface of different MOFs has been functionalized using PNA probes, OligoNucleotides mimic that are well suited for specific DNA target sequences detection. The hybrid sensing systems were tested for optical DNA detection of targets of relevance in biomedical application, using the cystic fibrosis gene mutation, and food-analysis, using the genomic DNA from genetic modified organism soy flour. After the solutions of DNA molecules has been infiltrated inside the fibers capillaries and hybridization has occurred, oligonucleotidefunctionalized gold nanoparticles were infiltrated and used to form a sandwich-like system to achieve signal amplification. Spectral measurements of the reflected signal reveal a clear wavelength shift of the reflected modes when the infiltrated complementary DNA matches with the PNA probes placed on the inner fiber surface. Measurements have also been made using the mismatched DNA solution for the c, containing a single nucleotide polymorphism, showing no significant changes in the reflected spectrum. Several experiments have been carried out demonstrating the reproducibility of the results and the high selectivity of the sensors, showing the simplicity and the potential of this approach.

  9. DNA origami metallized site specifically to form electrically conductive nanowires.

    PubMed

    Pearson, Anthony C; Liu, Jianfei; Pound, Elisabeth; Uprety, Bibek; Woolley, Adam T; Davis, Robert C; Harb, John N

    2012-09-06

    DNA origami is a promising tool for use as a template in the design and fabrication of nanoscale structures. The ability to engineer selected staple strands on a DNA origami structure provides a high density of addressable locations across the structure. Here we report a method using site-specific attachment of gold nanoparticles to modified staple strands and subsequent metallization to fabricate conductive wires from DNA origami templates. We have modified DNA origami structures by lengthening each staple strand in select regions with a 10-base nucleotide sequence and have attached DNA-modified gold nanoparticles to the lengthened staple strands via complementary base-pairing. The high density of extended staple strands allowed the gold nanoparticles to pack tightly in the modified regions of the DNA origami, where the measured median gap size between neighboring particles was 4.1 nm. Gold metallization processes were optimized so that the attached gold nanoparticles grew until gaps between particles were filled and uniform continuous nanowires were formed. Finally, electron beam lithography was used to pattern electrodes in order to measure the electrical conductivity of metallized DNA origami, which showed an average resistance of 2.4 kΩ per metallized structure.

  10. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    PubMed Central

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  11. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  12. Cohort analysis of a single nucleotide polymorphism on DNA chips.

    PubMed

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

    2004-11-15

    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  13. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  14. Rapid high-throughput analysis of ochratoxin A by the self-assembly of DNAzyme-aptamer conjugates in wine.

    PubMed

    Yang, Cheng; Lates, Vasilica; Prieto-Simón, Beatriz; Marty, Jean-Louis; Yang, Xiurong

    2013-11-15

    We report a new label-free colorimetric aptasensor based on DNAzyme-aptamer conjugate for rapid and high-throughput detection of Ochratoxin A (OTA, a possible human carcinogen, group 2B) in wine. Two oligonucleotides were designed for this detection. One is N1 for biorecognition, which includes two adjacent sequences: the OTA-specific aptamer sequence and the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The other is a blocking DNA (B2), which is partially complementary to a part of the OTA aptamer and partially complementary to a part of the DNAzyme. The existence of OTA reduces the hybridization between N1 and B2. Thus, the activity of the non-hybridized DNAzyme is linearly correlated with the concentration of OTA up to 30 nM with a limit of detection of 4 nM (3σ). Meanwhile, a double liquid-liquid extraction (LLE) method is accordingly developed to purify OTA from wine. Compared with the existing HPLC-FD or immunoassay methods, the proposed strategy presents the most appropriate balance between accuracy and facility, resulting in a considerable improvement of real-time quality control, and thereby, preventing chronic poisoning caused by OTA contained red wine. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. The (in)complete organelle genome: exploring the use and nonuse of available technologies for characterizing mitochondrial and plastid chromosomes.

