Fermi GBM: Highlights from the First Year
NASA Technical Reports Server (NTRS)
Wilson-Hodge, Colleen A.
2009-01-01
The Fermi Gamma ray Burst Monitor is an all-sky instrument sensitive to photons from about 8 keV to 40 MeV. I will summarize highlights from the first year, including triggered observations of gamma ray bursts, soft gamma ray repeaters, and terrestrial gamma flashes, and observations in the continuous data of X-ray binaries and accreting X-ray pulsars. GBM provides complementary observations to Swift/BAT, observing many of the same sources, but over a wider energy range.
NASA Technical Reports Server (NTRS)
Gubarev, M.; Ramsey, B.; ODell, S. L.; Elsner, R.; Kilaru, K.; McCracken, J.; Pavlinsky, M.; Tkachenko, A.; Lapshov, I.
2012-01-01
The Spectrum-Rontgen-Gamma (SRG) mission is a Russian-German X-ray astrophysical observatory that carries two co-aligned and complementary X-ray telescope systems. The primary instrument is the German-led extended ROentgen Survey with an Imaging Telescope Array (eROSITA), a 7-module X-ray telescope system that covers the energy range from 0.2-12 keV. The complementary instrument is the Russian-led Astronomical Roentgen Telescope -- X-ray Concentrator (ART-XC or ART), a 7-module X-ray telescope system that provides higher energy coverage, up to 30 keV (with limited sensitivity above 12 keV).
Cosmic rays, gamma rays and synchrotron radiation from the Galaxy
Orlando, Elena
2012-07-30
Galactic cosmic rays (CR), interstellar gamma-ray emission and synchrotron radiation are related topics. CR electrons propagate in the Galaxy and interact with the interstellar medium, producing inverse-Compton emission measured in gamma rays and synchrotron emission measured in radio. I present an overview of the latest results with Fermi/LAT on the gamma-ray diffuse emission induced by CR nuclei and electrons. Then I focus on the recent complementary studies of the synchrotron emission in the light of the latest gamma-ray results. Relevant observables include spectral indices and their variations, using surveys over a wide range of radio frequencies. As a result, thismore » paper emphasizes the importance of using the parallel study of gamma rays and synchrotron radiation in order to constrain the low-energy interstellar CR electron spectrum, models of propagation of CRs, and magnetic fields.« less
GLAST and Ground-Based Gamma-Ray Astronomy
NASA Technical Reports Server (NTRS)
McEnery, Julie
2008-01-01
The launch of the Gamma-ray Large Area Space Telescope together with the advent of a new generation of ground-based gamma-ray detectors such as VERITAS, HESS, MAGIC and CANGAROO, will usher in a new era of high-energy gamma-ray astrophysics. GLAST and the ground based gamma-ray observatories will provide highly complementary capabilities for spectral, temporal and spatial studies of high energy gamma-ray sources. Joint observations will cover a huge energy range, from 20 MeV to over 20 TeV. The LAT will survey the entire sky every three hours, allowing it both to perform uniform, long-term monitoring of variable sources and to detect flaring sources promptly. Both functions complement the high-sensitivity pointed observations provided by ground-based detectors. Finally, the large field of view of GLAST will allow a study of gamma-ray emission on large angular scales and identify interesting regions of the sky for deeper studies at higher energies. In this poster, we will discuss the science returns that might result from joint GLAST/ground-based gamma-ray observations and illustrate them with detailed source simulations.
BOOTES and GTC observations of cosmic gamma-ray bursts and their progenitors
NASA Astrophysics Data System (ADS)
Castro-Tirado, Alberto J.
2016-07-01
We will summarize the follow-up observations of gamma-ray bursts performed worldwide by the BOOTES Network of robotic telescopes (with some of the data being contemporaneous to the prompt emission) leading to the discovery of many afterglows. Complementary data has been also obtained by the 10.4m GTC telescope in La Palma (mainly spectroscopy), with one of them being the highest extinguished afterglow detected to date.
Development and Calibration of the ART-XC Mirror Modules for the Spectrum Rontgen Gamma Mission
NASA Technical Reports Server (NTRS)
Ramsey, B.; Gubarev, M.; Elsner, R.; Kolodziejczak, J.; Odell, S.; Swartz, D.; Pavlinsky, M.; Tkachenko, A.; Lapshov, I.
2013-01-01
The Spectrum-Röntgen-Gamma (SRG) mission is a Russian-lead X-ray astrophysical observatory that carries two co-aligned X-ray telescope systems. The primary instrument is the German-led extended ROentgen Survey with an Imaging Telescope Array (eROSITA), a 7-module X-ray telescope system that covers the energy range from 0.2-12 keV. The complementary instrument is the Astronomical Roentgen Telescope -- X-ray Concentrator (ART-XC or ART), a 7-module Xray telescope system that provides higher energy coverage, up to 30 keV.
NASA Astrophysics Data System (ADS)
Qi, L.; Wilson, J. N.; Lebois, M.; Al-Adili, A.; Chatillon, A.; Choudhury, D.; Gatera, A.; Georgiev, G.; Göök, A.; Laurent, B.; Maj, A.; Matea, I.; Oberstedt, A.; Oberstedt, S.; Rose, S. J.; Schmitt, C.; Wasilewska, B.; Zeiser, F.
2018-03-01
Prompt fission gamma-ray spectra (PFGS) have been measured for the 239Pu(n,f) reaction using fast neutrons at Ēn=1.81 MeV produced by the LICORNE directional neutron source. The setup makes use of LaBr3 scintillation detectors and PARIS phoswich detectors to measure the emitted prompt fission gamma rays (PFG). The mean multiplicity, average total energy release per fission and average energy of photons are extracted from the unfolded PFGS. These new measurements provide complementary information to other recent work on thermal neutron induced fission of 239Pu and spontaneous fission of 252Cf.
Ackermann, M.
2015-09-02
We search for evidence of dark matter (DM) annihilation in the isotropic gamma-ray background (IGRB) measured with 50 months of Fermi Large Area Telescope (LAT) observations. An improved theoretical description of the cosmological DM annihilation signal, based on two complementary techniques and assuming generic weakly interacting massive particle (WIMP) properties, renders more precise predictions compared to previous work. More specifically, we estimate the cosmologically-induced gamma-ray intensity to have an uncertainty of a factor ~ 20 in canonical setups. We consistently include both the Galactic and extragalactic signals under the same theoretical framework, and study the impact of the former onmore » the IGRB spectrum derivation. We find no evidence for a DM signal and we set limits on the DM-induced isotropic gamma-ray signal. Our limits are competitive for DM particle masses up to tens of TeV and, indeed, are the strongest limits derived from Fermi LAT data at TeV energies. This is possible thanks to the new Fermi LAT IGRB measurement, which now extends up to an energy of 820 GeV. As a result, we quantify uncertainties in detail and show the potential this type of search offers for testing the WIMP paradigm with a complementary and truly cosmological probe of DM particle signals.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collaboration: Fermi LAT Collaboration
2015-09-01
We search for evidence of dark matter (DM) annihilation in the isotropic gamma-ray background (IGRB) measured with 50 months of Fermi Large Area Telescope (LAT) observations. An improved theoretical description of the cosmological DM annihilation signal, based on two complementary techniques and assuming generic weakly interacting massive particle (WIMP) properties, renders more precise predictions compared to previous work. More specifically, we estimate the cosmologically-induced gamma-ray intensity to have an uncertainty of a factor ∼ 20 in canonical setups. We consistently include both the Galactic and extragalactic signals under the same theoretical framework, and study the impact of the former on themore » IGRB spectrum derivation. We find no evidence for a DM signal and we set limits on the DM-induced isotropic gamma-ray signal. Our limits are competitive for DM particle masses up to tens of TeV and, indeed, are the strongest limits derived from Fermi LAT data at TeV energies. This is possible thanks to the new Fermi LAT IGRB measurement, which now extends up to an energy of 820 GeV. We quantify uncertainties in detail and show the potential this type of search offers for testing the WIMP paradigm with a complementary and truly cosmological probe of DM particle signals.« less
Study of near-stability nuclei populated as fission fragments in heavy-ion fusion reactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fotiadis, Nikolaos; Nelson, Ronald O; Devlin, Matthew
2010-01-01
Examples are presented to illustrate the power of prompt {gamma}-ray spectroscopy of fission fragments from compound nuclei with A {approx} 200 formed in fusion-evaporation reactions in experiments using the Gammasphere Ge-detector array. Complementary methods, such as Coulomb excitation and deep-inelastic processes, are also discussed. In other cases (n, xn{gamma}) reactions on stable isotopes have been used to establish neutron excitation functions for {gamma}-rays using a pulsed 'white'-neutron source, coupled to a high-energy-resolution germanium-detector array. The excitation functions can unambiguously assign {gamma}-rays to a specific reaction product. Results from all these methods bridge the gaps in the systematics of high-spin statesmore » between the neutron-deficient and neutron-rich nuclei. Results near shell closures should motivate new shell model calculations.« less
Copper crystal lens for medical imaging: first results
NASA Astrophysics Data System (ADS)
Roa, Dante E.; Smither, Robert K.
2001-06-01
A copper crystal lens designed to focus gamma ray energies of 100 to 200 keV has been assembled at Argonne National Laboratory. In particular, the lens has been optimized to focus the 140.6 keV gamma rays from technetium-99 m typically used in radioactive tracers. This new approach to medical imaging relies on crystal diffraction to focus incoming gamma rays in a manner similar to a simple convex lens focusing visible light. The lens is envisioned to be part of an array of lenses that can be used as a complementary technique to gamma cameras for localized scans of suspected tumor regions in the body. In addition, a 2- lens array can be used to scan a woman's breast in search of tumors with no discomfort to the patient. The incoming gamma rays are diffracted by a set of 828 copper crystal cubes arranged in 13 concentric rings, which focus the gamma rays into a very small area on a well-shielded NaI detector. Experiments performance with technetium-99 m and cobalt 57 radioactive sources indicate that a 6-lens array should be capable of detecting sources with (mu) Ci strength.
Sizing up the population of gamma-ray binaries
NASA Astrophysics Data System (ADS)
Dubus, Guillaume; Guillard, Nicolas; Petrucci, Pierre-Olivier; Martin, Pierrick
2017-12-01
Context. Gamma-ray binaries are thought to be composed of a young pulsar in orbit around a massive O or Be star with their gamma-ray emission powered by pulsar spin-down. The number of such systems in our Galaxy is not known. Aims: We aim to estimate the total number of gamma-ray binaries in our Galaxy and to evaluate the prospects for new detections in the GeV and TeV energy range, taking into account that their gamma-ray emission is modulated on the orbital period. Methods: We modelled the population of gamma-ray binaries and evaluated the fraction of detected systems in surveys with the Fermi-LAT (GeV), H.E.S.S., HAWC and CTA (TeV) using observation-based and synthetic template light curves. Results: The detected fraction depends more on the orbit-average flux than on the light-curve shape. Our best estimate for the number of gamma-ray binaries is 101-52+89 systems. A handful of discoveries are expected by pursuing the Fermi-LAT survey. Discoveries in TeV surveys are less likely. However, this depends on the relative amounts of power emitted in GeV and TeV domains. There could be as many as ≈ 200 HESS J0632+057-like systems with a high ratio of TeV to GeV emission compared to other gamma-ray binaries. Statistics allow for as many as three discoveries in five years of HAWC observations and five discoveries in the first two years of the CTA Galactic Plane survey. Conclusions: We favour continued Fermi-LAT observations over ground-based TeV surveys to find new gamma-ray binaries. Gamma-ray observations are most sensitive to short orbital period systems with a high spin-down pulsar power. Radio pulsar surveys (SKA) are likely to be more efficient in detecting long orbital period systems, providing a complementary probe into the gamma-ray binary population.
NASA Technical Reports Server (NTRS)
Racusin, J. L.; Oates, S. R.; De Pasquale, M.; Kocevski, D.
2016-01-01
We present a correlation between the average temporal decay (alpha X,avg, greater than 200 s) and early-time luminosity (LX,200 s) of X-ray afterglows of gamma-ray bursts as observed by the Swift X-ray Telescope. Both quantities are measured relative to a rest-frame time of 200 s after the gamma-ray trigger. The luminosity â€" average decay correlation does not depend on specific temporal behavior and contains one scale-independent quantity minimizing the role of selection effects. This is a complementary correlation to that discovered by Oates et al. in the optical light curves observed by the Swift Ultraviolet Optical Telescope. The correlation indicates that, on average, more luminous X-ray afterglows decay faster than less luminous ones, indicating some relative mechanism for energy dissipation. The X-ray and optical correlations are entirely consistent once corrections are applied and contamination is removed. We explore the possible biases introduced by different light-curve morphologies and observational selection effects, and how either geometrical effects or intrinsic properties of the central engine and jet could explain the observed correlation.
Fast Neutron Detection Using Pixelated CdZnTe Spectrometers
NASA Astrophysics Data System (ADS)
Streicher, Michael; Goodman, David; Zhu, Yuefeng; Brown, Steven; Kiff, Scott; He, Zhong
2017-07-01
Fast neutrons are an important signature of special nuclear materials (SNMs). They have a low natural background rate and readily penetrate high atomic number materials that easily shield gamma-ray signatures. Therefore, they provide a complementary signal to gamma rays for detecting shielded SNM. Scattering kinematics dictate that a large nucleus (such as Cd or Te) will recoil with small kinetic energy after an elastic collision with a fast neutron. Charge carrier recombination and quenching further reduce the recorded energy deposited. Thus, the energy threshold of CdZnTe detectors must be very low in order to sense the small signals from these recoils. In this paper, the threshold was reduced to less than 5 keVee to demonstrate that the 5.9-keV X-ray line from 55Fe could be separated from electronic noise. Elastic scattering neutron interactions were observed as small energy depositions (less than 20 keVee) using digitally sampled pulse waveforms from pixelated CdZnTe detectors. Characteristic gamma-ray lines from inelastic neutron scattering were also observed.
A population of gamma-ray emitting globular clusters seen with the Fermi Large Area Telescope
Abdo, A. A.
2010-11-24
Context. Globular clusters with their large populations of millisecond pulsars (MSPs) are believed to be potential emitters of high-energy gamma-ray emission. The observation of this emission provides a powerful tool to assess the millisecond pulsar population of a cluster, is essential for understanding the importance of binary systems for the evolution of globular clusters, and provides complementary insights into magnetospheric emission processes. Aims. Our goal is to constrain the millisecond pulsar populations in globular clusters from analysis of gamma-ray observations. Methods. We use 546 days of continuous sky-survey observations obtained with the Large Area Telescope aboard the Fermi Gamma-ray Spacemore » Telescope to study the gamma-ray emission towards 13 globular clusters. Results. Steady point-like high-energy gamma-ray emission has been significantly detected towards 8 globular clusters. Five of them (47 Tucanae, Omega Cen, NGC 6388, Terzan 5, and M 28) show hard spectral power indices (0.7 < Γ < 1.4) and clear evidence for an exponential cut-off in the range 1.0 - 2.6 GeV, which is the characteristic signature of magnetospheric emission from MSPs. Three of them (M 62, NGC 6440 and NGC 6652) also show hard spectral indices (1.0 < Γ < 1.7), however the presence of an exponential cut-off can not be unambiguously established. Three of them (Omega Cen, NGC 6388, NGC 6652) have no known radio or X-ray MSPs yet still exhibit MSP spectral properties. From the observed gamma-ray luminosities, we estimate the total number of MSPs that is expected to be present in these globular clusters. We show that our estimates of the MSP population correlate with the stellar encounter rate and we estimate 2600 - 4700 MSPs in Galactic globular clusters, commensurate with previous estimates. Conclusions. The observation of high-energy gamma-ray emission from globular clusters thus provides a reliable independent method to assess their millisecond pulsar populations.« less
Study of fission fragment de-excitation by gamma-ray spectrometry with the EXILL experiment
NASA Astrophysics Data System (ADS)
Materna, Thomas; a, Michal Rapał; Letourneau, Alain; Marchix, Anthony; Litaize, Olivier; Sérot, Olivier; Urban, Waldemar; Blanc, Aurélien; Jentschel, Michael; Köster, Ulli; Mutti, Paolo; Soldner, Torsten; Simpson, Gary; Ur, Călin A.; France, Gilles de
2017-09-01
A large array of Ge detectors installed at ILL, around a 235U target irradiated with cold neutrons, (EXILL) allowed measurement of prompt gamma-ray cascades occurring in fission fragments with an unambiguous determination of fragments. Here we present preliminary results of a systematic comparison between experimental γ-ray intensities and those obtained from the Monte-Carlo simulation code FIFRELIN, which is dedicated to the de-excitation of fission fragments. Major γ-ray intensities in the 142Ba and 92Kr fission products, extracted from EXILL data, were compared to FIFRELIN, as well as to reported values (when available) obtained with EUROGAM2 in the spontaneous fission of 248Cm. The evolution of γ-ray intensities in 92Kr versus the complementary partner in fission (i.e. versus the total number of evaporated neutrons by the fission pair) was then extracted and compared to FIFRELIN.
Observing the Non-Thermal Universe with the Highest Energy Photons
NASA Astrophysics Data System (ADS)
Dingus, Brenda L.; HAWC, VERITAS, CTA
2016-01-01
Astrophysical sources of relativistic particles radiate gamma rays to such high energies that they can be detected from the ground. The existence of high energy gamma rays implies that even higher energy particles are being accelerated placing strong constraints on these non-thermal accelerators. Within our galaxy, TeV gamma rays have been detected from supernova remnants, pulsar wind nebula, x-ray binaries and some yet to be identified sources in the Galactic plane. In addition, these gamma rays have sufficient energy to be attenuated by the interaction with infrared photons producing an electron-positron pair. Thus the spectrum of gamma rays can also constrain the infrared photon density, which for distant extragalactic sources is a direct probe of cosmology. The known extragalactic TeV sources are primarily the blazer class of active galactic nuclei. And TeV gamma rays might even be produced by annihilating dark matter.The US currently supports two ground-based gamma-ray observatories—HAWC and VERITAS—and NSF is developing a prototype for the international Cherenkov Telescope Array (CTA) observatory. The HAWC (High Altitude Water Cherenkov) observatory just began operation of the full detector in March 2015 and with its wide field of view scans ~2/3 of the sky each day for TeV sources. VERITAS (Very EneRgetic Imaging Telescope Array System) is an array of four imaging atmospheric Cherenkov telescopes that follows individual sources to produce lightcurves and spectra from 85 GeV to > 30 TeV. The combination of both a survey and pointed observatory is very complementary with a broad scientific reach that includes the study of extragalactic and Galactic objects as well as the search for astrophysical signatures of dark matter and the measurement of cosmic rays. I will present the current view of the TeV sky and the latest results from HAWC and VERITAS as well as plans for CTA.
Fast Neutron Detection using Pixelated CdZnTe Spectrometers
Streicher, Michael; Goodman, David; Zhu, Yuefeng; ...
2017-05-29
One important important signature of special nuclear materials (SNM) are fast neutrons. Fast neutrons have a low natural background rate and readily penetrate high atomic number materials which easily shield gamma-ray signatures. Thus, fast neutrons provide a complementary signal to gamma rays for detecting shielded SNM. Scattering kinematics dictate that a large nucleus (such as Cd or Te) will recoil with small kinetic energy after an elastic collision with a fast neutron. Charge carrier recombination and quenching further reduce the recorded energy deposited. Thus, the energy threshold of CdZnTe detectors must be very low in order to sense the smallmore » signals from these recoils. Here, the threshold was reduced to less than 5 keVee to demonstrate that the 5.9 keV x-ray line from 55Fe could be separated from electronic noise. Elastic scattering neutron interactions were observed as small energy depositions (less than 20 keVee) using digitally-sampled pulse waveforms from pixelated CdZnTe detectors. Characteristic gamma-ray lines from inelastic neutron scattering were also observed.« less
Gamma-ray Monitoring of Active Galactic Nuclei with HAWC
NASA Astrophysics Data System (ADS)
Lauer, Robert; HAWC Collaboration
2016-03-01
Active Galactic Nuclei (AGN) are extra-galactic sources that can exhibit extreme flux variability over a wide range of wavelengths. TeV gamma rays have been observed from about 60 AGN and can help to diagnose emission models and to study cosmic features like extra-galactic background light or inter-galactic magnetic fields. The High Altitude Water Cherenkov (HAWC) observatory is a new extensive air shower array that can complement the pointed TeV observations of imaging air Cherenkov telescopes. HAWC is optimized for studying gamma rays with energies between 100 GeV and 100 TeV and has an instantaneous field of view of ~2 sr and a duty cycle >95% that allow us to scan 2/3 of the sky every day. By performing an unbiased monitoring of TeV emissions of AGN over most of the northern and part of the southern sky, HAWC can provide crucial information and trigger follow-up observations in collaborations with pointed TeV instruments. Furthermore, HAWC coverage of AGN is complementary to that provided by the Fermi satellite at lower energies. In this contribution, we will present HAWC flux light curves of TeV gamma rays from various sources, notably the bright AGN Markarian 421 and Markarian 501, and highlight recent results from multi-wavelengths and multi-instrument studies.
Gamma-ray detectors for breast imaging
NASA Astrophysics Data System (ADS)
Williams, Mark B.; Goode, Allen R.; Majewski, Stan; Steinbach, Daniela; Weisenberger, Andrew G.; Wojcik, Randolph F.; Farzanpay, Farzin
1997-07-01
Breast cancer is the most common cancer of American women and is the leading cause of cancer-related death among women aged 15 - 54; however recent years have shown that early detection using x-ray mammography can lead to a high probability of cure. However, because of mammography's low positive predictive value, surgical or core biopsy is typically required for diagnosis. In addition, the low radiographic contrast of many nonpalpable breast masses, particularly among women with radiographically dense breasts, results in an overall rate of 10% to 25% for missed tumors. Nuclear imaging of the breast using single gamma emitters (scintimammography) such as (superscript 99m)Tc, or positron emitters such as F-18- fluorodeoxyglucose (FDG) for positron emission tomography (PET), can provide information on functional or metabolic tumor activity that is complementary to the structural information of x-ray mammography, thereby potentially reducing the number of unnecessary biopsies and missed cancers. This paper summarizes recent data on the efficacy of scintimammography using conventional gamma cameras, and describes the development of dedicated detectors for gamma emission breast imaging. The detectors use new, high density crystal scintillators and large area position sensitive photomultiplier tubes (PSPMTs). Detector design, imaging requirements, and preliminary measured imaging performance are discussed.
NASA Technical Reports Server (NTRS)
Livingston, R. A.; Schweitzer, J. S.; Parsons, Ann M.; Arens, Ellen E.
2010-01-01
The liquid hydrogen and oxygen cryogenic storage tanks at John F. Kennedy Space Center (KSC) use expanded perlite as thermal insulation. Th ere is evidence that some of the perlite has compacted over time, com promising the thermal performance and possibly also structural integr ity of the tanks. Therefore an Non-destructive Testing (NDT) method for measuring the perlite density or void fraction is urgently needed. Methods based on neutrons are good candidates because they can readil y penetrate through the 1.75 cm outer steel shell and through the ent ire 120 cm thickness of the perlite zone. Neutrons interact with the nuclei of materials to produce characteristic gamma rays which are the n detected. The gamma ray signal strength is proportional to the atom ic number density. Consequently, if the perlite is compacted then the count rates in the individual peaks in the gamma ray spectrum will i ncrease. Perlite is a feldspathic volcanic rock made up of the major elements Si, AI, Na, K and 0 along with some water. With commercially available portable neutron generators it is possible to produce simul taneously fluxes of neutrons in two energy ranges: fast (14 MeV) and thermal (25 meV). Fast neutrons produce gamma rays by inelastic scatt ering which is sensitive to Fe and O. Thermal neutrons produce gamma rays by radiative capture in prompt gamma neutron activation (PGNA) and this is sensitive to Si, AI, Na, Kand H. Thus the two energy ranges produce complementary information. The R&D program has three phases: numerical simulations of neutron and gamma ray transport with MCNP s oftware, evaluation of the system in the laboratory on test articles and finally mapping of the perlite density in the cryogenic tanks at KSC. The preliminary MCNP calculations have shown that the fast/therma l neutron NDT method is capable of distinguishing between expanded an d compacted perlite with excellent statistics.
Monopole, astrophysics and cosmic ray observatory at Gran Sasso
NASA Technical Reports Server (NTRS)
Demarzo, C.; Enriquez, O.; Giglietto, N.; Posa, F.; Attolini, M.; Baldetti, F.; Giacomelli, G.; Grianti, F.; Margiotta, A.; Serra, P.
1985-01-01
A new large area detector, MACRO was approved for installation at the Gran Sasso Laboratory in Italy. The detector will be dedicated to the study of naturally penetrating radiation deep underground. It is designed with the general philosophy of covering the largest possible area with a detector having both sufficient built-in redundancy and use of complementary techniques to study very rare phenomena. The detector capabilities will include monopole investigations significantly below the Parker bound; astrophysics studies of very high energy gamma ray and neutrino point sources; cosmic ray measurements of single and multimuons; and the general observation of rare new forms of matter in the cosmic rays.
Neutralino dark matter and the Fermi gamma-ray lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chalons, Guillaume; Dolan, Matthew J.; McCabe, Christopher, E-mail: guillaume.chalons@kit.edu, E-mail: m.j.dolan@durham.ac.uk, E-mail: christopher.mccabe@durham.ac.uk
2013-02-01
Motivated by recent claims of lines in the Fermi gamma-ray spectrum, we critically examine means of enhancing neutralino annihilation into neutral gauge bosons. The signal can be boosted while remaining consistent with continuum photon constraints if a new singlet-like pseudoscalar is present. We consider singlet extensions of the MSSM, focusing on the NMSSM, where a 'well-tempered' neutralino can explain the lines while remaining consistent with current constraints. We adopt a complementary numerical and analytic approach throughout in order to gain intuition for the underlying physics. The scenario requires a rich spectrum of light neutralinos and charginos leading to characteristic phenomenologicalmore » signatures at the LHC whose properties we explore. Future direct detection prospects are excellent, with sizeable spin-dependent and spin-independent cross-sections.« less
Global Distribution of Shallow Water on Mars: Neutron Mapping of Summer-Time Surface by HEND/Odyssey
NASA Technical Reports Server (NTRS)
Mitrofanov, I. G.; Litvak, M. L.; Kozyrev, A. S.; Sanin, A. B.; Tretyakov, V. I.; Boynton, W.; Hamara, D.; Shinohara, C.; Saunders, R. S.; Drake, D.
2003-01-01
Orbital mapping of induced neutrons and gamma-rays by Odyssey has recently successfully proven the applicability of nuclear methods for studying of the elementary composition of Martian upper-most subsurface. In particular, the suite of Gamma-Ray Spectrometer (GRS) has discovered the presence of large water-ice rich regions southward and northward on Mars. The data of neutron mapping of summer-time surface are presented below from the Russian High Energy Neutron Spectrometer (HEND), which is a part of GRS suite. These maps represent the content of water in the soil for summer season at Southern and Northern hemispheres, when the winter deposit of CO2 is absent on the surface. The seasonal evolution of CO2 coverage on Mars is the subject of the complementary paper.
Probing Millisecond Pulsar Emission Geometry Using Light Curves From the Fermi Large Area Telescope
NASA Technical Reports Server (NTRS)
Venter, Christo; Harding, Alice; Guillemot, L.
2009-01-01
An interesting new high-energy pulsar sub-population is emerging following early discoveries of gamma-ray millisecond pulsars (MSPs) by the Fermi Large Area Telescope (LAT). We present results from 3D emission modeling, including the Special Relativistic effects of aberration and time-of-flight delays and also rotational sweepback of 13-field lines, in the geometric context of polar cap (PC), slot gap (SG), outer gap (OG), and two-pole caustic (TPC) pulsar models. In contrast to the general belief that these very old, rapidly-rotating neutron stars (NSs) should have largely pair-starved magnetospheres due to the absence of significant pair production, we find that most of the light curves are best fit by SG and OG models, which indicates the presence of narrow accelerating gaps limited by robust pair production -- even in these pulsars with very low spin-down luminosities. The gamma-ray pulse shapes and relative phase lags with respect to the radio pulses point to high-altitude emission being dominant for all geometries. We also find exclusive differentiation of the current gamma-ray MSP population into two MSP sub-classes: light curve shapes and lags across wavebands impose either pair-starved PC (PSPC) or SG / OG-type geometries. In the first case, the radio pulse has a small lag with respect to the single gamma-ray pulse, while the (first) gamma-ray peak usually trails the radio by a large phase offset in the latter case. Finally, we find that the flux correction factor as a function of magnetic inclination and observer angles is typically of order unity for all models. Our calculation of light curves and flux correction factor f(_, _, P) for the case of MSPs is therefore complementary to the "ATLAS paper" of Watters et al. for younger pulsars.
Separating astrophysical sources from indirect dark matter signals
Siegal-Gaskins, Jennifer M.
2015-01-01
Indirect searches for products of dark matter annihilation and decay face the challenge of identifying an uncertain and subdominant signal in the presence of uncertain backgrounds. Two valuable approaches to this problem are (i) using analysis methods which take advantage of different features in the energy spectrum and angular distribution of the signal and backgrounds and (ii) more accurately characterizing backgrounds, which allows for more robust identification of possible signals. These two approaches are complementary and can be significantly strengthened when used together. I review the status of indirect searches with gamma rays using two promising targets, the Inner Galaxy and the isotropic gamma-ray background. For both targets, uncertainties in the properties of backgrounds are a major limitation to the sensitivity of indirect searches. I then highlight approaches which can enhance the sensitivity of indirect searches using these targets. PMID:25304638
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bredeweg, T. A.; Fowler, M. M.; Bond, E. M.
2006-03-13
Neutron capture cross section measurements on many of the actinides are complicated by low-energy neutron-induced fission, which competes with neutron capture to varying degrees depending on the nuclide of interest. Measurements of neutron capture on 235U using the Detector for Advanced Neutron Capture Experiments (DANCE) have shown that we can partially resolve capture from fission events based on total photon calorimetry (i.e. total {gamma}-ray energy and {gamma}-ray multiplicity per event). The addition of a fission-tagging detector to the DANCE array will greatly improve our ability to separate these two competing processes so that improved neutron capture and (n,{gamma})/(n,fission) cross sectionmore » ratio measurements can be obtained. The addition of a fission-tagging detector to the DANCE array will also provide a means to study several important issues associated with neutron-induced fission, including (n,fission) cross sections as a function of incident neutron energy, and total energy and multiplicity of prompt fission photons. We have focused on two detector designs with complementary capabilities, a parallel-plate avalanche counter and an array of solar cells.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Nonthermal processes around collapsed objects: High energy gamma ray sources in the radio sky
NASA Technical Reports Server (NTRS)
Helfand, David J.; Ruderman, Malvin; Applegate, James H.; Becker, Robert H.
1993-01-01
In our proposal responding to the initial Guest Observer NRA for the Compton Gamma Ray Observatory, 'Nonthermal Processes Around Collapsed Objects: High Energy Gamma Ray Sources in the Radio Sky', we stated that 'At high energies - the identity of the principal Galactic source population remains unknown' although the 'one certain source of high energy emission is young radio pulsars'. These two statements remain true, although at this writing, eighteen months after the beginning of the Compton allsky survey, much of the gamma-ray data required to greatly extend our knowledge of the Galaxy's high energy emission has been collected. The thrust of the program supported by our grant was to collect and analyze a complementary set of data on the Milky Way at radio wavelengths in order to help identify the dominant Pop 1 component of the Galaxy's gamma ray sources, and to pursue theoretical investigations on the origins and emission mechanisms of young pulsars, the one component of this population identified to date. We summarize here our accomplishments under the grant. In Section 2, we describe our VLA surveys of the Galactic Plane along with the current status of the radio source catalogs derived therefrom; unfortunately, owing to the TDRSS antenna problem and subsequent extension of the Sky Survey, we were not able to carry out a comparison with the EGRET data directly, although everything is now in place to do so as soon as it becomes available. In Section 2, we summarize our progress on the theoretical side, including the substantial completion of a dissertation on pulsar origins and work on the high energy emission mechanisms of isolated pulsars. We list the personnel supported by the grant in section 4 and provide a complete bibliography of publications supported in whole or in part by the grant in the final section.
Geochemistry at 4 Vesta: Observations Using Fast Neutrons
NASA Technical Reports Server (NTRS)
Lawrence, David J.; Prettyman, Thomas H.; Feldman, William C.; Bazell, David; Mittlefehldt, David W.; Peplowski, Patrick N.; Reedy, Robert C.
2012-01-01
Dawn is currently in orbit around the asteroid 4 Vesta, and one of the major objectives of the mission is to probe the relationship of Vesta to the Howardite, Eucrite, and Diogenite (HED) meteorites. As Vesta is an example of a differentiated planetary embryo, Dawn will also provide fundamental information about planetary evolution in the early solar system [1]. To help accomplish this overall goal, the Dawn spacecraft carries the Gamma-Ray and Neutron Detector (GRaND). GRaND uses planetary gamma-ray and neutron spectroscopy to measure the surface elemental composition of Vesta and will provide information that is unique and complementary to that provided by the other Dawn instruments and investigations. Gamma-ray and neutron spectroscopy is a standard technique for measuring planetary compositions [2], having successfully made measurements at near-Earth asteroids, the Moon, Mars, Mercury and now Vesta. GRaND has made the first measurements of the neutron spectrum from any asteroid (previous asteroid measurements were only made with gamma-rays). Dawn has been collecting data at Vesta since July 2011. The prime data collection period for GRaND is the Low-Altitude Mapping Orbit (LAMO), which started on 12 December 2011 and will last through spring 2012. During LAMO, the Dawn spacecraft orbits at an average altitude of 210 km above the surface of Vesta, which allows good neutron and gamma-ray signals to be detected from Vesta. A description of the overall goals of GRaND and a summary of the initial findings are given elsewhere [3,4]. The subject of this study is to present the information that will be returned from GRaND using fast neutron measurements. Here, we discuss what fast neutrons can reveal about Vesta s surface composition, how such data can address Dawn science goals, and describe fast neutron measurements made in the early portion of the Vesta LAMO phase.
NASA Technical Reports Server (NTRS)
Livingston, R. A.; Schweitzer, J. S.; Parsons, A. M.; Arens, E. E.
2010-01-01
MCNP simulations have been run to evaluate the feasibility of using a combination of fast and thermal neutrons as a nondestructive method to measure of the compaction of the perlite insulation in the liquid hydrogen and oxygen cryogenic storage tanks at John F. Kennedy Space Center (KSC). Perlite is a feldspathic volcanic rock made up of the major elements Si, AI, Na, K and 0 along with some water. When heated it expands from four to twenty times its original volume which makes it very useful for thermal insulation. The cryogenic tanks at Kennedy Space Center are spherical with outer diameters of 69-70 feet and lined with a layer of expanded perlite with thicknesses on the order of 120 cm. There is evidence that some of the perlite has compacted over time since the tanks were built 1965, affecting the thermal properties and possibly also the structural integrity of the tanks. With commercially available portable neutron generators it is possible to produce simultaneously fluxes of neutrons in two energy ranges: fast (14 Me V) and thermal (25 me V). The two energy ranges produce complementary information. Fast neutrons produce gamma rays by inelastic scattering, which is sensitive to Fe and O. Thermal neutrons produce gamma rays by prompt gamma neutron activation (PGNA) and this is sensitive to Si, Al, Na, K and H. The compaction of the perlite can be measured by the change in gamma ray signal strength which is proportional to the atomic number densities of the constituent elements. The MCNP simulations were made to determine the magnitude of this change. The tank wall was approximated by a I-dimensional slab geometry with an 11/16" outer carbon steel wall, an inner stainless wall and 120 cm thick perlite zone. Runs were made for cases with expanded perlite, compacted perlite or with various void fractions. Runs were also made to simulate the effect of adding a moderator. Tallies were made for decay-time analysis from t=0 to 10 ms; total detected gamma-rays; detected gamma-rays from thermal neutron reactions d. detected gamma-rays from non-thermal neutron reactions and total detected gamma-rays as a function of depth into the annulus volume. These indicated a number of possible independent metrics of perlite compaction. For example the count rate for perlite elements increased from 3600 to 8500 cps for an increase in perlite density from 6 lbs/lcf to 16.5 lbs/cf. Thus the MCNP simulations have confirmed the feasibility of using neutron methods to map the compaction of perlite in the walls of the cryogenic tanks.
Multi-Messenger Astronomy and Dark Matter
NASA Astrophysics Data System (ADS)
Bergström, Lars
This chapter presents the elaborated lecture notes on Multi-Messenger Astronomy and Dark Matter given by Lars Bergström at the 40th Saas-Fee Advanced Course on "Astrophysics at Very High Energies". One of the main problems of astrophysics and astro-particle physics is that the nature of dark matter remains unsolved. There are basically three complementary approaches to try to solve this problem. One is the detection of new particles with accelerators, the second is the observation of various types of messengers from radio waves to gamma-ray photons and neutrinos, and the third is the use of ingenious experiments for direct detection of dark matter particles. After giving an introduction to the particle universe, the author discusses the relic density of particles, basic cross sections for neutrinos and gamma-rays, supersymmetric dark matter, detection methods for neutralino dark matter, particular dark matter candidates, the status of dark matter detection, a detailled calculation on an hypothetical "Saas-Fee Wimp", primordial black holes, and gravitational waves.
NASA Astrophysics Data System (ADS)
Kim, Kyungmin; Harry, Ian W.; Hodge, Kari A.; Kim, Young-Min; Lee, Chang-Hwan; Lee, Hyun Kyu; Oh, John J.; Oh, Sang Hoon; Son, Edwin J.
2015-12-01
We apply a machine learning algorithm, the artificial neural network, to the search for gravitational-wave signals associated with short gamma-ray bursts (GRBs). The multi-dimensional samples consisting of data corresponding to the statistical and physical quantities from the coherent search pipeline are fed into the artificial neural network to distinguish simulated gravitational-wave signals from background noise artifacts. Our result shows that the data classification efficiency at a fixed false alarm probability (FAP) is improved by the artificial neural network in comparison to the conventional detection statistic. Specifically, the distance at 50% detection probability at a fixed false positive rate is increased about 8%-14% for the considered waveform models. We also evaluate a few seconds of the gravitational-wave data segment using the trained networks and obtain the FAP. We suggest that the artificial neural network can be a complementary method to the conventional detection statistic for identifying gravitational-wave signals related to the short GRBs.
Integral -tracking extreme radiation across the Universe
NASA Astrophysics Data System (ADS)
2002-10-01
Gamma rays are released by the most violent events in the Universe. Unlike the serene beauty of the stars that we can see with our own eyes, the gamma-ray Universe is a place of wild explosions, cosmic collisions, and matter being sucked into black holes or trapped in super-strong magnetic fields. So far, astronomers have only had glimpses of this violence; Integral will bring it into sharp focus. Exploring the turbulent Universe Gamma rays carry large quantities of energy away from the violent events where they are created, such as supernova explosions, black holes, and the mysterious gamma-ray bursts. Integral will find a lot more out about these powerful gamma-ray sources. Very massive stars end their lives in big explosions called supernovae. These outbursts liberate more energy than the combined light of millions upon millions of stars, much of it in the form of gamma rays. New chemical elements are created as results of such explosions. In fact, all atoms heavier than iron are created due to such explosions. For this reason, we call supernovae the chemical factories” of the Universe. However, we do not know completely how new atoms are created when a star explodes. Integral will look into it as one of its first scientific objectives. After the explosion, each supernova leaves behind a dead 'heart'. This heart is incredibly dense and can be either a neutron star or a black hole. Both can generate gamma rays because they possess incredibly strong gravitational fields that can capture passing dust, gas and, possibly, larger celestial objects. When matter falls through a gravitational field, it heats up and releases energy. In the case of neutron stars and black holes, the energy released is very intense and is given off in the form of x-rays and gamma rays. As well as black holes from supernovae, called stellar black holes, the Universe contains a variety of far more massive black holes that are found at the core of some galaxies, the galactic black holes. Galactic black holes also give off gamma rays, and with such awesome power that you can detect them almost halfway across the known Universe. As well as making the most accurate studies of these objects to date, Integral will also investigate the mysterious blasts of gamma rays that explode across the Universe about once a day, the gamma-ray bursts. They can last just a few seconds and can come from any direction in space. The origin of gamma-ray bursts has remained unexplained for years, from their first observation in the late 1960s. Today, many scientists think that gamma ray bursts could be linked to the death throes of the very first stars. Alternatively, they could be generated by colliding neutron stars, or could be caused by the explosion of supermassive stars at the end of their lives, the hypernovae. Integral's instruments will study gamma-ray bursts with the highest accuracy ever and may discover something about their origins. Integral’s instruments Integral has four instruments to give the spacecraft maximum versatility in its task of studying the gamma-ray Universe. Designed to complement each other, their combined observations will allow scientists to get a very complete and accurate picture of each celestial target at different wavelengths. The first two are dedicated gamma-ray instruments. Imager on Board the Integral Satellite (IBIS) is the sharpest-resolution gamma-ray camera ever built. Spectrometer on Integral (SPI) will measure the energy of gamma rays with exceptional accuracy. In particular, it will be more sensitive to fainter radiation than any previous gamma-ray spectrometer. The other two instruments are designed to provide complementary scientific data about Integral’s targets. The Joint European X-Ray Monitor (JEM-X) will make observations simultaneously with the main gamma-ray instruments and will provide images at X-ray wavelengths. The Optical Monitoring Camera (OMC) will do the same but at visible-light wavelengths. The total weight of the four instruments is about 2 tonnes, roughly half the launch weight of Integral. Integral's orbit and operations After launch, Integral will follow an elliptical orbit that is inclined by 51.6° to the Earth’s equator. In this orbit, it will cycle between 9000 kilometres and 153 000 kilometres above Earth, completing one revolution of the Earth every 72 hours. This eccentric orbit is necessary because there are ‘radiation belts’ that surround the Earth and these would interfere with Integral’s ability to see gamma rays. It is important for Integral to be outside these belts. Its elliptical orbit is designed to keep it outside the radiation belts for 90% of its trajectory around Earth. Once Integral is in orbit, it must communicate with Earth to download its scientific data and to receive commands. Communicating with and controlling Integral is a task spread over a number of different sites. Firstly, astronomers submit proposals for observations to the Integral Science Operations Centre (ISOC) at Noordwijk, The Netherlands. Experts at ISOC evaluate the proposals and draw up a list of targets and detailed observation schedules for Integral. The schedules are sent to the Mission Operations Centre (MOC) at the European Space Operations Centre (ESOC) in Darmstadt, Germany. There everything is transformed into commands that Integral will understand. Signals to and from Integral go through two tracking stations, one at Redu in Belgium, the second at Goldstone in California, United States. The MOC also ensures the correct performance of the spacecraft. After Integral has collected observations, the raw science data is forwarded to the Integral Science Data Centre (ISDC) in Versoix near Geneva, Switzerland. There it is converted into usable data files, archived, and distributed to the astronomical community. A worldwide network of space science institutes and observatories will receive the data very quickly. This is essential especially when sudden and short-lasting phenomena such as gamma-ray bursts occur. In this case, all observatories need to receive the information within one minute to be able to point their telescopes immediately at the area of the sky where the gamma-ray burst has been detected. Building Integral Integral was selected as a mission by ESA in June 1993. The prime contractor for the spacecraft was Alenia Aerospazio, Turin, Italy. Alenia involved 26 subcontracting companies from 12 European countries to build the spacecraft’s service module. This provides the essentials for the spacecraft such as power (via solar panels), satellite control, and the communications link to the ground. Alenia was also responsible for integrating the four science instruments on-board the spacecraft, known collectively as the payload module. Four consortia of academic and industrial partners, variously located throughout Europe, built the instruments. Integral has faced many technological challenges. However, the greatest was finding a way to focus gamma rays, which are so powerful they pass through ordinary mirrors. To overcome this, Integral’s gamma-ray instruments and its X-ray monitor use a technique called coded-mask imaging. Instead of focusing, the coded mask blocks some gamma rays, creating a recognisable shadow on the detector beneath. Ground computer systems process the data coming from the gamma-ray detector looking for this shadow. Once it finds the shadow pattern, it groups the gamma rays together, forming an image. Gamma rays from different astronomical objects enter the instruments at different angles and so cast different shadows, allowing gamma rays from multiple sources to be separated. Integral has been developed and built at a cost of 330 million Euros. This price does not include the cost of launch, which Russia is providing free in exchange for observing time on Integral. Neither does the cost include the price of the science instruments, which have been provided by academic and industrial consortia. To reduce costs, the design for the service module was reused from ESA’s XMM-Newton satellite. Note to editors: historical perspective on gamma-ray astronomy Scientists have placed small gamma-ray detectors on satellites since the early 1960s. However, the most extraordinary discovery came in the late 1960s from a series of military satellites designed to monitor the ban on nuclear bombs being tested on Earth. These satellites detected the appropriately named gamma-ray bursts, which explode without warning about once a day, from random directions in the sky. In 1972, the NASA probe SAS-2 confirmed that the Universe is bathed in a perpetual shower of gamma rays. In 1975, ESA launched the gamma-ray satellite COS-B, that worked until being switched off in 1982. COS-B produced the first map of the gamma-ray sky and identified a number of bright gamma ray sources. It was followed by the Russian-French mission GRANAT, in 1989-1998, and NASA’s Compton Gamma-ray Observatory (CGRO), in 1991-2000. The CGRO satellite greatly increased our understanding of gamma-ray astronomy. Soon we can expect Integral to dazzle the world with the next leap in technology.
Multi-particle inspection using associated particle sources
Bingham, Philip R.; Mihalczo, John T.; Mullens, James A.; McConchie, Seth M.; Hausladen, Paul A.
2016-02-16
Disclosed herein are representative embodiments of methods, apparatus, and systems for performing combined neutron and gamma ray radiography. For example, one exemplary system comprises: a neutron source; a set of alpha particle detectors configured to detect alpha particles associated with neutrons generated by the neutron source; neutron detectors positioned to detect at least some of the neutrons generated by the neutron source; a gamma ray source; a set of verification gamma ray detectors configured to detect verification gamma rays associated with gamma rays generated by the gamma ray source; a set of gamma ray detectors configured to detect gamma rays generated by the gamma ray source; and an interrogation region located between the neutron source, the gamma ray source, the neutron detectors, and the gamma ray detectors.
Effects of Correlated and Uncorrelated Gamma Rays on Neutron Multiplicity Counting
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cowles, Christian C.; Behling, Richard S.; Imel, George R.
Neutron multiplicity counting relies on time correlation between neutron events to assay the fissile mass, (α,n) to spontaneous fission neutron ratio, and neutron self-multiplication of samples. Gamma-ray sensitive neutron multiplicity counters may misidentify gamma rays as neutrons and therefore miscalculate sample characteristics. Time correlated and uncorrelated gamma-ray-like signals were added into gamma-ray free neutron multiplicity counter data to examine the effects of gamma ray signals being misidentified as neutron signals on assaying sample characteristics. Multiplicity counter measurements with and without gamma-ray-like signals were compared to determine the assay error associated with gamma-ray-like signals at various gamma-ray and neutron rates. Correlatedmore » and uncorrelated gamma-ray signals each produced consistent but different measurement errors. Correlated gamma-ray signals most strongly led to fissile mass overestimates, whereas uncorrelated gamma-ray signals most strongly lead to (α,n) neutron overestimates. Gamma-ray sensitive neutron multiplicity counters may be able to account for the effects of gamma-rays on measurements to mitigate measurement uncertainties.« less
Combined Photoneutron And X Ray Interrogation Of Containers For Nuclear Materials
NASA Astrophysics Data System (ADS)
Gozani, Tsahi; Shaw, Timothy; King, Michael J.; Stevenson, John; Elsalim, Mashal; Brown, Craig; Condron, Cathie
2011-06-01
Effective cargo inspection systems for nuclear material detection require good penetration by the interrogating radiation, generation of a sufficient number of fissions, and strong and penetrating detection signatures. Inspection systems need also to be sensitive over a wide range of cargo types and densities encountered in daily commerce. Thus they need to be effective with highly hydrogenous cargo, where neutron attenuation is a major limitation, as well as with dense metallic cargo, where x-ray penetration is low. A system that interrogates cargo with both neutrons and x-rays can, in principle, achieve high performance over the widest range of cargos. Moreover, utilizing strong prompt-neutron (˜3 per fission) and delayed-gamma ray (˜7 per fission) signatures further strengthens the detection sensitivity across all cargo types. The complementary nature of x-rays and neutrons, used as both probing radiation and detection signatures, alleviates the need to employ exceedingly strong sources, which would otherwise be required to achieve adequate performance across all cargo types, if only one type of radiation probe were employed. A system based on the above principles, employing a commercially-available 9 MV linac was developed and designed. Neutrons are produced simultaneously with x-rays by the photonuclear interaction of the x-ray beam with a suitable converter. A total neutron yield on the order of 1011 n/s is achieved with an average electron beam current of 100 μA. If fissionable material is present, fissions are produced both by the high-energy x-ray beam and by the photoneutrons. Photofission and neutron fission dominate in hydrogenous and metallic cargos, respectively. Neutron-capture gamma rays provide information on the cargo composition. The prompt neutrons resulting from fission are detected by two independent detector systems: by very efficient Differential Die Away Analysis (DDAA) detectors, and by direct detection of neutrons with energies higher than 3 MeV using a recently developed fluorine-based threshold activation detector (TAD). The delayed gamma-ray signals are measured with high efficiency with the same TAD and with additional lower-cost plastic scintillators.
NASA Technical Reports Server (NTRS)
Thompson, David
2012-01-01
Gamma rays reveal extreme, nonthermal conditions in the Universe. The Fermi Gamma-ray Space Telescope has been exploring the gamma-ray sky for more than four years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge gamma-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.
Geology orbiter comparison study
NASA Technical Reports Server (NTRS)
Cutts, J. A. J.; Blasius, K. R.; Davis, D. R.; Pang, K. D.; Shreve, D. C.
1977-01-01
Instrument requirements of planetary geology orbiters were examined with the objective of determining the feasibility of applying standard instrument designs to a host of terrestrial targets. Within the basic discipline area of geochemistry, gamma-ray, X-ray fluorescence, and atomic spectroscopy remote sensing techniques were considered. Within the discipline area of geophysics, the complementary techniques of gravimetry and radar were studied. Experiments using these techniques were analyzed for comparison at the Moon, Mercury, Mars and the Galilean satellites. On the basis of these comparative assessments, the adaptability of each sensing technique was judged as a basic technique for many targets, as a single instrument applied to many targets, as a single instrument used in different mission modes, and as an instrument capability for nongeoscience objectives.
New method for scanning spacecraft and balloon-borne/space-based experiments
NASA Technical Reports Server (NTRS)
Polites, Michael E.
1991-01-01
A new method is presented for scanning balloon-borne experiments, free-flying spacecraft, and gimballed experiments mounted to the space shuttle or the space station. It uses rotating-unbalanced-mass (RUM) devices for generating circular, line, or raster scan patterns and an auxiliary control system for target acquisition, keeping the scan centered on the target, and producing complementary motion for raster scanning. It is ideal for applications where the only possible way to accomplish the required scan is to physically scan the entire experiment or spacecraft as in X-ray and gamma ray experiments. In such cases, this new method should have advantages over prior methods in terms of either power, weight, cost, performance, stability, or a combination of these.
Measuring cosmological parameters with Gamma-Ray Bursts: status and perspectives
NASA Astrophysics Data System (ADS)
Amati, L.
2017-10-01
Given their huge isotropic-equivalent radiated energies, up to more than 10^{54} erg released in a few tens of seconds, and their redshift distribution extending up to more than z = 9, Gamma-Ray Bursts (GRB) are in principle a powerful tool for measuring the geometry and expansion rate of the Universe. In the recent years, several attempts have been made to exploit the correlation between the photon energy at which the nuFnu spectrum peaks ('peak energy') and the radiated energy (or luminosity) for 'standardizing' GRBs and use them as tools (complementary to other probes like SN Ia, BAO and the CMB) for the estimate of cosmological parameters. These studies show that already with the present data set GRBs can provide a signicant and independent confirmation of Ω_{M} ˜ 0.3 for a flat ΛCDM universe and that the measurements expected from present and next GRB experiments (e.g. Swift, Fermi/GBM, SVOM, CALET/GBM, UFFO) will allow us to substantially improve the constraints on Ω_{M} and Ω_{Λ}, and, in particular, to get unique clues on dark energy properties and evolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stinnett, Jacob; Venkataraman, Ram
The objective of this training is to explain the origin of x-rays and gamma rays, gamma ray interactions with matter, detectors and electronics used in gamma ray-spectrometry, and features of a gamma-ray spectrum for nuclear material that is safeguarded.
Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches
NASA Technical Reports Server (NTRS)
Galper, A.M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A.I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.;
2012-01-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons + positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is approx. 0.01 deg (E(sub gamma) > 100 GeV), the energy resolution approx. 1% (E(sub gamma) > 10 GeV), and the proton rejection factor approx 10(exp 6). GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches
NASA Technical Reports Server (NTRS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu V.;
2012-01-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons (+) positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is approximately 0.01deg (E(sub gamma) greater than 100 GeV), the energy resolution approximately 1% (E(sub gamma) greater than 10 GeV), and the proton rejection factor approximately 10(exp 6). GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
NASA Astrophysics Data System (ADS)
Matthews, James
The present volume on high energy gamma-ray astronomy discusses the composition and properties of heavy cosmic rays greater than 10 exp 12 eV, implications of the IRAS Survey for galactic gamma-ray astronomy, gamma-ray emission from young neutron stars, and high-energy diffuse gamma rays. Attention is given to observations of TeV photons at the Whipple Observatory, TeV gamma rays from millisecond pulsars, recent data from the CYGNUS experiment, and recent results from the Woomera Telescope. Topics addressed include bounds on a possible He/VHE gamma-ray line signal of Galactic dark matter, albedo gamma rays from cosmic ray interactions on the solar surface, source studies, and the CANGAROO project. Also discussed are neural nets and other methods for maximizing the sensitivity of a low-threshold VHE gamma-ray telescope, a prototype water-Cerenkov air-shower detector, detection of point sources with spark chamber gamma-ray telescopes, and real-time image parameterization in high energy gamma-ray astronomy using transputers. (For individual items see A93-25002 to A93-25039)
Very high-energy gamma rays from gamma-ray bursts.
Chadwick, Paula M
2007-05-15
Very high-energy (VHE) gamma-ray astronomy has undergone a transformation in the last few years, with telescopes of unprecedented sensitivity having greatly expanded the source catalogue. Such progress makes the detection of a gamma-ray burst at the highest energies much more likely than previously. This paper describes the facilities currently operating and their chances for detecting gamma-ray bursts, and reviews predictions for VHE gamma-ray emission from gamma-ray bursts. Results to date are summarized.
NASA Astrophysics Data System (ADS)
Thielemann, Friedrich-Karl; Isern, Jordi; Perego, Albino; von Ballmoos, Peter
2018-04-01
We present the status and open problems of nucleosynthesis in supernova explosions of both types, responsible for the production of the intermediate mass, Fe-group and heavier elements (with the exception of the main s-process). Constraints from observations can be provided through individual supernovae (SNe) or their remnants (e.g. via spectra and gamma-rays of decaying unstable isotopes) and through surface abundances of stars which witness the composition of the interstellar gas at their formation. With a changing fraction of elements heavier than He in these stars (known as metallicity) the evolution of the nucleosynthesis in galaxies over time can be determined. A complementary way, related to gamma-rays from radioactive decays, is the observation of positrons released in β+-decays, as e.g. from ^{26}Al, ^{44}Ti, ^{56,57}Ni and possibly further isotopes of their decay chains (in competition with the production of e+e- pairs in acceleration shocks from SN remnants, pulsars, magnetars or even of particle physics origin). We discuss (a) the role of the core-collapse supernova explosion mechanism for the composition of intermediate mass, Fe-group (and heavier?) ejecta, (b) the transition from neutron stars to black holes as the final result of the collapse of massive stars, and the relation of the latter to supernovae, faint supernovae, and gamma-ray bursts/hypernovae, (c) Type Ia supernovae and their nucleosynthesis (e.g. addressing the ^{55}Mn puzzle), plus (d) further constraints from galactic evolution, γ-ray and positron observations. This is complemented by the role of rare magneto-rotational supernovae (related to magnetars) in comparison with the nucleosynthesis of compact binary mergers, especially with respect to forming the heaviest r-process elements in galactic evolution.
The Gamma-ray Universe through Fermi
NASA Technical Reports Server (NTRS)
Thompson, David J.
2012-01-01
Gamma rays, the most powerful form of light, reveal extreme conditions in the Universe. The Fermi Gamma-ray Space Telescope and its smaller cousin AGILE have been exploring the gamma-ray sky for several years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge ga.nuna-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.
Sneaky Gamma-Rays: Using Gravitational Lensing to Avoid Gamma-Gamma-Absorption
NASA Astrophysics Data System (ADS)
Boettcher, Markus; Barnacka, Anna
2014-08-01
It has recently been suggested that gravitational lensing studies of gamma-ray blazars might be a promising avenue to probe the location of the gamma-ray emitting region in blazars. Motivated by these prospects, we have investigated potential gamma-gamma absorption signatures of intervening lenses in the very-high-energy gamma-ray emission from lensedblazars. We considered intervening galaxies and individual stars within these galaxies. We find that the collective radiation field of galaxies acting as sources of macrolensing are not expected to lead to significant gamma-gamma absorption. Individual stars within intervening galaxies could, in principle, cause a significant opacity to gamma-gamma absorption for VHE gamma-rays if the impact parameter (the distance of closest approach of the gamma-ray to the center of the star) is small enough. However, we find that the curvature of the photon path due to gravitational lensing will cause gamma-ray photons to maintain a sufficiently large distance from such stars to avoid significant gamma-gamma absorption. This re-inforces the prospect of gravitational-lensing studies of gamma-ray blazars without interference due to gamma-gamma absorption due to the lensing objects.
Prospects for compact high-intensity laser synchrotron x-ray and gamma sources
NASA Astrophysics Data System (ADS)
Pogorelsky, I. V.
1997-03-01
A laser interacting with a relativistic electron beam behaves like a virtual wiggler of an extremely short period equal to half of the laser wavelength. This approach opens a route to relatively compact, high-brightness x-ray sources alternative or complementary to conventional synchrotron light sources. Although not new, the laser synchrotron source (LSS) concept is still waiting for a convincing demonstration. Available at the BNL Accelerator Test Facility (ATF), a high-brightness electron beam and the high-power CO2 laser may be used for prototype LSS demonstration. In a feasible demonstration experiment, 10-GW, 100-ps CO2 laser beam will be brought to a head-on collision with a 10-ps, 0.5-nC, 50 MeV electron bunch. Flashes of collimated 4.7 keV (2.6 Å) x-rays of 10-ps pulse duration, with a flux of ˜1019photons/sec, will be produced via linear Compton backscattering. The x-ray spectrum is tunable proportionally to the e-beam energy. A rational short-term extension of the proposed experiment would be further enhancement of the x-ray flux to the 1022 photons/sec level, after the ongoing ATF CO2 laser upgrade to 5 TW peak power and electron bunch shortening to 3 ps is realized. In the future, exploiting the promising approach of a high-gradient laser wake field accelerator, a compact "table-top" LSS of monochromatic gamma radiation may become feasible.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ajello, M.; Atwood, W. B.; Baldini, L.
During its first year of data taking, the Large Area Telescope (LAT) onboard the Fermi Gamma-Ray Space Telescope has collected a large sample of high-energy cosmic-ray electrons and positrons (CREs). We present the results of a directional analysis of the CRE events, in which we searched for a flux excess correlated with the direction of the Sun. Two different and complementary analysis approaches were implemented, and neither yielded evidence of a significant CRE flux excess from the Sun. Here, we derive upper limits on the CRE flux from the Sun’s direction, and use these bounds to constrain two classes ofmore » dark matter models which predict a solar CRE flux: (1) models in which dark matter annihilates to CREs via a light intermediate state, and (2) inelastic dark matter models in which dark matter annihilates to CREs.« less
Ajello, M.; Atwood, W. B.; Baldini, L.; ...
2011-08-15
During its first year of data taking, the Large Area Telescope (LAT) onboard the Fermi Gamma-Ray Space Telescope has collected a large sample of high-energy cosmic-ray electrons and positrons (CREs). We present the results of a directional analysis of the CRE events, in which we searched for a flux excess correlated with the direction of the Sun. Two different and complementary analysis approaches were implemented, and neither yielded evidence of a significant CRE flux excess from the Sun. Here, we derive upper limits on the CRE flux from the Sun’s direction, and use these bounds to constrain two classes ofmore » dark matter models which predict a solar CRE flux: (1) models in which dark matter annihilates to CREs via a light intermediate state, and (2) inelastic dark matter models in which dark matter annihilates to CREs.« less
Design and performance of the GAMMA-400 gamma-ray telescope for dark matter searches
NASA Astrophysics Data System (ADS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.; Kaplin, V. A.; Kachanov, V. A.; Kheymits, M. D.; Leonov, A. A.; Longo, F.; Mazets, E. P.; Maestro, P.; Marrocchesi, P.; Mereminskiy, I. A.; Mikhailov, V. V.; Moiseev, A. A.; Mocchiutti, E.; Mori, N.; Moskalenko, I. V.; Naumov, P. Yu.; Papini, P.; Picozza, P.; Rodin, V. G.; Runtso, M. F.; Sparvoli, R.; Spillantini, P.; Suchkov, S. I.; Tavani, M.; Topchiev, N. P.; Vacchi, A.; Vannuccini, E.; Yurkin, Yu. T.; Zampa, N.; Zverev, V. G.; Zirakashvili, V. N.
2013-02-01
The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons + positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is ~0.01° (Eγ > 100 GeV), the energy resolution ~1% (Eγ > 10 GeV), and the proton rejection factor ~106. GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.
NASA Astrophysics Data System (ADS)
Topchiev, N. P.; Galper, A. M.; Arkhangelskiy, A. I.; Arkhangelskaja, I. V.; Kheymits, M. D.; Suchkov, S. I.; Yurkin, Y. T.
2017-01-01
Scientific project GAMMA-400 (Gamma Astronomical Multifunctional Modular Apparatus) relates to the new generation of space observatories intended to perform an indirect search for signatures of dark matter in the cosmic-ray fluxes, measurements of characteristics of diffuse gamma-ray emission and gamma-rays from the Sun during periods of solar activity, gamma-ray bursts, extended and point gamma-ray sources, electron/positron and cosmic-ray nuclei fluxes up to TeV energy region by means of the GAMMA-400 gamma-ray telescope represents the core of the scientific complex. The system of triggers and counting signals formation of the GAMMA-400 gamma-ray telescope constitutes the pipelined processor structure which collects data from the gamma-ray telescope subsystems and produces summary information used in forming the trigger decision for each event. The system design is based on the use of state-of-the-art reconfigurable logic devices and fast data links. The basic structure, logic of operation and distinctive features of the system are presented.
Day-Scale Variability of 3C 279 and Searches for Correlations in Gamma-Ray, X-Ray and Optical Bands
NASA Technical Reports Server (NTRS)
Hartman, R. C.; Villata, M.; Balonek, T. J.; Bertsch, D. L.; Bock, H.; Boettcher, M.; Carini, M. T.; Collmar, W.; DeFrancesco, G.; Ferrera, E. C.;
2001-01-01
Light curves of 3C 279 are presented in optical (R-band), X-rays (RXTE/PCA), and gamma rays (CGRO/EGRET) for 1999 Jan-Feb and 2000 Jan-Mar. During both of those epochs the gamma-ray levels were high, and all three observed bands demonstrated substantial variation, on time scales as short as one day. Correlation analyses provided no consistent pattern, although a rather significant optical/gamma-ray correlation was seen in 1999, with a gamma-ray lag of approximately 2.5 days, and there are other suggestions of correlations in the light curves. For comparison, correlation analysis is also presented for the gamma-ray and X-ray light curves during the large gamma-ray flare in 1996 Feb and the two gamma-bright weeks leading up to it; the correlation at that time was strong, with a gamma-ray/X-ray offset of no more than one day.
Highlights of GeV Gamma-Ray Astronomy
NASA Technical Reports Server (NTRS)
Thompson, David J.
2010-01-01
Because high-energy gamma rays are primarily produced by high-energy particle interactions, the gamma-ray survey of the sky by the Fermi Gamma-ray Space Telescope offers a view of sites of cosmic ray production and interactions. Gamma-ray bursts, pulsars, pulsar wind nebulae, binary sources, and Active Galactic Nuclei are all phenomena that reveal particle acceleration through their gamma-ray emission. Diffuse Galactic gamma radiation, Solar System gamma-ray sources, and energetic radiation from supernova remnants are likely tracers of high-energy particle interactions with matter and photon fields. This paper will present a broad overview of the constantly changing sky seen with the Large Area Telescope (LAT) on the Fermi spacecraft.
Unidentified Gamma-Ray Sources: Hunting Gamma-Ray Blazars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; D'Abrusco, R.; Tosti, G.
2012-04-02
One of the main scientific objectives of the ongoing Fermi mission is unveiling the nature of the unidentified {gamma}-ray sources (UGSs). Despite the large improvements of Fermi in the localization of {gamma}-ray sources with respect to the past {gamma}-ray missions, about one third of the Fermi-detected objects are still not associated to low energy counterparts. Recently, using the Wide-field Infrared Survey Explorer (WISE) survey, we discovered that blazars, the rarest class of Active Galactic Nuclei and the largest population of {gamma}-ray sources, can be recognized and separated from other extragalactic sources on the basis of their infrared (IR) colors. Basedmore » on this result, we designed an association method for the {gamma}-ray sources to recognize if there is a blazar candidate within the positional uncertainty region of a generic {gamma}-ray source. With this new IR diagnostic tool, we searched for {gamma}-ray blazar candidates associated to the UGS sample of the second Fermi {gamma}-ray catalog (2FGL). We found that our method associates at least one {gamma}-ray blazar candidate as a counterpart each of 156 out of 313 UGSs analyzed. These new low-energy candidates have the same IR properties as the blazars associated to {gamma}-ray sources in the 2FGL catalog.« less
UNIDENTIFIED {gamma}-RAY SOURCES: HUNTING {gamma}-RAY BLAZARS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; Ajello, M.; D'Abrusco, R.
2012-06-10
One of the main scientific objectives of the ongoing Fermi mission is unveiling the nature of unidentified {gamma}-ray sources (UGSs). Despite the major improvements of Fermi in the localization of {gamma}-ray sources with respect to the past {gamma}-ray missions, about one-third of the Fermi-detected objects are still not associated with low-energy counterparts. Recently, using the Wide-field Infrared Survey Explorer survey, we discovered that blazars, the rarest class of active galactic nuclei and the largest population of {gamma}-ray sources, can be recognized and separated from other extragalactic sources on the basis of their infrared (IR) colors. Based on this result, wemore » designed an association method for the {gamma}-ray sources to recognize if there is a blazar candidate within the positional uncertainty region of a generic {gamma}-ray source. With this new IR diagnostic tool, we searched for {gamma}-ray blazar candidates associated with the UGS sample of the second Fermi {gamma}-ray LAT catalog (2FGL). We found that our method associates at least one {gamma}-ray blazar candidate as a counterpart to each of 156 out of 313 UGSs analyzed. These new low-energy candidates have the same IR properties as the blazars associated with {gamma}-ray sources in the 2FGL catalog.« less
NASA Technical Reports Server (NTRS)
Becker, Peter A.; Kafatos, Menas
1995-01-01
We develop a general expression for the gamma - gamma absorption coefficient, alpha(sub gamma(gamma)) for gamma-rays propagating in an arbitrary direction at an arbitrary point in space above an X-ray-emitting accretion disk. The X-ray intensity is assumed to vary as a power law in energy and radius between the outer disk radius, R(sub 0), and the inner radius, R(sub ms) which is the radius of marginal stability for a Schwarzschild black hole. We use our result for alpha(sub gamma(gamma)) to calculate the gamma - gamma optical depth, tau(sub gamma(gamma)) for gamma - rays created at height z and propagating at angle Phi relative to the disk axis, and we show that for Phi = 0 and z greater than or approx equal to R(sub 0), tau(sub gamma(gamma)) proportional to Epsilon(sup alpha)z(sup -2(alpha) - 3), where alpha is the X-ray spectral index and Epsilon is the gamma - ray energy. As an application, we use our formalism to compute the minimum distance between the central black hole and the site of production of the gamma-rays detected by EGRET during the 1991 June flare of 3C 279. In order to obtain an upper limit, we assume that all of the X-rays observed contemporaneously by Ginga were emitted by the disk. Our results suggest that the observed gamma - rays may have originated within less than or approx equal to 45 GM/sq c from a black hole of mass greater than or approx equal to 10(exp 9) solar mass, perhaps in active plasma located above the central funnel of the accretion disk. This raises the possibility of establishing a direct connection between the production of the observed gamma - rays and the accretion of material onto the black hole. We also consider the variation of the optical depth as a function of the angle of propagation Phi. Our results indicate that the "focusing" of the gamma - rays along the disk axis due to pair production is strong enough to explain the observed degree of alignment in blazar sources. If the gamma - rays are produced isotropically in gamma - ray blazars, then these objects should appear as bright MeV sources when viewed along off-axis lines of sight.
NASA Technical Reports Server (NTRS)
Polites, Michael E.
1990-01-01
A new method is presented for scanning balloon-borne experiments, free-flying spacecraft, and gimballed experiments mounted to the space shuttle or the space station. It uses rotating-unbalanced-mass (RUM) devices for generating circular, line, or raster scan patterns and an auxiliary control system for target acquisition, keeping the scan centered on the target, and producing complementary motion for raster scanning. It is ideal for applications where the only possible way to accomplish the required scan is to physically scan the entire experiment or spacecraft as in x ray and gamma ray experiments. In such cases, this new method should have advantages over prior methods in terms of either power, weight, cost, performance, stability, or a combination of these.
NASA Astrophysics Data System (ADS)
Lawrence, D. J.; Maurice, S.; Patterson, G. W.; Hibbitts, C. A.
2010-05-01
Understanding the global composition of Ganymede's surface is a key goal of the Europa Jupiter System Mission (EJSM) that is being jointly planned by NASA and ESA. Current plans for obtaining surface information with the Jupiter Ganymede Orbiter (JGO) use spectral imaging measurements. While spectral imaging can provide good mineralogy-related information, quantitative data about elemental abundances can often be hindered by non-composition variations due to surface effects (e.g., space weathering, grain effects, temperature, etc.). Orbital neutron and gamma-ray spectroscopy can provide quantitative composition information that is complementary to spectral imaging measurements, as has been demonstrated with similar instrumental combinations at the Moon, Mars, and Mercury. Neutron and gamma-ray measurements have successfully returned abundance information in a hydrogen-rich environment on Mars. In regards to neutrons and gamma-rays, there are many similarities between the Mars and Ganymede hydrogen-rich environments. In this study, we present results of neutron transport models, which show that quantitative composition information from Ganymede's surface can be obtained in a realistic mission scenario. Thermal and epithermal neutrons are jointly sensitive to the abundances of hydrogen and neutron absorbing elements, such as iron and titanium. These neutron measurements can discriminate between regions that are rich or depleted in neutron absorbing elements, even in the presence of large amounts of hydrogen. Details will be presented about how the neutron composition parameters can be used to meet high-level JGO science objectives, as well as an overview of a neutron spectrometer than can meet various mission and stringent environmental requirements.
Discovery of an Unidentified Fermi Object as a Black Widow-Like Millisecond Pulsar
NASA Technical Reports Server (NTRS)
Kong, A. K. H.; Huang, R. H. H.; Cheng, K. S.; Takata, J.; Yatsu, Y.; Cheung, C. C.; Donato, D.; Lin, L. C. C.; Kataoka, J.; Takahashi, Y.;
2012-01-01
The Fermi Gamma-ray Space Telescope has revolutionized our knowledge of the gamma-ray pulsar population, leading to the discovery of almost 100 gamma-ray pulsars and dozens of gamma-ray millisecond pulsars (MSPs). Although the outer-gap model predicts different sites of emission for the radio and gamma-ray pulsars, until now all of the known gamma-ray MSPs have been visible in the radio. Here we report the discovery of a radio-quiet" gamma-ray emitting MSP candidate by using Fermi, Chandra, Swift, and optical observations. The X-ray and gamma-ray properties of the source are consistent with known gamma-ray pulsars. We also found a 4.63-hr orbital period in optical and X-ray data. We suggest that the source is a black widow-like MSP with a approx. 0.1 Stellar Mass late-type companion star. Based on the profile of the optical and X-ray light-curves, the companion star is believed to be heated by the pulsar while the X-ray emissions originate from pulsar magnetosphere and/or from intra-binary shock. No radio detection of the source has been reported yet and although no gamma-ray/radio pulsation has been found, we estimated that the spin period of the MSP is approx. 3-5 ms based on the inferred gamma-ray luminosity.
SAS-2 gamma-ray observations of PSR 1747-46. [radio pulsar
NASA Technical Reports Server (NTRS)
Thompson, D. J.; Fichtel, C. E.; Kniffen, D. A.; Ogelman, H. B.; Lamb, R. C.
1976-01-01
Evidence is reported for the observation of gamma-ray emission from the radio pulsar PSR 1747-46 by the gamma-ray telescope aboard SAS 2. The evidence is based on the presence of both an approximately 3-sigma enhancement of gamma rays at the pulsar's location and an approximately 4-sigma peak in the phase plot of 79 gamma-ray events whose phase was calculated from the pulsar's known period. The gamma-ray pulsation is found to appear at a phase lag of about 0.16 from that predicted by the radio observations. The pulsed gamma-ray fluxes above 35 MeV and 100 MeV are estimated, and it is shown that the gamma-ray pulse width is similar to the radio pulse width. It is concluded that PSR 1747-46 is a most likely candidate for pulsed gamma-ray emission.
Fermi Gamma-Ray Space Telescope: Science Highlights for the First 8 Months
NASA Technical Reports Server (NTRS)
Moiseev, Alexander
2010-01-01
The Fermi Gamma-ray Space Telescope was launched on June 11, 2008 and since August 2008 has successfully been conducting routine science observations of high energy phenomena in the gamma-ray sky. A number of exciting discoveries have been made during its first year of operation, including blazar flares, high-energy gamma-ray bursts, and numerous new,gamma-ray sources of different types, among them pulsars and Active Galactic Nuclei (AGN). fermi-LAT also performed accurate mea.<;urement of the diffuse gamma-radiation which clarifies the Ge V excess reported by EGRET almost 10 years ago, high precision measurement of the high energy electron spectrum, and other observations. An overview of the observatory status and recent results as of April 30, 2009, are presented. Key words: gamma-ray astronomy, cosmic rays, gamma-ray burst, pulsar, blazar. diffuse gamma-radiation
Results and prospects in multi-messenger particle astrophysics
NASA Astrophysics Data System (ADS)
Mostafa, Miguel
2017-01-01
In high-energy particle astrophysics the old days were certainly not better than these. Our field has thrived in the past decade with experiments covering thousands of square kilometers to measure the suppression in the flux of the highest energy cosmic rays ever observed, instrumenting a cubic kilometer of Antarctic ice to discover astrophysical neutrinos, and measuring a change in arm length as small as 10-19 m for the ground-breaking direct observation of gravitational waves. Additionally, the current generation of space-borne and ground-based gamma-ray experiments have revealed a plethora of gamma-ray sources, including pulsars, compact binaries, the galactic center, and extragalactic sources such as starburst galaxies and radio galaxies. Before the next generation of instruments bring us yet another order of magnitude in sensitivity, we can combine current observations to probe physics beyond the standard model, and to extend the high-energy frontier well above the energies accessible to laboratory accelerators. One example of this potential is the search for dark-matter annihilation and decay products. To use the multi-messenger approach effectively for probing dark-matter signatures and physics beyond the LHC energy requires understanding the origin (or acceleration mechanism) and the propagation processes. High energy protons and nuclei, neutrinos, gamma-rays, X-rays, and gravitational waves bring new and complementary views of the astrophysical sources. By comparing observations through different windows, we can use the sites of violent phenomena as a laboratory to probe the physical processes under extreme conditions throughout the Universe, and to test the fundamental laws of particle physics and gravitation. As a community we need to engage in a bold synergistic approach to understanding the violent processes that give rise to the high-energy cosmic phenomena in the Universe. In this invited talk, I will present on-going multi-messenger studies to obtain new information about cosmic sources, and I will discuss the prospects of combining data from the electromagnetic, particle, and gravitational windows to advance high energy astrophysics into a new era.
NASA Astrophysics Data System (ADS)
Kheymits, M. D.; Leonov, A. A.; Zverev, V. G.; Galper, A. M.; Arkhangelskaya, I. V.; Arkhangelskiy, A. I.; Suchkov, S. I.; Topchiev, N. P.; Yurkin, Yu T.; Bakaldin, A. V.; Dalkarov, O. D.
2016-02-01
The GAMMA-400 gamma-ray space-based telescope has as its main goals to measure cosmic γ-ray fluxes and the electron-positron cosmic-ray component produced, theoretically, in dark-matter-particles decay or annihilation processes, to search for discrete γ-ray sources and study them in detail, to examine the energy spectra of diffuse γ-rays — both galactic and extragalactic — and to study gamma-ray bursts (GRBs) and γ-rays from the active Sun. Scientific goals of GAMMA-400 telescope require fine angular resolution. The telescope is of a pair-production type. In the converter-tracker, the incident gamma-ray photon converts into electron-positron pair in the tungsten layer and then the tracks are detected by silicon- strip position-sensitive detectors. Multiple scattering processes become a significant obstacle in the incident-gamma direction reconstruction for energies below several gigaelectronvolts. The method of utilising this process to improve the resolution is proposed in the presented work.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A.A.; /Naval Research Lab, Wash., D.C.; Ackermann, M.