    PubMed

    Sanitá Lima, Matheus; Woods, Laura C; Cartwright, Matthew W; Smith, David Roy

    2016-11-01

    Not long ago, scientists paid dearly in time, money and skill for every nucleotide that they sequenced. Today, DNA sequencing technologies epitomize the slogan 'faster, easier, cheaper and more', and in many ways, sequencing an entire genome has become routine, even for the smallest laboratory groups. This is especially true for mitochondrial and plastid genomes. Given their relatively small sizes and high copy numbers per cell, organelle DNAs are currently among the most highly sequenced kind of chromosome. But accurately characterizing an organelle genome and the information it encodes can require much more than DNA sequencing and bioinformatics analyses. Organelle genomes can be surprisingly complex and can exhibit convoluted and unconventional modes of gene expression. Unravelling this complexity can demand a wide assortment of experiments, from pulsed-field gel electrophoresis to Southern and Northern blots to RNA analyses. Here, we show that it is exactly these types of 'complementary' analyses that are often lacking from contemporary organelle genome papers, particularly short 'genome announcement' articles. Consequently, crucial and interesting features of organelle chromosomes are going undescribed, which could ultimately lead to a poor understanding and even a misrepresentation of these genomes and the genes they express. High-throughput sequencing and bioinformatics have made it easy to sequence and assemble entire chromosomes, but they should not be used as a substitute for or at the expense of other types of genomic characterization methods. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  16. Equine infectious anemia virus in naturally infected horses from the Brazilian Pantanal.

    PubMed

    Cursino, Andreia Elisa; Vilela, Ana Paula Pessoa; Franco-Luiz, Ana Paula Moreira; de Oliveira, Jaquelline Germano; Nogueira, Márcia Furlan; Júnior, João Pessoa Araújo; de Aguiar, Daniel Moura; Kroon, Erna Geessien

    2018-05-11

    Equine infectious anemia (EIA) has a worldwide distribution, and is widespread in Brazil. The Brazilian Pantanal presents with high prevalence comprising equine performance and indirectly the livestock industry, since the horses are used for cattle management. Although EIA is routinely diagnosed by the agar gel immunodiffusion test (AGID), this serological assay has some limitations, so PCR-based detection methods have the potential to overcome these limitations and act as complementary tests to those currently used. Considering the limited number of equine infectious anemia virus (EIAV) sequences which are available in public databases and the great genome variability, studies of EIAV detection and characterization molecular remain important. In this study we detected EIAV proviral DNA from 23 peripheral blood mononuclear cell (PBMCs) samples of naturally infected horses from Brazilian Pantanal using a semi-nested-PCR (sn-PCR). The serological profile of the animals was also evaluated by AGID and ELISA for gp90 and p26. Furthermore, the EIAV PCR amplified DNA was sequenced and phylogenetically analyzed. Here we describe the first EIAV sequences of the 5' LTR of the tat gene in naturally infected horses from Brazil, which presented with 91% similarity to EIAV reference sequences. The Brazilian EIAV sequences also presented variable nucleotide similarities among themselves, ranging from 93,5% to 100%. Phylogenetic analysis showed that Brazilian EIAV sequences grouped in a separate clade relative to other reference sequences. Thus this molecular detection and characterization may provide information about EIAV circulation in Brazilian territories and improve phylogenetic inferences.

  17. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    PubMed

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

    PubMed

    Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

    2007-04-10

    For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

  19. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity

    PubMed Central

    Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.

    2016-01-01

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241

  20. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    PubMed

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

    PubMed

    Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

    2014-06-01

    Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Label-free electrochemical genosensor based on mesoporous silica thin film.