The diffuse galactic {gamma}-ray emission is produced by cosmic rays (CRs) interacting with the interstellar gas and radiation field. Measurements by the Energetic Gamma-Ray Experiment Telescope (EGRET) instrument on the Compton Gamma-Ray Observatory indicated excess {gamma}-ray emission {ge}1 GeV relative to diffuse galactic {gamma}-ray emission models consistent with directly measured CR spectra (the so-called 'EGRET GeV excess'). The Large Area Telescope (LAT) instrument on the Fermi Gamma-Ray Space Telescope has measured the diffuse {gamma}-ray emission with improved sensitivity and resolution compared to EGRET. We report on LAT measurements for energies 100 MeV to 10 GeV and galactic latitudes 10{sup o}more » {le} |b| {le} 20{sup o}. The LAT spectrum for this region of the sky is well reproduced by a diffuse galactic {gamma}-ray emission model that is consistent with local CR spectra and inconsistent with the EGRET GeV excess.« less
Abdo, A A; Ackermann, M; Ajello, M; Anderson, B; Atwood, W B; Axelsson, M; Baldini, L; Ballet, J; Barbiellini, G; Bastieri, D; Baughman, B M; Bechtol, K; Bellazzini, R; Berenji, B; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brez, A; Brigida, M; Bruel, P; Burnett, T H; Caliandro, G A; Cameron, R A; Caraveo, P A; Casandjian, J M; Cecchi, C; Charles, E; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Conrad, J; Dereli, H; Dermer, C D; de Angelis, A; de Palma, F; Digel, S W; Di Bernardo, G; Dormody, M; do Couto e Silva, E; Drell, P S; Dubois, R; Dumora, D; Edmonds, Y; Farnier, C; Favuzzi, C; Fegan, S J; Focke, W B; Frailis, M; Fukazawa, Y; Funk, S; Fusco, P; Gaggero, D; Gargano, F; Gehrels, N; Germani, S; Giebels, B; Giglietto, N; Giordano, F; Glanzman, T; Godfrey, G; Grenier, I A; Grondin, M-H; Grove, J E; Guillemot, L; Guiriec, S; Hanabata, Y; Harding, A K; Hayashida, M; Hays, E; Hughes, R E; Jóhannesson, G; Johnson, A S; Johnson, R P; Johnson, T J; Johnson, W N; Kamae, T; Katagiri, H; Kataoka, J; Kawai, N; Kerr, M; Knödlseder, J; Kocian, M L; Kuehn, F; Kuss, M; Lande, J; Latronico, L; Longo, F; Loparco, F; Lott, B; Lovellette, M N; Lubrano, P; Madejski, G M; Makeev, A; Mazziotta, M N; McConville, W; McEnery, J E; Meurer, C; Michelson, P F; Mitthumsiri, W; Mizuno, T; Moiseev, A A; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nolan, P L; Nuss, E; Ohsugi, T; Okumura, A; Omodei, N; Orlando, E; Ormes, J F; Paneque, D; Panetta, J H; Parent, D; Pelassa, V; Pepe, M; Pesce-Rollins, M; Piron, F; Porter, T A; Rainò, S; Rando, R; Razzano, M; Reimer, A; Reimer, O; Reposeur, T; Ritz, S; Rodriguez, A Y; Roth, M; Ryde, F; Sadrozinski, H F-W; Sanchez, D; Sander, A; Saz Parkinson, P M; Scargle, J D; Sellerholm, A; Sgrò, C; Smith, D A; Smith, P D; Spandre, G; Spinelli, P; Starck, J-L; Stecker, F W; Striani, E; Strickman, M S; Strong, A W; Suson, D J; Tajima, H; Takahashi, H; Tanaka, T; Thayer, J B; Thayer, J G; Thompson, D J; Tibaldo, L; Torres, D F; Tosti, G; Tramacere, A; Uchiyama, Y; Usher, T L; Vasileiou, V; Vilchez, N; Vitale, V; Waite, A P; Wang, P; Winer, B L; Wood, K S; Ylinen, T; Ziegler, M
2009-12-18
The diffuse galactic gamma-ray emission is produced by cosmic rays (CRs) interacting with the interstellar gas and radiation field. Measurements by the Energetic Gamma-Ray Experiment Telescope (EGRET) instrument on the Compton Gamma-Ray Observatory indicated excess gamma-ray emission greater, > or approximately equal to 1 GeV relative to diffuse galactic gamma-ray emission models consistent with directly measured CR spectra (the so-called "EGRET GeV excess"). The Large Area Telescope (LAT) instrument on the Fermi Gamma-Ray Space Telescope has measured the diffuse gamma-ray emission with improved sensitivity and resolution compared to EGRET. We report on LAT measurements for energies 100 MeV to 10 GeV and galactic latitudes 10 degrees < or = |b| < or = 20 degrees. The LAT spectrum for this region of the sky is well reproduced by a diffuse galactic gamma-ray emission model that is consistent with local CR spectra and inconsistent with the EGRET GeV excess.
Mercuric iodine room temperature gamma-ray detectors
NASA Technical Reports Server (NTRS)
Patt, Bradley E.; Markakis, Jeffrey M.; Gerrish, Vernon M.; Haymes, Robert C.; Trombka, Jacob I.
1990-01-01
high resolution mercuric iodide room temperature gamma-ray detectors have excellent potential as an essential component of space instruments to be used for high energy astrophysics. Mercuric iodide detectors are being developed both as photodetectors used in combination with scintillation crystals to detect gamma-rays, and as direct gamma-ray detectors. These detectors are highly radiation damage resistant. The list of applications includes gamma-ray burst detection, gamma-ray line astronomy, solar flare studies, and elemental analysis.
NASA Astrophysics Data System (ADS)
Torii, T.; Sanada, Y.; Watanabe, A.
2017-12-01
In the vicinity of the tops of high mountains and in the coastal areas of the Sea of Japan in winter, the generation of high energy photons that lasts more than 100 seconds at the occurrence of thunderclouds has been reported. At the same time, 511 keV gamma rays are also detected. On the other hand, we irradiated a radiosonde equipped with gamma-ray detectors at the time of thunderstorm and observed fluctuation in gamma-ray count-rate. As a result, we found that the gamma-ray count-rate increases significantly near the top of the thundercloud. Therefore, in order to investigate the fluctuation of the energy of the gamma rays, we developed a radiation detector for radiosonde to observe the fluctuation of the low energy gamma-ray spectrum and observed the fluctuation of the gamma-ray spectrum. We will describe the counting rate and spectral fluctuation of gamma-ray detectors for radiosonde observed in the sky in Fukushima prefecture, Japan.
Lunar occultations for gamma-ray source measurements
NASA Technical Reports Server (NTRS)
Koch, David G.; Hughes, E. B.; Nolan, Patrick L.
1990-01-01
The unambiguous association of discrete gamma-ray sources with objects radiating at other wavelengths, the separation of discrete sources from the extended emission within the Galaxy, the mapping of gamma-ray emission from nearby galaxies and the measurement of structure within a discrete source cannot presently be accomplished at gamma-ray energies. In the past, the detection processes used in high-energy gamma-ray astronomy have not allowed for good angular resolution. This problem can be overcome by placing gamma-ray detectors on the moon and using the horizon as an occulting edge to achieve arcsec resolution. For purposes of discussion, this concept is examined for gamma rays above 100 MeV for which pair production dominates the detection process and locally-generated nuclear gamma rays do not contribute to the background.
NASA Astrophysics Data System (ADS)
Fradkin, M. I.; Gorchakov, E. V.; Kaplin, V. A.; Kaplin, D. V.; Kurnosova, L. V.; Labenskij, A. G.; Runtso, M. F.; Topchiev, N. P.
The conditions required for gamma-ray astronomy measurements at energies of 10 - 1000 GeV by a gamma-ray telescope on the International Space Station are discussed. It is shown that the properties of the detected gamma rays can be determined accurately at 30 - 1000 GeV, even if the space station solar arrays fall in the aperture of the gamma-ray telescope. Measurements of the secondary gamma-ray spectrum using a ground-based model of the gamma-ray telescope have been carried out, and the resulting spectrum at energies of 1 - 100 GeV is presented.
Gamma ray astrophysics to the year 2000. Report of the NASA Gamma Ray Program Working Group
NASA Technical Reports Server (NTRS)
1988-01-01
Important developments in gamma-ray astrophysics up to energies of 100 GeV during the last decade are reviewed. Also, the report seeks to define the major current scientific goals of the field and proposes a vigorous program to pursue them, extending to the year 2000. The goals of gamma-ray astronomy include the study of gamma rays which provide the most direct means of studying many important problems in high energy astrophysics including explosive nucleosynthesis, accelerated particle interactions and sources, and high-energy processes around compact objects. The current research program in gamma-ray astronomy in the U.S. including the space program, balloon program and foreign programs in gamma-ray astronomy is described. The high priority recommendations for future study include an Explorer-class high resolution gamma-ray spectroscopy mission and a Get Away Special cannister (GAS-can) or Scout class multiwavelength experiment for the study of gamma-ray bursts. Continuing programs include an extended Gamma Ray Observatory mission, continuation of the vigorous program of balloon observations of the nearby Supernova 1987A, augmentation of the balloon program to provide for new instruments and rapid scientific results, and continuation of support for theoretical research. Long term recommendations include new space missions using advanced detectors to better study gamma-ray sources, the development of these detectors, continued study for the assembly of large detectors in space, collaboration with the gamma-ray astronomy missions initiated by other countries, and consideration of the Space Station attached payloads for gamma-ray experiments.
Terrestrial Gamma-Ray Flashes (TGFs)
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
2010-01-01
This slide presentation reviews the observation of Terrestrial Gamma Ray Flashes (TGFs) by Gamma-Ray Telescopes. These were: (1) BATSE /Compton Observatory, (2) Solar Spectroscopic Imager, (3) AGILE Gamma-ray Telescope, and (4) Gamma-ray Burst Monitor (GBM) on the Fermi Gamma-ray Space Telescope. It contains charts which display the counts over time, a map or the TGFs observed by the Reuven Ramaty High Energy Solar Spectroscopic Imager (RHESSI). and a map showing the latitude and longitude of 85 of the TGFs observed by the Fermi GBM.
Space instrumentation for gamma-ray astronomy
NASA Astrophysics Data System (ADS)
Teegarden, B. J.
1999-02-01
The decade of the 1990s has witnessed a renaissance in the field of gamma-ray astronomy. The seminal event was the launch of the Compton Gamma-Ray Observatory (CGRO) in April 1991. There have been a flood of major discoveries from CGRO including breakthroughs in gamma-ray bursts, annihilation radiation, and blazars. The Italian SAX satellite was launched in April 1996. Although not primarily a gamma-ray mission, it has added a new dimension to our understanding of gamma-ray bursts. Along with these new discoveries a firm groundwork has been laid for missions and new technology development that should maintain a healthy and vigorous field throughout most of the next decade. These include the ESA INTEGRAL mission (INTErnational Gamma-Ray Astrophysics Laboratory, to be launched in mid-2001) and the NASA GLAST mission (Gamma-Ray Large Area Space Telescope) with a likely launch in the middle of the next decade. These two missions will extend the observational capabilities well beyond those of CGRO. New technologies (to gamma-ray astronomy), such as cooled germanium detectors, silicon strip detectors, and CdTe detectors are planned for these new missions. Additional promising new technologies such as CdZnTe strip detectors, scintillator fibers, and a gamma-ray lens for future gamma-ray astronomy missions are under development in laboratories around the world.
Re-evaluating reaction rates relevant to nova nucleosynthesis from a nuclear structure perspective
NASA Astrophysics Data System (ADS)
Jenkins, D. G.; Lister, C. J.; Janssens, R. V. F.; Khoo, T. L.; Moore, E. F.; Rehm, K. E.; Seweryniak, D.; Wuosmaa, A. H.; Davinson, T.; Woods, P. J.; Jokinen, A.; Penttila, H.; Martınez-Pinedo, G.; Jose, J.
2006-03-01
Conventionally, reaction rates relevant to nova nucleosynthesis are determined by performing the relevant proton capture reactions directly for stable species, or as has become possible more recently in inverse kinematics using short-lived accelerated radioactive beams with recoil separators. A secondary approach is to compile information on the properties of levels in the Gamow window using transfer reactions. We present a complementary technique where the states of interest are populated in a heavy-ion fusion reaction and their gamma decay studied with a state-of-the-art array of high-purity germanium detectors. The advantages of this approach, including the ability to determine resonance energies with high precision and the possibility of determining spins and parities from gamma-ray angular distributions are discussed. Two specific examples related to the 22Na(p,γ) and 30P(p,γ) reactions are presented.
Gamma-ray Output Spectra from 239 Pu Fission
Ullmann, John
2015-05-25
The gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. We found that a dependence of the gamma-raymore » spectrum on the gamma-ray multplicity was also observed. Finally, global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.« less
NASA Technical Reports Server (NTRS)
1991-01-01
An overview is given of the Gamma Ray Observatory (GRO) mission. Detection of gamma rays and gamma ray sources, operations using the Space Shuttle, and instruments aboard the GRO, including the Burst and Transient Source Experiment (BATSE), the Oriented Scintillation Spectrometer Experiment (OSSE), the Imaging Compton Telescope (COMPTEL), and the Energetic Gamma Ray Experiment Telescope (EGRET) are among the topics surveyed.
Wang, Peihe; Cai, Yuanyuan; Lin, Dongju; Jiang, Yingxiao
2017-08-07
Gamma ray can promote cancer cell apoptosis and cell cycle arrest. It is often used in the clinical treatment of tumors, including lung cancer. In this study, we aimed to explore the role of gamma ray treatment and its correlation with BTG2 in cell proliferation, apoptosis, and cell cycle arrest regulation in a lung cancer cell line. A549 cell viability, apoptosis rate, and cell cycle were investigated after gamma ray treatment. We then used siRNA for BTG2 to detect the effect of BTG2 knockdown on the progress of gamma ray-treated lung cancer cells. Finally, we investigated the signaling pathway by which gamma ray might regulate BTG2. We found that gamma ray inhibited A549 cell viability and promoted apoptosis and cell cycle arrest, while BTG2 knockdown could relieve the effect caused by gamma ray on A549 cells. Moreover, we confirmed that the effect of BTG2 partly depends on p53 expression and gamma ray-promoting BTG2 expression through the JNK/NF-κB signaling pathway. Our study assessed the possible mechanism of gamma ray in tumor treatment and also investigated the role of BTG2 in gamma ray therapy. All these findings might give a deep understanding of the effect of gamma ray on the progression of lung cancer involving BTG2.
Investigation of Martian H2O and CO2 via orbital gamma ray spectroscopy
NASA Technical Reports Server (NTRS)
Evans, Larry G.; Squyres, Steven W.
1987-01-01
The capability of an orbital gamma ray spectrometer to address presently unanswered questions concerning H2O and CO2 on Mars is investigated. The gamma ray signal produced by the Martian atmosphere and by several simple models of Martian surface materials is calculated. Results are reported for: (1) the production of neutrons in the atmosphere and in the subsurface material by cosmic ray interactions, (2) the scattering of neutrons and the resultant neutron energy spectrum and spatial distributions, (3) the reproduction of gamma rays by neutron prompt capture and nonelastic scatter reactions, (4) the production of gamma rays by natural radionuclides, (5) the attenuation of the gamma ray signal by passage through surface materials and the Martian atmosphere, (6) the production of the gamma ray continuum background, and (7) the uncertainty in gamma ray line strengths that results from the combined signal and background observed by the detector.
Significance of medium energy gamma ray astronomy in the study of cosmic rays
NASA Technical Reports Server (NTRS)
Fichtel, C. E.; Kniffen, D. A.; Thompson, D. J.; Bignami, G. F.; Cheung, C. Y.
1975-01-01
Medium energy (about 10 to 30 MeV) gamma ray astronomy provides information on the product of the galactic electron cosmic ray intensity and the galactic matter to which the electrons are dynamically coupled by the magnetic field. Because high energy (greater than 100 MeV) gamma ray astronomy provides analogous information for the nucleonic cosmic rays and the relevant matter, a comparison between high energy and medium energy gamma ray intensities provides a direct ratio of the cosmic ray electrons and nucleons throughout the galaxy. A calculation of gamma ray production by electron bremsstrahlung shows that: bremsstrahlung energy loss is probably not negligible over the lifetime of the electrons in the galaxy; and the approximate bremsstrahlung calculation often used previously overestimates the gamma ray intensity by about a factor of two. As a specific example, expected medium energy gamma ray intensities are calculated for the speral arm model.
Gamma-Ray Astronomy Across 6 Decades of Energy: Synergy between Fermi, IACTs, and HAWC
NASA Technical Reports Server (NTRS)
Hui, C. Michelle
2017-01-01
Gamma Ray Observatories, Gamma-Ray Astrophysics, GeV TeV Sky Survey, Galaxy, Galactic Plane, Source Distribution, The gamma-ray sky is currently well-monitored with good survey coverage. Many instruments from different waveband/messenger (X rays, gamma rays, neutrinos, gravitational waves) available for simultaneous observations. Both wide-field and pointing instruments in development and coming online in the next decade LIGO
[Argonne Logo] [DOE Logo] Cosmic Gamma-Rays Home Publications Talks People Students Argonne > ; HEP > Cosmic Gamma-Rays Projects VERITAS Past Projects TrICE What's New CTA Cosmic Gamma-Rays The
Fermi Gamma-Ray Space Telescope: Highlights of the GeV Sky
NASA Technical Reports Server (NTRS)
Thomspon, D. J.
2011-01-01
Because high-energy gamma rays can be produced by processes that also produce neutrinos. the gamma-ray survey of the sky by the Fermi Gamma-ray Space Telescope offers a view of potenl ial targds for neutrino observations. Gamma-ray bursts. active galactic nuclei, and supernova remnants are all sites where hadronic, neutrino-producing interactions are plausible. Pulsars, pulsar wind nebulae, and binary sources are all phenomena that reveal leptonic particle acceleration through their gamma-ray emission. \\Vhile important to gamma-ray astrophysics. such sources are of less interest to neutrino studies. This talk will present a broad overview of the constantly changing sky seen with the Large Area Telescope (LAT) on the Fermi spacecraft.
The Andromeda galaxy in gamma-rays
NASA Technical Reports Server (NTRS)
Oezel, M. E.; Berkhuijsen, E. M.
1987-01-01
Implications of high-energy gamma-ray observations of the Andromeda galaxy with the next generation of satellites Gamma-1 and GRO are discussed in the context of the origin of cosmic rays and gamma-ray processes. The present estimate of the total gamma-ray flux of this galaxy at energies above 100 MeV is a factor of about three less than previous estimates.
Gamma ray spectroscopy in astrophysics. [conferences
NASA Technical Reports Server (NTRS)
Cline, T. L. (Editor); Ramaty, R. (Editor)
1978-01-01
Experimental and theoretical aspects of gamma ray spectroscopy in high energy astrophysics are discussed. Line spectra from solar, stellar, planetary, and cosmic gamma rays are examined as well as HEAO investigations, the prospects of a gamma ray observatory, and follow-on X-ray experiments in space.
Gamma-400 Science Objectives Built on the Current HE Gamma-Ray and CR Results
NASA Technical Reports Server (NTRS)
Moiseev, Alexander; Mitchell, John; Thompson, David
2012-01-01
The main scientific interest of the Russian Gamma-400 team: Observe gamma-rays above approximately 50 GeV with excellent energy and angular resolution with the goals of: (1) Studying the fine spectral structure of the isotropic high-energy gamma-radiation, (2) Attempting to identify the many still-unidentified Fermi-LAT gamma-ray sources. Gamma-400 will likely be the only space-based gamma-ray observatory operating at the end of the decade. In our proposed Gamma-400-LE version, it will substantially improve upon the capabilities of Fermi LAT and AGILE in both LE and HE energy range. Measuring gamma-rays from approx 20 MeV to approx 1 TeV for at least 7 years, Gamma-400-LE will address the topics of dark matter, cosmic ray origin and propagation, neutron stars, flaring pulsars, black holes, AGNs, GRBs, and actively participate in multiwavelength campaigns.
Amor, S; André, N; Kilchytska, V; Tounsi, F; Mezghani, B; Gérard, P; Ali, Z; Udrea, F; Flandre, D; Francis, L A
2017-05-05
In this paper, we investigate the recovery of some semiconductor-based components, such as N/P-type field-effect transistors (FETs) and a complementary metal-oxide-semiconductor (CMOS) inverter, after being exposed to a high total dose of gamma ray radiation. The employed method consists mainly of a rapid, low power and in situ annealing mitigation technique by silicon-on-insulator micro-hotplates. Due to the ionizing effect of the gamma irradiation, the threshold voltages showed an average shift of -580 mV for N-channel transistors, and -360 mV for P-MOSFETs. A 4 min double-cycle annealing of components with a heater temperature up to 465 °C, corresponding to a maximum power of 38 mW, ensured partial recovery but was not sufficient for full recovery. The degradation was completely recovered after the use of a built-in high temperature annealing process, up to 975 °C for 8 min corresponding to a maximum power of 112 mW, which restored the normal operating characteristics for all devices after their irradiation.
NASA Astrophysics Data System (ADS)
Amor, S.; André, N.; Kilchytska, V.; Tounsi, F.; Mezghani, B.; Gérard, P.; Ali, Z.; Udrea, F.; Flandre, D.; Francis, L. A.
2017-05-01
In this paper, we investigate the recovery of some semiconductor-based components, such as N/P-type field-effect transistors (FETs) and a complementary metal-oxide-semiconductor (CMOS) inverter, after being exposed to a high total dose of gamma ray radiation. The employed method consists mainly of a rapid, low power and in situ annealing mitigation technique by silicon-on-insulator micro-hotplates. Due to the ionizing effect of the gamma irradiation, the threshold voltages showed an average shift of -580 mV for N-channel transistors, and -360 mV for P-MOSFETs. A 4 min double-cycle annealing of components with a heater temperature up to 465 °C, corresponding to a maximum power of 38 mW, ensured partial recovery but was not sufficient for full recovery. The degradation was completely recovered after the use of a built-in high temperature annealing process, up to 975 °C for 8 min corresponding to a maximum power of 112 mW, which restored the normal operating characteristics for all devices after their irradiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Clark, E; Marie Kane, M
2008-12-12
Four formulations of EPDM (ethylene-propylene diene monomer) elastomer were exposed to tritium gas initially at one atmosphere and ambient temperature for between three and four months in closed containers. Material properties that were characterized include density, volume, mass, appearance, flexibility, and dynamic mechanical properties. The glass transition temperature was determined by analysis of the dynamic mechanical property data per ASTM standards. EPDM samples released significant amounts of gas when exposed to tritium, and the glass transition temperature increased by about 3 C. during the exposure. Effects of ultraviolet and gamma irradiation on the surface electrical conductivity of two types ofmore » polyaniline films are also documented as complementary results to planned tritium exposures. Future work will determine the effects of tritium gas exposure on the electrical conductivity of polyaniline films, to demonstrate whether such films can be used as a sensor to detect tritium. Surface conductivity was significantly reduced by irradiation with both gamma rays and ultraviolet light. The results of the gamma and UV experiments will be correlated with the tritium exposure results.« less
Multiwavelength observations of a VHE gamma-ray flare from PKS 1510-089 in 2015
NASA Astrophysics Data System (ADS)
Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; Arcaro, C.; Babić, A.; Banerjee, B.; Bangale, P.; Barres de Almeida, U.; Barrio, J. A.; Bednarek, W.; Bernardini, E.; Berti, A.; Biasuzzi, B.; Biland, A.; Blanch, O.; Bonnefoy, S.; Bonnoli, G.; Borracci, F.; Bretz, T.; Carosi, R.; Carosi, A.; Chatterjee, A.; Colin, P.; Colombo, E.; Contreras, J. L.; Cortina, J.; Covino, S.; Cumani, P.; Da Vela, P.; Dazzi, F.; De Angelis, A.; De Lotto, B.; de Oña Wilhelmi, E.; Di Pierro, F.; Doert, M.; Domínguez, A.; Dominis Prester, D.; Dorner, D.; Doro, M.; Einecke, S.; Eisenacher Glawion, D.; Elsaesser, D.; Engelkemeier, M.; Fallah Ramazani, V.; Fernández-Barral, A.; Fidalgo, D.; Fonseca, M. V.; Font, L.; Fruck, C.; Galindo, D.; García López, R. J.; Garczarczyk, M.; Gaug, M.; Giammaria, P.; Godinović, N.; Gora, D.; Guberman, D.; Hadasch, D.; Hahn, A.; Hassan, T.; Hayashida, M.; Herrera, J.; Hose, J.; Hrupec, D.; Hughes, G.; Ishio, K.; Konno, Y.; Kubo, H.; Kushida, J.; Kuveždić, D.; Lelas, D.; Lindfors, E.; Lombardi, S.; Longo, F.; López, M.; Majumdar, P.; Makariev, M.; Maneva, G.; Manganaro, M.; Mannheim, K.; Maraschi, L.; Mariotti, M.; Martínez, M.; Mazin, D.; Menzel, U.; Mirzoyan, R.; Moralejo, A.; Moretti, E.; Nakajima, D.; Neustroev, V.; Niedzwiecki, A.; Nievas Rosillo, M.; Nilsson, K.; Nishijima, K.; Noda, K.; Nogués, L.; Paiano, S.; Palacio, J.; Palatiello, M.; Paneque, D.; Paoletti, R.; Paredes, J. M.; Paredes-Fortuny, X.; Pedaletti, G.; Peresano, M.; Perri, L.; Persic, M.; Poutanen, J.; Prada Moroni, P. G.; Prandini, E.; Puljak, I.; Garcia, J. R.; Reichardt, I.; Rhode, W.; Ribó, M.; Rico, J.; Saito, T.; Satalecka, K.; Schroeder, S.; Schweizer, T.; Shore, S. N.; Sillanpää, A.; Sitarek, J.; Šnidarić, I.; Sobczynska, D.; Stamerra, A.; Strzys, M.; Surić, T.; Takalo, L.; Tavecchio, F.; Temnikov, P.; Terzić, T.; Tescaro, D.; Teshima, M.; Torres, D. F.; Torres-Albà, N.; Toyama, T.; Treves, A.; Vanzo, G.; Vazquez Acosta, M.; Vovk, I.; Ward, J. E.; Will, M.; Wu, M. H.; Zarić, D.; Desiante, R.; Becerra González, J.; D'Ammando, F.; Larsson, S.; Raiteri, C. M.; Reinthal, R.; Lähteenmäki, A.; Järvelä, E.; Tornikoski, M.; Ramakrishnan, V.; Jorstad, S. G.; Marscher, A. P.; Bala, V.; MacDonald, N. R.; Kaur, N.; Sameer; Baliyan, K.; Acosta-Pulido, J. A.; Lazaro, C.; Martí-nez-Lombilla, C.; Grinon-Marin, A. B.; Pastor Yabar, A.; Protasio, C.; Carnerero, M. I.; Jermak, H.; Steele, I. A.; Larionov, V. M.; Borman, G. A.; Grishina, T. S.
2017-07-01
Context. PKS 1510-089 is one of only a few flat spectrum radio quasars detected in the very-high-energy (VHE, > 100 GeV) gamma-ray band. Aims: We study the broadband spectral and temporal properties of the PKS 1510-089 emission during a high gamma-ray state. Methods: We performed VHE gamma-ray observations of PKS 1510-089 with the Major Atmospheric Gamma Imaging Cherenkov (MAGIC) telescopes during a long, high gamma-ray state in May 2015. In order to perform broadband modeling of the source, we have also gathered contemporaneous multiwavelength data in radio, IR, optical photometry and polarization, UV, X-ray, and GeV gamma-ray ranges. We construct a broadband spectral energy distribution (SED) in two periods, selected according to VHE gamma-ray state. Results: PKS 1510-089 was detected by MAGIC during a few day-long observations performed in the middle of a long, high optical and gamma-ray state, showing for the first time a significant VHE gamma-ray variability. Similarly to the optical and gamma-ray high state of the source detected in 2012, it was accompanied by a rotation of the optical polarization angle and the emission of a new jet component observed in radio. However, owing to large uncertainty on the knot separation time, the association with the VHE gamma-ray emission cannot be firmly established. The spectral shape in the VHE band during the flare is similar to those obtained during previous measurements of the source. The observed flux variability sets constraints for the first time on the size of the region from which VHE gamma rays are emitted. We model the broadband SED in the framework of the external Compton scenario and discuss the possible emission site in view of multiwavelength data and alternative emission models.
Development of neutron imaging beamline for NDT applications at Dhruva reactor, India
NASA Astrophysics Data System (ADS)
Shukla, Mayank; Roy, Tushar; Kashyap, Yogesh; Shukla, Shefali; Singh, Prashant; Ravi, Baribaddala; Patel, Tarun; Gadkari, S. C.
2018-05-01
Thermal neutron imaging techniques such as radiography or tomography are very useful tool for various scientific investigations and industrial applications. Neutron radiography is complementary to X-ray radiography, as neutrons interact with nucleus as compared to X-ray interaction with orbital electrons. We present here design and development of a neutron imaging beamline at 100 MW Dhruva research reactor for neutron imaging applications such as radiography, tomography and phase contrast imaging. Combinations of sapphire and bismuth single crystals have been used as thermal neutron filter/gamma absorber at the input of a specially designed collimator to maximize thermal neutron to gamma ratio. The maximum beam size of neutrons has been restricted to ∼120 mm diameter at the sample position. A cadmium ratio of ∼250 with L / D ratio of 160 and thermal neutron flux of ∼ 4 × 107 n/cm2 s at the sample position has been measured. In this paper, different aspects of the beamline design such as collimator, shielding, sample manipulator, digital imaging system are described. Nondestructive radiography/tomography experiments on hydrogen concentration in Zr-alloy, aluminium foam, ceramic metal seals etc. are also presented.
Observation of nuclear reactors on satellites with a balloon-borne gamma-ray telescope
NASA Technical Reports Server (NTRS)
O'Neill, Terrence J.; Kerrick, Alan D.; Ait-Ouamer, Farid; Tumer, O. Tumay; Zych, Allen D.
1989-01-01
Four Soviet nuclear-powered satellites flying over a double Compton gamma-ray telescope resulted in the detection of gamma rays with 0.3-8.0 MeV energies on April 15, 1988, as the balloonborne telescope searched, from a 35-km altitude, for celestial gamma-ray sources. The satellites included Cosmos 1900 and 1932. The USSR is the only nation currently employing moderated nuclear reactors for satellite power; reactors in space may cause significant problems for gamma-ray astronomy by increasing backgrounds, especially in the case of gamma-ray bursts.
Future Hard X-ray and Gamma-Ray Missions
NASA Astrophysics Data System (ADS)
Krawczynski, Henric; Physics of the Cosmos (PCOS) Gamma Ray Science Interest Group (GammaSIG) Team
2017-01-01
With four major NASA and ESA hard X-ray and gamma-ray missions in orbit (Swift, NuSTAR, INTEGRAL, and Fermi) hard X-ray and gamma-ray astronomy is making major contributions to our understanding of the cosmos. In this talk, I will summarize the current and upcoming activities of the Physics of the Cosmos Gamma Ray Science Interest Group and highlight a few of the future hard X-ray and gamma-ray mission discussed by the community. HK thanks NASA for the support through the awards NNX14AD19G and NNX16AC42G and for PCOS travel support.
Probing Intrinsic Properties of Short Gamma-Ray Bursts with Gravitational Waves.
Fan, Xilong; Messenger, Christopher; Heng, Ik Siong
2017-11-03
Progenitors of short gamma-ray bursts are thought to be neutron stars coalescing with their companion black hole or neutron star, which are one of the main gravitational wave sources. We have devised a Bayesian framework for combining gamma-ray burst and gravitational wave information that allows us to probe short gamma-ray burst luminosities. We show that combined short gamma-ray burst and gravitational wave observations not only improve progenitor distance and inclination angle estimates, they also allow the isotropic luminosities of short gamma-ray bursts to be determined without the need for host galaxy or light-curve information. We characterize our approach by simulating 1000 joint short gamma-ray burst and gravitational wave detections by Advanced LIGO and Advanced Virgo. We show that ∼90% of the simulations have uncertainties on short gamma-ray burst isotropic luminosity estimates that are within a factor of two of the ideal scenario, where the distance is known exactly. Therefore, isotropic luminosities can be confidently determined for short gamma-ray bursts observed jointly with gravitational waves detected by Advanced LIGO and Advanced Virgo. Planned enhancements to Advanced LIGO will extend its range and likely produce several joint detections of short gamma-ray bursts and gravitational waves. Third-generation gravitational wave detectors will allow for isotropic luminosity estimates for the majority of the short gamma-ray burst population within a redshift of z∼1.
Pulsed high-energy gamma rays from PSR 1055-52
NASA Technical Reports Server (NTRS)
Fierro, J. M.; Bertsch, D. L.; Brazier, K. T.; Chiang, J.; D'Amico, N.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Johnston, S.; Kanbach, G.
1993-01-01
The Energetic Gamma Ray Experiment Telescope (EGRET) aboard the Compton Gamma Ray Observatory has detected a high-energy gamma-ray source at a position coincident with that of the radio pulsar PSR 1055-52. Analysis of the EGRET data at the radio pulsar period of 197 ms has revealed pulsed gamma-radiation at energies above 300 MeV, making PSR 1055-52 the fifth detected high-energy gamma-ray pulsar. The pulsed radiation from PSR 1055-52 has a very hard photon spectral index of -1.18 +/- 0.16 and a high efficiency for converting its rotational energy into gamma-rays. No unpulsed emission was observed.
NASA Technical Reports Server (NTRS)
Schneid, E. J.; Bertsch, D. L.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kwok, P. W.; Mattox, J. R.; Sreekumar, P.; Thompson, D. J.; Kanbach, G.
1992-01-01
The Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory has observed energetic gamma ray bursts and flares. On May 3, 1991, EGRET detected a gamma ray burst both in the energy measuring NaI (Tl) scintillator and independently in the spark chamber imaging assembly. The NaI spectra were accumulated by a special BURST mode of EGRET. The spectra were measured over a range from 1 to 200 MeV, in three sequential spectra of 1,2, and 4 seconds. During the peak of the burst, six individual gamma rays were detected in the spark chamber, allowing a determination of the burst arrival direction. The intense flares of June were also detected. A solar flare on June 4 was observed to last for several minutes and for a brief time, less than a minute, had significant emission of gamma rays exceeding 150 MeV.
Gamma-ray astronomy: From Fermi up to the HAWC high-energy {gamma}-ray observatory in Sierra Negra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carraminana, Alberto; Collaboration: HAWC Collaboration
Gamma-rays represent the most energetic electromagnetic window for the study of the Universe. They are studied both from space at MeV and GeV energies, with instruments like the Fermi{gamma}-ray Space Telescope, and at TeV energies with ground based instruments profiting of particle cascades in the atmosphere and of the Cerenkov radiation of charged particles in the air or in water. The Milagro gamma-ray observatory represented the first instrument to successfully implement the water Cerenkov technique for {gamma}-ray astronomy, opening the ground for the more sensitive HAWC {gamma}-ray observatory, currently under development in the Sierra Negra site and already providing earlymore » science results.« less
Very High-Energy Gamma-Ray Sources.
ERIC Educational Resources Information Center
Weekes, Trevor C.
1986-01-01
Discusses topics related to high-energy, gamma-ray astronomy (including cosmic radiation, gamma-ray detectors, high-energy gamma-ray sources, and others). Also considers motivation for the development of this field, the principal results to date, and future prospects. (JN)
Exploring the Extreme Universe with the Fermi Gamma-Ray Space Telescope
NASA Technical Reports Server (NTRS)
Thompson, D. J.
2010-01-01
Because high-energy gamma rays are produced by powerful sources, the Fermi Gamma-ray Space Telescope provides a window on extreme conditions in the Universe. Some key observations of the constantly changing gamma-ray sky include: (1) Gamma-rays from pulsars appear to come from a region well above the surface of the neutron star; (2) Multiwavelength studies of blazars show that simple models of jet emission are not always adequate to explain what is seen; (3) Gamma-ray bursts can constrain models of quantum gravity; (4) Cosmic-ray electrons at energies approaching 1 TeV suggest a local source for some of these particles.
The large area high resolution gamma ray astrophysics facility - HR-GRAF
NASA Astrophysics Data System (ADS)
Fenyves, E. J.; Chaney, R. C.; Hoffman, J. H.; Cline, D. B.; Atac, M.; Park, J.; White, S. R.; Zych, A. D.; Tumer, Q. T.; Hughes, E. B.
1990-03-01
The long-term program is described in terms of its equipment, scientific objectives, and long-range scientific studies. A prototype of a space-based large-area high-resolution gamma-ray facility (HR-GRAF) is being developed to examine pointlike and diffuse gamma-ray sources in the range 1 MeV-100 GeV. The instrument for the facility is proposed to have high angular and energy resolution and very high sensitivity to permit the study of the proposed objects. The primary research targets include the mapping of galactic gamma radiation, observing the angular variations of diffuse gamma rays, and studying the Galactic center with particular emphasis on the hypothetical black hole. Also included in the research plans are obtaining data on gamma-ray bursters, investigating the transmission of gamma rays from cold dark matter, and studying nuclear gamma-ray lines.
Gamma ray astrophysics. [emphasizing processes and absorption
NASA Technical Reports Server (NTRS)
Stecker, F. W.
1974-01-01
Gamma ray production processes are reviewed, including Compton scattering, synchrotron radiation, bremsstrahlung interactions, meson decay, nucleon-antinucleon annihilations, and pion production. Gamma ray absorption mechanisms through interactions with radiation and with matter are discussed, along with redshifts and gamma ray fluxes.
Portable compton gamma-ray detection system
Rowland, Mark S [Alamo, CA; Oldaker, Mark E [Pleasanton, CA
2008-03-04
A Compton scattered gamma-ray detector system. The system comprises a gamma-ray spectrometer and an annular array of individual scintillators. The scintillators are positioned so that they are arrayed around the gamma-ray spectrometer. The annular array of individual scintillators includes a first scintillator. A radiation shield is positioned around the first scintillator. A multi-channel analyzer is operatively connected to the gamma-ray spectrometer and the annular array of individual scintillators.
Simultaneous optical/gamma-ray observations of GRBs
NASA Technical Reports Server (NTRS)
Greiner, J.; Wenzel, W.; Hudec, R.; Moskalenko, E. I.; Metlov, V.; Chernych, N. S.; Getman, V. S.; Ziener, Rainer; Birkle, K.; Bade, N.
1994-01-01
Details on the project to search for serendipitous time correlated optical photographic observations of Gamma Ray Bursters (GRB's) are presented. The ongoing photographic observations at nine observatories are used to look for plates which were exposed simultaneously with a gamma ray burst detected by the gamma ray instrument team (BATSE) and contain the burst position. The results for the first two years of the gamma ray instrument team operation are presented.
NASA Technical Reports Server (NTRS)
Ramaty, R.; Lingenfelter, R. E.
1986-01-01
Observations of gamma rays from solar flares, gamma ray bursts, the Galactic center, galactic nucleosynthesis, SS433, and Cygnus X-3, and their effects on astrophysical problems are discussed. It is observed that gamma ray spectra from solar flares are applicable to the study of particle acceleration and confinement and the determination of chemical abundances in the solar atmosphere. The gamma ray lines from the compact galactic object SS433 are utilized to examine the acceleration of jets, and analysis of the gamma ray lines of Cygnus X-3 reveal that particles can be accelerated in compact sources to ultrahigh energies.
Future prospects for gamma-ray
NASA Technical Reports Server (NTRS)
Fichtel, C.
1980-01-01
Astrophysical phenomena discussed are: the very energetic and nuclear processes associated with compact objects; astrophysical nucleo-synthesis; solar particle acceleration; the chemical composition of the planets and other bodies of the solar system; the structure of our galaxy; the origin and dynamic pressure effects of the cosmic rays; the high energy particles and energetic processes in other galaxies, especially active ones; and the degree of matter antimater symmetry of the universe. The gamma ray results of GAMMA-I, the gamma ray observatory, the gamma ray burst network, solar polar, and very high energy gamma ray telescopes on the ground provide justification for more sophisticated telescopes.
Arcsec source location measurements in gamma-ray astronomy from a lunar observatory
NASA Astrophysics Data System (ADS)
Koch, D. G.; Hughes, B. E.
1990-03-01
The physical processes typically used in the detection of high energy gamma-rays do not permit good angular resolution, which makes difficult the unambiguous association of discrete gamma-ray sources with objects emitting at other wavelengths. This problem can be overcome by placing gamma-ray detectors on the moon and using the horizon as an occulting edge to achieve arcsec resolution. For the purpose of discussion, this concept is examined for gamma rays above about 20 MeV for which pair production dominates the detection process and locally-generated nuclear gamma rays do not contribute to the background.
Detection of high-energy gamma-ray emission from the globular cluster 47 Tucanae with Fermi.
Abdo, A A; Ackermann, M; Ajello, M; Atwood, W B; Axelsson, M; Baldini, L; Ballet, J; Barbiellini, G; Bastieri, D; Baughman, B M; Bechtol, K; Bellazzini, R; Berenji, B; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brez, A; Brigida, M; Bruel, P; Burnett, T H; Caliandro, G A; Cameron, R A; Caraveo, P A; Casandjian, J M; Cecchi, C; Celik, O; Charles, E; Chaty, S; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Conrad, J; Cutini, S; Dermer, C D; de Palma, F; Digel, S W; Dormody, M; do Couto e Silva, E; Drell, P S; Dubois, R; Dumora, D; Farnier, C; Favuzzi, C; Fegan, S J; Focke, W B; Frailis, M; Fukazawa, Y; Fusco, P; Gargano, F; Gasparrini, D; Gehrels, N; Germani, S; Giebels, B; Giglietto, N; Giordano, F; Glanzman, T; Godfrey, G; Grenier, I A; Grove, J E; Guillemot, L; Guiriec, S; Hanabata, Y; Harding, A K; Hayashida, M; Hays, E; Horan, D; Hughes, R E; Jóhannesson, G; Johnson, A S; Johnson, R P; Johnson, T J; Johnson, W N; Kamae, T; Katagiri, H; Kawai, N; Kerr, M; Knödlseder, J; Kuehn, F; Kuss, M; Lande, J; Latronico, L; Lemoine-Goumard, M; Longo, F; Loparco, F; Lott, B; Lovellette, M N; Lubrano, P; Makeev, A; Mazziotta, M N; McConville, W; McEnery, J E; Meurer, C; Michelson, P F; Mitthumsiri, W; Mizuno, T; Moiseev, A A; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nolan, P L; Norris, J P; Nuss, E; Ohsugi, T; Omodei, N; Orlando, E; Ormes, J F; Paneque, D; Panetta, J H; Parent, D; Pelassa, V; Pepe, M; Pierbattista, M; Piron, F; Porter, T A; Rainò, S; Rando, R; Razzano, M; Rea, N; Reimer, A; Reimer, O; Reposeur, T; Ritz, S; Rochester, L S; Rodriguez, A Y; Romani, R W; Roth, M; Ryde, F; Sadrozinski, H F-W; Sanchez, D; Sander, A; Saz Parkinson, P M; Sgrò, C; Smith, D A; Smith, P D; Spandre, G; Spinelli, P; Starck, J-L; Strickman, M S; Suson, D J; Tajima, H; Takahashi, H; Tanaka, T; Thayer, J B; Thayer, J G; Thompson, D J; Tibaldo, L; Torres, D F; Tosti, G; Tramacere, A; Uchiyama, Y; Usher, T L; Vasileiou, V; Vilchez, N; Vitale, V; Wang, P; Webb, N; Winer, B L; Wood, K S; Ylinen, T; Ziegler, M
2009-08-14
We report the detection of gamma-ray emissions above 200 megaelectron volts at a significance level of 17sigma from the globular cluster 47 Tucanae, using data obtained with the Large Area Telescope onboard the Fermi Gamma-ray Space Telescope. Globular clusters are expected to emit gamma rays because of the large populations of millisecond pulsars that they contain. The spectral shape of 47 Tucanae is consistent with gamma-ray emission from a population of millisecond pulsars. The observed gamma-ray luminosity implies an upper limit of 60 millisecond pulsars present in 47 Tucanae.
Discoveries by the Fermi Gamma Ray Space Telescope
NASA Technical Reports Server (NTRS)
Gehrels, Neil
2011-01-01
Fermi is a large space gamma-ray mission developed by NASA and the DOE with major contributions from France, Germany, Italy, Japan and Sweden. It was launched in June 2008 and has been performing flawlessly since then. The main instrument is the Large Area Telescope (LAT) operating in the 20 MeV to 300 GeV range and a smaller monitor instrument is the Gamma-ray Burst Monitor (GBM) operating in the 8 keV to 40 MeV range. New findings are occurring every week. Some of the key discoveries are: 1) Discovery of many new gamma-ray pulsars, including gamma-ray only and millisecond pulsars. 2) Detection of high energy gamma-ray emission from globular clusters, most likely due to summed emission from msec pulsars. 3) Discovery of delayed and extended high energy gamma-ray emission from short and long gamma-ray busts. 4) Detection of approximately 250 gamma-ray bursts per year with the GBM instrument. 5) Most accurate measurement of the cosmic ray electron spectrum between 30 GeV and 1 TeV, showing some excess above the conventional diffusion model. The talk will present the new discoveries and their implications.
Search for gamma ray lines from supernovae and supernova remnants
NASA Technical Reports Server (NTRS)
Chupp, E. L.; Forrest, D. J.; Suri, A. N.; Adams, R.; Tsai, C.
1974-01-01
A gamma ray monitor with a NaI crystal shielded with a cup-shaped CsI cover was contained in the rotating wheel compartment of the OSO-7 spacecraft for measuring the gamma ray spectra from 0.3 to 10 MeV in search for gamma ray lines from a possible remnant in the Gum Nebula and the apparent Type I supernovae in NGC5253. A brief analysis of data yielded no positive indications for X-rays, gamma ray lines, or continuum from these sources.
Gamma-ray irradiation enhanced boron-10 compound accumulation in murine tumors.
Liu, Yong; Nagata, Kenji; Masunaga, Shin-ichiro; Suzuki, Minoru; Kashino, Genro; Kinashi, Yuko; Tanaka, Hiroki; Sakurai, Yoshinori; Maruhashi, Akira; Ono, Koji
2009-11-01
Previous studies have demonstrated that X-ray irradiation affects angiogenesis in tumors. Here, we studied the effects of gamma-ray irradiation on boron-10 compound accumulation in a murine tumor model. The mouse squamous cell carcinoma was irradiated with gamma-ray before BSH ((10)B-enriched borocaptate sodium) administration. Then, the boron-10 concentrations in tumor and normal muscle tissues were measured by prompt gamma-ray spectrometry (PGA). A tumor blood flow assay was performed, and cell killing effects of neutron irradiation with various combinations of BSH and gamma-rays were also examined. BSH concentrations of tumor tissues were 16.1 +/- 0.6 microg/g, 16.7 +/- 0.5 microg/g and 17.8 +/- 0.5 microg/g at 72 hours after gamma-ray irradiation at doses of 5, 10, and 20 Gy, compared with 13.1 +/- 0.5 microg/g in unirradiated tumor tissues. The enhancing inhibition of colony formation by neutron irradiation with BSH was also found after gamma-ray irradiation. In addition, increasing Hoechst 33342 perfusion was also observed. In this study, we demonstrated that gamma-ray irradiation enhances BSH accumulation in tumors. The present results suggest that the enhancement of (10)B concentration that occurs after gamma-ray irradiation may be due to the changes in the extracellular microenvironment, including in tumor vessels, induced by gamma-ray irradiation.
Ninteenth International Cosmic Ray Conference. OG Sessions, Volume 1
NASA Technical Reports Server (NTRS)
Jones, F. C. (Compiler)
1985-01-01
Contributed papers addressing cosmic ray origin and galactic phenomena are compiled. The topic areas covered in this volume include gamma ray bursts, gamma rays from point sources, and diffuse gamma ray emission.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, Nayantara, E-mail: nayan@phy.iitb.ac.in
2008-06-15
Centaurus A, the cosmic ray accelerator a few Mpc away from us, is possibly one of the nearest sources of extremely high energy cosmic rays. We investigate whether the gamma ray data currently available from Centaurus A in the GeV-TeV energy band can be explained with only proton-proton interactions. We show that for a single power law proton spectrum, mechanisms of {gamma}-ray production other than proton-proton interactions are needed inside this radio-galaxy to explain the gamma ray flux observed by EGRET, upper limits from HESS/CANGAROO-III and the correlated extremely energetic cosmic ray events observed by the Pierre Auger experiment. Inmore » future, with better {gamma}-ray data, and simultaneous observation with {gamma}-ray and cosmic ray detectors, it will be possible to carry out such studies on different sources in more detail.« less
Fermi gamma-ray imaging of a radio galaxy.
Abdo, A A; Ackermann, M; Ajello, M; Atwood, W B; Baldini, L; Ballet, J; Barbiellini, G; Bastieri, D; Baughman, B M; Bechtol, K; Bellazzini, R; Berenji, B; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brez, A; Brigida, M; Bruel, P; Burnett, T H; Buson, S; Caliandro, G A; Cameron, R A; Caraveo, P A; Casandjian, J M; Cavazzuti, E; Cecchi, C; Celik, O; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Colafrancesco, S; Cominsky, L R; Conrad, J; Costamante, L; Cutini, S; Davis, D S; Dermer, C D; de Angelis, A; de Palma, F; Digel, S W; do Couto e Silva, E; Drell, P S; Dubois, R; Dumora, D; Farnier, C; Favuzzi, C; Fegan, S J; Finke, J; Focke, W B; Fortin, P; Fukazawa, Y; Funk, S; Fusco, P; Gargano, F; Gasparrini, D; Gehrels, N; Georganopoulos, M; Germani, S; Giebels, B; Giglietto, N; Giordano, F; Giroletti, M; Glanzman, T; Godfrey, G; Grenier, I A; Grove, J E; Guillemot, L; Guiriec, S; Hanabata, Y; Harding, A K; Hayashida, M; Hays, E; Hughes, R E; Jackson, M S; Jóhannesson, G; Johnson, A S; Johnson, T J; Johnson, W N; Kamae, T; Katagiri, H; Kataoka, J; Kawai, N; Kerr, M; Knödlseder, J; Kocian, M L; Kuss, M; Lande, J; Latronico, L; Lemoine-Goumard, M; Longo, F; Loparco, F; Lott, B; Lovellette, M N; Lubrano, P; Madejski, G M; Makeev, A; Mazziotta, M N; McConville, W; McEnery, J E; Meurer, C; Michelson, P F; Mitthumsiri, W; Mizuno, T; Moiseev, A A; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nolan, P L; Norris, J P; Nuss, E; Ohsugi, T; Omodei, N; Orlando, E; Ormes, J F; Paneque, D; Parent, D; Pelassa, V; Pepe, M; Pesce-Rollins, M; Piron, F; Porter, T A; Rainò, S; Rando, R; Razzano, M; Razzaque, S; Reimer, A; Reimer, O; Reposeur, T; Ritz, S; Rochester, L S; Rodriguez, A Y; Romani, R W; Roth, M; Ryde, F; Sadrozinski, H F-W; Sambruna, R; Sanchez, D; Sander, A; Saz Parkinson, P M; Scargle, J D; Sgrò, C; Siskind, E J; Smith, D A; Smith, P D; Spandre, G; Spinelli, P; Starck, J-L; Stawarz, Ł; Strickman, M S; Suson, D J; Tajima, H; Takahashi, H; Takahashi, T; Tanaka, T; Thayer, J B; Thayer, J G; Thompson, D J; Tibaldo, L; Torres, D F; Tosti, G; Tramacere, A; Uchiyama, Y; Usher, T L; Vasileiou, V; Vilchez, N; Vitale, V; Waite, A P; Wallace, E; Wang, P; Winer, B L; Wood, K S; Ylinen, T; Ziegler, M; Hardcastle, M J; Kazanas, D
2010-05-07
The Fermi Gamma-ray Space Telescope has detected the gamma-ray glow emanating from the giant radio lobes of the radio galaxy Centaurus A. The resolved gamma-ray image shows the lobes clearly separated from the central active source. In contrast to all other active galaxies detected so far in high-energy gamma-rays, the lobe flux constitutes a considerable portion (greater than one-half) of the total source emission. The gamma-ray emission from the lobes is interpreted as inverse Compton-scattered relic radiation from the cosmic microwave background, with additional contribution at higher energies from the infrared-to-optical extragalactic background light. These measurements provide gamma-ray constraints on the magnetic field and particle energy content in radio galaxy lobes, as well as a promising method to probe the cosmic relic photon fields.
NASA Astrophysics Data System (ADS)
Peplowski, Patrick N.; Wilson, Jack T.; Beck, Andrew W.; Burks, Morgan; Goldsten, John O.; Lawrence, David J.
2018-01-01
Gamma-ray spectroscopy investigations characterize the chemical composition of planetary surfaces by measuring element-characteristic gamma rays with energies of ∼100 keV to ∼9 MeV. Over this energy range, the mean free path of a gamma ray varies from about 1 to 25 cm, therefore gamma-ray measurements sample subsurface composition. Many elements emit gamma rays at multiple, often widely spaced energies, so gamma-ray measurements can in principle also be used to identify depth-dependent variations in subsurface composition. We report results from laboratory measurements and radiation transport modeling designed to demonstrate this capability. The laboratory measurements verified the presence of depth-dependent gamma-ray signatures, and were then used to benchmark radiation transport simulations that were used to model realistic Mars-like scenarios. The models indicate that compositionally distinct subsurface deposits, buried to depths of ∼80 cm (125 g/cm2), can be identified using gamma-ray measurements. Going beyond identification to characterization (burial depth, relative composition of the layers) of the deposits requires knowledge of the vertical and horizontal variability in the water content of the near-surface surface materials, the local Galactic Cosmic Ray environment (magnitude and energy distribution), the depth-dependent neutron flux, gamma-ray production cross sections, and knowledge of the composition and column density of the atmosphere. The results of our experiments and models provided a basis for examining the utility of using orbiter- and lander-based gamma-ray measurements to identify subsurface deposits on Mars.
Principles and status of neutron-based inspection technologies
NASA Astrophysics Data System (ADS)
Gozani, Tsahi
2011-06-01
Nuclear based explosive inspection techniques can detect a wide range of substances of importance for a wide range of objectives. For national and international security it is mainly the detection of nuclear materials, explosives and narcotic threats. For Customs Services it is also cargo characterization for shipment control and customs duties. For the military and other law enforcement agencies it could be the detection and/or validation of the presence of explosive mines, improvised explosive devices (IED) and unexploded ordnances (UXO). The inspection is generally based on the nuclear interactions of the neutrons (or high energy photons) with the various nuclides present and the detection of resultant characteristic emissions. These can be discrete gamma lines resulting from the thermal neutron capture process (n,γ) or inelastic neutron scattering (n,n'γ) occurring with fast neutrons. The two types of reactions are generally complementary. The capture process provides energetic and highly penetrating gamma rays in most inorganic substances and in hydrogen, while fast neutron inelastic scattering provides relatively strong gamma-ray signatures in light elements such as carbon and oxygen. In some specific important cases unique signatures are provided by the neutron capture process in light elements such as nitrogen, where unusually high-energy gamma ray is produced. This forms the basis for key explosive detection techniques. In some cases the elastically scattered source (of mono-energetic) neutrons may provide information on the atomic weight of the scattering elements. The detection of nuclear materials, both fissionable (e.g., 238U) and fissile (e.g., 235U), are generally based on the fissions induced by the probing neutrons (or photons) and detecting one or more of the unique signatures of the fission process. These include prompt and delayed neutrons and gamma rays. These signatures are not discrete in energy (typically they are continua) but temporally and energetically significantly different from the background, thus making them readily distinguishable. The penetrability of neutrons as probes and signatures as well as the gamma ray signatures make neutron interrogation applicable to the inspection of large conveyances such as cars, trucks, marine containers and also smaller objects like explosive mines concealed in the ground. The application of nuclear interrogation techniques greatly depends on operational requirements. For example explosive mines and IED detection clearly require one-sided inspection, which excludes transmission based inspection (e.g., transmission radiography) and greatly limits others. The technologies developed over the last decades are now being implemented with good results. Further advances have been made over the last several years that increase the sensitivity, applicability and robustness of these systems. The principle, applications and status of neutron-based inspection techniques will be reviewed.
Fermi LAT Search for Dark Matter in Gamma-Ray Lines and the Inclusive Photon Spectrum
NASA Technical Reports Server (NTRS)
Ackermann, M.; Ajello, M.; Albert, A.; Baldini, L.; Barbiellini, G.; Bechtol, K.; Bellazzini, R.; Berenji, B.; Blandford, R. D.; Bloom, E. D.;
2012-01-01
Dark matter particle annihilation or decay can produce monochromatic gamma-ray lines and contribute to the diffuse gamma-ray background. Flux upper limits are presented for gamma-ray spectral lines from 7 to 200 GeV and for the diffuse gamma-ray background from 4.8 GeV to 264 GeV obtained from two years of Fermi Large Area Telescope data integrated over most of the sky. We give cross section upper limits and decay lifetime lower limits for dark matter models that produce gamma-ray lines or contribute to the diffuse spectrum, including models proposed as explanations of the PAMELA and Fermi cosmic-ray data.
Fermi LAT search for dark matter in gamma-ray lines and the inclusive photon spectrum
Ackermann, M.
2012-07-05
Dark matter particle annihilation or decay can produce monochromatic gamma-ray lines and contribute to the diffuse gamma-ray background. Furthermore, we present the flux upper limits for gamma-ray spectral lines from 7 to 200 GeV and for the diffuse gamma-ray background from 4.8 GeV to 264 GeV obtained from two years of Fermi Large Area Telescope data integrated over most of the sky. Here, we give cross-section upper limits and decay lifetime lower limits for dark matter models that produce gamma-ray lines or contribute to the diffuse spectrum, including models proposed as explanations of the PAMELA and Fermi cosmic-ray data.
The Role of Beam Geometry in Population Statistics and Pulse Profiles of Radio and Gamma-ray Pulsars
NASA Technical Reports Server (NTRS)
Gonthier, Peter L.; VanGuilder, Robert; Harding, Alice K.
2004-01-01
We present results of a pulsar population synthesis study that incorporates a number of recent developments and some significant improvements over our previous study. We have included the results of the Parkes multi-beam pulsar survey in our select group of nine radio surveys, doubling our sample of radio pulsars. More realistic geometries for the radio and gamma-ray beams are included in our Monte Carlo computer code that simulates the characteristics of the Galactic population of radio and gamma-ray pulsars. We adopted with some modifications the radio beam geometry of Arzoumanian, Chernoff & Cordes (2002). For the gamma-ray beam, we have assumed the slot gap geometry described in the work of Muslimov & Harding (2003). To account for the shape of the distribution of radio pulsars in the P(dot) - P diagram, we continue to find that decay of the magnetic field on a timescale of 2.8 Myr is needed. With all nine surveys, our model predicts that EGRET should have seen 7 radio-quiet (below the sensitivity of these radio surveys) and 19 radio-loud gamma-ray pulsars. AGILE (nominal sensitivity map) is expected to detect 13 radio-quiet and 37 radio-loud gamma-ray pulsars, while GLAST, with greater sensitivity is expected to detect 276 radio-quiet and 344 radio-loud gamma-ray pulsars. When the Parkes multi-beam pulsar survey is excluded, the ratio of radio-loud to radio-quiet gamma-ray pulsars decreases, especially for GLAST. The decrease for EGRET is 45%, implying that some fraction of EGRET unidentified sources are radio-loud gamma-ray pulsars. In the radio geometry adopted, short period pulsars are core dominated. Unlike the EGRET gamma-ray pulsars, our model predicts that when two gamma-ray peaks appear in the pulse profile, a dominant radio core peak appears in between the gamma-ray peaks. Our findings suggest that further improvements are required in describing both the radio and gamma-ray geometries.
Characteristics of Gamma-Ray Loud Blazars in the VLBA Imaging and Polarimetry Survey
NASA Technical Reports Server (NTRS)
Linford, J. D.; Taylor, G. B.; Romani, R. W.; Healey, S. E.; Helmboldt, J. F.; Readhead, A. C.; Reeves, R.; Richards, J. L.; Cotter, G.
2010-01-01
The radio properties of blazars detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed as part of the VLBA Imaging and Polarimetry Survey. This large, flux-limited sample of active galactic nuclei (AGNs) provides insights into the mechanism that produces strong gamma-ray emission. At lower flux levels, radio flux density does not directly correlate with gamma-ray flux. We find that the LAT-detected BL Lac objects tend to be similar to the non-LAT BL Lac objects, but that the LAT-detected FSRQs are often significantly different from the non-LAT FSRQs. The differences between the gamma-ray loud and quiet FSRQS can be explained by Doppler boosting; these objects appear to require larger Doppler factors than those of the BL Lac objects. It is possible that the gamma-ray loud FSRQs are fundamentally different from the gamma-ray quiet FSRQs. Strong polarization at the base of the jet appears to be a signature for gamma-ray loud AGNs.
Probe for contamination detection in recyclable materials
Taleyarkhan, Rusi
2003-08-05
A neutron detection system for detection of contaminants contained within a bulk material during recycling includes at least one neutron generator for neutron bombardment of the bulk material, and at least one gamma ray detector for detection of gamma rays emitted by contaminants within the bulk material. A structure for analyzing gamma ray data is communicably connected to the gamma ray detector, the structure for analyzing gamma ray data adapted. The identity and concentration of contaminants in a bulk material can also be determined. By scanning the neutron beam, discrete locations within the bulk material having contaminants can be identified. A method for recycling bulk material having unknown levels of contaminants includes the steps of providing at least one neutron generator, at least one gamma ray detector, and structure for analyzing gamma ray data, irradiating the bulk material with neutrons, and then determining the presence of at least one contaminant in the bulk material from gamma rays emitted from the bulk material.
NASA Astrophysics Data System (ADS)
Taira, Y.; Toyokawa, H.; Kuroda, R.; Yamamoto, N.; Adachi, M.; Tanaka, S.; Katoh, M.
2013-05-01
High-energy ultrashort gamma-ray pulses can be generated via laser Compton scattering with 90° collisions at the UVSOR-II electron storage ring. As an applied study of ultrashort gamma-ray pulses, a new photon-induced positron annihilation lifetime spectroscopy approach has been developed. Ultrashort gamma-ray pulses with a maximum energy of 6.6 MeV and pulse width of 2.2 ps created positrons throughout bulk lead via pair production. Annihilation gamma rays were detected by a BaF2 scintillator mounted on a photomultiplier tube. A positron lifetime spectrum was obtained by measuring the time difference between the RF frequency of the electron storage ring and the detection time of the annihilation gamma rays. We calculated the response of the BaF2 scintillator and the time jitter caused by the variation in the total path length of the ultrashort gamma-ray pulses, annihilation gamma rays, and scintillation light using a Monte Carlo simulation code. The positron lifetime for bulk lead was successfully measured.
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
1995-01-01
A history and overview of the observed properties of gamma-ray bursts are presented. The phenomenon of gamma-ray bursts is without precedent in astronomy, having no observed property that would be a direct indicator of their distance and no counterpart object in another wavelength region. Their brief, random appearance only in the gamma-ray region has made their study difficult. The observed time profiles, spectral properties, and durations of gamma-ray bursts cover a wide range. All proposed models for their origin must be considered speculative. It is humbling to think that even after 25 years since their discovery, the distance scale of gamma-ray bursts is still very much debatable.
NASA Astrophysics Data System (ADS)
Wu, J.; Clark, C. J.; Pletsch, H. J.; Guillemot, L.; Johnson, T. J.; Torne, P.; Champion, D. J.; Deneva, J.; Ray, P. S.; Salvetti, D.; Kramer, M.; Aulbert, C.; Beer, C.; Bhattacharyya, B.; Bock, O.; Camilo, F.; Cognard, I.; Cuéllar, A.; Eggenstein, H. B.; Fehrmann, H.; Ferrara, E. C.; Kerr, M.; Machenschalk, B.; Ransom, S. M.; Sanpa-Arsa, S.; Wood, K.
2018-02-01
We report on the analysis of 13 gamma-ray pulsars discovered in the Einstein@Home blind search survey using Fermi Large Area Telescope (LAT) Pass 8 data. The 13 new gamma-ray pulsars were discovered by searching 118 unassociated LAT sources from the third LAT source catalog (3FGL), selected using the Gaussian Mixture Model machine-learning algorithm on the basis of their gamma-ray emission properties being suggestive of pulsar magnetospheric emission. The new gamma-ray pulsars have pulse profiles and spectral properties similar to those of previously detected young gamma-ray pulsars. Follow-up radio observations have revealed faint radio pulsations from two of the newly discovered pulsars and enabled us to derive upper limits on the radio emission from the others, demonstrating that they are likely radio-quiet gamma-ray pulsars. We also present results from modeling the gamma-ray pulse profiles and radio profiles, if available, using different geometric emission models of pulsars. The high discovery rate of this survey, despite the increasing difficulty of blind pulsar searches in gamma rays, suggests that new systematic surveys such as presented in this article should be continued when new LAT source catalogs become available.
Recommended Priorities for NASA's Gamma Ray Astronomy Program 1999-2013
NASA Technical Reports Server (NTRS)
Carol, Ladd
1999-01-01
The Gamma-Ray Astronomy Program Working Group (GRAPWG) recommends priorities for the NASA Gamma-Ray Astronomy Program. The highest priority science topic is nuclear astrophysics and sites of gamma ray line emission. Other high priority topics are gamma ray bursts, hard x-ray emission from accreting black holes and neutron stars, the Advanced Compton Telescope (ACT), the High-resolution Spectroscopic Imager (HSI), and the Energetic X-ray Imaging Survey Telescope (EXIST). The recommendations include special consideration for technology development, TeV astronomy, the ultra-long duration balloon (ULDB) program, the International Space Station, optical telescope support, and data analysis and theory.
Observational techniques for solar flare gamma-rays, hard X-rays, and neutrons
NASA Technical Reports Server (NTRS)
Lin, Robert P.
1989-01-01
The development of new instrumentation and techniques for solar hard X-ray, gamma ray and neutron observations from spacecraft and/or balloon-borne platforms is examined. The principal accomplishments are: (1) the development of a two segment germanium detector which is near ideal for solar hard X-ray and gamma ray spectroscopy; (2) the development of long duration balloon flight techniques and associated instrumentation; and (3) the development of innovative new position sensitive detectors for hard X-ray and gamma rays.
Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C
2017-12-01
X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.
Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.
2017-01-01
X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455
Gamma-ray transfer and energy deposition in supernovae
NASA Technical Reports Server (NTRS)
Swartz, Douglas A.; Sutherland, Peter G.; Harkness, Robert P.
1995-01-01
Solutions to the energy-independent (gray) radiative transfer equations are compared to results of Monte Carlo simulations of the Ni-56 and Co-56 decay gamma-ray energy deposition in supernovae. The comparison shows that an effective, purely absorptive, gray opacity, kappa(sub gamma) approximately (0. 06 +/- 0.01)Y(sub e) sq cm/g, where Y is the total number of electrons per baryon, accurately describes the interaction of gamma-rays with the cool supernova gas and the local gamma-ray energy deposition within the gas. The nature of the gamma-ray interaction process (dominated by Compton scattering in the relativistic regime) creates a weak dependence of kappa(sub gamma) on the optical thickness of the (spherically symmetric) supernova atmosphere: The maximum value of kappa(sub gamma) applies during optically thick conditions when individual gamma-rays undergo multiple scattering encounters and the lower bound is reached at the phase characterized by a total Thomson optical depth to the center of the atmosphere tau(sub e) approximately less than 1. Gamma-ray deposition for Type Ia supernova models to within 10% for the epoch from maximum light to t = 1200 days. Our results quantitatively confirm that the quick and efficient solution to the gray transfer problem provides an accurate representation of gamma-ray energy deposition for a broad range of supernova conditions.
Characteristics of gamma-ray line flares
NASA Technical Reports Server (NTRS)
Bai, T.; Dennis, B.
1983-01-01
Observations of solar gamma rays by the Solar Maximum Mission (SMM) demonstrate that energetic protons and ions are rapidly accelerated during the impulsive phase. To understand the acceleration mechanisms for these particles, the characteristics of the gamma ray line flares observed by SMM were studied. Some very intense hard X-ray flares without detectable gamma ray lines were also investigated. Gamma ray line flares are distinguished from other flares by: (1) intense hard X-ray and microwave emissions; (2) delay of high energy hard X-rays; (3) emission of type 2 and/or type 4 radio bursts; and (4) flat hard X-ray spectra (average power law index: 3.1). The majority of the gamma ray line flares shared all these characteristics, and the remainder shared at least three of them. Positive correlations were found between durations of spike bursts and spatial sizes of flare loops as well as between delay times and durations of spike bursts.
The POPOP4 library and codes for preparing secondary gamma-ray production cross sections
NASA Technical Reports Server (NTRS)
Ford, W. E., III
1972-01-01
The POPOP4 code for converting secondary gamma ray yield data to multigroup secondary gamma ray production cross sections and the POPOP4 library of secondary gamma ray yield data are described. Recent results of the testing of uranium and iron data sets from the POPOP4 library are given. The data sets were tested by comparing calculated secondary gamma ray pulse height spectra measured at the ORNL TSR-II reactor.
NASA Technical Reports Server (NTRS)
Lang, F. L.; Werntz, C. W.; Crannell, C. J.; Trombka, J. I.; Chang, C. C.
1986-01-01
The ratio of the flux of 15.10-MeV gamma rays to the flux of 4.438-MeV gamma rays resulting from excitation of the corresponding states in C-12 as a sensitive measure of the spectrum of the exciting particles produced in solar flares and other cosmic sources. These gamma rays are produced predominantly by interactions with C-12 and O-16, both of which are relatively abundant in the solar photosphere. Gamma ray production cross sections for proton interactions have been reported previously for all important channels except for the production of 15.10-MeV gamma rays from O-16. The first reported measurement of the 15.10-MeV gamma ray production cross section from p + O-16 is presented here. The University of Maryland cyclotron was employed to produce 40-, 65-, and 86-MeV protons which interacted with CH2 and BeO targets. The resultant gamma ray spectra were measured with a high-purity germanium semiconductor detector at 70, 90, 110, 125, and 140 degrees relative to the direction of the incident beam for each proton energy. Other gamma ray lines resulting from direct excitation and spallation reactions with C-12 and 0-16 were observed as well, and their gamma ray production cross sections described.
The self-absorption effect of gamma rays in /sup 239/Pu
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hsu, Hsiao-Hua
1989-01-01
Nuclear materials assay with gamma-ray spectrum measurement is a well-established method for safeguards. However, for a thick source, the self-absorption of characteristic low-energy gamma rays has been a handicap to accurate assay. I have carried out Monte Carlo simulations to study this effect using the /sup 239/Pu ..cap alpha..-decay gamma-ray spectrum as an example. The thickness of a plutonium metal source can be considered a function of gamma-ray intensity ratios. In a practical application, gamma-ray intensity ratios can be obtained from a measured spectrum. With the help of calculated curves, scientists can find the source thickness and make corrections tomore » gamma-ray intensities, which then lead to an accurate quantitative determination of radioactive isotopes in the material. 2 refs., 9 figs.« less
Using gamma-ray emission to measure areal density of inertial confinement fusion capsulesa)
NASA Astrophysics Data System (ADS)
Hoffman, N. M.; Wilson, D. C.; Herrmann, H. W.; Young, C. S.
2010-10-01
Fusion neutrons streaming from a burning inertial confinement fusion capsule generate gamma rays via inelastic nuclear scattering in the ablator of the capsule. The intensity of gamma-ray emission is proportional to the product of the ablator areal density (ρR) and the yield of fusion neutrons, so by detecting the gamma rays we can infer the ablator areal density, provided we also have a measurement of the capsule's total neutron yield. In plastic-shell capsules, for example, C12 nuclei emit gamma rays at 4.44 MeV after excitation by 14.1 MeV neutrons from D+T fusion. These gamma rays can be measured by a new gamma-ray detector under development. Analysis of predicted signals is in progress, with results to date indicating that the method promises to be useful for diagnosing imploded capsules.
Characterization of gamma rays existing in the NMIJ standard neutron field.
Harano, H; Matsumoto, T; Ito, Y; Uritani, A; Kudo, K
2004-01-01
Our laboratory provides national standards on fast neutron fluence. Neutron fields are always accompanied by gamma rays produced in neutron sources and surroundings. We have characterised these gamma rays in the 5.0 MeV standard neutron field. Gamma ray measurement was performed using an NE213 liquid scintillator. Pulse shape discrimination was incorporated to separate the events induced by gamma rays from those by neutrons. The measured gamma ray spectra were unfolded with the HEPRO program package to obtain the spectral fluences using the response matrix prepared with the EGS4 code. Corrections were made for the gamma rays produced by neutrons in the detector assembly using the MCNP4C code. The effective dose equivalents were estimated to be of the order of 25 microSv at the neutron fluence of 10(7) neutrons cm(-2).
A Search for Ultra--High-Energy Gamma-Ray Emission from Five Supernova Remnants
NASA Astrophysics Data System (ADS)
Allen, G. E.; Berley, D.; Biller, S.; Burman, R. L.; Cavalli-Sforza, M.; Chang, C. Y.; Chen, M. L.; Chumney, P.; Coyne, D.; Dion, C. L.; Dorfan, D.; Ellsworth, R. W.; Goodman, J. A.; Haines, T. J.; Hoffman, C. M.; Kelley, L.; Klein, S.; Schmidt, D. M.; Schnee, R.; Shoup, A.; Sinnis, C.; Stark, M. J.; Williams, D. A.; Wu, J.-P.; Yang, T.; Yodh, G. B.
1995-07-01
The majority of the cosmic rays in our Galaxy with energies in the range of ~1010--1014 eV are thought to be accelerated in supernova remnants (SNRs). Measurements of SNR gamma-ray spectra in this energy region could support or contradict this concept. The Energetic Gamma-Ray Experiment Telescope (EGRET) collaboration has reported six sources of gamma rays above 108 eV whose coordinates are coincident with SNRs. Five of these sources are within the field of view of the CYGNUS extensive air shower detector. A search of the CYGNUS data set reveals no evidence of gamma-ray emission at energies ~1014 eV for these five SNRs. The flux upper limits from the CYGNUS data are compared to the lower energy fluxes measured with the EGRET detector using Drury, Aharonian, & Volk's recent model of gamma-ray production in the shocks of SNRs. The results suggest one or more of the following: (1) the gamma-ray spectra for these five SNRs soften by about 1014 eV, (2) the integral gamma-ray spectra of the SNRs are steeper than about E-1.3, or (3) most of the gamma rays detected with the EGRET instrument for each SNR are not produced in the SNR's shock but are produced at some other site (such as a pulsar).
Gamma Ray Bursts-Afterglows and Counterparts
NASA Technical Reports Server (NTRS)
Fishman, Gerald J
1998-01-01
Several breakthrough discoveries were made last year of x-ray, optical and radio afterglows and counterparts to gamma-ray bursts, and a redshift has been associated with at least one of these. These discoveries were made possible by the fast, accurate gamma-ray burst locations of the BeppoSAX satellite. It is now generally believed that the burst sources are at cosmological distances and that they represent the most powerful explosions in the Universe. These observations also open new possibilities for the study of early star formation, the physics of extreme conditions and perhaps even cosmology. This session will concentrate on recent x-ray, optical and radio afterglow observations of gamma-ray bursts, associated redshift measurements, and counterpart observations. Several review and theory talks will also be presented, along with a summary of the astrophysical implications of the observations. There will be additional poster contributions on observations of gamma-ray burst source locations at wavelengths other than gamma rays. Posters are also solicited that describe new observational capabilities for rapid follow-up observations of gamma-ray bursts.
GRI: The Gamma-Ray Imager mission
NASA Astrophysics Data System (ADS)
Knödlseder, J.; Gri Consortium
Observations of the gamma-ray sky reveal the most powerful sources and the most violent events in the Universe While at lower wavebands the observed emission is generally dominated by thermal processes the gamma-ray sky provides us with a view on the non-thermal Universe Here particles are accelerated to extreme relativistic energies by mechanisms which are still poorly understood and nuclear reactions are synthesizing the basic constituents of our world Cosmic accelerators and cosmic explosions are the major science themes that are addressed in the gamma-ray regime With the INTEGRAL observatory ESA has provided a unique tool to the astronomical community and has put Europe in the lead in the field of gamma-ray astronomy INTEGRAL provides an unprecedented survey of the soft gamma-ray sky revealing hundreds of sources new classes of objects extraordinary views of antimatter annihilation in our Galaxy and fingerprints of recent nucleosynthesis processes While INTEGRAL has provided the global overview over the soft gamma-ray sky there is a growing need to perform deeper more focused investigations of gamma-ray sources In soft X-rays a comparable step was taken going from the Einstein satellite to the XMM Newton observatory Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction and multilayer-coated mirror techniques have paved the way towards a gamma-ray mission providing major improvements compared to past missions regarding sensitivity and angular resolution Such a
NASA Technical Reports Server (NTRS)
Aharonian, F. A.; Mamidjanian, E. A.; Nikolsky, S. I.; Tukish, E. I.
1985-01-01
The recently observed primary ultra high energy gamma-rays (UHEGR) testify to the cosmic ray (CR) acceleration in the Galaxy. The available data may be interpreted as gamma-ray production due to photomeson production in CR sources.