    PubMed

    Saadaoui, Maroua; Fernández, Iñigo; Luna, Gema; Díez, Paula; Campuzano, Susana; Raouafi, Noureddine; Sánchez, Alfredo; Pingarrón, José M; Villalonga, Reynaldo

    2016-10-01

    A novel label-free electrochemical strategy for nucleic acid detection was developed by using gold electrodes coated with mesoporous silica thin films as sensing interface. The biosensing approach relies on the covalent attachment of a capture DNA probe on the surface of the silica nanopores and further hybridization with its complementary target oligonucleotide sequence, causing a diffusion hindering of an Fe(CN)6 (3-/4-) electrochemical probe through the nanochannels of the mesoporous film. This DNA-mesoporous silica thin film-modified electrodes allowed sensitive (91.7 A/M) and rapid (45 min) detection of low nanomolar levels of synthetic target DNA (25 fmol) and were successfully employed to quantify the endogenous content of Escherichia coli 16S ribosomal RNA (rRNA) directly in raw bacterial lysate samples without isolation or purification steps. Moreover, the 1-month stability demonstrated by these biosensing devices enables their advanced preparation and storage, as desired for practical real-life applications. Graphical abstract Mesoporous silica thin films as scaffolds for the development of novel label-free electrochemical genosensors to perform selective, sensitive and rapid detection of target oligonucleotide sequences. Application towards E. coli determination.

  3. Development of novel low-copy nuclear markers for Hieraciinae (Asteraceae) and their perspective for other tribes.

    PubMed

    Krak, Karol; Alvarez, Inés; Caklová, Petra; Costa, Andrea; Chrtek, Jindrich; Fehrer, Judith

    2012-02-01

    The development of three low-copy nuclear markers for low taxonomic level phylogenies in Asteraceae with emphasis on the subtribe Hieraciinae is reported. Marker candidates were selected by comparing a Lactuca complementary DNA (cDNA) library with public DNA sequence databases. Interspecific variation and phylogenetic signal of the selected genes were investigated for diploid taxa from the subtribe Hieraciinae and compared to a reference phylogeny. Their ability to cross-amplify was assessed for other Asteraceae tribes. All three markers had higher variation (2.1-4.5 times) than the internal transcribed spacer (ITS) in Hieraciinae. Cross-amplification was successful in at least seven other tribes of the Asteraceae. Only three cases indicating the presence of paralogs or pseudogenes were detected. The results demonstrate the potential of these markers for phylogeny reconstruction in the Hieraciinae as well as in other Asteraceae tribes, especially for very closely related species.

  4. Availability: A Metric for Nucleic Acid Strand Displacement Systems.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Padilla, Jennifer E; Hallstrom, Natalya; Goltry, Sara; Lee, Jeunghoon; Yurke, Bernard; Hughes, William L; Graugnard, Elton

    2017-01-20

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks.

  5. Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

    PubMed Central

    Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

    2011-01-01

    We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

  6. Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.

    PubMed

    Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François

    2009-07-08

    Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.

  7. Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription

    PubMed Central

    Beerens, Nancy; Kjems, Jørgen

    2010-01-01

    Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859

  8. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  9. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

    PubMed

    Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

    2013-10-15

    Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.

  10. A new age in functional genomics using CRISPR/Cas9 in arrayed library screening.

    PubMed

    Agrotis, Alexander; Ketteler, Robin

    2015-01-01

    CRISPR technology has rapidly changed the face of biological research, such that precise genome editing has now become routine for many labs within several years of its initial development. What makes CRISPR/Cas9 so revolutionary is the ability to target a protein (Cas9) to an exact genomic locus, through designing a specific short complementary nucleotide sequence, that together with a common scaffold sequence, constitute the guide RNA bridging the protein and the DNA. Wild-type Cas9 cleaves both DNA strands at its target sequence, but this protein can also be modified to exert many other functions. For instance, by attaching an activation domain to catalytically inactive Cas9 and targeting a promoter region, it is possible to stimulate the expression of a specific endogenous gene. In principle, any genomic region can be targeted, and recent efforts have successfully generated pooled guide RNA libraries for coding and regulatory regions of human, mouse and Drosophila genomes with high coverage, thus facilitating functional phenotypic screening. In this review, we will highlight recent developments in the area of CRISPR-based functional genomics and discuss potential future directions, with a special focus on mammalian cell systems and arrayed library screening.

  11. Effect of sequencing of complementary feeding in relation to breast-feeding on total intake in infants.

    PubMed

    Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A

    2014-03-01

    The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.