X-ray and gamma ray astronomy detectors
NASA Technical Reports Server (NTRS)
Decher, Rudolf; Ramsey, Brian D.; Austin, Robert
1994-01-01
X-ray and gamma ray astronomy was made possible by the advent of space flight. Discovery and early observations of celestial x-rays and gamma rays, dating back almost 40 years, were first done with high altitude rockets, followed by Earth-orbiting satellites> once it became possible to carry detectors above the Earth's atmosphere, a new view of the universe in the high-energy part of the electromagnetic spectrum evolved. Many of the detector concepts used for x-ray and gamma ray astronomy were derived from radiation measuring instruments used in atomic physics, nuclear physics, and other fields. However, these instruments, when used in x-ray and gamma ray astronomy, have to meet unique and demanding requirements related to their operation in space and the need to detect and measure extremely weak radiation fluxes from celestial x-ray and gamma ray sources. Their design for x-ray and gamma ray astronomy has, therefore, become a rather specialized and rapidly advancing field in which improved sensitivity, higher energy and spatial resolution, wider spectral coverage, and enhanced imaging capabilities are all sought. This text is intended as an introduction to x-ray and gamma ray astronomy instruments. It provides an overview of detector design and technology and is aimed at scientists, engineers, and technical personnel and managers associated with this field. The discussion is limited to basic principles and design concepts and provides examples of applications in past, present, and future space flight missions.
Future Facilities for Gamma-Ray Pulsar Studies
NASA Technical Reports Server (NTRS)
Thompson, D. J.
2003-01-01
Pulsars seen at gamma-ray energies offer insight into particle acceleration to very high energies, along with information about the geometry and interaction processes in the magnetospheres of these rotating neutron stars. During the next decade, a number of new gamma-ray facilities will become available for pulsar studies. This brief review describes the motivation for gamma-ray pulsar studies, the opportunities for such studies, and some specific discussion of the capabilities of the Gamma-ray Large Area Space Telescope (GLAST) Large Area Telescope (LAT) for pulsar measurements.
Gamma ray constraints on the Galactic supernova rate
NASA Technical Reports Server (NTRS)
Hartmann, D.; The, L.-S.; Clayton, Donald D.; Leising, M.; Mathews, G.; Woosley, S. E.
1991-01-01
We perform Monte Carlo simulations of the expected gamma ray signatures of Galactic supernovae of all types to estimate the significance of the lack of a gamma ray signal due to supernovae occurring during the last millenium. Using recent estimates of the nuclear yields, we determine mean Galactic supernova rates consistent with the historic supernova record and the gamma ray limits. Another objective of these calculations of Galactic supernova histories is their application to surveys of diffuse Galactic gamma ray line emission.
Gamma ray constraints on the galactic supernova rate
NASA Technical Reports Server (NTRS)
Hartmann, D.; The, L.-S.; Clayton, D. D.; Leising, M.; Mathews, G.; Woosley, S. E.
1992-01-01
Monte Carlo simulations of the expected gamma-ray signatures of galactic supernovae of all types are performed in order to estimate the significance of the lack of a gamma-ray signal due to supernovae occurring during the last millenium. Using recent estimates of nuclear yields, we determine galactic supernova rates consistent with the historic supernova record and the gamma-ray limits. Another objective of these calculations of galactic supernova histories is their application to surveys of diffuse galactic gamma-ray line emission.
Fission prompt gamma-ray multiplicity distribution measurements and simulations at DANCE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chyzh, A; Wu, C Y; Ullmann, J
2010-08-24
The nearly energy independence of the DANCE efficiency and multiplicity response to {gamma} rays makes it possible to measure the prompt {gamma}-ray multiplicity distribution in fission. We demonstrate this unique capability of DANCE through the comparison of {gamma}-ray energy and multiplicity distribution between the measurement and numerical simulation for three radioactive sources {sup 22}Na, {sup 60}Co, and {sup 88}Y. The prospect for measuring the {gamma}-ray multiplicity distribution for both spontaneous and neutron-induced fission is discussed.
The Mystery of Gamma-Ray Bursts
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
2004-01-01
Gamma-ray bursts remain one of the greatest mysteries in astrophysics. Observations of gamma-ray bursts made by the BATSE experiment on the Compton Gamma-Ray Observatory will be described. Most workers in the field now believe that they originate from cosmological distances. This view has been reinforced by observations this year of several optical afterglow counterparts to gamma-ray bursts. A summary of these recent discoveries will be presented, along with their implications for models of the burst emission mechanism and the energy source of the bursts.
The Goddard program of gamma ray transient astronomy
NASA Technical Reports Server (NTRS)
Cline, T. L.; Desai, U. D.; Teegarden, B. J.
1980-01-01
Gamma ray burst studies are reviewed. The past results, present status and future expectations are outlined regarding endeavors using experiments on balloons, IMP-6 and -7, OGO-3, ISEE-1 and -3, Helios-2, Solar Maximum Mission, the Einstein Observatory, Solar Polar and the Gamma Ray Observatory, and with the interplanetary gamma ray burst networks, to which some of these spacecraft sensors contribute. Additional emphasis is given to the recent discovery of a new type of gamma ray transient, detected on 1979 March 5.
Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L
1986-01-01
Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221
Space-Borne Observations of Intense Gamma-Ray Flashes (TGFs) Above Thunderstorms
NASA Technical Reports Server (NTRS)
Fishman, Gerald J.
2011-01-01
Intense millisecond flashes of MeV photons have been observed with space-borne detectors. These terrestrial gamma-ray flashes (TGFs) were discovered with the Burst and Transient Source Experiment (BATSE) aboard the Compton Gamma- Ray Observatory (CGRO) in the early 1990s. They are now being observed with several other instruments, including the Gamma-ray Burst Monitor (GBM) detectors on the Fermi Gamma-ray Space Telescope. Although Fermi-GBM was designed and optimized for the observation of cosmic gamma-ray bursts (GRBs), it has unprecedented capabilities for these TGF observations. On several occasions, intense beams of high-energy electrons and positrons have been observed at the geomagnetic conjugate points of TGFs.
Low energy gamma ray emission from the Cygnus OB2 association
NASA Technical Reports Server (NTRS)
Chen, Wan; White, Richard L.
1992-01-01
According to our newly developed model of gamma-ray emission from chaotic early-type stellar winds, we predict the combined gamma-ray flux from the circumstellar winds of many very luminous early-type stars in the Cyg OB2 association can be detectable by the Energetic Gamma Ray Experiment Telescope (EGRET) (and maybe also by OSSE) on CGRO. Due to different radiation mechanisms, the gamma-ray spectrum from stellar winds can be quite different from that of CYG X-3; this spectral difference and the time-variation of Cyg X-3 flux will help to distinguish the gamma-ray components from different sources in this small region, which is spatially unresolvable by CGRO.
Production of gamma rays with energies greater than 30 MeV in the atmosphere
NASA Technical Reports Server (NTRS)
Thompson, D.; Fichtel, C.; Kniffen, D.
1974-01-01
A three-dimensional study of atmospheric gamma rays with energy greater than 30 MeV has been carried out. Experimental results were obtained from four balloon flights from Palestine, Texas, with a 15 cm by 15 cm digitized wire grid spark chamber. The energy spectrum for downward-moving gamma rays steepens with increasing atmospheric depth. Near the top of the atmosphere, the spectrum steepens with increasing zenith angle. Experimental results compare reasonably well with a three-dimensional Monte Carlo calculation of atmospheric gamma ray production. Inclusion of upward-moving gamma rays makes possible the use of atmospheric secondaries for in-flight calibration of satellite gamma ray detectors.
Soft gamma rays from black holes versus neutron stars
NASA Technical Reports Server (NTRS)
Liang, Edison P.
1992-01-01
The recent launches of GRANAT and GRO provide unprecedented opportunities to study compact collapsed objects from their hard x ray and gamma ray emissions. The spectral range above 100 keV can now be explored with much higher sensitivity and time resolution than before. The soft gamma ray spectral data is reviewed of black holes and neutron stars, radiation, and particle energization mechanisms and potentially distinguishing gamma ray signatures. These may include soft x ray excesses versus deficiencies, thermal versus nonthermal processes, transient gamma ray bumps versus power law tails, lines, and periodicities. Some of the highest priority future observations are outlines which will shed much light on such systems.
NASA Astrophysics Data System (ADS)
Aim-O, P.; Wongsawaeng, D.; Tancharakorn, S.; Sophon, M.
2017-09-01
High-density cement mixed with crumb rubber has been studied to be a gamma ray and neutron shielding material, especially for photonuclear reactions that may occur from accelerators where both types of radiation exist. The Buildup factors from gamma ray scattering, prompt and secondary gamma ray emissions from neutron capture and mechanical properties were evaluated. For buildup factor studies, two different geometries were used: narrow beam and broad beam. Prompt Gamma Neutron Activation Analysis (PGNAA) was carried out to determine the prompt and secondary gamma ray emissions. The compressive strength of samples was evaluated by using compression testing machine which was central point loading crushing test. The results revealed that addition of crumb rubber increased the buildup factor. Gamma ray spectra following PGNAA revealed no prompt or secondary gamma ray emission. Mechanical testing indicated that the compressive strength of the shielding material decreased with increasing volume percentage of crumb rubber.
A model for the UHE gamma-rays from Hercules X-1
NASA Technical Reports Server (NTRS)
Eichler, D.; Vestrand, W. T.
1985-01-01
An outburst of gamma rays with energies E gamma 10 to the 12th power eV was recently detected from the X-ray pulsar Hercules X-1. The outburst had a 3 minute duration and occurred at a time during the 35 day X-ray modulation that is associated with X-ray turnon. The gamma rays also have the same 1.24 second modulation that is observed at X-ray energies. Subsequently a 40 minute outburst was detected at E gamma 10 to the 14th power eV. The interaction of ultrahigh energy particles with a precessing accretion disk explain the observed gamma ray light curve. The constraints one can place on acceleration mechanisms and the possibility that the UHE particles are accelerated by shocks in an accretion flow are explained.
The gamma-ray light curves of SN 1987A
NASA Technical Reports Server (NTRS)
Leising, Mark D.; Share, Gerald H.
1990-01-01
Observations of the SN 1987A ejecta in four Co-56-decay gamma-ray lines, obtained using the SMM gamma-ray spectrometer between February 1987 and May 1989, are reported and analyzed. The instrument characteristics and data-reduction procedures are described, and the results are presented in extensive tables and graphs and discussed with reference to theoretical models. Gamma-ray fluxes significantly above possible instrumental levels (as determined from analysis of pre-1987 data) were detected in the second half of 1987 and the first half of 1988. The data are found to favor a model with some Co-56 in regions of low gamma-ray optical depth by 200 d after the SN outburst over models with all Co-56 at one depth within a uniform expanding envelope. Also investigated are the gamma-ray contribution to the total bolometric luminosity and the escape (and potential observability) of Co-57 gamma rays.
NASA Technical Reports Server (NTRS)
Jones, F. C. (Compiler)
1986-01-01
Invited talks, rapporteur talks, and highlight talks are included. Topics of the invited and highlight talks include astrophysical jets, gamma-ray line astronomy, cosmic rays and gamma rays in astrophysics, the early universe, elementary particle physics, solar flares and acceleration of energetic particles, cosmogenic nuclei, extragalactic astronomy, composition of solar flare particles, very high energy gamma ray sources, gamma-ray bursts, shock acceleration in the solar wind, cosmic rays in deep underground detectors, spectrum of cosmic rays at 10 to the 19th power eV, and nucleus-nucleus interactions.
NASA Technical Reports Server (NTRS)
1983-01-01
Topics addressing the characteristics and emission mechanisms of gamma ray bursts and neutron and gamma ray emission from solar flares are discussed. In addition, observational aspects of gamma ray astronomy are addressed with particular attention given to optical transients associated with gamma ray bursts.
NASA Technical Reports Server (NTRS)
Kniffen, Donald A.; Elliott, William W.
1999-01-01
The final report consists of summaries of work proposed, work accomplished, papers and presentations published and continuing work regarding the cooperative agreement. The work under the agreement is based on high energy gamma ray source data analysis collected from the Energetic Gamma-Ray Experiment Telescope (EGRET).
NASA Astrophysics Data System (ADS)
Kocevski, D.; Ajello, M.; Buson, S.; Buehler, R.; Giomi, M.
2016-02-01
During the week between February 8 and 15, 2016, the Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, observed gamma-ray activity from a new transient source, Fermi J1654-1055.
High energy gamma-ray observations of SN 1987A
NASA Technical Reports Server (NTRS)
Sood, R. K.; Thomas, J. A.; Waldron, L.; Manchanda, R. K.; Rochester, G. K.
1988-01-01
Results are presented from observations of SN 1987A made with a combined high energy gamma ray and hard X-ray payload carried on a balloon flight over Alice Springs, Australia on April 5, 1988. The payload instrumentation is described, emphasizing the characteristics of the gamma-ray detector. The gamma-ray emission profile is illustrated and the preliminary results of the observations are summarized.
TEV GAMMA-RAY OBSERVATIONS OF THE GALACTIC CENTER RIDGE BY VERITAS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Archer, A.; Buckley, J. H.; Bugaev, V.
2016-04-20
The Galactic Center ridge has been observed extensively in the past by both GeV and TeV gamma-ray instruments revealing a wealth of structure, including a diffuse component and the point sources G0.9+0.1 (a composite supernova remnant) and Sgr A* (believed to be associated with the supermassive black hole located at the center of our Galaxy). Previous very high energy (VHE) gamma-ray observations with the H.E.S.S. experiment have also detected an extended TeV gamma-ray component along the Galactic plane in the >300 GeV gamma-ray regime. Here we report on observations of the Galactic Center ridge from 2010 to 2014 by themore » VERITAS telescope array in the >2 TeV energy range. From these observations we (1) provide improved measurements of the differential energy spectrum for Sgr A* in the >2 TeV gamma-ray regime, (2) provide a detection in the >2 TeV gamma-ray emission from the composite SNR G0.9+0.1 and an improved determination of its multi-TeV gamma-ray energy spectrum, and (3) report on the detection of VER J1746-289, a localized enhancement of >2 TeV gamma-ray emission along the Galactic plane.« less
A New View of the High Energy Gamma-Ray Sky with the Ferrni Gamma-Ray Space Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie
2009-01-01
Following its launch in June 2008, high energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have opened a new and important window on a wide variety of phenomena, including pulsars, black holes and active galactic nuclei, gamma-ray bursts, supernova remnants and the origin of cosmic rays, and searches for hypothetical new phenomena such as super symmetric dark matter annihilations. In this talk I will describe the current status of the Fermi observatory and review the science highlights from the first year of observations.
Study of gamma spectrometry laboratory measurement in various sediment and vulcanic rocks
NASA Astrophysics Data System (ADS)
Nurhandoko, Bagus Endar B.; Kurniadi, Rizal; Rizka Asmara Hadi, Muhammad; Rizal Komara, Insan
2017-01-01
Gamma-ray spectroscopy is the quantitative study of the energy spectra of gamma-ray sources. This method is powerful to characterize some minerals, especially to differentiate rocks which contains among Potassium, Uranium, dan Thorium. Rock contains radioactive material which produce gamma rays in various energies and intensities. When these emissions are detected and analyzed with a spectroscopy system, a gamma-ray energy spectrum can be used as indicator for mineral content of rock. Some sediment and vulcanic rock have been collected from East Java Basin. Samples are ranging from Andesite vulcanics, Tuff, Shale, various vulcanic clay and Alluvial clay. We present some unique characteristics of gamma spectrometry in various sedimentar and vulcanic rocks of East Java Basins. Details contents of gamma ray spectra give enrichments to characterize sample of sediment and vulcanic in East Java. Weathered vulcanic clay has lower counting rate of gamma ray than alluvial deltaic clay counting rate. Therefore, gamma spectrometrometry can be used as tool for characterizing the enviroment of clay whether vulcanic or alluvial-deltaic. This phenomena indicates that gamma ray spectrometry can be as tool for characterizing the clay whether it tends to Smectite or Illite
Repeated irradiations with gamma-rays at a Dose of 0.5 Gy may exacerbate asthma.
Fang, Su-ping; Tago, Fumitoshi; Tanaka, Takashi; Simura, Noriko; Muto, Yasuko; Goto, Resuke; Kojima, Shuji
2005-06-01
We previously showed that 0.5 Gy whole-body gamma-ray irradiation with a single or small number of repeated exposures inhibits tumor growth in mice, via elevation of the IFN-gamma/IL-4 ratio concomitantly with a decrease in the percentage of B cells. Here we examined whether repeated 0.5 Gy gamma-rays irradiation can improve asthma in an OVA-induced asthmatic mouse model. We found that repeated irradiation (10 times) with 0.5 Gy of gamma-rays significantly increased total IgE in comparison with the disease-control group. The levels of IL-4 and IL-5 were also significantly higher in the gamma-ray-irradiated group, while that of IFN-gamma was significantly lower, resulting in a further decrease of the IFN-gamma/IL-4 ratio from the normal value. These results indicate that the repeated irradiation with gamma-rays may exacerbate asthma, and may have opposite effects on different immune reactions unlike the irradiation with a single or small number of repeated exposures.
Lightning Initiation and Propagation
2009-08-22
ray (gamma ray ) and multiple-station (>24) cosmic - ray - muon detection network (TERA) pl:esently in place. Upgrade TERA with LaBr3 detectors to...DATES COVERED 4. TITLE AND SUBTITLE Lightning Initistion and Propagation Including the Role of X- Rays , Gamma Rays , and Cosmic Rays 5a... rays , gamma rays , and cosmic rays in the initiation and propagation of lightning and in the phenomenology of thunderclouds. The experimental
GLAST: Exploring Nature's Highest Energy Processes with the Gamma-ray Large Area Space Telescope
NASA Technical Reports Server (NTRS)
Digel, Seth; Myers, J. D.; White, Nicholas E. (Technical Monitor)
2001-01-01
The Gamma-ray Large Area Space Telescope (GLAST) is an international and multi-agency space mission that will study the cosmos in the energy range 10 keV-300 GeV. Several successful exploratory missions in gamma-ray astronomy led to the Energetic Gamma Ray Experiment Telescope (EGRET) instrument on the Compton Gamma Ray Observatory (CGRO). Launched in 1991, EGRET made the first complete survey of the sky in the 30 MeV-10 GeV range. EGRET showed the high-energy gamma-ray sky to be surprisingly dynamic and diverse, with sources ranging from the sun and moon to massive black holes at large redshifts. Most of the gamma-ray sources detected by EGRET remain unidentified. In light of the discoveries with EGRET, the great potential of the next generation gamma-ray telescope can be appreciated. GLAST will have an imaging gamma-ray telescope vastly more capable than instruments flown previously, as well as a secondary instrument to augment the study of gamma-ray bursts. The main instrument, the Large Area Telescope (LAT), will have superior area, angular resolution, field of view, and deadtime that together will provide a factor of 30 or more advance in sensitivity, as well as provide capability for study of transient phenomena. The GLAST Burst Monitor (GBM) will have a field of view several times larger than the LAT and will provide spectral coverage of gamma-ray bursts that extends from the lower limit of the LAT down to 10 keV. The basic parameters of the GBM are compared to those of the Burst and Transient Source Experiment (BATSE) instrument on CGRO in Table 1-2. With the LAT and GBM, GLAST will be a flexible observatory for investigating the great range of astrophysical phenomena best studied in high-energy gamma rays. NASA plans to launch GLAST in late 2005.
Gamma-Ray Observations of the Supernova Remnant RX J0852.0-4622 with the Fermi Large Area Telescope
NASA Technical Reports Server (NTRS)
Tanaka, T.; Allafort, A.; Ballet, J.; Funk, S.; Giordano, F.; Hewitt, J.; Lemoine-Goumard, M.; Tajima, H.; Tibolla, O.; Uchiyama, Y.
2011-01-01
We report on gamma-ray observations of the supernova remnant (SNR) RX J0852.04622 with the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. In the Fermi-LAT data, we find a spatially extended source at the location of the SNR. The extension is consistent with the SNR size seen in other wavelengths such as X-rays and TeV gamma rays, leading to the identification of the gamma-ray source with the SNR. The spectrum is well described as a power law with a photon index of = 1.85 0.06 (stat)+0.18 0.19 (sys), which smoothly connects to the H.E.S.S. spectrum in the TeV energy band. We discuss the gamma-ray emission mechanism based on multiwavelength data. The broadband data can be fit well by a model in which the gamma rays are of hadronic origin. We also consider a scenario with inverse Compton scattering of electrons as the emission mechanism of the gamma rays. Although the leptonic model predicts a harder spectrum in the Fermi-LAT energy range, the model can fit the data considering the statistical and systematic errors.
Gamma-Ray Pulsar Candidates for GLAST
NASA Technical Reports Server (NTRS)
Thompson, D. J.
2008-01-01
The Gamma-ray Large Area Space Telescope (GLAST) will be launched this year, and its Large Area Telescope (LAT) is expected to discover scores to hundreds of gamma-ray pulsars. This poster discusses which of the over 1700 known pulsars, mostly visible only at radio frequencies, are likely to emit greater than 100 MeV gamma rays with intensities detectable by the LAT. The main figure of merit used to select gamma-ray pulsar candidates is sqrt(E-dot)/d2, where E-dot is the energy loss due to rotational spin-down, and d is the distance to the pulsar. The figure of merit incorporates spin-down flux at earth (proportional to E-dot/d2) times efficiency, assumed proportional to l/sqrt(E-dot). A few individual objects are cited to illustrate the issues. Since large E-dot pulsars also tend to have large timing noise and occasional glitches, their ephemerides can become inaccurate in weeks to months. To detect and study the gamma-ray emission the photons must be accurately tagged with the pulse phase. With hours to days between gamma-ray photon arrival times from a pulsar and months to years of LAT exposure needed for good detections, GLAST will rely on radio and X-ray timing measurements throughout the continuous gamma-ray observations. The poster will describe efforts to coordinate pulsar timing of the candidate gamma-ray pulsars.
Low energy prompt gamma-ray tests of a large volume BGO detector.
Naqvi, A A; Kalakada, Zameer; Al-Anezi, M S; Raashid, M; Khateeb-ur-Rehman; Maslehuddin, M; Garwan, M A
2012-01-01
Tests of a large volume Bismuth Germinate (BGO) detector were carried out to detect low energy prompt gamma-rays from boron and cadmium-contaminated water samples using a portable neutron generator-based Prompt Gamma Neutron Activation Analysis (PGNAA) setup. Inspite of strong interference between the sample- and the detector-associated prompt gamma-rays, an excellent agreement has been observed between the experimental and calculated yields of the prompt gamma-rays, indicating successful application of the large volume BGO detector in the PGNAA analysis of bulk samples using low energy prompt gamma-rays. Copyright © 2011 Elsevier Ltd. All rights reserved.
Gamma-Ray Astrophysics: New Insight Into the Universe
NASA Technical Reports Server (NTRS)
Fichtel, Carl E.; Trombka, Jacob I.
1997-01-01
During the 15 years that have passed since the first edition of this book was published, there has been a major increase in our knowledge of gamma-ray astronomy. Much of this advance arises from the extensive results that have been forthcoming from the Compton Gamma-Ray Observatory. There has been the discovery of a new class of gamma-ray objects, namely high-energy gamma- ray-emitting blazars, a special class of Active Galactic Nuclei, whose basic high-energy properties now seem to be understood. A much improved picture of our galaxy now exists in the frequency range of gamma rays. The question of whether cosmic rays are galactic or metagalactic now seems settled with certainty. Significant new information exists on the gamma-ray properties of neutron star pulsars, Seyfert galaxies, and gamma-ray bursts. Substantial new insight has been obtained on solar phenomena through gamma-ray observations. Hence, this seemed to be an appropriate time to write a new edition of this book to add the important scientific implications of these many new findings. The special importance of gamma-ray astrophysics had long been recognized by many physicists and astronomers, and theorists had pursued many aspects of the subject well before the experimental results began to become available. The slower development of the experimental side was not because of a lack of incentive, but due to the substantial experimental difficulties that had to be overcome. Thus, as the gamma-ray results became available in much greater number and detail, it was possible to build upon the theoretical work that already existed and to make substantial progress in the study of many of the phenomena involved. Consequently, a much better understanding of many of the astrophysical phenomena mentioned here and others is now possible. Our principal aims in writing this book are the same as they were for the first edition: to provide a text which describes the significance of gamma-ray astrophysics and to assemble in one place a treatment of gamma rays emitted from bodies in the solar i system, from objects in our galaxy, as well as from interactions between cosmic rays and the interstellar medium, and from beyond our galaxy. Thus, this book is intended for those in astrophysics who wish to have the opportunity to learn more about the evolving field of gamma-ray astronomy and its relationship to the high-energy, evolutionary processes occurring in the universe. The last three chapters of the book provide a general discussion of the experimental aspects of the field that seemed best treated together, separately from the astrophysical aspects of gamma-ray astronomy that are discussed in the first ten chapters.
Gamma-Ray Emission from Galaxy Clusters : DARK MATTER AND COSMIC-RAYS
NASA Astrophysics Data System (ADS)
Pinzke, Anders
The quest for the first detection of a galaxy cluster in the high energy gamma-ray regime is ongoing, and even though clusters are observed in several other wave-bands, there is still no firm detection in gamma-rays. To complement the observational efforts we estimate the gamma-ray contributions from both annihilating dark matter and cosmic-ray (CR) proton as well as CR electron induced emission. Using high-resolution simulations of galaxy clusters, we find a universal concave shaped CR proton spectrum independent of the simulated galaxy cluster. Specifically, the gamma-ray spectra from decaying neutral pions, which are produced by CR protons, dominate the cluster emission. Furthermore, based on our derived flux and luminosity functions, we identify the galaxy clusters with the brightest galaxy clusters in gamma-rays. While this emission is challenging to detect using the Fermi satellite, major observations with Cherenkov telescopes in the near future may put important constraints on the CR physics in clusters. To extend these predictions, we use a dark matter model that fits the recent electron and positron data from Fermi, PAMELA, and H.E.S.S. with remarkable precision, and make predictions about the expected gamma-ray flux from nearby clusters. In order to remain consistent with the EGRET upper limit on the gamma-ray emission from Virgo, we constrain the minimum mass of substructures for cold dark matter halos. In addition, we find comparable levels of gamma-ray emission from CR interactions and dark matter annihilations without Sommerfeld enhancement.
Gamma-Ray Astronomy Technology Needs
NASA Technical Reports Server (NTRS)
Gehrels, N.; Cannizzo, J. K.
2012-01-01
In recent decades gamma-ray observations have become a valuable tool for studying the universe. Progress made in diverse 8re1lS such as gamma-ray bursts (GRBs), nucleosynthesis, and active galactic nuclei (AGNs) has complimented and enriched our astrophysical understanding in many ways. We present an overview of current and future planned space y-ray missions and discussion technology needs for- the next generation of space gamma-ray instruments.
Gamma-Ray Telescopes: 400 Years of Astronomical Telescopes
NASA Technical Reports Server (NTRS)
Gehrels, Neil; Cannizzo, John K.
2010-01-01
The last half-century has seen dramatic developments in gamma-ray telescopes, from their initial conception and development through to their blossoming into full maturity as a potent research tool in astronomy. Gamma-ray telescopes are leading research in diverse areas such as gamma-ray bursts, blazars, Galactic transients, and the Galactic distribution of Al-26.
Nuclear gamma rays from energetic particle interactions
NASA Technical Reports Server (NTRS)
Ramaty, R.; Kozlovsky, B.; Lingenfelter, R. E.
1978-01-01
Gamma ray line emission from nuclear deexcitation following energetic particle reactions is evaluated. The compiled nuclear data and the calculated gamma ray spectra and intensities can be used for the study of astrophysical sites which contain large fluxes of energetic protons and nuclei. A detailed evaluation of gamma ray line production in the interstellar medium is made.
Fermi Bubbles: an elephant in the gamma-ray sky
NASA Astrophysics Data System (ADS)
Malyshev, Dmitry
2017-03-01
The Fermi bubbles are one of the most remarkable features in the gamma-ray sky revealed by the Fermi Large Area Telescope (LAT). The nature of the gamma-ray emission and the origin of the bubbles are still open questions. In this note, we will review some basic features of leptonic and hadronic modes of gamma-ray production. At the moment, gamma rays are our best method to study the bubbles, but in order to resolve the origin of the bubbles multi-wavelength and multi-messenger observations will be crucial.
NASA Technical Reports Server (NTRS)
Sagdeev, Roald
1995-01-01
The main scientific objectives of the project were: (1) Calculation of average time history for different subsets of BATSE gamma-ray bursts; (2) Comparison of averaged parameters and averaged time history for different Burst And Transient Source Experiments (BASTE) Gamma Ray Bursts (GRB's) sets; (3) Comparison of results obtained with BATSE data with those obtained with APEX experiment at PHOBOS mission; and (4) Use the results of (1)-(3) to compare current models of gamma-ray bursts sources.
The structure and content of the galaxy and galactic gamma rays. [conferences
NASA Technical Reports Server (NTRS)
Fichtel, C. E.; Stecker, F. W.
1976-01-01
Papers are presented dealing with galactic structure drawing on all branches of galactic astronomy with emphasis on the implications of the new gamma ray observations. Topics discussed include: (1) results from the COS-B gamma ray satellite; (2) results from SAS-2 on gamma ray pulsar, Cygnus X-3, and maps of the galactic diffuse flux; (3) recent data from CO surveys of the galaxy; (4) high resolution radio surveys of external galaxies; (5) results on the galactic distribution of pulsars; and (6) theoretical work on galactic gamma ray emission.
Space Detectors for Gamma Rays (100 MeV-100 GeV): from Egret to Fermi LAT
NASA Technical Reports Server (NTRS)
Thompson, David J.
2015-01-01
The design of spaceborne high-energy (E is greater than 100 MeV) gamma-ray detectors depends on two principal factors: (1) the basic physics of detecting and measuring the properties of the gamma rays; and (2) the constraints of operating such a detector in space for an extended period. Improvements in technology have enabled major advances in detector performance, as illustrated by two successful instruments, EGRET on the Compton Gamma Ray Observatory and LAT on the Fermi Gamma-ray Space Telescope.
A Monte Carlo modeling alternative for the API Gamma Ray Calibration Facility.
Galford, J E
2017-04-01
The gamma ray pit at the API Calibration Facility, located on the University of Houston campus, defines the API unit for natural gamma ray logs used throughout the petroleum logging industry. Future use of the facility is uncertain. An alternative method is proposed to preserve the gamma ray API unit definition as an industry standard by using Monte Carlo modeling to obtain accurate counting rate-to-API unit conversion factors for gross-counting and spectral gamma ray tool designs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gamma Ray Pulsars: Multiwavelength Observations
NASA Technical Reports Server (NTRS)
Thompson, David J.
2004-01-01
High-energy gamma rays are a valuable tool for studying particle acceleration and radiation in the magnetospheres of energetic pulsars. The seven or more pulsars seen by instruments on the Compton Gamma Ray Observatory (CGRO) show that: the light curves usually have double-peak structures (suggesting a broad cone of emission); gamma rays are frequently the dominant component of the radiated power; and all the spectra show evidence of a high-energy turnover. For all the known gamma-ray pulsars, multiwavelength observations and theoretical models based on such observations offer the prospect of gaining a broad understanding of these rotating neutron stars. The Gamma-ray Large Area Space Telescope (GLAST), now in planning for a launch in 2006, will provide a major advance in sensitivity, energy range, and sky coverage.
NASA Technical Reports Server (NTRS)
Hays, Elizabeth
2009-01-01
An overview of the Fermi Gamma-ray Space Telescope's first 6 months in operation is provided. The Fermi Gamma-ray Space Telescope, formerly called GLAST, is a mission to measure the cosmic gamma-ray flux in the energy rage 20 MeV to more than 300 GeV, with supporting measurements for gamma-ray bursts from 8 keV to 30 MeV. It contains a Large Area Telescope capable of viewing the entire sky every 3 hours and a Gamma-ray Burst Monitor for viewing the entire unocculted sky. Since its launch on June 11, 2008 Fermi has provided information on pulsars, gamma ray bursts, relativistic jets, the active galactic nucleus, and a globular star cluster. This presentation describes Fermi's development, mission, instruments and recent findings.
Detection of 16 gamma-ray pulsars through blind frequency searches using the Fermi LAT.
Abdo, A A; Ackermann, M; Ajello, M; Anderson, B; Atwood, W B; Axelsson, M; Baldini, L; Ballet, J; Barbiellini, G; Baring, M G; Bastieri, D; Baughman, B M; Bechtol, K; Bellazzini, R; Berenji, B; Bignami, G F; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brez, A; Brigida, M; Bruel, P; Burnett, T H; Caliandro, G A; Cameron, R A; Caraveo, P A; Casandjian, J M; Cecchi, C; Celik, O; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Conrad, J; Cutini, S; Dermer, C D; de Angelis, A; de Luca, A; de Palma, F; Digel, S W; Dormody, M; do Couto e Silva, E; Drell, P S; Dubois, R; Dumora, D; Farnier, C; Favuzzi, C; Fegan, S J; Fukazawa, Y; Funk, S; Fusco, P; Gargano, F; Gasparrini, D; Gehrels, N; Germani, S; Giebels, B; Giglietto, N; Giommi, P; Giordano, F; Glanzman, T; Godfrey, G; Grenier, I A; Grondin, M-H; Grove, J E; Guillemot, L; Guiriec, S; Gwon, C; Hanabata, Y; Harding, A K; Hayashida, M; Hays, E; Hughes, R E; Jóhannesson, G; Johnson, R P; Johnson, T J; Johnson, W N; Kamae, T; Katagiri, H; Kataoka, J; Kawai, N; Kerr, M; Knödlseder, J; Kocian, M L; Kuss, M; Lande, J; Latronico, L; Lemoine-Goumard, M; Longo, F; Loparco, F; Lott, B; Lovellette, M N; Lubrano, P; Madejski, G M; Makeev, A; Marelli, M; Mazziotta, M N; McConville, W; McEnery, J E; Meurer, C; Michelson, P F; Mitthumsiri, W; Mizuno, T; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nolan, P L; Norris, J P; Nuss, E; Ohsugi, T; Omodei, N; Orlando, E; Ormes, J F; Paneque, D; Parent, D; Pelassa, V; Pepe, M; Pesce-Rollins, M; Pierbattista, M; Piron, F; Porter, T A; Primack, J R; Rainò, S; Rando, R; Ray, P S; Razzano, M; Rea, N; Reimer, A; Reimer, O; Reposeur, T; Ritz, S; Rochester, L S; Rodriguez, A Y; Romani, R W; Ryde, F; Sadrozinski, H F-W; Sanchez, D; Sander, A; Saz Parkinson, P M; Scargle, J D; Sgrò, C; Siskind, E J; Smith, D A; Smith, P D; Spandre, G; Spinelli, P; Starck, J-L; Strickman, M S; Suson, D J; Tajima, H; Takahashi, H; Takahashi, T; Tanaka, T; Thayer, J G; Thompson, D J; Tibaldo, L; Tibolla, O; Torres, D F; Tosti, G; Tramacere, A; Uchiyama, Y; Usher, T L; Van Etten, A; Vasileiou, V; Vilchez, N; Vitale, V; Waite, A P; Wang, P; Watters, K; Winer, B L; Wolff, M T; Wood, K S; Ylinen, T; Ziegler, M
2009-08-14
Pulsars are rapidly rotating, highly magnetized neutron stars emitting radiation across the electromagnetic spectrum. Although there are more than 1800 known radio pulsars, until recently only seven were observed to pulse in gamma rays, and these were all discovered at other wavelengths. The Fermi Large Area Telescope (LAT) makes it possible to pinpoint neutron stars through their gamma-ray pulsations. We report the detection of 16 gamma-ray pulsars in blind frequency searches using the LAT. Most of these pulsars are coincident with previously unidentified gamma-ray sources, and many are associated with supernova remnants. Direct detection of gamma-ray pulsars enables studies of emission mechanisms, population statistics, and the energetics of pulsar wind nebulae and supernova remnants.
NASA Goddard Space Flight Center, on Behalf of the Fermi Large Area Telescope Collaboration
NASA Technical Reports Server (NTRS)
Thompson, David J.
2010-01-01
Because high-energy gamma rays can be produced by processes that also produce neutrinos, the gamma-ray survey of the sky by the Fermi (Gamma-ray Space Telescope offers a view of potential targets for neutrino observations. Gamma-ray bursts. Active Galactic Nuclei, and supernova remnants are all sites where hadronic, neutrino-producing interactions are plausible. Pulsars, pulsar wind nebulae, and binary sources are all phenomena that reveal leptonic particle acceleration through their gamma-ray emission. While important to gamma-ray astrophysics, such sources are of less interest to neutrino studies. This talk will present a broad overview of the constantly changing sky seen with the Large Area Telescope (LAT)on the Fermi spacecraft.
The 3C 279 Campaign of Winter 1999: A Gamma-Optical Correlation?
NASA Technical Reports Server (NTRS)
Hartman, R. C.; Villata, M.; Raiteri, C. M.; Sobrito, M.; DeFrancesco, G.; Ostorero, L.; Tosti, G.; Kurtanidze, O.; Nikolashvili, M.; Takalo, L.
2000-01-01
Preliminary results are presented from the gamma-optical campaign of January-February 1999 on 3C 279. During this period we obtained good optical sampling of the source, the best ever for a gamma-bright OVV quasar. Its large and fast variations have been compared with the gamma-ray fluxes obtained simultaneously by Energy Gamma Ray Experiment Telescope (EGRET), on Compton Gamma Ray Observatory (CGRO). Despite rather poor counting statistics in the gamma-ray data, a fair correlation is found, with the gamma variations following those in the optical by 3-4 days. This is the first time such a significant day-scale correlation has been observed between the optical and gamma emissions from a OVV quasar. Its implications are currently under study.
Periodic Emission from the Gamma-ray Binary 1FGL J1018.6-5856
NASA Technical Reports Server (NTRS)
Celic, O.; Corbet, R. H. D.; Donato, D.; Ferrara, E. C.; Gehrels, N.; Harding, A. K.; Hays, E.; McEnery, J. E.; Thompson, D. J.; Troja, E.
2012-01-01
Gamma-ray binaries are stellar systems containing a neutron star or black hole with gamma-ray emission produced by an interaction between the components. These systems are rare, even though binary evolution models predict dozens in our Galaxy. A search for gamma-ray binaries with the Fermi Large Area Telescope (LAT) shows that IFGL JI018.6-5856 exhibits intensity and spectral modulation with a 16.6 day period. We identified a variable X-ray counterpart, which shows a sharp maximum coinciding with maximum gamma-ray emission, as well as an 06V f) star optical counterpart and a radio counterpart that is also apparently modulated on the orbital period. IFGL J1018.6-5856 is thus a gamma-ray binary, and its detection suggests the presence of other fainter binaries in the Galaxy.
A Study of Spatially-Coincident IceCube Neutrinos and Fermi Gamma-Ray Sources
NASA Astrophysics Data System (ADS)
Seymour, Hannah; Mukherjee, Reshmi; Shaevitz, Michael; Santander, Marcos
2016-03-01
The IceCube neutrino telescope has detected very-high-energy neutrino events with energies between several hundred TeV to a few PeV beginning inside the detector. These events are unlikely to have originated in the atmosphere, and are suspected to come from astrophysical sources, the likes of which can also be observed in gamma rays by the Fermi Gamma-Ray Space Telescope. We present an analysis of archival GeV gamma-ray data collected with the Large Area Telescope onboard the Fermi satellite to search for gamma-ray sources spatially coincident with the locations of high-enery muon neutrinos detected by IceCube. The combined detection of gamma rays and neutrinos from an astrophysical source will allow us to identify cosmic-ray acceleration sites. With gratitude to the Nevis Laboratories REU program.
NASA Technical Reports Server (NTRS)
Guiriec, S.; Kouveliotou, C.; Hartmann, D. H.; Granot, J.; Asano, K.; Meszaros, P.; Gill, R.; Gehrels, N.; McEnery, J.
2016-01-01
The origin of prompt emission from gamma-ray bursts (GRBs) remains to be an open question. Correlated prompt optical and gamma-ray emission observed in a handful of GRBs strongly suggests a common emission region, but failure to adequately fit the broadband GRB spectrum prompted the hypothesis of different emission mechanisms for the low- and high-energy radiations. We demonstrate that our multi-component model for GRB -ray prompt emission provides an excellent fit to GRB 110205A from optical to gamma-ray energies. Our results show that the optical and highest gamma-ray emissions have the same spatial and spectral origin, which is different from the bulk of the X- and softest gamma-ray radiation. Finally, our accurate redshift estimate for GRB 110205A demonstrates promise for using GRBs as cosmological standard candles.
Blazar 3C 66A: Another extragalactic source of ultra-high-energy gamma-ray photons
NASA Astrophysics Data System (ADS)
Neshpor, Yu. I.; Stepanyan, A. A.; Kalekin, O. P.; Fomin, V. P.; Chalenko, N. N.; Shitov, V. G.
1998-03-01
he observations of the object 3C 66A which were carried out with the GT-48 gamma-ray telescope at the Crimean Astrophysical Observatory in November-December 1996 revealed a flux of ultra-high-energy (>10^12 eV) gamma-ray photons from this blazar. According to preliminary estimates, the photon flux is (31) 10^11 photons cm^-2 s^-1. The blazar 3C 66A is the third extragalactic object from which a flux of ultra- high-energy gamma-ray photons was detected. Fluxes of gamma-ray photons were previously detected from the galaxies Mk 421 and Mk 501 at the Whipple observatory. This result provides further evidence that active processes proceed in blazars which are accompanied by the generation of cosmic rays responsible for the emission of gamma-ray photons.
Periodic emission from the gamma-ray binary 1FGL J1018.6-5856.
Fermi LAT Collaboration; Ackermann, M; Ajello, M; Ballet, J; Barbiellini, G; Bastieri, D; Belfiore, A; Bellazzini, R; Berenji, B; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brigida, M; Bruel, P; Buehler, R; Buson, S; Caliandro, G A; Cameron, R A; Caraveo, P A; Cavazzuti, E; Cecchi, C; Çelik, Ö; Charles, E; Chaty, S; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Corbel, S; Corbet, R H D; Cutini, S; de Luca, A; den Hartog, P R; de Palma, F; Dermer, C D; Digel, S W; do Couto e Silva, E; Donato, D; Drell, P S; Drlica-Wagner, A; Dubois, R; Dubus, G; Favuzzi, C; Fegan, S J; Ferrara, E C; Focke, W B; Fortin, P; Fukazawa, Y; Funk, S; Fusco, P; Gargano, F; Gasparrini, D; Gehrels, N; Germani, S; Giglietto, N; Giordano, F; Giroletti, M; Glanzman, T; Godfrey, G; Grenier, I A; Grove, J E; Guiriec, S; Hadasch, D; Hanabata, Y; Harding, A K; Hayashida, M; Hays, E; Hill, A B; Hughes, R E; Jóhannesson, G; Johnson, A S; Johnson, T J; Kamae, T; Katagiri, H; Kataoka, J; Kerr, M; Knödlseder, J; Kuss, M; Lande, J; Longo, F; Loparco, F; Lovellette, M N; Lubrano, P; Mazziotta, M N; McEnery, J E; Michelson, P F; Mitthumsiri, W; Mizuno, T; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nakamori, T; Naumann-Godo, M; Norris, J P; Nuss, E; Ohno, M; Ohsugi, T; Okumura, A; Omodei, N; Orlando, E; Ozaki, M; Paneque, D; Parent, D; Pesce-Rollins, M; Pierbattista, M; Piron, F; Pivato, G; Porter, T A; Rainò, S; Rando, R; Razzano, M; Reimer, A; Reimer, O; Ritz, S; Romani, R W; Roth, M; Saz Parkinson, P M; Sgrò, C; Siskind, E J; Spandre, G; Spinelli, P; Suson, D J; Takahashi, H; Tanaka, T; Thayer, J G; Thayer, J B; Thompson, D J; Tibaldo, L; Tinivella, M; Torres, D F; Tosti, G; Troja, E; Uchiyama, Y; Usher, T L; Vandenbroucke, J; Vianello, G; Vitale, V; Waite, A P; Winer, B L; Wood, K S; Wood, M; Yang, Z; Zimmer, S; Coe, M J; Di Mille, F; Edwards, P G; Filipović, M D; Payne, J L; Stevens, J; Torres, M A P
2012-01-13
Gamma-ray binaries are stellar systems containing a neutron star or black hole, with gamma-ray emission produced by an interaction between the components. These systems are rare, even though binary evolution models predict dozens in our Galaxy. A search for gamma-ray binaries with the Fermi Large Area Telescope (LAT) shows that 1FGL J1018.6-5856 exhibits intensity and spectral modulation with a 16.6-day period. We identified a variable x-ray counterpart, which shows a sharp maximum coinciding with maximum gamma-ray emission, as well as an O6V((f)) star optical counterpart and a radio counterpart that is also apparently modulated on the orbital period. 1FGL J1018.6-5856 is thus a gamma-ray binary, and its detection suggests the presence of other fainter binaries in the Galaxy.
Periodic Emission from the Gamma-Ray Binary 1FGL J1018.6-5856
NASA Technical Reports Server (NTRS)
2012-01-01
Gamma-ray binaries are stellar systems containing a neutron star or black hole, with gamma-ray emission produced by an interaction between the components. These systems are rare, even though binary evolution models predict dozens in our Galaxy, A search for gamma-ray binaries with the Fermi Large Area Telescope (LAT) shows that 1FGL ]1018.6-5856 exhibits intensity and spectral modulation with a 16.6 day period. We identified a variable x-ray counterpart, which shows a sharp maximum coinciding with maximum gamma-ray emission, as well as an O6V((f)) star optical counterpart and a radio counterpart that is also apparently modulated on the orbital period. 1FGL ]1018.6-5856 is thus a gamma-ray binary, and its detection suggests the presence of other fainter binaries in the Galaxy.
Two Active States of the Narrow-Line Gamma-Ray-Loud AGN GB 1310 + 487
NASA Technical Reports Server (NTRS)
Sokolovsky, K. V.; Schinzel, F. K.; Tanaka, Y. T.; Abolmasov, P. K.; Angelakis, E.; Bulgarelli, A.; Carrasco, L.; Cenko, S. B.; Cheung, C. C.; Clubb, K. I.;
2014-01-01
Context. Previously unremarkable, the extragalactic radio source GB1310 487 showed gamma-ray flare on 2009 November 18, reaching a daily flux of approximately 10(exp -6) photons cm(exp -2) s(exp -1) at energies E greater than 100MeV and became one of the brightest GeV sources for about two weeks. Its optical spectrum shows strong forbidden-line emission while lacking broad permitted lines, which is not typical for a blazar. Instead, the spectrum resembles those of narrow emission-line galaxies. Aims. We investigate changes in the object's radio-to-GeV spectral energy distribution (SED) during and after the prominent gamma-ray flare with the aim of determining the nature of the object and of constraining the origin of the variable high-energy emission. Methods. The data collected by the Fermi and AGILE satellites at gamma-ray energies; Swift at X-ray and ultraviolet (UV); the Kanata, NOT, and Keck telescopes at optical; OAGH and WISE at infrared (IR); and IRAM30m, OVRO 40m, Effelsberg 100m, RATAN-600, and VLBA at radio are analyzed together to trace the SED evolution on timescales of months. Results. The gamma-ray radio-loud narrow-line active galactic nucleus (AGN) is located at redshift z = 0.638. It shines through an unrelated foreground galaxy at z = 0.500. The AGN light is probably amplified by gravitational lensing. The AGN SED shows a two-humped structure typical of blazars and gamma-ray-loud narrow-line Seyfert 1 galaxies, with the high-energy (inverse-Compton) emission dominating by more than an order of magnitude over the low-energy (synchrotron) emission during gamma-ray flares. The difference between the two SED humps is smaller during the low-activity state. Fermi observations reveal a strong correlation between the gamma-ray flux and spectral index, with the hardest spectrum observed during the brightest gamma-ray state. The gamma-ray flares occurred before and during a slow rising trend in the radio, but no direct association between gamma-ray and radio flares could be established. Conclusions. If the gamma-ray flux is a mixture of synchrotron self-Compton (SSC) and external Compton (EC) emission, the observed GeV spectral variability may result from varying relative contributions of these two emission components. This explanation fits the observed changes in the overall IR to gamma-ray SED.
Pulsed Gamma Rays from the Millisecond Pulsar J0030+0451 with the Fermi Large Area Telescope
Abdo, A. A.; Ackermann, M.; Atwood, W. B.; ...
2009-06-19
In this paper, we report the discovery of gamma-ray pulsations from the nearby isolated millisecond pulsar (MSP) PSR J0030+0451 with the Large Area Telescope on the Fermi Gamma-ray Space Telescope (formerly GLAST). This discovery makes PSR J0030+0451 the second MSP to be detected in gamma rays after PSR J0218+4232, observed by the EGRET instrument on the Compton Gamma-Ray Observatory. The spin-down power E(dotabove) = 3.5 x 10 33 erg s -1 is an order of magnitude lower than the empirical lower bound of previously known gamma-ray pulsars. The emission profile is characterized by two narrow peaks, 0.07 ± 0.01 andmore » 0.08 ± 0.02 wide, respectively, separated by 0.44 ± 0.02 in phase. The first gamma-ray peak falls 0.15 ± 0.01 after the main radio peak. The pulse shape is similar to that of the "normal" gamma-ray pulsars. An exponentially cutoff power-law fit of the emission spectrum leads to an integral photon flux above 100 MeV of (6.76 ± 1.05 ± 1.35) × 10 –8 cm –2 s –1 with cutoff energy (1.7 ± 0.4 ± 0.5) GeV. Finally, based on its parallax distance of (300 ± 90) pc, we obtain a gamma-ray efficiency L γ/E(dotabove) ≃ 15% for the conversion of spin-down energy rate into gamma-ray radiation, assuming isotropic emission.« less
Gamma-sky.net: Portal to the gamma-ray sky
NASA Astrophysics Data System (ADS)
Voruganti, Arjun; Deil, Christoph; Donath, Axel; King, Johannes
2017-01-01
http://gamma-sky.net is a novel interactive website designed for exploring the gamma-ray sky. The Map View portion of the site is powered by the Aladin Lite sky atlas, providing a scalable survey image tesselated onto a three-dimensional sphere. The map allows for interactive pan and zoom navigation as well as search queries by sky position or object name. The default image overlay shows the gamma-ray sky observed by the Fermi-LAT gamma-ray space telescope. Other survey images (e.g. Planck microwave images in low/high frequency bands, ROSAT X-ray image) are available for comparison with the gamma-ray data. Sources from major gamma-ray source catalogs of interest (Fermi-LAT 2FHL, 3FGL and a TeV source catalog) are overlaid over the sky map as markers. Clicking on a given source shows basic information in a popup, and detailed pages for every source are available via the Catalog View component of the website, including information such as source classification, spectrum and light-curve plots, and literature references. We intend for gamma-sky.net to be applicable for both professional astronomers as well as the general public. The website started in early June 2016 and is being developed as an open-source, open data project on GitHub (https://github.com/gammapy/gamma-sky). We plan to extend it to display more gamma-ray and multi-wavelength data. Feedback and contributions are very welcome!
Gamma-Ray Pulsar Candidates for GLAST
NASA Technical Reports Server (NTRS)
Thompson, David J.; Smith, D. A.; Dumora, D.; Guillemot, L.; Parent, D.; Reposeur, T.; Grove, E.; Romani, R. W.; Thorsett, S. E.
2007-01-01
The Gamma-ray Large Area Space Telescope (GLAST) will be launched less than a year from now, and its Large Area Telescope (LAT) is expected to discover scores to hundreds of gamma-ray pulsars. This poster discusses which of the over 1700 known pulsars, mostly visible only at radio Erequencies, are likely to emit greater than l00 MeV gamma rays with intensities detectable by the LAT. The main figure of merit used to select gamma-ray pulsar candidates is sqrt(E-dot)/d^2, where E-dot is the energy loss due to rotational spindown, and d is the distance to the pulsar. The figure of merit incorporates spin-down flux at earth (proportional to E-dot/d^2) times efficiency, assumed proportional to 1/sqrt(E-dot). A few individual objects are cited to illustrate the issues. Since large E-dot pulsars also tend to have large timing noise and occasional glitches, their ephemerides can become inaccurate in weeks to months. To detect and study the gamma-ray emission the photons must be accurately tagged with the pulse phase. With hours to days between gamma-ray photon arrival times from a pulsar and months to years of LAT exposure needed for good detections, GLAST will need timing measurements throughout the continuous gamma-ray observations. The poster will describe efforts to coordinate pulsar timing of the candidate gamma-ray pulsars.
High energy gamma ray astronomy
NASA Technical Reports Server (NTRS)
Fichtel, Carl E.
1987-01-01
High energy gamma ray astronomy has evolved with the space age. Nonexistent twenty-five years ago, there is now a general sketch of the gamma ray sky which should develop into a detailed picture with the results expected to be forthcoming over the next decade. The galactic plane is the dominant feature of the gamma ray sky, the longitude and latitude distribution being generally correlated with galactic structural features including the spiral arms. Two molecular clouds were already seen. Two of the three strongest gamma ray sources are pulsars. The highly variable X-ray source Cygnus X-3 was seen at one time, but not another in the 100 MeV region, and it was also observed at very high energies. Beyond the Milky Way Galaxy, there is seen a diffuse radiation, whose origin remains uncertain, as well as at least one quasar, 3C 273. Looking to the future, the satellite opportunities for high energy gamma ray astronomy in the near term are the GAMMA-I planned to be launched in late 1987 and the Gamma Ray Observatory, scheduled for launch in 1990. The Gamma Ray Observatory will carry a total of four instruments covering the entire energy range from 30,000 eV to 3 x 10 to the 10th eV with over an order of magnitude increase in sensitivity relative to previous satellite instruments.
GW170817 falsifies dark matter emulators
NASA Astrophysics Data System (ADS)
Boran, S.; Desai, S.; Kahya, E. O.; Woodard, R. P.
2018-02-01
On August 17, 2017 the LIGO interferometers detected the gravitational wave (GW) signal (GW170817) from the coalescence of binary neutron stars. This signal was also simultaneously seen throughout the electromagnetic (EM) spectrum from radio waves to gamma rays. We point out that this simultaneous detection of GW and EM signals rules out a class of modified gravity theories, termed "dark matter emulators," which dispense with the need for dark matter by making ordinary matter couple to a different metric from that of GW. We discuss other kinds of modified gravity theories which dispense with the need for dark matter and are still viable. This simultaneous observation also provides the first observational test of Einstein's weak equivalence principle (WEP) between gravitons and photons. We estimate the Shapiro time delay due to the gravitational potential of the total dark matter distribution along the line of sight (complementary to the calculation by Abbott et al. [Astrophys. J. Lett. 848, L13 (2017)], 10.3847/2041-8213/aa920c) to be about 400 days. Using this estimate for the Shapiro delay and from the time difference of 1.7 seconds between the GW signal and gamma rays, we can constrain violations of the WEP using the parametrized post-Newtonian parameter γ , and it is given by |γGW-γEM|<9.8 ×10-8.
NASA Astrophysics Data System (ADS)
Abdo, Aws Ahmad
2007-08-01
Very high energy gamma-rays can be used to probe some of the most powerful astrophysical objects in the universe, such as active galactic nuclei, supernova remnants and pulsar-powered nebulae. The diffuse gamma radiation arising from the interaction of cosmic-ray particles with matter and radiation in the Galaxy is one of the few probes available to study the origin of cosmic- rays. Milagro is a water Cherenkov detector that continuously views the entire overhead sky. The large field-of-view combined with the long observation time makes Milagro the most sensitive instrument available for the study of large, low surface brightness sources such as the diffuse gamma radiation arising from interactions of cosmic radiation with interstellar matter. In this thesis I present a new background rejection technique for the Milagro detector through the development of a new gamma hadron separation variable. The Abdo variable, A 4 , coupled with the weighting analysis technique significantly improves the sensitivity of the Milagro detector. This new analysis technique resulted in the first discoveries in Milagro. Four localized sources of TeV gamma-ray emission have been discovered, three of which are in the Cygnus region of the Galaxy and one closer to the Galactic center. In addition to these localized sources, a diffuse emission of TeV gamma-rays has been discovered from the Cygnus region of the Galaxy as well. However, the TeV gamma-ray flux as measured at ~12 TeV from the Cygnus region exceeds that predicted from a conventional model of cosmic-ray production and propagation. This observation indicates the existence of either hard-spectrum cosmic-ray sources and/or other sources of TeV gamma rays in the region. Other TeV gamma-ray source candidates with post-trial statistical significances of > 4s have also been observed in the Galactic plane.
NASA Technical Reports Server (NTRS)
Cline, Thomas L.
1987-01-01
The discovery of cosmic gamma ray bursts was made with systems designed at Los Alamos Laboratory for the detection of nuclear explosions beyond the atmosphere. HELIOS-2 was the first gamma ray burst instrument launched; its initial results in 1976, seemed to deepen the mystery around gamma ray transients. Interplanetary spacecraft data were reviewed in terms of explaining the behavior and source of the transients.
Gamma-Ray background spectrum and annihilation rate in the baryon-symmetric big-bang cosmology
NASA Technical Reports Server (NTRS)
Puget, J. L.
1973-01-01
An attempt was made to extract experimental data on baryon symmetry by observing annihilation products. Specifically, gamma rays and neutrons with long mean free paths were analyzed. Data cover absorption cross sections and radiation background of the 0.511 MeV gamma rays from positron annihilations and the 70 MeV gamma rays from neutral pion decay.
REVIEWS OF TOPICAL PROBLEMS: On the nature of cosmic gamma-ray bursts
NASA Astrophysics Data System (ADS)
Luchkov, B. I.; Mitrofanov, I. G.; Rozental', I. L.
1996-07-01
Current hypotheses of gamma-ray burst origin are analysed. About 30 years after their discovery, it is still unclear where gamma-ray bursts are created (Solar system, Galaxy or Metagalaxy). Nor is the mechanism of their production known. This paper reviews on-going gamma-ray experiments and suggests possible lines of further studies on their origin.
A Giant Radio Flare from Cygnus X-3 with Associated Gamma-Ray Emission
NASA Technical Reports Server (NTRS)
Corbel, S.; Dubus, G.; Tomsick, J. A.; Szostek, A.; Corbet, R. H. D.; Miller-Jones, J. C. A.; Richards, J. L.; Pooley, G.; Trushkin, S.; Dubois, R.;
2012-01-01
With frequent flaring activity of its relativistic jets, Cygnus X-3 (Cyg X-3) is one of the most active microquasars and is the only Galactic black hole candidate with confirmed high energy gamma-ray emission, thanks to detections by Fermi/LAT and AGILE. In 2011, Cyg X-3 was observed to transit to a soft X-ray state, which is known to be associated with high-energy gamma-ray emission. We present the results of a multiwavelength campaign covering a quenched state, when radio emission from Cyg X-3 is at its weakest and the X-ray spectrum is very soft. A giant (approx 20 Jy) optically thin radio flare marks the end of the quenched state, accompanied by rising non-thermal hard X-rays. Fermi/LAT observations (E greater than or equal 100 MeV) reveal renewed gamma-ray activity associated with this giant radio flare, suggesting a common origin for all non-thermal components. In addition, current observations unambiguously show that the gamma-ray emission is not exclusively related to the rare giant radio flares. A 3-week period of gamma-ray emission is also detected when Cyg X-3 was weakly flaring in radio, right before transition to the radio quenched state. No gamma rays are observed during the one-month long quenched state, when the radio flux is weakest. Our results suggest transitions into and out of the ultrasoft X-ray (radio quenched) state trigger gamma-ray emission, implying a connection to the accretion process, and also that the gamma-ray activity is related to the level of radio flux (and possibly shock formation), strengthening the connection to the relativistic jets.
Dissecting the Gamma-Ray Background in Search of Dark Matter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cholis, Ilias; Hooper, Dan; McDermott, Samuel D.
2014-02-01
Several classes of astrophysical sources contribute to the approximately isotropic gamma-ray background measured by the Fermi Gamma-Ray Space Telescope. In this paper, we use Fermi's catalog of gamma-ray sources (along with corresponding source catalogs at infrared and radio wavelengths) to build and constrain a model for the contributions to the extragalactic gamma-ray background from astrophysical sources, including radio galaxies, star-forming galaxies, and blazars. We then combine our model with Fermi's measurement of the gamma-ray background to derive constraints on the dark matter annihilation cross section, including contributions from both extragalactic and galactic halos and subhalos. The resulting constraints are competitivemore » with the strongest current constraints from the Galactic Center and dwarf spheroidal galaxies. As Fermi continues to measure the gamma-ray emission from a greater number of astrophysical sources, it will become possible to more tightly constrain the astrophysical contributions to the extragalactic gamma-ray background. We project that with 10 years of data, Fermi's measurement of this background combined with the improved constraints on the astrophysical source contributions will yield a sensitivity to dark matter annihilations that exceeds the strongest current constraints by a factor of ~ 5 - 10.« less
NASA Technical Reports Server (NTRS)
Fichtel, C. E.; Bertsch, D. L.; Dingus, B. L.; Esposito, J. A.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Lin, Y. C.; Mattox, J. R.
1994-01-01
Hawking (1974) and Page & Hawking (1976) investigated theoretically the possibility of detecting high-energy gamma rays produced by the quantum-mechanical decay of a small black hole created in the early universe. They concluded that, at the very end of the life of the small black hole, it would radiate a burst of gamma rays peaked near 250 MeV with a total energy of about 10(exp 34) ergs in the order of a microsecond or less. The characteristics of a black hole are determined by laws of physics beyond the range of current particle accelerators; hence, the search for these short bursts of high-energy gamma rays provides at least the possibility of being the first test of this region of physics. The Compton Observatory Energetic Gamma-Ray Experiment Telescope (EGRET) has the capability of detecting directly the gamma rays from such bursts at a much fainter level than SAS 2, and a search of the EGRET data has led to an upper limit of 5 x 10(exp -2) black hole decays per cu pc per yr, placing constraints on this and other theories predicting microsecond high-energy gamma-ray bursts.
Prompt gamma-ray emission from biological tissues during proton irradiation: a preliminary study.
Polf, J C; Peterson, S; Ciangaru, G; Gillin, M; Beddar, S
2009-02-07
In this paper, we present the results of a preliminary study of secondary 'prompt' gamma-ray emission produced by proton-nuclear interactions within tissue during proton radiotherapy. Monte Carlo simulations were performed for mono-energetic proton beams, ranging from 2.5 MeV to 250 MeV, irradiating elemental and tissue targets. Calculations of the emission spectra from different biological tissues and their elemental components were made. Also, prompt gamma rays emitted during delivery of a clinical proton spread-out Bragg peak (SOBP) in a homogeneous water phantom and a water phantom containing heterogeneous tissue inserts were calculated to study the correlation between prompt gamma-ray production and proton dose delivery. The results show that the prompt gamma-ray spectra differ significantly for each type of tissue studied. The relative intensity of the characteristic gamma rays emitted from a given tissue was shown to be proportional to the concentration of each element in that tissue. A strong correlation was found between the delivered SOBP dose distribution and the characteristic prompt gamma-ray production. Based on these results, we discuss the potential use of prompt gamma-ray emission as a method to verify the accuracy and efficacy of doses delivered with proton radiotherapy.
The locations of cosmic explosions
NASA Technical Reports Server (NTRS)
Fruchter, A. S.; Levan, A. J.; Strolger, L.; Vreeswijk, P. M.; Bersier, D.; Burud, I.; Castro-Ceron, J. M.; Consclice, C.; Dahlen, T.; Strolger, L.
2005-01-01
When massive stars exhaust their fuel they collapse and often produce the extraordinarily bright explosions known as core-collapse supernovae. Recently, it has become apparent that stellar collapse can power the even more brilliant relativistic explosions known as long-duration gamma-ray bursts. In some cases, a gamma-ray burst and a supernova have been observed from the same event. One would thus expect that gamma-ray bursts and supernovae should be found in similar environments. Here we show that this expectation is wrong. Using Hubble Space Telescope imaging of the host galaxies of long-duration gamma-ray bursts and core-collapse supernovae, we demonstrate that while the distribution of the supernovae in their hosts traces the blue light of young stars, the gamma-ray bursts are much more concentrated on the very brightest regions of their hosts. Furthermore, the host galaxies of the gamma-ray bursts are significantly fainter and more irregular than the hosts of the supernovae. Together these results suggest that long-duration gamma-ray bursts are associated with the very most massive stars and may be restricted to galaxies of limited chemical evolution. Our results directly imply that long-duration gamma-ray bursts are relatively rare in galaxies such as our own Milky Way.
Ohlinger, R.D.; Humphrey, H.W.
1985-08-26
A gamma ray detector shield comprised of a rigid, lead, cylindrical-shaped vessel having upper and lower portions with an pneumatically driven, sliding top assembly. Disposed inside the lead shield is a gamma ray scintillation crystal detector. Access to the gamma detector is through the sliding top assembly.
Detecting pin diversion from pressurized water reactors spent fuel assemblies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ham, Young S.; Sitaraman, Shivakumar
Detecting diversion of spent fuel from Pressurized Water Reactors (PWR) by determining possible diversion including the steps of providing a detector cluster containing gamma ray and neutron detectors, inserting the detector cluster containing the gamma ray and neutron detectors into the spent fuel assembly through the guide tube holes in the spent fuel assembly, measuring gamma ray and neutron radiation responses of the gamma ray and neutron detectors in the guide tube holes, processing the gamma ray and neutron radiation responses at the guide tube locations by normalizing them to the maximum value among each set of responses and takingmore » the ratio of the gamma ray and neutron responses at the guide tube locations and normalizing the ratios to the maximum value among them and producing three signatures, gamma, neutron, and gamma-neutron ratio, based on these normalized values, and producing an output that consists of these signatures that can indicate possible diversion of the pins from the spent fuel assembly.« less
Long gamma-ray bursts and core-collapse supernovae have different environments.
Fruchter, A S; Levan, A J; Strolger, L; Vreeswijk, P M; Thorsett, S E; Bersier, D; Burud, I; Castro Cerón, J M; Castro-Tirado, A J; Conselice, C; Dahlen, T; Ferguson, H C; Fynbo, J P U; Garnavich, P M; Gibbons, R A; Gorosabel, J; Gull, T R; Hjorth, J; Holland, S T; Kouveliotou, C; Levay, Z; Livio, M; Metzger, M R; Nugent, P E; Petro, L; Pian, E; Rhoads, J E; Riess, A G; Sahu, K C; Smette, A; Tanvir, N R; Wijers, R A M J; Woosley, S E
2006-05-25
When massive stars exhaust their fuel, they collapse and often produce the extraordinarily bright explosions known as core-collapse supernovae. On occasion, this stellar collapse also powers an even more brilliant relativistic explosion known as a long-duration gamma-ray burst. One would then expect that these long gamma-ray bursts and core-collapse supernovae should be found in similar galactic environments. Here we show that this expectation is wrong. We find that the gamma-ray bursts are far more concentrated in the very brightest regions of their host galaxies than are the core-collapse supernovae. Furthermore, the host galaxies of the long gamma-ray bursts are significantly fainter and more irregular than the hosts of the core-collapse supernovae. Together these results suggest that long-duration gamma-ray bursts are associated with the most extremely massive stars and may be restricted to galaxies of limited chemical evolution. Our results directly imply that long gamma-ray bursts are relatively rare in galaxies such as our own Milky Way.
Detecting the Attenuation of Blazar Gamma-ray Emission by Extragalactic Background Light with GLAST
NASA Technical Reports Server (NTRS)
Chen, Andrew; Ritz, Steven
1999-01-01
Gamma rays with energy above 10 GeV interact with optical-UV photons resulting in pair production. Therefore, a large sample of high redshift sources of these gamma rays can be used to probe the extragalactic background starlight (EBL) by examining the redshift dependence of the attenuation of the flux above 10 GeV. GLAST, the next generation high-energy gamma-ray telescope, will for the first time have the unique capability to detect thousands of gamma-ray blazars up to redshifts of at least z = 4, with enough angular resolution to allow identification of a large fraction of their optical counterparts. By combining recent determinations of the gamma-ray blazar luminosity function, recent calculations of the high energy gamma-ray opacity due to EBL absorption, and the expected GLAST instrument performance to produce simulated samples of blazars that GLAST would detect, including their redshifts and fluxes, we demonstrate that these blazars have the potential to be a highly effective probe of the EBL.
NASA Astrophysics Data System (ADS)
Wunderer, Cornelia B.; GRI Collaboration
2006-09-01
Observations of the gamma-ray sky reveal the most powerful sources and the most violent events in the Universe. While at lower wavebands the observed emission is generally dominated by thermal processes, the gamma-ray sky provides us with a view on the non-thermal Universe. Here particles are accelerated to extreme relativistic energies by mechanisms which are still poorly understood, and nuclear reactions are synthesizing the basic constituents of our world. Cosmic accelerators and cosmic explosions are the major science themes that are addressed in the gamma-ray regime. With the INTEGRAL observatory, ESA has provided a unique tool to the astronomical community revealing hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes. While INTEGRAL provides the global overview over the soft gamma-ray sky, there is a growing need to perform deeper, more focused investigations of gamma-ray sources. In soft X-rays a comparable step was taken going from the Einstein and the EXOSAT satellites to the Chandra and XMM/Newton observatories. Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction and multilayer coated mirror techniques have paved the way towards a gamma-ray mission, providing major improvements compared to past missions regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow to study particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
GRI: the gamma-ray imager mission
NASA Astrophysics Data System (ADS)
Knödlseder, Jürgen
2006-06-01
Observations of the gamma-ray sky reveal the most powerful sources and the most violent events in the Universe. While at lower wavebands the observed emission is generally dominated by thermal processes, the gamma-ray sky provides us with a view on the non-thermal Universe. Here particles are accelerated to extreme relativistic energies by mechanisms which are still poorly understood, and nuclear reactions are synthesizing the basic constituents of our world. Cosmic accelerators and cosmic explosions are the major science themes that are addressed in the gamma-ray regime. With the INTEGRAL observatory, ESA has provided a unique tool to the astronomical community revealing hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes. While INTEGRAL provides the global overview over the soft gamma-ray sky, there is a growing need to perform deeper, more focused investigations of gamma-ray sources. In soft X-rays a comparable step was taken going from the Einstein and the EXOSAT satellites to the Chandra and XMM/Newton observatories. Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction and multilayer-coated mirror techniques hav paved the way towards a gamma-ray mission, providing major improvements compared to past missions regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow to study particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
A Search for the X-ray Counterpart of the Unidentified Gamma-ray Source 3EG J2020+4017 (2CG078+2)
NASA Technical Reports Server (NTRS)
Weisskopf, Martin; Swartz, Douglas A.; Carraminana, Alberto; Carrasco, Luis; Kaplan, David L.; Becker, Werner; Elsner, Ronald F.; Kanbach, Gottfried; ODell, Stephen L.; Tennant, Allyn F.
2006-01-01
We report observations with the Chandra X-ray Observatory of a field in the gamma-Cygni supernova remnant (SNR78.2+2.1) centered on the cataloged location of the unidentified, bright gamma-ray source 3EG J2020+4017. In this search for an X-ray counterpart to the gamma-ray source, we detected 30 X-ray sources. Of these, we found 17 strong-candidate counterparts in optical (visible through near-infrared) cataloged and an additional 3 through our optical observations. Based upon colors and (for several objects) optical spectra, nearly all the optically identified objects appear to be reddened main-sequence stars: None of the X-ray sources with an optical counterpart is a plausible X-ray counterpart to 3EG J2020+4017-if that gamma-ray source is a spin-powered pulsar. Many of the 10 X-ray sources lacking optical counterparts are likely (extragalactic) active galactic nuclei, based upon the sky density of such sources. Although one of the 10 optically unidentified X-ray sources could be the gamma-ray source, there is no auxiliary evidence supporting such an identification
NASA Astrophysics Data System (ADS)
Kim, Hyung Taek; Nakajima, Kazuhisa; Hojbota, Calin; Jeon, Jong Ho; Rhee, Yong-Joo; Lee, Kyung Hwan; Lee, Seong Ku; Sung, Jae Hee; Lee, Hwang Woon; Pathak, Vishwa B.; Pae, Ki Hong; Sebban, Stéphane; Tissandier, Fabien; Gautier, Julien; Ta Phuoc, Kim; Malka, Victor; Nam, Chang Hee
2017-05-01
Short-pulse x-ray/gamma-ray sources have become indispensable light sources for investigating material science, bio technology, and photo-nuclear physics. In past decades, rapid advancement of high intensity laser technology led extensive progresses in the field of radiation sources based on laser-plasma interactions - x-ray lasers, betatron radiation and Compton gamma-rays. Ever since the installation of a 100-TW laser in 2006, we have pursued the development of ultrashort x-ray/gamma-ray radiations, such as x-ray lasers, relativistic high-order harmonics, betatron radiation and all-optical Compton gamma-rays. With the construction of two PW Ti:Sapphire laser beamlines having peak powers of 1.0 PW and 1.5 PW in 2010 and 2012, respectively [1], we have investigated the generation of multi-GeV electron beams [2] and MeV betatron radiations. We plan to carry out the Compton backscattering to generate MeV gamma-rays from the interaction of a GeV electron beam and a PW laser beam. Here, we present the recent progress in the development of ultrashort x-ray/gamma-ray radiation sources based on laser plasma interactions and the plan for developing Compton gamma-ray sources driven by the PW lasers. In addition, we will present the applications of laser-plasma x-ray lasers to x-ray holography and coherent diffraction imaging. [references] 1. J. H. Sung, S. K. Lee, T. J. Yu, T. M. Jeong, and J. Lee, Opt. Lett. 35, 3021 (2010). 2. H. T. Kim, K. H. Pae, H. J. Cha, I J. Kim, T. J. Yu, J. H. Sung, S. K. Lee, T. M. Jeong, J. Lee, Phys. Rev. Lett. 111, 165002 (2013).
NASA Astrophysics Data System (ADS)
Aleksandrov, A. P.; Berezovoy, A. N.; Galper, A. M.; Grachev, V. M.; Dmitrenko, V. V.; Kirillov-Ugryumov, V. G.; Lebedev, V. V.; Lyakhov, V. A.; Moiseyev, A. A.; Ulin, S. Y.
1985-09-01
Coding collimators are used to improve the angular resolution of gamma-ray telescopes at energies above 50 MeV. However, the interaction of cosmic rays with the collimation material can lead to the appearance of a gamma-ray background flux which can have a deleterious effect on measurement efficiency. An experiment was performed on the Salyut-6-Soyuz spacecraft system with the Elena-F small-scale gamma-ray telescope in order to measure the magnitude of this background. It is shown that, even at a zenith angle of approximately zero degrees (the angle at which the gamma-ray observations are made), the coding collimator has only an insignificant effect on the background conditions.
An Unusual Supernova in the Error Box of the Gamma-Ray Burst of 25 April 1998
NASA Technical Reports Server (NTRS)
Galama , T. J.; Vreeswijk, P. M.; vanParadijs, J.; Kouveliotou, C.; Augusteijn, T.; Boehnhardt, H.; Brewer, J. P.; Doublier, V.; Gonzalez, J.-F.; Leibundgut, B.;
1999-01-01
The discovery of afterglows associated with gamma-ray bursts at X-ray, optical and radio wavelengths and the measurement of the redshifts of some of these events has established that gamma-ray bursts lie at extreme distances, making them the most powerful photon-emitters known in the Universe. Here we report the discovery of transient optical emission in the error box of the gamma-ray burst GRB980425, the light curve of which was very different from that of previous optical afterglows associated with gamma-ray bursts. The optical transient is located in a spiral arm of the galaxy ESO 184-GS2, which has a redshift velocity of only 2,550 km/ s. Its optical spectrum and location indicate that it is a very luminous supernova, which has been identified as SN1998bw. If this supernova and GRB980425 are indeed associated, the energy radiated in gamma-rays is at least four orders of magnitude less than in other gamma-ray bursts, although its appearance was otherwise unremarkable: this indicates that very different mechanisms can give rise to gamma-ray bursts. But independent of this association, the supernova is itself unusual, exhibiting an unusual light curve at radio wavelengths that requires that the gas emitting the radio photons be expanding relativistically.
Prospects for future very high-energy gamma-ray sky survey: Impact of secondary gamma rays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoue, Yoshiyuki; Kalashev, Oleg E.; Kusenko, Alexander
2014-02-01
Very high-energy gamma-ray measurements of distant blazars can be well explained by secondary gamma rays emitted by cascades induced by ultra-high-energy cosmic rays. The secondary gamma rays will enable one to detect a large number of blazars with future ground based gamma-ray telescopes such as Cherenkov Telescope Array (CTA). We show that the secondary emission process will allow CTA to detect 100, 130, 150, 87, and 8 blazars above 30 GeV, 100 GeV, 300 GeV, 1 TeV, and 10 TeV, respectively, up to z~8 assuming the intergalactic magnetic field (IGMF) strength B=10-17 G and an unbiased all sky survey withmore » 0.5 h exposure at each field of view, where total observing time is ~540 h. These numbers will be 79, 96, 110, 63, and 6 up to z~5 in the case of B=10-15 G. This large statistics of sources will be a clear evidence of the secondary gamma-ray scenarios and a new key to studying the IGMF statistically. We also find that a wider and shallower survey is favored to detect more and higher redshift sources even if we take into account secondary gamma rays.« less
Studying the High Energy Gamma Ray Sky with Gamma Ray Large Area Space Telescope (GLAST)
NASA Technical Reports Server (NTRS)
Kamae, T.; Ohsugi, T.; Thompson, D. J.; Watanabe, K.
1998-01-01
Building on the success of the Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory, the Gamma Ray Large Area Space Telescope (GLAST) will make a major step in the study of such subjects as blazars, gamma Ray bursts, the search for dark matter, supernova remnants, pulsars, diffuse radiation, and unidentified high energy sources. The instrument will be built on new and mature detector technologies such as silicon strip detectors, low-power low-noise LSI, and a multilevel data acquisition system. GLAST is in the research and development phase, and one full tower (of 25 total) is now being built in collaborating institutes. The prototype tower will be tested thoroughly at Stanford Linear Accelerator Center (SLAC) in the fall of 1999.
Monitoring the Low-Energy Gamma-Ray Sky Using Earth Occultation with GLAST GBM
NASA Technical Reports Server (NTRS)
Case, G.; Wilson-Hodge, C.; Cherry, M.; Kippen, M.; Ling, J.; Radocinski, R.; Wheaton, W.