  12. Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

    PubMed

    Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

    1998-09-23

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

  13. Asymmetric Regulation of Bipolar Single-stranded DNA Translocation by the Two Motors within Escherichia coli RecBCD Helicase*

    PubMed Central

    Xie, Fuqian; Wu, Colin G.; Weiland, Elizabeth; Lohman, Timothy M.

    2013-01-01

    Repair of double-stranded DNA breaks in Escherichia coli is initiated by the RecBCD helicase that possesses two superfamily-1 motors, RecB (3′ to 5′ translocase) and RecD (5′ to 3′ translocase), that operate on the complementary DNA strands to unwind duplex DNA. However, it is not known whether the RecB and RecD motors act independently or are functionally coupled. Here we show by directly monitoring ATP-driven single-stranded DNA translocation of RecBCD that the 5′ to 3′ rate is always faster than the 3′ to 5′ rate on DNA without a crossover hotspot instigator site and that the translocation rates are coupled asymmetrically. That is, RecB regulates both 3′ to 5′ and 5′ to 3′ translocation, whereas RecD only regulates 5′ to 3′ translocation. We show that the recently identified RecBC secondary translocase activity functions within RecBCD and that this contributes to the coupling. This coupling has implications for how RecBCD activity is regulated after it recognizes a crossover hotspot instigator sequence during DNA unwinding. PMID:23192341

  14. Sensitive detection of multiple pathogens using a single DNA probe.

    PubMed

    Nordin, Noordiana; Yusof, Nor Azah; Abdullah, Jaafar; Radu, Son; Hushiarian, Roozbeh

    2016-12-15

    A simple but promising electrochemical DNA nanosensor was designed, constructed and applied to differentiate a few food-borne pathogens. The DNA probe was initially designed to have a complementary region in Vibrio parahaemolyticus (VP) genome and to make different hybridization patterns with other selected pathogens. The sensor was based on a screen printed carbon electrode (SPCE) modified with polylactide-stabilized gold nanoparticles (PLA-AuNPs) and methylene blue (MB) was employed as the redox indicator binding better to single-stranded DNA. The immobilization and hybridization events were assessed using differential pulse voltammetry (DPV). The fabricated biosensor was able to specifically distinguish complementary, non-complementary and mismatched oligonucleotides. DNA was measured in the range of 2.0×10(-9)-2.0×10(-13)M with a detection limit of 5.3×10(-12)M. The relative standard deviation for 6 replications of DPV measurement of 0.2µM complementary DNA was 4.88%. The fabricated DNA biosensor was considered stable and portable as indicated by a recovery of more than 80% after a storage period of 6 months at 4-45°C. Cross-reactivity studies against various food-borne pathogens showed a reliably sensitive detection of VP. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. DNA metabarcoding and microscopic analyses of sea turtles biofilms: Complementary to understand turtle behavior

    PubMed Central

    Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E.; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric

    2018-01-01

    Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior. PMID:29659610

  16. DNA metabarcoding and microscopic analyses of sea turtles biofilms: Complementary to understand turtle behavior.

    PubMed

    Rivera, Sinziana F; Vasselon, Valentin; Ballorain, Katia; Carpentier, Alice; Wetzel, Carlos E; Ector, Luc; Bouchez, Agnès; Rimet, Frédéric

    2018-01-01

    Sea turtles are distributed in tropical and subtropical seas worldwide. They play several ecological roles and are considered important indicators of the health of marine ecosystems. Studying epibiotic diatoms living on turtle shells suggestively has great potential in the study of turtle behavior because diatoms are always there. However, diatom identification at the species level is time consuming, requires well-trained specialists, and there is a high probability of finding new taxa growing on turtle shells, which makes identification tricky. An alternative approach based on DNA barcoding and high throughput sequencing (HTS), metabarcoding, has been developed in recent years to identify species at the community level by using a DNA reference library. The suitabilities of morphological and molecular approaches were compared. Diatom assemblages were sampled from seven juvenile green turtles (Chelonia mydas) from Mayotte Island, France. The structures of the epibiotic diatom assemblages differed between both approaches. This resulted in different clustering of the turtles based on their diatom communities. Metabarcoding allowed better discrimination between turtles based on their epibiotic diatom assemblages and put into evidence the presence of a cryptic diatom diversity. Microscopy, for its part, provided more ecological information of sea turtles based on historical bibliographical data and the abundances of ecological guilds of the diatom species present in the samples. This study shows the complementary nature of these two methods for studying turtle behavior.