2007-01-01
Long term all-sky monitoring of the 20 keV - 2 MeV gamma-ray sky using the Earth occultation technique was demonstrated by the BATSE instrument on the Compton Gamma Ray Observatory. The principles and techniques used for the development of an end-to-end earth occultation data analysis system for BATSE can be extended to the GLAST Gamma-ray Burst Monitor (GBM), resulting in multiband light curves and time-resolved spectra in the energy range 8 keV to above 1 MeV for known gamma-ray sources and transient outbursts, as well as the discovery of new sources of gamma-ray emission. In this paper we describe the application of the technique to the GBM. We also present the expected sensitivity for the GBM.
Separation of gamma-ray and neutron events with CsI(Tl) pulse shape analysis
NASA Astrophysics Data System (ADS)
Ashida, Y.; Nagata, H.; Koshio, Y.; Nakaya, T.; Wendell, R.
2018-04-01
Fast neutrons are a large background to measurements of gamma-rays emitted from excited nuclei, such that detectors that can efficiently distinguish between the two are essential. In this paper we describe the separation of gamma-rays from neutrons with the pulse shape information of the CsI(Tl) scintillator, using a fast neutron beam and several gamma-ray sources. We find that a figure of merit optimized for this separation takes on large and stable values (nearly 4) between 5 and 10 MeV of electron equivalent deposited energy, the region of most interest to the study of nuclear de-excitation gamma-rays. Accordingly, this work demonstrates the ability of CsI(Tl) scintillators to reject neutron backgrounds to gamma-ray measurements at these energies.
Fermi Establishes Classical Novae as a Distinct Class of Gamma-ray Sources
NASA Technical Reports Server (NTRS)
Ackermann, M.; Ajello, M.; Albert, A.; Baldini, L.; Ballet, J.; Bastieri, D.; Bellazzini, R.; Bissaldi, E.; Blandford, R. D.; Bloom, E. D.;
2014-01-01
A classical nova results from runaway thermonuclear explosions on the surface of a white dwarf that accretes matter from a low-mass main-sequence stellar companion. In 2012 and 2013, three novae were detected in gamma rays and stood in contrast to the first gamma-ray detected nova V407 Cygni 2010, which belongs to a rare class of symbiotic binary systems. Despite likely differences in the compositions and masses of their white dwarf progenitors, the three classical novae are similarly characterized as soft spectrum transient gamma-ray sources detected over 2-3 week durations. The gamma-ray detections point to unexpected high-energy particle acceleration processes linked to the mass ejection from thermonuclear explosions in an unanticipated class of Galactic gamma-ray sources.
NASA Technical Reports Server (NTRS)
Ackermann, M.; Ajello, M.; Albert, A.; Allafort, A.; Antolini, E.; Baldini, L.; Ballet, J.; Barbiellini, G; Bastieri, D.; Bechtol, K.;
2013-01-01
In this paper, we present the Fermi All-sky Variability Analysis (FAVA), a tool to systematically study the variability of the gamma-ray sky measured by the Large Area Telescope on board the Fermi Gamma-ray Space Telescope.For each direction on the sky, FAVA compares the number of gamma-rays observed in a given time window to the number of gamma-rays expected for the average emission detected from that direction. This method is used in weekly time intervals to derive a list of 215 flaring gamma-ray sources. We proceed to discuss the 27 sources found at Galactic latitudes smaller than 10 and show that, despite their low latitudes, most of them are likely of extragalactic origin.
The GeV Gamma-Ray Emission Detected by Fermi-LAT Adjacent to SNR Kesteven 41
NASA Astrophysics Data System (ADS)
Liu, Bing; Chen, Yang; Zhang, Xiao; Zhang, Gao-Yuan; Xing, Yi; Pannuti, Thomas G.
2017-02-01
Gamma-ray observations for Supernova remnant (SNR)-molecular cloud (MC) association systems play an important role in the research on the acceleration and propagation of cosmic-ray protons. Through the analysis of 5.6 years of Fermi-Large Area Telescope observation data, here we report on the detection of a gamma-ray emission source near the SNR Kesteven 41 with a significance of 24σ in 0.2-300 GeV. The best-fit location of the gamma-ray source is consistent with the MC with which the SNR interacts. Several hypotheses including both leptonic and hadronic scenarios are considered to investigate the origin of these gamma-rays. The gamma-ray emission can be naturally explained by the decay of neutral pions produced via the collision between high energy protons accelerated by the shock of Kesteven 41 and the adjacent MC. The electron energy budget would be too high for the SNR if the gamma-rays were produced via inverse Compton (IC) scattering off the Cosmic Microwave Background (CMB) photons.
Fermi: The Gamma-Ray Large Area Telescope Mission Status
NASA Technical Reports Server (NTRS)
McEnery, Julie
2014-01-01
Following its launch in June 2008, high-energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have unveiled over 1000 new sources and opened an important and previously unexplored window on a wide variety of phenomena. These have included the discovery of an population of pulsars pulsing only in gamma rays; the detection of photons up to 10s of GeV from gamma-ray bursts, enhancing our understanding of the astrophysics of these powerful explosions; the detection of hundreds of active galaxies; a measurement of the high energy cosmic-ray electron spectrum which may imply the presence of nearby astrophysical particle accelerators; the determination of the diffuse gamma-ray emission with unprecedented accuracy and the constraints on phenomena such as supersymmetric dark-matter annihilations and exotic relics from the Big Bang. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from active galaxies and the discovery of transient sources in our galaxy. In this talk I will describe the current status of the Fermi observatory and review the science highlights from Fermi.
Fermi: The Gamma-Ray Large Area Space Telescope Mission Status
NASA Technical Reports Server (NTRS)
McEnery, Julie E
2014-01-01
Following its launch in June 2008, high-energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have unveiled over 1000 new sources and opened an important and previously unexplored window on a wide variety of phenomena. These have included the discovery of a population of pulsars pulsing only in gamma rays; the detection of photons up to 10s of gigaelectronvolts from gamma-ray bursts, enhancing our understanding of the astrophysics of these powerful explosions; the detection of hundreds of active galaxies; a measurement of the high energy cosmic-ray electron spectrum which may imply the presence of nearby astrophysical particle accelerators; the determination of the diffuse gamma-ray emission with unprecedented accuracy and the constraints on phenomena such as super-symmetric dark-matter annihilations and exotic relics from the Big Bang. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from active galaxies and the discovery of transient sources in our galaxy. In this talk I will describe the current status of the Fermi observatory and review the science highlights from Fermi.
Fermi: The Gamma-Ray Large Area Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie
2015-01-01
Following its launch in June 2008, high-energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have unveiled over 1000 new sources and opened an important and previously unexplored window on a wide variety of phenomena. These have included the discovery of an population of pulsars pulsing only in gamma rays; the detection of photons up to 10s of GeV from gamma-ray bursts, enhancing our understanding of the astrophysics of these powerful explosions; the detection of hundreds of active galaxies; a measurement of the high energy cosmic-ray electron spectrum which may imply the presence of nearby astrophysical particle accelerators; the determination of the diffuse gamma-ray emission with unprecedented accuracy and the constraints on phenomena such as supersymmetric dark-matter annihilations and exotic relics from the Big Bang. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from active galaxies and the discovery of transient sources in our galaxy. In this talk I will describe the current status of the Fermi observatory and review the science highlights from Fermi.
Fermi: The Gamma-Ray Large Area Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie
2014-01-01
Following its launch in June 2008, high-energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have unveiled over 1000 new sources and opened an important and previously unexplored window on a wide variety of phenomena. These have included the discovery of an population of pulsars pulsing only in gamma rays; the detection of photons up to 10 seconds of gigaelectronvolts from gamma-ray bursts, enhancing our understanding of the astrophysics of these powerful explosions; the detection of hundreds of active galaxies; a measurement of the high energy cosmic-ray electron spectrum which may imply the presence of nearby astrophysical particle accelerators; the determination of the diffuse gamma-ray emission with unprecedented accuracy and the constraints on phenomena such as super-symmetric dark-matter annihilations and exotic relics from the Big Bang. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from active galaxies and the discovery of transient sources in our galaxy. In this talk I will describe the current status of the Fermi observatory and review the science highlights from Fermi.
Fermi: The Gamma-Ray Large Area Space Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie
2014-01-01
Following its launch in June 2008, high-energy gamma-ray observations by the Fermi Gamma-ray Space Telescope have unveiled over 1000 new sources and opened an important and previously unexplored window on a wide variety of phenomena. These have included the discovery of an population of pulsars pulsing only in gamma rays; the detection of photons up to 10s of GeV from gamma-ray bursts, enhancing our understanding of the astrophysics of these powerful explosions; the detection of hundreds of active galaxies; a measurement of the high energy cosmic-ray electron spectrum which may imply the presence of nearby astrophysical particle accelerators; the determination of the diffuse gamma-ray emission with unprecedented accuracy and the constraints on phenomena such as supersymmetric dark-matter annihilations and exotic relics from the Big Bang. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from active galaxies and the discovery of transient sources in our galaxy. In this talk I will describe the current status of the Fermi observatory and review the science highlights from Fermi.
Millisecond Pulsars at Gamma-Ray Energies: Fermi Detections and Implications
NASA Technical Reports Server (NTRS)
Harding, Alice K.
2011-01-01
The Fermi Gamma-Ray Space Telescope has revolutionized the study of pulsar physics with the discovery of new populations of radio quiet and millisecond gamma-ray pulsars. The Fermi Large Area Telescope has so far discovered approx.20 new gamma-ray millisecond pulsars (MSPs) by both folding at periods of known radio MSPs or by detecting them as gamma-ray sources that are followed up by radio pulsar searches. The second method has resulted in a phenomenally successful synergy, with -30 new radio MSPs (to date) having been discovered at Fermi unidentified source locations and the gamma-ray pulsations having then been detected in a number of these using the radio timing solutions. Many of the newly discovered MSPs may be suitable for addition to the collection of very stable MSPs used for gravitational wave detection. Detection of such a large number of MSPs was surprising, given that most have relatively low spin-down luminosity and surface field strength. I will discuss their properties and the implications for pulsar particle acceleration and emission, as well as their potential contribution to gamma-ray backgrounds and Galactic cosmic rays.
Search for gamma-ray emission from AE Aquarii with seven year of Fermi LAT observations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jian; Torres, Diego F.; Rea, Nanda
2016-11-14
AE Aquarii (AE Aqr) is a cataclysmic binary hosting one of the fastest rotating (more » $${P}_{\\mathrm{spin}}$$ = 33.08 s) white dwarfs (WDs) known. Based on seven years of Fermi Large Area Telescope (LAT) Pass 8 data, we report on a deep search for gamma-ray emission from AE Aqr. When using X-ray observations from ASCA, XMM-Newton, Chandra, Swift, Suzaku, and NuSTAR, spanning 20 years, we substantially extend and improve the spin ephemeris of AE Aqr. Using this ephemeris, we searched for gamma-ray pulsations at the spin period of the WD. We detected no gamma-ray pulsations above 3σ significance. Neither phase-averaged gamma-ray emission nor gamma-ray variability of AE Aqr is detected by Fermi LAT. We also impose the most restrictive upper limit to the gamma-ray flux from AE Aqr to date: $$1.3\\times {10}^{-12}$$ erg cm -2 s -1 in the 100 MeV–300 GeV energy range, providing constraints on models.« less
NASA Astrophysics Data System (ADS)
Aleksandrov, A. P.; Berezovoj, A. N.; Gal'Per, A. M.; Grachev, V. M.; Dmitrenko, V. V.; Kirillov-Ugryumov, V. G.; Lebedev, V. V.; Lyakhov, V. A.; Moiseev, A. A.; Ulin, S. E.; Shchvets, N. I.
1984-11-01
Coding collimators are used to improve the angular resolution of gamma-ray telescopes at energies above 50 MeV. However, the interaction of cosmic rays with the collimator material can lead to the appearance of a gramma-ray background flux which can have a deleterious effect on measurement efficiency. An experiment was performed on the Salyut-6-Soyuz spacecraft system with the Elena-F small-scale gamma-ray telescope in order to measure the magnitude of this background. It is shown that, even at a zenith angle of approximately zero degrees (the angle at which the gamma-ray observations are made), the coding collimator has only an insignificant effect on the background conditions.
The First Fermi Large Area Telescope Catalog of Gamma-ray Pulsars
Abdo, A. A.; Ackermann, M.; Ajello, M.; ...
2010-03-25
The dramatic increase in the number of known gamma-ray pulsars since the launch of the Fermi Gamma-ray Space Telescope (formerly GLAST) offers the first opportunity to study a sizable population of these high-energy objects. This catalog summarizes 46 high-confidence pulsed detections using the first six months of data taken by the Large Area Telescope (LAT), Fermi's main instrument. Sixteen previously unknown pulsars were discovered by searching for pulsed signals at the positions of bright gamma-ray sources seen with the LAT, or at the positions of objects suspected to be neutron stars based on observations at other wavelengths. The dimmest observed flux among these gamma-ray-selected pulsars is 6.0 × 10 –8 ph cm –2 s –1 (for E>100 MeV). Pulsed gamma-ray emission was discovered from 24 known pulsars by using ephemerides (timing solutions) derived from monitoring radio pulsars. Eight of these new gamma-ray pulsars are millisecond pulsars. The dimmest observed flux among the radio-selected pulsars is 1.4 × 10 –8 ph cm –2 s –1 (for E>100 MeV). The remaining six gamma-ray pulsars were known since the Compton Gamma Ray Observatory mission, or before. The limiting flux for pulse detection is non-uniform over the sky owing to different background levels, especially near the Galactic plane. The pulsed energy spectra can be described by a power law with an exponential cutoff, with cutoff energies in the range ~1-5 GeV. The rotational energy-loss rate (more » $$\\dot{E}$$) of these neutron stars spans five decades, from ~3 × 10 33 erg s –1 to 5 × 10 38 erg s –1, and the apparent efficiencies for conversion to gamma-ray emission range from ~0.1% to ~ unity, although distance uncertainties complicate efficiency estimates. The pulse shapes show substantial diversity, but roughly 75% of the gamma-ray pulse profiles have two peaks, separated by ≳0.2 of rotational phase. For most of the pulsars, gamma-ray emission appears to come mainly from the outer magnetosphere, while polar-cap emission remains plausible for a remaining few. Spatial associations imply that many of these pulsars power pulsar wind nebulae. In conclusion, these discoveries suggest that gamma-ray-selected young pulsars are born at a rate comparable to that of their radio-selected cousins and that the birthrate of all young gamma-ray-detected pulsars is a substantial fraction of the expected Galactic supernova rate.« less
Recombining plasma in the gamma-ray-emitting mixed-morphology supernova remnant 3C 391
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ergin, T.; Sezer, A.; Saha, L.
2014-07-20
A group of middle-aged mixed-morphology (MM) supernova remnants (SNRs) interacting with molecular clouds (MCs) has been discovered to be strong GeV gamma-ray emitters by the Large Area Telescope (LAT) on board the Fermi Gamma-Ray Space Telescope (Fermi-LAT). The recent observations of the Suzaku X-ray satellite have revealed that some of these interacting gamma-ray-emitting SNRs, such as IC443, W49B, W44, and G359.1-0.5, have overionized plasmas. 3C 391 (G31.9+0.0) is another Galactic MM SNR interacting with MCs. It was observed in GeV gamma rays by Fermi-LAT as well as in the 0.3-10.0 keV X-ray band by Suzaku. In this work, 3C 391more » was detected in GeV gamma rays with a significance of ∼18σ and we showed that the GeV emission is point-like in nature. The GeV gamma-ray spectrum was shown to be best explained by the decay of neutral pions assuming that the protons follow a broken power-law distribution. We revealed radiative recombination structures of silicon and sulfur from 3C 391 using Suzaku data. In this paper, we discuss the possible origin of this type of radiative plasma and hadronic gamma rays.« less
GRI: The Gamma-Ray Imager mission
NASA Astrophysics Data System (ADS)
Knödlseder, Jürgen; GRI Consortium
With the INTEGRAL observatory ESA has provided a unique tool to the astronomical community revealing hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes. While INTEGRAL provides the global overview over the soft gamma-ray sky, there is a growing need to perform deeper, more focused investigations of gamma-ray sources. In soft X-rays a comparable step was taken going from the Einstein and the EXOSAT satellites to the Chandra and XMM/Newton observatories. Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction have paved the way towards a new gamma-ray mission, providing major improvements regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow studies of particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
GRI: The Gamma-Ray Imager mission
NASA Astrophysics Data System (ADS)
Knödlseder, Jürgen; GRI Consortium
2006-06-01
With the INTEGRAL observatory, ESA has provided a unique tool to the astronomical community revealing hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes. While INTEGRAL provides the global overview over the soft gamma-ray sky, there is a growing need to perform deeper, more focused investigations of gamma-ray sources. In soft X-rays a comparable step was taken going from the Einstein and the EXOSAT satellites to the Chandra and XMM/Newton observatories. Technological advances in the past years in the domain of gamma-ray focusing using Laue diffraction have paved the way towards a new gamma-ray mission, providing major improvements regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow the study of particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
Periodic Emission from the Gamma-Ray Binary 1FGL J1018.6-5856
Ackermann, M.
2012-01-12
Gamma-ray binaries are stellar systems containing a neutron star or black hole with gamma-ray emission produced by an interaction between the components. These systems are rare, even though binary evolution models predict dozens in our Galaxy. A search for gamma-ray binaries with the Fermi Large Area Telescope (LAT) shows that 1FGL J1018.6-5856 exhibits intensity and spectral modulation with a 16.6 day period. We identified a variable X-ray counterpart, which shows a sharp maximum coinciding with maximum gamma-ray emission, as well as an O6V((f)) star optical counterpart and a radio counterpart that is also apparently modulated on the orbital period. 1FGLmore » J1018.6-5856 is thus a gamma-ray binary, and its detection suggests the presence of other fainter binaries in the Galaxy.« less
Status of the GAMMA-400 Project
NASA Technical Reports Server (NTRS)
Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Gusakov, Yu. V.; Farber, M. O.;
2013-01-01
The preliminary design of the new space gamma-ray telescope GAMMA-400 for the energy range 100 MeV-3 TeV is presented. The angular resolution of the instrument, 1-2 deg at E(gamma) approximately 100 MeV and approximately 0.01 at E(gamma) greater than 100 GeV, its energy resolution is approximately 1% at E(gamma) greater than 100 GeV, and the proton rejection factor is approximately 10(exp 6) are optimized to address a broad range of science topics, such as search for signatures of dark matter, studies of Galactic and extragalactic gamma-ray sources, Galactic and extragalactic diffuse emission, gamma-ray bursts, as well as high-precision measurements of spectra of cosmic-ray electrons, positrons, and nuclei.
Modulated method for efficient, narrow-bandwidth, laser Compton X-ray and gamma-ray sources
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barty, Christopher P. J.
A method of x-ray and gamma-ray generation via laser Compton scattering uses the interaction of a specially-formatted, highly modulated, long duration, laser pulse with a high-frequency train of high-brightness electron bunches to both create narrow bandwidth x-ray and gamma-ray sources and significantly increase the laser to Compton photon conversion efficiency.
Method for efficient, narrow-bandwidth, laser compton x-ray and gamma-ray sources
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barty, Christopher P. J.
A method of x-ray and gamma-ray generation via laser Compton scattering uses the interaction of a specially-formatted, highly modulated, long duration, laser pulse with a high-frequency train of high-brightness electron bunches to both create narrow bandwidth x-ray and gamma-ray sources and significantly increase the laser to Compton photon conversion efficiency.
Abdul-Majid, S
1987-01-01
The characteristics of a 25.4 X 91 cm solar cell panel used as an x-ray and gamma-ray radiation monitor are presented. Applications for monitoring the primary x-ray beam are described at different values of operating currents and voltages as well as for directional dependence of scattered radiation. Other applications in gamma-ray radiography are also given. The detector showed linear response to both x-ray and gamma-ray exposures. The equipment is rigid, easy to use, relatively inexpensive and requires no power supply or any complex electronic equipment.
Fermi GBM Observations of Terrestrial Gamma-Ray Flashes
NASA Technical Reports Server (NTRS)
Wilson-Hodge, Colleen A.; Briggs, M. S.; Connaughton, V.; Fishman, G. J.; Bhat, P. N.; Paciesas, W. S.; Preece, R.; Kippen, R. M.; vonKienlin, A.; Dwyer, J. R.;
2010-01-01
This slide presentation explores the relationship between Terrestrial Gamma-Ray Flashes (TGF) and lightning. Using data from the World-Wide Lightning Location Network (WWLLN), and the gamma ray observations from Fermi's Gamma-ray Burst Monitor (GBM), the study reviews any causal relationship between TGFs and lightning. The conclusion of the study is that the TGF and lightning are simultaneous with out a causal relationship.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moskalenko, Igor V.; Porter, Troy A.
2007-06-14
We use the GEANT4 Monte Carlo framework to calculate the gamma-ray albedo of the Moon due to interactions of cosmic ray (CR) nuclei with moon rock. Our calculation of the albedo spectrum agrees with the EGRET data. We show that the spectrum of gamma-rays from the Moon is very steep with an effective cutoff around 3 GeV (600 MeV for the inner part of the Moon disc). Since it is the only (almost) black spot in the gamma-ray sky, it provides a unique opportunity for calibration of gamma-ray telescopes, such as the forthcoming Gamma Ray Large Area Space Telescope (GLAST).more » The albedo flux depends on the incident CR spectrum which changes over the solar cycle. Therefore, it is possible to monitor the CR spectrum using the albedo gamma-ray flux. Simultaneous measurements of CR proton and helium spectra by the Payload for Antimatter Matter Exploration and Light-nuclei Astrophysics (PAMELA), and observations of the albedo -rays by the GLAST Large Area Telescope (LAT), can be used to test the model predictions and will enable the GLAST LAT to monitor the CR spectrum near the Earth beyond the lifetime of PAMELA.« less
NEAR Gamma Ray Spectrometer Characterization and Repair
NASA Technical Reports Server (NTRS)
Groves, Joel Lee; Vajda, Stefan
1998-01-01
This report covers the work completed in the third year of the contract. The principle activities during this period were (1) the characterization of the NEAR 2 Gamma Ray Spectrometer using a neutron generator to generate complex gamma ray spectra and a large Ge Detecter to identify all the major peaks in the spectra; (2) the evaluation and repair of the Engineering Model Unit of the Gamma Ray Spectrometer for the NEAR mission; (3) the investigation of polycapillary x-ray optics for x-ray detection; and (4) technology transfer from NASA to forensic science.
Multiwavelength Study of Gamma-Ray Bright Blazars
NASA Astrophysics Data System (ADS)
Morozova, Daria; Larionov, V. M.; Hagen-Thorn, V. A.; Jorstad, S. G.; Marscher, A. P.; Troitskii, I. S.
2011-01-01
We investigate total intensity radio images of 6 gamma-ray bright blazars (BL Lac, 3C 279, 3C 273, W Com, PKS 1510-089, and 3C 66A) and their optical and gamma-ray light curves to study connections between gamma-ray and optical brightness variations and changes in the parsec-scale radio structure. We use high-resolution maps obtained by the BU group at 43 GHz with the VLBA, optical light curves constructed by the St.Petersburg State U. (Russia) team using measurements with the 0.4 m telescope of St.Petersburg State U. (LX200) and the 0.7 m telescope of the Crimean Astrophysical Observatory (AZT-8), and gamma-ray light curves, which we have constructed with data provided by the Fermi Large Area Telescope. Over the period from August 2008 to November 2009, superluminal motion is found in all 6 objects with apparent speed ranging from 2c to 40c. The blazars with faster apparent speeds, 3C 273, 3C 279, PKS 1510-089, and 3C 66A, exhibit stronger variability of the gamma-ray emission. There is a tendency for sources with sharply peaked gamma-ray flares to have faster jet speed than sources with gamma-ray light curves with no sharp peaks. Gamma-ray light curves with sharply peaked gamma-ray flares possess a stronger gamma-ray/optical correlations. The research at St.Petersburg State U. was funded by the Minister of Education and Science of the Russian Federation (state contract N#P123). The research at BU was funded in part by NASA Fermi Guest Investigator grant NNX08AV65G and by NSF grant AST-0907893. The VLBA is an instrument of the National Radio Astronomy Observatory, a facility of the National Science Foundation operated under cooperative agreement by Associated Universities, Inc.
Cosmic gamma-rays and cosmic nuclei above 1 TeV
NASA Technical Reports Server (NTRS)
Watson, A. A.
1986-01-01
Work on cosmic gamma rays and cosmic nuclei above I TeV is described and evaluated. The prospect that gamma ray astronomy above I TeV will give new insights into high energy cosmic ray origin within our galaxy is particularly bright.
Sources of GeV Photons and the Fermi Results
NASA Astrophysics Data System (ADS)
Dermer, Charles D.
This chapter presents the elaborated lecture notes on Sources of GeV Photons and the Fermi Results given by Charles D. Dermer at the 40th Saas-Fee Advanced Course on "Astrophysics at Very High Energies". The Fermi Gamma-ray Space Telescope made important discoveries and established new results in various areas of astrophysics: from our solar system to remote gamma-ray bursts, from pulsar physics to limits on dark matter and Lorentz invariance violations. The author gives a broad overview of these results by discussing GeV instrumentation and the GeV sky as seen by Fermi, the Fermi catalogs on gamma-ray sources, pulsars and active galactic nuclei, relativistic jet physics and blazars, gamma-rays from cosmic rays in the Galaxy, from star-forming galaxies and from clusters of galaxies, the diffuse extra-galactic gamma-ray background, micro-quasars, radio galaxies, the extragalactic background light, gamma-ray bursts, Fermi acceleration, ultra-high energy cosmic rays, and black holes.
Simultaneous observation of the gamma-ray binary LS I+61 303 with GLAST and Suzaku
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Takuya; Fukazawa, Yasushi; Mizuno, Tsunefumi
2007-07-12
The gamma-ray binary LS I+61 303 is a bright gamma-ray source, and thus an attracting object for GLAST. We proposed to observe this object with the X-ray satellite Suzaku (AO-2), simultaneously with GLAST, radio wave, and optical spectro-polarimetry, in order to probe the geometrical state of the binary system emitting the gamma-ray radiation, as a function of the binary orbital phase for the first time. This is essential to understand the mechanism of jet production and gamma-ray emission. The idea is not only to measure the multi-band overall continuum shape, but also to make use of continuous monitoring capability ofmore » GLAST, wide X-ray band of Suzaku, and good accessibility of the Kanata optical/NIR telescope (Hiroshima University) with the sensitive optical spectro-polarimetry. Further collaboration with TeV gamma-ray telescopes is also hoped to constrain the jet constitution.« less
Ground-based very high energy gamma ray astronomy: Observational highlights
NASA Technical Reports Server (NTRS)
Turver, K. E.
1986-01-01
It is now more than 20 years since the first ground based gamma ray experiments involving atmospheric Cerenkov radiation were undertaken. The present highlights in observational ground-based very high energy (VHE) gamma ray astronomy and the optimism about an interesting future for the field follow progress in these areas: (1) the detection at increased levels of confidence of an enlarged number of sources so that at present claims were made for the detection, at the 4 to 5 sd level of significance, of 8 point sources; (2) the replication of the claimed detections with, for the first time, confirmation of the nature and detail of the emission; and (3) the extension of gamma ray astronomy to the ultra high energy (UHE) domain. The pattern, if any, to emerge from the list of sources claimed so far is that X-ray binary sources appear to be copious emitters of gamma rays over at least 4 decades of energy. These X-ray sources which behave as VHE and UHE gamma ray emitters are examined.
Cui, Jie; Xu, Xin; Yang, Mo; Chen, Chen; Zhao, Wei; Wu, Mei; Zhang, Zun-zhen
2011-11-01
To explore the relationship between the expression level of DNA polymerase beta (pol beta) and 60Co gamma-ray radiosensitivity and provide a basis on improving the efficiency of radiotherapy theoretically. pol beta wild-type cells (pol beta +/+), pol beta null cells (pol beta -/-) and pol beta overexpressed cells (polp beta oe) were applied as a model system. The radiosensitivity of 60Co gamma-ray on the cell was detected by MTT assay and clone formation assay. The DCFH-DA fluorescent probe was used to examine the cellular ROS after 60Co gamma-rays radiation. MTT assay showed that after radiation by 60Co gamma-rays followed with 72 h incubation, the cell viabilities in the three kinds of cells decreased significantly with a dose-response relationship (r-/+ = -0.976, r-/- = -0.977, r(oe) = -0.982, P<0.05). In addition, the viability of pol beta -/- cell was lower than those of other two kinds of cells at the same dose (P<0.05). Likewise, the colony number and colony formation rate in all tested cells also decreased after exposure to 60Co gamma-rays. The ROS level in the three kinds of cells was enhanced after treatment with 60Co gamma-ray, and the ROS level in pol beta -/- cells was much higher than that in the other two kinds of cells (P<0.05). Cell death caused by 60Co gamma-ray may associated with the DNA oxidative damage mediated by ROS; Overexpression of pol beta could protect against oxidative DNA damage, thus the cell apoptosis/death, thereby leading to reducing the radiosensitivity of 60Co gamma-rays, while null of DNA pol beta could increase radiosensitivity of 60Co gamma-rays by compromising the DNA repair.
Discovery of very-high-energy gamma-rays from the Galactic Centre ridge.
Aharonian, F; Akhperjanian, A G; Bazer-Bachi, A R; Beilicke, M; Benbow, W; Berge, D; Bernlöhr, K; Boisson, C; Bolz, O; Borrel, V; Braun, I; Breitling, F; Brown, A M; Chadwick, P M; Chounet, L-M; Cornils, R; Costamante, L; Degrange, B; Dickinson, H J; Djannati-Ataï, A; Drury, L O'C; Dubus, G; Emmanoulopoulos, D; Espigat, P; Feinstein, F; Fontaine, G; Fuchs, Y; Funk, S; Gallant, Y A; Giebels, B; Gillessen, S; Glicenstein, J F; Goret, P; Hadjichristidis, C; Hauser, D; Hauser, M; Heinzelmann, G; Henri, G; Hermann, G; Hinton, J A; Hofmann, W; Holleran, M; Horns, D; Jacholkowska, A; de Jager, O C; Khélifi, B; Klages, S; Komin, Nu; Konopelko, A; Latham, I J; Le Gallou, R; Lemière, A; Lemoine-Goumard, M; Leroy, N; Lohse, T; Marcowith, A; Martin, J M; Martineau-Huynh, O; Masterson, C; McComb, T J L; de Naurois, M; Nolan, S J; Noutsos, A; Orford, K J; Osborne, J L; Ouchrif, M; Panter, M; Pelletier, G; Pita, S; Pühlhofer, G; Punch, M; Raubenheimer, B C; Raue, M; Raux, J; Rayner, S M; Reimer, A; Reimer, O; Ripken, J; Rob, L; Rolland, L; Rowell, G; Sahakian, V; Saugé, L; Schlenker, S; Schlickeiser, R; Schuster, C; Schwanke, U; Siewert, M; Sol, H; Spangler, D; Steenkamp, R; Stegmann, C; Tavernet, J-P; Terrier, R; Théoret, C G; Tluczykont, M; van Eldik, C; Vasileiadis, G; Venter, C; Vincent, P; Völk, H J; Wagner, S J
2006-02-09
The source of Galactic cosmic rays (with energies up to 10(15) eV) remains unclear, although it is widely believed that they originate in the shock waves of expanding supernova remnants. At present the best way to investigate their acceleration and propagation is by observing the gamma-rays produced when cosmic rays interact with interstellar gas. Here we report observations of an extended region of very-high-energy (> 10(11) eV) gamma-ray emission correlated spatially with a complex of giant molecular clouds in the central 200 parsecs of the Milky Way. The hardness of the gamma-ray spectrum and the conditions in those molecular clouds indicate that the cosmic rays giving rise to the gamma-rays are likely to be protons and nuclei rather than electrons. The energy associated with the cosmic rays could have come from a single supernova explosion around 10(4) years ago.
Helios-2 Vela-Ariel-5 gamma-ray burst source position
NASA Technical Reports Server (NTRS)
Cline, T. L.; Trainor, J. H.; Desai, U. D.; Klebesadel, R. W.; Ricketts, M.; Heluken, H.
1979-01-01
The gamma-ray burst of 28 January 1976, one of 18 events thus far detected in interplanetary space with Helios-2, was also observed with the Vela-5A, -6A and the Ariel-5 satellites. A small source field is obtained from the intersection of the region derived from the observed time delays between Helios-2 and Vela-5A and -6A with the source region independently found with the Ariel-5 X-ray detector. This area contains neither any steady X-ray source as scanned by HEAO-A nor any previously catalogued X-ray, radio or infrared sources, X-ray transients, quasars, seyferts, globular clusters, flare stars, pulsars, white dwarfs or high energy gamma-ray sources. The region is however, within the source field of a gamma-ray transient observed in 1974, which exhibited nuclear gamma-ray line structure.
Cosmic ray albedo gamma rays from the quiet sun
NASA Technical Reports Server (NTRS)
Seckel, D.; Stanev, T.; Gaisser, T. K.
1992-01-01
We estimate the flux of gamma-rays that result from collisions of high energy galactic cosmic rays with the solar atmosphere. An important aspect of our model is the propagation of cosmic rays through the magnetic fields of the inner solar systems. We use diffusion to model propagation down to the bottom of the corona. Below the corona we trace particle orbits through the photospheric fields to determine the location of cosmic ray interactions in the solar atmosphere and evolve the resultant cascades. For our nominal choice of parameters, we predict an integrated flux of gamma rays (at 1 AU) of F(E(sub gamma) greater than 100 MeV) approximately = 5 x 10(exp -8)/sq cm sec. This can be an order of magnitude above the galactic background and should be observable by the Energetic Gamma Ray experiment telescope (EGRET).
NASA Technical Reports Server (NTRS)
Jones, W. V. (Editor); Wefel, J. P. (Editor)
1985-01-01
The potential of the Space Station as a platform for cosmic-ray and high-energy gamma-ray astronomy is discussed in reviews, reports, and specific proposals. Topics examined include antiparticles and electrons, science facilities and new technology, high-energy nuclear interactions, nuclear composition and energy spectra, Space Shuttle experiments, Space Station facilities and detectors, high-energy gamma rays, and gamma-ray facilities and techniques. Consideration is given to universal-baryon-symmetry testing on the scale of galactic clusters, particle studies in a high-inclination orbit, balloon-borne emulsion-chamber results on ultrarelativistic nucleus-nucleus interactions, ionization states of low-energy cosmic rays, a large gamma-ray telescope for point-source studies above 1 GeV, and the possible existence of stable quark matter.
The supernova-gamma-ray burst-jet connection.
Hjorth, Jens
2013-06-13
The observed association between supernovae and gamma-ray bursts represents a cornerstone in our understanding of the nature of gamma-ray bursts. The collapsar model provides a theoretical framework for this connection. A key element is the launch of a bipolar jet (seen as a gamma-ray burst). The resulting hot cocoon disrupts the star, whereas the (56)Ni produced gives rise to radioactive heating of the ejecta, seen as a supernova. In this discussion paper, I summarize the observational status of the supernova-gamma-ray burst connection in the context of the 'engine' picture of jet-driven supernovae and highlight SN 2012bz/GRB 120422A--with its luminous supernova but intermediate high-energy luminosity--as a possible transition object between low-luminosity and jet gamma-ray bursts. The jet channel for supernova explosions may provide new insights into supernova explosions in general.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ackermann, M.; Ajello, M.; Albert, A.
2013-07-01
In this paper, we present the Fermi All-sky Variability Analysis (FAVA), a tool to systematically study the variability of the gamma-ray sky measured by the Large Area Telescope on board the Fermi Gamma-ray Space Telescope. For each direction on the sky, FAVA compares the number of gamma-rays observed in a given time window to the number of gamma-rays expected for the average emission detected from that direction. This method is used in weekly time intervals to derive a list of 215 flaring gamma-ray sources. We proceed to discuss the 27 sources found at Galactic latitudes smaller than 10 Degree-Sign andmore » show that, despite their low latitudes, most of them are likely of extragalactic origin.« less
Ackermann, M.; Ajello, M.; Albert, A.; ...
2013-06-17
In this paper, we present the Fermi All-sky Variability Analysis (FAVA), a tool to systematically study the variability of the gamma-ray sky measured by the Large Area Telescope on board the Fermi Gamma-ray Space Telescope. In addition, for each direction on the sky, FAVA compares the number of gamma-rays observed in a given time window to the number of gamma-rays expected for the average emission detected from that direction. This method is used in weekly time intervals to derive a list of 215 flaring gamma-ray sources. Finally, we proceed to discuss the 27 sources found at Galactic latitudes smaller thanmore » 10° and show that, despite their low latitudes, most of them are likely of extragalactic origin.« less
The goals of gamma-ray spectroscopy in high energy astrophysics
NASA Technical Reports Server (NTRS)
Lingenfelter, Richard E.; Higdon, James C.; Leventhal, Marvin; Ramaty, Reuven; Woosley, Stanford E.
1990-01-01
The use of high resolution gamma-ray spectroscopy in astrophysics is discussed with specific attention given to the application of the Nuclear Astrophysics Explorer (NAE). The gamma-ray lines from nuclear transitions in radionucleic decay and positron annihilation permits the study of current sites, rates and models of nucleosynthesis, and galactic structure. Diffuse galactic emission is discussed, and the high-resolution observations of gamma-ray lines from discrete sites are also described. Interstellar mixing and elemental abundances can also be inferred from high-resolution gamma-ray spectroscopy of nucleosynthetic products. Compact objects can also be examined by means of gamma-ray emissions, allowing better understanding of neutron stars and the accreting black hole near the galactic center. Solar physics can also be investigated by examining such features as solar-flare particle acceleration and atmospheric abundances.
The 2010 May Flaring Episode of Cygnus X-3 in Radio, X-Rays, and gamma-Rays
NASA Technical Reports Server (NTRS)
Williams, Peter K. G.; Tomsick, John A.; Bodaghee, Arash; Bower, Geoffrey C.; Pooley, Guy G.; Pottschmidt, Katja; Rodriguez, Jerome; Wilms, Joern; Migliari, Simone; Trushkin, Sergei A.
2011-01-01
In 2009, Cygnus X-3 (Cyg X-3) became the first microquasar to be detected in the GeV gamma-ray regime, via the satellites Fermi and AGILE. The addition of this new band to the observational toolbox holds promise for building a more detailed understanding of the relativistic jets of this and other systems. We present a rich dataset of radio, hard and soft X-ray, and gamma-ray observations of Cyg X-3 made during a flaring episode in 2010 May. We detect a approx.3-d softening and recovery of the X-ray emission, followed almost immediately by a approx.1-Jy radio flare at 15 GHz, followed by a 4.3sigma gamma-ray flare (E > 100 MeV) approx.1.5 d later. The radio sampling is sparse, but we use archival data to argue that it is unlikely the gamma-ray flare was followed by any significant unobserved radio flares. In this case, the sequencing of the observed events is difficult to explain in a model in which the gamma-ray emission is due to inverse Compton scattering of the companion star's radiation field. Our observations suggest that other mechanisms may also be responsible for gamma-ray emission from Cyg X-3.