  17. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    PubMed

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Effect of Backbone Design on Hybridization Thermodynamics of Oligo-nucleic Acids: A Coarse-Grained Molecular Dynamics Simulation Study

    NASA Astrophysics Data System (ADS)

    Ghobadi, Ahmadreza F.; Jayaraman, Arthi

    DNA hybridization is the basis of various bio-nano technologies, such as DNA origami and assembly of DNA-functionalized nanoparticles. A hybridized double stranded (ds) DNA is formed when complementary nucleobases on hybridizing strands exhibit specific and directional hydrogen bonds through canonical Watson-Crick base-pairing interactions. In recent years, the need for cheaper alternatives and significant synthetic advances have driven design of DNA mimics with new backbone chemistries. However, a fundamental understanding of how these backbone modifications in the oligo-nucleic acids impact the hybridization and melting behavior of the duplex is still lacking. In this talk, we present our recent findings on impact of varying backbone chemistry on hybridization of oligo-nucleic acid duplexes. We use coarse-grained molecular dynamics simulations to isolate the effect of strand flexibility, electrostatic interactions and nucleobase spacing on the melting curves for duplexes with various strand sequences and concentrations. Since conjugation of oligo-nucleic acids with polymers serve as building blocks for thermo-responsive polymer networks and gels, we also present the effect of such conjugation on hybridization thermodynamics and polymer conformation.

  19. Detection of Bacillus anthracis DNA in Complex Soil and Air Samples Using Next-Generation Sequencing

    PubMed Central

    Be, Nicholas A.; Thissen, James B.; Gardner, Shea N.; McLoughlin, Kevin S.; Fofanov, Viacheslav Y.; Koshinsky, Heather; Ellingson, Sally R.; Brettin, Thomas S.; Jackson, Paul J.; Jaing, Crystal J.

    2013-01-01

    Bacillus anthracis is the potentially lethal etiologic agent of anthrax disease, and is a significant concern in the realm of biodefense. One of the cornerstones of an effective biodefense strategy is the ability to detect infectious agents with a high degree of sensitivity and specificity in the context of a complex sample background. The nature of the B. anthracis genome, however, renders specific detection difficult, due to close homology with B. cereus and B. thuringiensis. We therefore elected to determine the efficacy of next-generation sequencing analysis and microarrays for detection of B. anthracis in an environmental background. We applied next-generation sequencing to titrated genome copy numbers of B. anthracis in the presence of background nucleic acid extracted from aerosol and soil samples. We found next-generation sequencing to be capable of detecting as few as 10 genomic equivalents of B. anthracis DNA per nanogram of background nucleic acid. Detection was accomplished by mapping reads to either a defined subset of reference genomes or to the full GenBank database. Moreover, sequence data obtained from B. anthracis could be reliably distinguished from sequence data mapping to either B. cereus or B. thuringiensis. We also demonstrated the efficacy of a microbial census microarray in detecting B. anthracis in the same samples, representing a cost-effective and high-throughput approach, complementary to next-generation sequencing. Our results, in combination with the capacity of sequencing for providing insights into the genomic characteristics of complex and novel organisms, suggest that these platforms should be considered important components of a biosurveillance strategy. PMID:24039948

  20. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

    PubMed

    Miller, Andrew D

    2015-02-01

    A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

  2. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  3. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  4. Species delimitation in the Central African herbs Haumania (Marantaceae) using georeferenced nuclear and chloroplastic DNA sequences.

    PubMed

    Ley, A C; Hardy, O J

    2010-11-01

    Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Deep Sequencing of Plant and Animal DNA Contained within Traditional Chinese Medicines Reveals Legality Issues and Health Safety Concerns

    PubMed Central

    Coghlan, Megan L.; Haile, James; Houston, Jayne; Murray, Dáithí C.; White, Nicole E.; Moolhuijzen, Paula; Bellgard, Matthew I.; Bunce, Michael

    2012-01-01

    Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when plant reference databases become better established. PMID:22511890

  6. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  7. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

    PubMed

    Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

    2015-07-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

  8. Modulation of DNA-Polyamide Interaction by β-alanine Substitutions: A Study of Positional Effects on Binding Affinity, Kinetics and Thermodynamics

    PubMed Central

    Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.

    2014-01-01

    Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096

  9. miR-ID: A novel, circularization-based platform for detection of microRNAs

    PubMed Central

    Kumar, Pavan; Johnston, Brian H.; Kazakov, Sergei A.

    2011-01-01

    MicroRNAs (miRNAs) are important regulators of gene expression and have great potential as biomarkers, prognostic indicators, and therapeutic targets. Determining the expression patterns of these molecules is essential for elucidating their biogenesis, regulation, relation to disease, and response to therapy. Although PCR-based assays are commonly used for expression profiling of miRNAs, the small size, sequence heterogeneity, and (in some cases) end modifications of miRNAs constrain the performance of existing PCR methods. Here we introduce miR-ID, a novel method that avoids these constraints while providing superior sensitivity and sequence specificity at a lower cost. It also has the unique ability to differentiate unmodified small RNAs from those carrying 2′-OMe groups at their 3′-ends while detecting both forms. miR-ID is comprised of the following steps: (1) circularization of the miRNA by a ligase; (2) reverse transcription of the circularized miRNA (RTC), producing tandem repeats of a DNA sequence complementary to the miRNA; and (3) qPCR amplification of segments of this multimeric cDNA using 5′-overlapping primers and a nonspecific dye such as SYBR Green. No chemically modified probes (e.g., TaqMan) or primers (e.g., LNA) are required. The circular RNA and multimeric cDNA templates provide unmatched flexibility in the positioning of primers, which may include straddling the boundaries between these repetitive miRNA sequences. miR-ID is based on new findings that are themselves of general interest, including reverse transcription of small RNA circles and the use of 5′-overlapping primers for detection of repetitive sequences by qPCR. PMID:21169480

  10. A DNA Barcoding Method to Discriminate between the Model Plant Brachypodium distachyon and Its Close Relatives B. stacei and B. hybridum (Poaceae)

    PubMed Central

    López-Alvarez, Diana; López-Herranz, Maria Luisa; Betekhtin, Alexander; Catalán, Pilar

    2012-01-01

    Background Brachypodium distachyon s. l. has been widely investigated across the world as a model plant for temperate cereals and biofuel grasses. However, this annual plant shows three cytotypes that have been recently recognized as three independent species, the diploids B. distachyon (2n = 10) and B. stacei (2n = 20) and their derived allotetraploid B. hybridum (2n = 30). Methodology/Principal Findings We propose a DNA barcoding approach that consists of a rapid, accurate and automatable species identification method using the standard DNA sequences of complementary plastid (trnLF) and nuclear (ITS, GI) loci. The highly homogenous but largely divergent B. distachyon and B. stacei diploids could be easily distinguished (100% identification success) using direct trnLF (2.4%), ITS (5.5%) or GI (3.8%) sequence divergence. By contrast, B. hybridum could only be unambiguously identified through the use of combined trnLF+ITS sequences (90% of identification success) or by cloned GI sequences (96.7%) that showed 5.4% (ITS) and 4% (GI) rate divergence between the two parental sequences found in the allopolyploid. Conclusion/Significance Our data provide an unbiased and effective barcode to differentiate these three closely-related species from one another. This procedure overcomes the taxonomic uncertainty generated from methods based on morphology or flow cytometry identifications that have resulted in some misclassifications of the model plant and its allies. Our study also demonstrates that the allotetraploid B. hybridum has resulted from bi-directional crosses of B. distachyon and B. stacei plants acting either as maternal or paternal parents. PMID:23240000

  11. Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

    2013-10-01

    We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate. Electronic supplementary information (ESI) available: Details on the synthesis, purification and characterisation of the DHLA-PEG600-N3, cyclooctyne-DNA, and QD-TBA20 conjugates as well as all supporting figures and tables. See DOI: 10.1039/c3nr02897f

  12. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    PubMed

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  13. Water-Soluble Conjugated Polymers: Self-Assembly and Biosensor Applications

    NASA Astrophysics Data System (ADS)

    Bazan, Guillermo

    2005-03-01

    Homogeneous assays can be designed which take advantage of the optical amplification of conjugated polymers and the self-assembly characteristic of aqueous polyelectrolytes. For example, a ssDNA sequence sensor comprises an aqueous solution containing a cationic water soluble conjugated polymer such as poly(9,9-bis(trimethylammonium)-hexyl)-fluorene phenylene) with a peptide nucleic acid (PNA) labeled with a dye (PNA-C*). Signal transduction is controlled by hybridization of the neutral PNA-C* probe and the negative ssDNA target, resulting in favorable electrostatic interactions between the hybrid complex and the cationic polymer. Distance requirements for Förster energy transfer are thus met only when ssDNA of complementary sequence to the PNA-C* probe is present. Signal amplification by the conjugated polymer provides fluorescein emission >25 times higher than that of the directly excited dye. Transduction by electrostatic interactions followed by energy transfer is a general strategy. Examples involving other biomolecular recognition events, such as DNA/DNA, RNA/protein and RNA/RNA, will also be provided. The mechanism of biosensing will be discussed, with special attention to the varying contributions of hydrophobic and electrostatic forces, polymer conformation, charge density, local concentration of C*s and tailored defect sites for aggregation-induced optical changes. Finally, the water solubility of these conjugated polymers opens possibilities for spin casting onto organic materials, without dissolving the underlying layers. This property is useful for fabricating multilayer organic optoelectronic devices by simple solution techniques.

  14. Studying epigenetic DNA modifications in undergraduate laboratories using complementary bioinformatic and molecular approaches.

    PubMed

    Militello, Kevin T

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines bioinformatic and molecular approaches to study the presence and abundance of 5-methylcytosine in different organisms. Students were originally provided with the protein sequence of the Xenopus laevis DNMT1 cytosine-5 DNA methyltransferase and used BLASTP searches to detect the presence of protein orthologs in the genomes of several organisms including Homo sapiens, Mus musculus, Plasmodium falciparum, Drosophila melanogaster, Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans. Students generated hypotheses regarding the presence and abundance of 5-methylcytosine in these organisms based on their bioinformatics data, and directly tested their predictions on a subset of DNAs using restriction enzyme isoschizomer assays. A southern blotting assay to answer the same question is also presented. In addition to exposure to the field of epigenetics, the strengths of the laboratory are students are able to make predictions using bioinformatic tools and quickly test them in the laboratory. In addition, students are exposed to two potential misinterpretations of bioinformatic search data. The laboratory is easily modified to incorporate outside research interests in epigenetics. © 2013 by The International Union of Biochemistry and Molecular Biology.

  15. Visualization of nucleic acids with synthetic exciton-controlled fluorescent oligonucleotide probes.

    PubMed

    Wang, Dan Ohtan; Okamoto, Akimitsu

    2015-01-01

    Engineered probes to adapt new photochemical properties upon recognition of target nucleic acids offer powerful tools to DNA and RNA visualization technologies. Herein, we describe a rapid and effective visualization method of nucleic acids in both fixed and living cells with hybridization-sensitive fluorescent oligonucleotide probes. These probes are efficiently quenched in an aqueous environment due to the homodimeric, excitonic interactions between fluorophores but become highly fluorescent upon hybridization to DNA or RNA with complementary sequences. The fast hybridization kinetics and quick fluorescence activation of the new probes allow applications to simplify the conventional fluorescent in situ hybridization protocols and reduce the amount of time to process the samples. Furthermore, hybridization-sensitive fluorescence emission of the probes allows monitoring dynamic behaviors of RNA in living cells.

  16. An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents

    PubMed Central

    Chang, Shy-Shin; Hsu, Hsung-Ling; Cheng, Ju-Chien; Tseng, Ching-Ping

    2011-01-01

    Background Bacterial DNA contamination in PCR reagents has been a long standing problem that hampers the adoption of broad-range PCR in clinical and applied microbiology, particularly in detection of low abundance bacteria. Although several DNA decontamination protocols have been reported, they all suffer from compromised PCR efficiency or detection limits. To date, no satisfactory solution has been found. Methodology/Principal Findings We herein describe a method that solves this long standing problem by employing a broad-range primer extension-PCR (PE-PCR) strategy that obviates the need for DNA decontamination. In this method, we first devise a fusion probe having a 3′-end complementary to the template bacterial sequence and a 5′-end non-bacterial tag sequence. We then hybridize the probes to template DNA, carry out primer extension and remove the excess probes using an optimized enzyme mix of Klenow DNA polymerase and exonuclease I. This strategy allows the templates to be distinguished from the PCR reagent contaminants and selectively amplified by PCR. To prove the concept, we spiked the PCR reagents with Staphylococcus aureus genomic DNA and applied PE-PCR to amplify template bacterial DNA. The spiking DNA neither interfered with template DNA amplification nor caused false positive of the reaction. Broad-range PE-PCR amplification of the 16S rRNA gene was also validated and minute quantities of template DNA (10–100 fg) were detectable without false positives. When adapting to real-time and high-resolution melting (HRM) analytical platforms, the unique melting profiles for the PE-PCR product can be used as the molecular fingerprints to further identify individual bacterial species. Conclusions/Significance Broad-range PE-PCR is simple, efficient, and completely obviates the need to decontaminate PCR reagents. When coupling with real-time and HRM analyses, it offers a new avenue for bacterial species identification with a limited source of bacterial DNA, making it suitable for use in clinical and applied microbiology laboratories. PMID:21637859

  17. Progress in ion torrent semiconductor chip based sequencing.

    PubMed

    Merriman, Barry; Rothberg, Jonathan M

    2012-12-01

    In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  19. New concepts of fluorescent probes for specific detection of DNA sequences: bis-modified oligonucleotides in excimer and exciplex detection.

    PubMed

    Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt

    2009-12-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  20. Structural insights into the cTAR DNA recognition by the HIV-1 nucleocapsid protein: role of sugar deoxyriboses in the binding polarity of NC

    PubMed Central

    Bazzi, Ali; Zargarian, Loussiné; Chaminade, Françoise; Boudier, Christian; De Rocquigny, Hughes; René, Brigitte; Mély, Yves; Fossé, Philippe; Mauffret, Olivier

    2011-01-01

    An essential step of the reverse transcription of the HIV-1 genome is the first strand transfer that requires the annealing of the TAR RNA hairpin to the cTAR DNA hairpin. HIV-1 nucleocapsid protein (NC) plays a crucial role by facilitating annealing of the complementary hairpins. Using nuclear magnetic resonance and gel retardation assays, we investigated the interaction between NC and the top half of the cTAR DNA (mini-cTAR). We show that NC(11-55) binds the TGG sequence in the lower stem that is destabilized by the adjacent internal loop. The 5′ thymine interacts with residues of the N-terminal zinc knuckle and the 3′ guanine is inserted in the hydrophobic plateau of the C-terminal zinc knuckle. The TGG sequence is preferred relative to the apical and internal loops containing unpaired guanines. Investigation of the DNA–protein contacts shows the major role of hydrophobic interactions involving nucleobases and deoxyribose sugars. A similar network of hydrophobic contacts is observed in the published NC:DNA complexes, whereas NC contacts ribose differently in NC:RNA complexes. We propose that the binding polarity of NC is related to these contacts that could be responsible for the preferential binding to single-stranded nucleic acids. PMID:21227929

Top