Neutron induced background in the COMPTEL detector on the Gamma Ray Observatory
NASA Technical Reports Server (NTRS)
Morris, D. J.; Aarts, H.; Bennett, K.; Busetta, M.; Byrd, R.; Collmar, W.; Connors, A.; Diehl, R.; Eymann, G.; Foster, C.
1992-01-01
Interactions of neutrons in a prototype of the Compton imaging telescope (COMPTEL) gamma ray detector for the Gamma Ray Observatory were studied to determine COMPTEL's sensitivity as a neutron telescope and to estimate the gamma ray background resulting from neutron interactions. The IUCF provided a pulsed neutron beam at five different energies between 18 and 120 MeV. These measurements showed that the gamma ray background from neutron interactions is greater than previously expected. It was thought that most such events would be due to interactions in the upper detector modules of COMPTEL and could be distinguished by pulse shape discrimination. Rather, the bulk of the gamma ray background appears to be due to interactions in passive material, primarily aluminum, surrounding the D1 modules. In a considerable fraction of these interactions, two or more gamma rays are produced simultaneously, with one interacting in the D1 module and the other interacting in the module of the lower (D2) detector. If the neutron interacts near the D1 module, the D1 D2 time of flight cannot distinguish such an event from a true gamma ray event. In order to assess the significance of this background, the flux of neutrons in orbit has been estimated based on observed events with neutron pulse shape signature in D1. The strength of this neutron induced background is estimated. This is compared with the rate expected from the isotropic cosmic gamma ray flux.
Very-high-energy gamma rays from a distant quasar: how transparent is the universe?
Albert, J; Aliu, E; Anderhub, H; Antonelli, L A; Antoranz, P; Backes, M; Baixeras, C; Barrio, J A; Bartko, H; Bastieri, D; Becker, J K; Bednarek, W; Berger, K; Bernardini, E; Bigongiari, C; Biland, A; Bock, R K; Bonnoli, G; Bordas, P; Bosch-Ramon, V; Bretz, T; Britvitch, I; Camara, M; Carmona, E; Chilingarian, A; Commichau, S; Contreras, J L; Cortina, J; Costado, M T; Covino, S; Curtef, V; Dazzi, F; De Angelis, A; De Cea Del Pozo, E; de Los Reyes, R; De Lotto, B; De Maria, M; De Sabata, F; Mendez, C Delgado; Dominguez, A; Dorner, D; Doro, M; Errando, M; Fagiolini, M; Ferenc, D; Fernández, E; Firpo, R; Fonseca, M V; Font, L; Galante, N; López, R J García; Garczarczyk, M; Gaug, M; Goebel, F; Hayashida, M; Herrero, A; Höhne, D; Hose, J; Hsu, C C; Huber, S; Jogler, T; Kneiske, T M; Kranich, D; La Barbera, A; Laille, A; Leonardo, E; Lindfors, E; Lombardi, S; Longo, F; López, M; Lorenz, E; Majumdar, P; Maneva, G; Mankuzhiyil, N; Mannheim, K; Maraschi, L; Mariotti, M; Martínez, M; Mazin, D; Meucci, M; Meyer, M; Miranda, J M; Mirzoyan, R; Mizobuchi, S; Moles, M; Moralejo, A; Nieto, D; Nilsson, K; Ninkovic, J; Otte, N; Oya, I; Panniello, M; Paoletti, R; Paredes, J M; Pasanen, M; Pascoli, D; Pauss, F; Pegna, R G; Perez-Torres, M A; Persic, M; Peruzzo, L; Piccioli, A; Prada, F; Prandini, E; Puchades, N; Raymers, A; Rhode, W; Ribó, M; Rico, J; Rissi, M; Robert, A; Rügamer, S; Saggion, A; Saito, T Y; Salvati, M; Sanchez-Conde, M; Sartori, P; Satalecka, K; Scalzotto, V; Scapin, V; Schmitt, R; Schweizer, T; Shayduk, M; Shinozaki, K; Shore, S N; Sidro, N; Sierpowska-Bartosik, A; Sillanpää, A; Sobczynska, D; Spanier, F; Stamerra, A; Stark, L S; Takalo, L; Tavecchio, F; Temnikov, P; Tescaro, D; Teshima, M; Tluczykont, M; Torres, D F; Turini, N; Vankov, H; Venturini, A; Vitale, V; Wagner, R M; Wittek, W; Zabalza, V; Zandanel, F; Zanin, R; Zapatero, J
2008-06-27
The atmospheric Cherenkov gamma-ray telescope MAGIC, designed for a low-energy threshold, has detected very-high-energy gamma rays from a giant flare of the distant Quasi-Stellar Radio Source (in short: radio quasar) 3C 279, at a distance of more than 5 billion light-years (a redshift of 0.536). No quasar has been observed previously in very-high-energy gamma radiation, and this is also the most distant object detected emitting gamma rays above 50 gigaelectron volts. Because high-energy gamma rays may be stopped by interacting with the diffuse background light in the universe, the observations by MAGIC imply a low amount for such light, consistent with that known from galaxy counts.
Gamma-ray burster recurrence timescales
NASA Technical Reports Server (NTRS)
Schaefer, B. E.; Cline, T. L.
1984-01-01
Three optical transients have been found which are associated with gamma-ray bursters (GRBs). The deduced recurrence timescale for these optical transients (tau sub opt) will depend on the minimum brightness for which a flash would be detected. A detailed analysis using all available data of tau sub opt as a function of E(gamma)/E(opt) is given. For flashes similar to those found in the Harvard archives, the best estimate of tau sub opt is 0.74 years, with a 99% confidence interval from 0.23 years to 4.7 years. It is currently unclear whether the optical transients from GRBs also give rise to gamma-ray events. One way to test this association is to measure the recurrence timescale of gamma-ray events tau sub gamma. A total of 210 gamma-ray error boxes were examined and it was found that the number of observed overlaps is not significantly different from the number expected from chance coincidence. This observation can be used to place limits on tau sub gamma for an assumed luminosity function. It was found that tau sub gamma is approx. 10 yr if bursts are monoenergetic. However, if GRBs have a power law luminosity function with a wide dynamic range, then the limit is tau sub gamma 0.5 yr. Hence, the gamma-ray data do not require tau sub gamma and tau sub opt to be different.
Multiwavelength Photometric and Spectropolarimetric Analysis of the FSRQ 3C 279
NASA Astrophysics Data System (ADS)
Patiño-Álvarez, V. M.; Fernandes, S.; Chavushyan, V.; López-Rodríguez, E.; León-Tavares, J.; Schlegel, E. M.; Carrasco, L.; Valdés, J.; Carramiñana, A.
2018-06-01
In this paper, we present light curves for 3C 279 over a time period of six years; from 2008 to 2014. Our multiwavelength data comprise 1 mm to gamma-rays, with additional optical polarimetry. Based on the behaviour of the gamma-ray light curve with respect to other bands, we identified three different activity periods. One of the activity periods shows anomalous behaviour with no gamma-ray counterpart associated with optical and NIR flares. Another anomalous activity period shows a flare in gamma-rays, 1 mm and polarization degree, however, it does not have counterparts in the UV continuum, optical and NIR bands. We find a significant overall correlation of the UV continuum emission, the optical and NIR bands. This correlation suggests that the NIR to UV continuum is co-spatial. We also find a correlation between the UV continuum and the 1 mm data, which implies that the dominant process in producing the UV continuum is synchrotron emission. The gamma-ray spectral index shows statistically significant variability and an anti-correlation with the gamma-ray luminosity. We demonstrate that the dominant gamma-ray emission mechanism in 3C 279 changes over time. Alternatively, the location of the gamma-ray emission zone itself may change depending on the activity state of the central engine.
Fermi/LAT study of gamma-ray emission in the direction of the monceros loop supernova remnant
Katagiri, H.; Sugiyama, S.; Ackermann, M.; ...
2016-10-31
Here, we present an analysis of the gamma-ray measurements by the Large Area Telescope on board the Fermi Gamma-ray Space Telescope in the region of the supernova remnant (SNR) Monoceros Loop (G205.5+0.5). The brightest gamma-ray peak is spatially correlated with the Rosette Nebula, which is a molecular cloud complex adjacent to the southeast edge of the SNR. After subtraction of this emission by spatial modeling, the gamma-ray emission from the SNR emerges, which is extended and fit by a Gaussian spatial template. The gamma-ray spectra are significantly better reproduced by a curved shape than a simple power law. The luminosities between 0.2 and 300 GeV aremore » $$\\sim 4\\times {10}^{34}$$ erg s -1 for the SNR and $$\\sim 3\\times {10}^{34}$$ erg s -1 for the Rosette Nebula, respectively. We also argue that the gamma-rays likely originate from the interactions of particles accelerated in the SNR. Furthermore, the decay of neutral pions produced in nucleon–nucleon interactions of accelerated hadrons with interstellar gas provides a reasonable explanation for the gamma-ray emission of both the Rosette Nebula and the Monoceros SNR.« less
Moisture effect in prompt gamma measurements from soil samples.
Naqvi, A A; Khiari, F Z; Liadi, F A; Khateeb-Ur-Rehman; Raashid, M A; Isab, A H
2016-09-01
The variation in intensity of 1.78MeV silicon, 6.13MeV oxygen, and 2.22MeV hydrogen prompt gamma rays from soil samples due to the addition of 5.1, 7.4, 9.7, 11.9 and 14.0wt% water was studied for 14MeV incident neutron beams utilizing a LaBr3:Ce gamma ray detector. The intensities of 1.78MeV and 6.13MeV gamma rays from silicon and oxygen, respectively, decreased with increasing sample moisture. The intensity of 2.22MeV hydrogen gamma rays increases with moisture. The decrease in intensity of silicon and oxygen gamma rays with moisture concentration indicates a loss of 14MeV neutron flux, while the increase in intensity of 2.22MeV gamma rays with moisture indicates an increase in thermal neutron flux due to increasing concentration of moisture. The experimental intensities of silicon, oxygen and hydrogen prompt gamma rays, measured as a function of moisture concentration in the soil samples, are in good agreement with the theoretical results obtained through Monte Carlo calculations. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
HESS Collaboration; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Anton, G.; Balenderan, S.; Balzer, A.; Barnacka, A.; Becherini, Y.; Becker, J.; Bernlöhr, K.; Birsin, E.; Biteau, J.; Bochow, A.; Boisson, C.; Bolmont, J.; Bordas, P.; Brucker, J.; Brun, F.; Brun, P.; Bulik, T.; Büsching, I.; Carrigan, S.; Casanova, S.; Cerruti, M.; Chadwick, P. M.; Charbonnier, A.; Chaves, R. C. G.; Cheesebrough, A.; Cologna, G.; Conrad, J.; Couturier, C.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; Dickinson, H. J.; Djannati-Ataï, A.; Domainko, W.; O'C. Drury, L.; Dubus, G.; Dutson, K.; Dyks, J.; Dyrda, M.; Egberts, K.; Eger, P.; Espigat, P.; Fallon, L.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Füßling, M.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Gast, H.; Gérard, L.; Giebels, B.; Glicenstein, J. F.; Glück, B.; Göring, D.; Grondin, M.-H.; Häffner, S.; Hague, J. D.; Hahn, J.; Hampf, D.; Harris, J.; Hauser, M.; Heinz, S.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hillert, A.; Hinton, J. A.; Hofmann, W.; Hofverberg, P.; Holler, M.; Horns, D.; Jacholkowska, A.; Jahn, C.; Jamrozy, M.; Jung, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kaufmann, S.; Khélifi, B.; Klochkov, D.; Kluźniak, W.; Kneiske, T.; Komin, Nu.; Kosack, K.; Kossakowski, R.; Krayzel, F.; Laffon, H.; Lamanna, G.; Lenain, J.-P.; Lennarz, D.; Lohse, T.; Lopatin, A.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Masbou, J.; Maurin, G.; Maxted, N.; Mayer, M.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Moderski, R.; Mohamed, M.; Moulin, E.; Naumann, C. L.; Naumann-Godo, M.; de Naurois, M.; Nedbal, D.; Nekrassov, D.; Nguyen, N.; Nicholas, B.; Niemiec, J.; Nolan, S. J.; Ohm, S.; de Oña Wilhelmi, E.; Opitz, B.; Ostrowski, M.; Oya, I.; Panter, M.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perez, J.; Petrucci, P.-O.; Peyaud, B.; Pita, S.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raue, M.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Rieger, F.; Ripken, J.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Sanchez, D. A.; Santangelo, A.; Schlickeiser, R.; Schulz, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Sheidaei, F.; Skilton, J. L.; Sol, H.; Spengler, G.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Szostek, A.; Tavernet, J.-P.; Terrier, R.; Tluczykont, M.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Viana, A.; Vincent, P.; Völk, H. J.; Volpe, F.; Vorobiov, S.; Vorster, M.; Wagner, S. J.; Ward, M.; White, R.; Wierzcholska, A.; Zacharias, M.; Zajczyk, A.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.; Ali, M. O.
2012-09-01
Context. In some galaxy clusters, powerful active galactic nuclei (AGN) have blown bubbles with cluster scale extent into the ambient medium. The main pressure support of these bubbles is not known to date, but cosmic rays are a viable possibility. For such a scenario copious gamma-ray emission is expected as a tracer of cosmic rays from these systems. Aims: Hydra A, the closest galaxy cluster hosting a cluster scale AGN outburst, located at a redshift of 0.0538, is investigated for being a gamma-ray emitter with the High Energy Stereoscopic System (H.E.S.S.) array and the Fermi Large Area Telescope (Fermi-LAT). Methods: Data obtained in 20.2 h of dedicated H.E.S.S. observations and 38 months of Fermi-LAT data, gathered by its usual all-sky scanning mode, have been analyzed to search for a gamma-ray signal. Results: No signal has been found in either data set. Upper limits on the gamma-ray flux are derived and are compared to models. These are the first limits on gamma-ray emission ever presented for galaxy clusters hosting cluster scale AGN outbursts. Conclusions: The non-detection of Hydra A in gamma-rays has important implications on the particle populations and physical conditions inside the bubbles in this system. For the case of bubbles mainly supported by hadronic cosmic rays, the most favorable scenario, which involves full mixing between cosmic rays and embedding medium, can be excluded. However, hadronic cosmic rays still remain a viable pressure support agent to sustain the bubbles against the thermal pressure of the ambient medium. The largest population of highly-energetic electrons, which are relevant for inverse-Compton gamma-ray production is found in the youngest inner lobes of Hydra A. The limit on the inverse-Compton gamma-ray flux excludes a magnetic field below half of the equipartition value of 16 μG in the inner lobes.
Tanaka, Kenichi; Endo, Satoru; Hoshi, Masaharu
2010-01-01
The imaging plate (IP) technique is tried to be used as a handy method to measure the spatial neutron distribution via the (157)Gd(n,gamma)(158)Gd reaction for neutron capture therapy (NCT). For this purpose, IP is set in a water phantom and irradiated in a mixed field of neutrons and gamma-rays. The Hiroshima University Radiobiological Research Accelerator is utilized for this experiment. The neutrons are moderated with 20-cm-thick D(2)O to obtain suitable neutron field for NCT. The signal for IP doped with Gd as a neutron-response enhancer is subtracted with its contribution by gamma-rays, which was estimated using IP without Gd. The gamma-ray response of Gd-doped IP to non-Gd IP is set at 1.34, the value measured for (60)Co gamma-rays, in estimating the gamma-ray contribution to Gd-doped IP signal. Then measured distribution of the (157)Gd(n,gamma)(158)Gd reaction rate agrees within 10% with the calculated value based on the method that has already been validated for its reproducibility of Au activation. However, the evaluated distribution of the (157)Gd(n,gamma)(158)Gd reaction rate is so sensitive to gamma-ray energy, e.g. the discrepancy of the (157)Gd(n,gamma)(158)Gd reaction rate between measurement and calculation becomes 30% for the photon energy change from 33keV to 1.253MeV.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, Aous A.; /Naval Research Lab, Wash., D.C.; Ackermann, M.
2011-12-01
We report the discovery of {gamma}-ray pulsations ({ge}0.1 GeV) from the young radio and X-ray pulsar PSR J0205 + 6449 located in the Galactic supernova remnant 3C 58. Data in the {gamma}-ray band were acquired by the Large Area Telescope aboard the Fermi Gamma-ray Space Telescope (formerly GLAST), while the radio rotational ephemeris used to fold {gamma}-rays was obtained using both the Green Bank Telescope and the Lovell telescope at Jodrell Bank. The light curve consists of two peaks separated by 0.49 {+-} 0.01 {+-} 0.01 cycles which are aligned with the X-ray peaks. The first {gamma}-ray peak trails themore » radio pulse by 0.08 {+-} 0.01 {+-} 0.01, while its amplitude decreases with increasing energy as for the other {gamma}-ray pulsars. Spectral analysis of the pulsed {gamma}-ray emission suggests a simple power law of index -2.1 {+-} 0.1 {+-} 0.2 with an exponential cutoff at 3.0{sub -0.7}{sup +1.1} {+-} 0.4 GeV. The first uncertainty is statistical and the second is systematic. The integral {gamma}-ray photon flux above 0.1 GeV is (13.7 {+-} 1.4 {+-} 3.0) x 10{sup -8} cm{sup -2} s{sup -1}, which implies for a distance of 3.2 kpc and assuming a broad fan-like beam a luminosity of 8.3 x 10{sup 34} erg s{sup -1} and an efficiency {eta} of 0.3%. Finally, we report a 95% upper limit on the flux of 1.7 x 10{sup -8} cm{sup -2} s{sup -1} for off-pulse emission from the object.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A. A.; Ackermann, M.; Ajello, M.
2009-07-10
We report the discovery of {gamma}-ray pulsations ({>=}0.1 GeV) from the young radio and X-ray pulsar PSR J0205 + 6449 located in the Galactic supernova remnant 3C 58. Data in the {gamma}-ray band were acquired by the Large Area Telescope aboard the Fermi Gamma-ray Space Telescope (formerly GLAST), while the radio rotational ephemeris used to fold {gamma}-rays was obtained using both the Green Bank Telescope and the Lovell telescope at Jodrell Bank. The light curve consists of two peaks separated by 0.49 {+-} 0.01 {+-} 0.01 cycles which are aligned with the X-ray peaks. The first {gamma}-ray peak trails themore » radio pulse by 0.08 {+-} 0.01 {+-} 0.01, while its amplitude decreases with increasing energy as for the other {gamma}-ray pulsars. Spectral analysis of the pulsed {gamma}-ray emission suggests a simple power law of index -2.1 {+-} 0.1 {+-} 0.2 with an exponential cutoff at 3.0{sup +1.1} {sub -0.7} {+-} 0.4 GeV. The first uncertainty is statistical and the second is systematic. The integral {gamma}-ray photon flux above 0.1 GeV is (13.7 {+-} 1.4 {+-} 3.0) x 10{sup -8} cm{sup -2} s{sup -1}, which implies for a distance of 3.2 kpc and assuming a broad fan-like beam a luminosity of 8.3 x 10{sup 34} erg s{sup -1} and an efficiency {eta} of 0.3%. Finally, we report a 95% upper limit on the flux of 1.7 x 10{sup -8} cm{sup -2} s{sup -1} for off-pulse emission from the object.« less
NASA Technical Reports Server (NTRS)
Dacostafereiraneri, A.; Bui-Van, A.; Lavigne, J. M.; Sabaud, C.; Vedrenne, G.; Agrinier, B.; Gouiffes, C.
1985-01-01
A time of flight measuring device is the basic triggering system of most of medium and high energy gamma-ray telescopes. A simple gamma-ray telescope has been built in order to check in flight conditions the functioning of an advanced time of flight system. The technical ratings of the system are described. This telescope has been flown twice with stratospheric balloons, its axis being oriented at various Zenital directions. Flight results are presented for diffuse gamma-rays, atmospheric secondaries, and various causes of noise in the 5 MeV-50 MeV energy range.
Multiwavelength Challenges in the Fermi Era
NASA Technical Reports Server (NTRS)
Thompson, D. J.
2010-01-01
The gamma-ray surveys of the sky by AGILE and the Fermi Gamma-ray Space Telescope offer both opportunities and challenges for multiwavelength and multi-messenger studies. Gamma-ray bursts, pulsars, binary sources, flaring Active Galactic Nuclei, and Galactic transient sources are all phenomena that can best be studied with a wide variety of instruments simultaneously or contemporaneously. From the gamma-ray side, a principal challenge is the latency from the time of an astrophysical event to the recognition of this event in the data. Obtaining quick and complete multiwavelength coverage of gamma-ray sources of interest can be difficult both in terms of logistics and in terms of generating scientific interest.
Duval, J.S.
1987-01-01
A detailed aerial gamma-ray spectrometric survey of the Jabal Ashirah area in the southeastern Arabian Shield has been analyzed using computer-classification algorithms. The analysis resulted in maps that show radiometric map units and gamma-ray anomalies indicating the presence of possible concentrations of potassium and uranium. The radiometric-unit map was interpreted to 'produce a simplified radiolithic map that was correlated with the mapped geology. The gamma-ray data show uranium anomalies that coincide with a tin-bearing granite, but known gold and nickel mineralization do not have any associated gamma-ray signatures.
A 3D simulation look-up library for real-time airborne gamma-ray spectroscopy
NASA Astrophysics Data System (ADS)
Kulisek, Jonathan A.; Wittman, Richard S.; Miller, Erin A.; Kernan, Warnick J.; McCall, Jonathon D.; McConn, Ron J.; Schweppe, John E.; Seifert, Carolyn E.; Stave, Sean C.; Stewart, Trevor N.
2018-01-01
A three-dimensional look-up library consisting of simulated gamma-ray spectra was developed to leverage, in real-time, the abundance of data provided by a helicopter-mounted gamma-ray detection system consisting of 92 CsI-based radiation sensors and exhibiting a highly angular-dependent response. We have demonstrated how this library can be used to help effectively estimate the terrestrial gamma-ray background, develop simulated flight scenarios, and to localize radiological sources. Source localization accuracy was significantly improved, particularly for weak sources, by estimating the entire gamma-ray spectra while accounting for scattering in the air, and especially off the ground.
New Fermi-LAT event reconstruction reveals more high-energy gamma rays from gamma-ray bursts
Atwood, W. B.; Baldini, L.; Bregeon, J.; ...
2013-08-19
Here, based on the experience gained during the four and a half years of the mission, the Fermi-LAT Collaboration has undertaken a comprehensive revision of the event-level analysis going under the name of Pass 8. Although it is not yet finalized, we can test the improvements in the new event reconstruction with the special case of the prompt phase of bright gamma-ray bursts (GRBs), where the signal-to-noise ratio is large enough that loose selection cuts are sufficient to identify gamma rays associated with the source. Using the new event reconstruction, we have re-analyzed 10 GRBs previously detected by the Largemore » Area Telescope (LAT) for which an X-ray/optical follow-up was possible and found four new gamma rays with energies greater than 10 GeV in addition to the seven previously known. Among these four is a 27.4 GeV gamma ray from GRB 080916C, which has a redshift of 4.35, thus making it the gamma ray with the highest intrinsic energy (~147 GeV) detected from a GRB. We present here the salient aspects of the new event reconstruction and discuss the scientific implications of these new high-energy gamma rays, such as constraining extragalactic background light models, Lorentz invariance violation tests, the prompt emission mechanism, and the bulk Lorentz factor of the emitting region.« less
Precision imaging of 4.4 MeV gamma rays using a 3-D position sensitive Compton camera.
Koide, Ayako; Kataoka, Jun; Masuda, Takamitsu; Mochizuki, Saku; Taya, Takanori; Sueoka, Koki; Tagawa, Leo; Fujieda, Kazuya; Maruhashi, Takuya; Kurihara, Takuya; Inaniwa, Taku
2018-05-25
Imaging of nuclear gamma-ray lines in the 1-10 MeV range is far from being established in both medical and physical applications. In proton therapy, 4.4 MeV gamma rays are emitted from the excited nucleus of either 12 C* or 11 B* and are considered good indicators of dose delivery and/or range verification. Further, in gamma-ray astronomy, 4.4 MeV gamma rays are produced by cosmic ray interactions in the interstellar medium, and can thus be used to probe nucleothynthesis in the universe. In this paper, we present a high-precision image of 4.4 MeV gamma rays taken by newly developed 3-D position sensitive Compton camera (3D-PSCC). To mimic the situation in proton therapy, we first irradiated water, PMMA and Ca(OH)2 with a 70 MeV proton beam, then we identified various nuclear lines with the HPGe detector. The 4.4 MeV gamma rays constitute a broad peak, including single and double escape peaks. Thus, by setting an energy window of 3D-PSCC from 3 to 5 MeV, we show that a gamma ray image sharply concentrates near the Bragg peak, as expected from the minimum energy threshold and sharp peak profile in the cross section of 12 C(p,p) 12 C*.
A link between prompt optical and prompt gamma-ray emission in gamma-ray bursts.
Vestrand, W T; Wozniak, P R; Wren, J A; Fenimore, E E; Sakamoto, T; White, R R; Casperson, D; Davis, H; Evans, S; Galassi, M; McGowan, K E; Schier, J A; Asa, J W; Barthelmy, S D; Cummings, J R; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; McLean, K; Palmer, D; Parsons, A; Tueller, J
2005-05-12
The prompt optical emission that arrives with the gamma-rays from a cosmic gamma-ray burst (GRB) is a signature of the engine powering the burst, the properties of the ultra-relativistic ejecta of the explosion, and the ejecta's interactions with the surroundings. Until now, only GRB 990123 had been detected at optical wavelengths during the burst phase. Its prompt optical emission was variable and uncorrelated with the prompt gamma-ray emission, suggesting that the optical emission was generated by a reverse shock arising from the ejecta's collision with surrounding material. Here we report prompt optical emission from GRB 041219a. It is variable and correlated with the prompt gamma-rays, indicating a common origin for the optical light and the gamma-rays. Within the context of the standard fireball model of GRBs, we attribute this new optical component to internal shocks driven into the burst ejecta by variations of the inner engine. The correlated optical emission is a direct probe of the jet isolated from the medium. The timing of the uncorrelated optical emission is strongly dependent on the nature of the medium.
The second FERMI large area telescope catalog of gamma-ray pulsars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A. A.; Ajello, M.; Allafort, A.
2013-09-19
This catalog summarizes 117 high-confidence ≥0.1 GeV gamma-ray pulsar detections using three years of data acquired by the Large Area Telescope (LAT) on the Fermi satellite. Half are neutron stars discovered using LAT data through periodicity searches in gamma-ray and radio data around LAT unassociated source positions. The 117 pulsars are evenly divided into three groups: millisecond pulsars, young radio-loud pulsars, and young radio-quiet pulsars. We characterize the pulse profiles and energy spectra and derive luminosities when distance information exists. Spectral analysis of the off-peak phase intervals indicates probable pulsar wind nebula emission for four pulsars, and off-peak magnetospheric emissionmore » for several young and millisecond pulsars. We compare the gamma-ray properties with those in the radio, optical, and X-ray bands. We provide flux limits for pulsars with no observed gamma-ray emission, highlighting a small number of gamma-faint, radio-loud pulsars. The large, varied gamma-ray pulsar sample constrains emission models. Fermi's selection biases complement those of radio surveys, enhancing comparisons with predicted population distributions.« less
The second fermi large area telescope catalog of gamma-ray pulsars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A. A.; Ajello, M.; Allafort, A.
2013-09-19
This catalog summarizes 117 high-confidence ≥0.1 GeV gamma-ray pulsar detections using three years of data acquired by the Large Area Telescope (LAT) on the Fermi satellite. Half are neutron stars discovered using LAT data through periodicity searches in gamma-ray and radio data around LAT unassociated source positions. The 117 pulsars are evenly divided into three groups: millisecond pulsars, young radio-loud pulsars, and young radio-quiet pulsars. We characterize the pulse profiles and energy spectra and derive luminosities when distance information exists. Spectral analysis of the off-peak phase intervals indicates probable pulsar wind nebula emission for four pulsars, and off-peak magnetospheric emissionmore » for several young and millisecond pulsars. We compare the gamma-ray properties with those in the radio, optical, and X-ray bands. We provide flux limits for pulsars with no observed gamma-ray emission, highlighting a small number of gamma-faint, radio-loud pulsars. The large, varied gamma-ray pulsar sample constrains emission models. Fermi's selection biases complement those of radio surveys, enhancing comparisons with predicted population distributions.« less
NASA Astrophysics Data System (ADS)
Limkitjaroenporn, P.; Kaewkhao, J.
2014-10-01
In this work, the gamma-rays interaction properties of zircons from Cambodia and South Africa have been studied. The densities of Cambodian and South African's zircons are 4.6716±0.0040 g/cm3 and 4.5505±0.0018 g/cm3, respectively. The mass attenuation coefficient and the effective atomic number of gemstones were measured with the gamma-ray in energies range 223-662 keV using the Compton scattering technique. The mass attenuation coefficients of both zircons decreased with the increasing of gamma-rays energies. The different mass attenuation coefficients between the two zircons observed at gamma-ray energies below 400 keV are attributed to the differences in the photoelectric interaction. The effective atomic number of zircons was decreased with the increasing of gamma-ray energies and showed totally different values between the Cambodia and South Africa sources. The origins of the two zircons could be successfully identified by the method based on gamma-rays interaction with matter with advantage of being a non-destructive testing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moskalenko, Igor V.; Porter, Troy A.; Digel, Seth W.
2007-12-17
We calculate the {gamma}-ray albedo flux from cosmic-ray (CR) interactions with the solid rock and ice in Main Belt asteroids and Kuiper Belt objects (KBOs) using the Moon as a template. We show that the {gamma}-ray albedo for the Main Belt and Kuiper Belt strongly depends on the small-body mass spectrum of each system and may be detectable by the forthcoming Gamma Ray Large Area Space Telescope (GLAST). The orbits of the Main Belt asteroids and KBOs are distributed near the ecliptic, which passes through the Galactic center and high Galactic latitudes. If detected, the {gamma}-ray emission by the Mainmore » Belt and Kuiper Belt has to be taken into account when analyzing weak {gamma}-ray sources close to the ecliptic, especially near the Galactic center and for signals at high Galactic latitudes, such as the extragalactic {gamma}-ray emission. Additionally, it can be used to probe the spectrum of CR nuclei at close-to-interstellar conditions, and the mass spectrum of small bodies in the Main Belt and Kuiper Belt. The asteroid albedo spectrum also exhibits a 511 keV line due to secondary positrons annihilating in the rock. This may be an important and previously unrecognized celestial foreground for the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL) observations of the Galactic 511 keV line emission including the direction of the Galactic center.« less
High-energy Emission from Nonrelativistic Radiative Shocks: Application to Gamma-Ray Novae
NASA Astrophysics Data System (ADS)
Vurm, Indrek; Metzger, Brian D.
2018-01-01
The observation of GeV gamma-rays from novae by Fermi/LAT demonstrates that the nonrelativistic radiative shocks in these systems can accelerate particles to energies of at least ∼10 GeV. The low-energy extension of the same nonthermal particle distribution inevitably gives rise to emission in the hard X-ray band. Above ≳ 10 {keV}, this radiation can escape the system without significant absorption/attenuation, and can potentially be detected by NuSTAR. We present theoretical models for hard X-ray and gamma-ray emission from radiative shocks in both leptonic and hadronic scenarios, accounting for the rapid evolution of the downstream properties due to the fast cooling of thermal plasma. We find that due to strong Coulomb losses, only a fraction of {10}-4{--}{10}-3 of the gamma-ray luminosity is radiated in the NuSTAR band; nevertheless, this emission could be detectable simultaneously with the LAT emission in bright gamma-ray novae with a ∼50 ks exposure. The spectral slope in hard X-rays is α ≈ 0 for typical nova parameters, thus serving as a testable prediction of the model. Our work demonstrates how combined hard X-ray and gamma-ray observations can be used to constrain properties of the nova outflow (velocity, density, and mass outflow rate) and particle acceleration at the shock. A very low X-ray to gamma-ray luminosity ratio ({L}{{X}}/{L}γ ≲ 5× {10}-4) would disfavor leptonic models for the gamma-ray emission. Our model can also be applied to other astrophysical environments with radiative shocks, including SNe IIn and colliding winds in massive star binaries.
Novel methods for estimating 3D distributions of radioactive isotopes in materials
NASA Astrophysics Data System (ADS)
Iwamoto, Y.; Kataoka, J.; Kishimoto, A.; Nishiyama, T.; Taya, T.; Okochi, H.; Ogata, H.; Yamamoto, S.
2016-09-01
In recent years, various gamma-ray visualization techniques, or gamma cameras, have been proposed. These techniques are extremely effective for identifying "hot spots" or regions where radioactive isotopes are accumulated. Examples of such would be nuclear-disaster-affected areas such as Fukushima or the vicinity of nuclear reactors. However, the images acquired with a gamma camera do not include distance information between radioactive isotopes and the camera, and hence are "degenerated" in the direction of the isotopes. Moreover, depth information in the images is lost when the isotopes are embedded in materials, such as water, sand, and concrete. Here, we propose two methods of obtaining depth information of radioactive isotopes embedded in materials by comparing (1) their spectra and (2) images of incident gamma rays scattered by the materials and direct gamma rays. In the first method, the spectra of radioactive isotopes and the ratios of scattered to direct gamma rays are obtained. We verify experimentally that the ratio increases with increasing depth, as predicted by simulations. Although the method using energy spectra has been studied for a long time, an advantage of our method is the use of low-energy (50-150 keV) photons as scattered gamma rays. In the second method, the spatial extent of images obtained for direct and scattered gamma rays is compared. By performing detailed Monte Carlo simulations using Geant4, we verify that the spatial extent of the position where gamma rays are scattered increases with increasing depth. To demonstrate this, we are developing various gamma cameras to compare low-energy (scattered) gamma-ray images with fully photo-absorbed gamma-ray images. We also demonstrate that the 3D reconstruction of isotopes/hotspots is possible with our proposed methods. These methods have potential applications in the medical fields, and in severe environments such as the nuclear-disaster-affected areas in Fukushima.
A Novel Study Connecting Ultra-High Energy Cosmic Rays, Neutrinos, and Gamma-Rays
NASA Astrophysics Data System (ADS)
Coenders, Stefan; Resconi, Elisa; Padovani, Paolo; Giommi, Paolo; Caccianiga, Lorenzo
We present a novel study connecting ultra-high energy cosmic rays, neutrinos, and gamma-rays with the objective to identify common counterparts of the three astrophysical messengers. In the test presented here, we first identify potential hadronic sources by filtering gamma-ray emitters that are in spatial coincidence with IceCube neutrinos. Subsequently, these objects are correlated against ultra-high energy cosmic rays detected by the Pierre Auger Observatory and the Telescope Array, scanning in gamma-ray flux and angular separation between sources and cosmic rays. A maximal excess of 80 cosmic rays (41.9 expected) is observed for the second catalog of hard Fermi-LAT objects of blazars of the high synchrotron peak type. This corresponds to a deviation from the null-hypothesis of 2.94σ . No excess is observed for objects not in spatial connection with neutrinos. The gamma-ray sources that make up the excess are blazars of the high synchrotron peak type.
Ultralow-dose, feedback imaging with laser-Compton X-ray and laser-Compton gamma ray sources
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barty, Christopher P. J.
Ultralow-dose, x-ray or gamma-ray imaging is based on fast, electronic control of the output of a laser-Compton x-ray or gamma-ray source (LCXS or LCGS). X-ray or gamma-ray shadowgraphs are constructed one (or a few) pixel(s) at a time by monitoring the LCXS or LCGS beam energy required at each pixel of the object to achieve a threshold level of detectability at the detector. An example provides that once the threshold for detection is reached, an electronic or optical signal is sent to the LCXS/LCGS that enables a fast optical switch that diverts, either in space or time the laser pulsesmore » used to create Compton photons. In this way, one prevents the object from being exposed to any further Compton x-rays or gamma-rays until either the laser-Compton beam or the object are moved so that a new pixel location may be illumination.« less
Coded-aperture imaging of the Galactic center region at gamma-ray energies
NASA Technical Reports Server (NTRS)
Cook, Walter R.; Grunsfeld, John M.; Heindl, William A.; Palmer, David M.; Prince, Thomas A.
1991-01-01
The first coded-aperture images of the Galactic center region at energies above 30 keV have revealed two strong gamma-ray sources. One source has been identified with the X-ray source IE 1740.7 - 2942, located 0.8 deg away from the nucleus. If this source is at the distance of the Galactic center, it is one of the most luminous objects in the galaxy at energies from 35 to 200 keV. The second source is consistent in location with the X-ray source GX 354 + 0 (MXB 1728-34). In addition, gamma-ray flux from the location of GX 1 + 4 was marginally detected at a level consistent with other post-1980 measurements. No significant hard X-ray or gamma-ray flux was detected from the direction of the Galactic nucleus or from the direction of the recently discovered gamma-ray source GRS 1758-258.
Hard X-ray and low-energy gamma-ray spectrometers
NASA Technical Reports Server (NTRS)
Gehrels, N.; Crannell, C. J.; Orwig, L. E.; Forrest, D. J.; Lin, R. P.; Starr, R.
1988-01-01
Basic principles of operation and characteristics of scintillation and semi-conductor detectors used for solar hard X-ray and gamma-ray spectrometers are presented. Scintillation materials such as NaI offer high stopping power for incident gamma rays, modest energy resolution, and relatively simple operation. They are, to date, the most often used detector in solar gamma-ray spectroscopy. The scintillator BGO has higher stopping power than NaI, but poorer energy resolution. The primary advantage of semi-conductor materials such as Ge is their high-energy resolution. Monte-Carlo simulations of the response of NaI and Ge detectors to model solar flare inputs show the benefit of high resoluton for studying spectral lines. No semi-conductor material besides Ge is currently available with adequate combined size and purity to make general-use hard X-ray and gamma-ray detectors for solar studies.
NASA Technical Reports Server (NTRS)
Stecker, F. W. (Editor); Trombka, J. I. (Editor)
1973-01-01
Conference papers on gamma ray astrophysics are summarized. Data cover the energy region from about 0.3 MeV to a few hundred GeV and theoretical models of production mechanisms that give rise to both galactic and extragalactic gamma rays.
NASA Technical Reports Server (NTRS)
Lingenfelter, R. E.; Ramaty, R.
1986-01-01
Recent observations of gamma-ray line emission from solar flares, gamma-ray bursts, the galactic center, the interstellar medium and the jets of SS433 are reviewed. The implications of these observations on high energy processes in these sources are discussed.
Investigation of gamma rays from the galactic center
NASA Technical Reports Server (NTRS)
Helmken, H. F.
1973-01-01
Data from Argentine balloon flights made to investigate gamma ray emission from the galactic center are summarized. Data are also summarized from a Palestine, Texas balloon flight to measure gamma rays from NP 0532 and Crab Nebulae.
An Ordinary Gamma-Ray Burst with Extraordinary Consequences
2017-10-18
On Aug. 17, the Gamma-ray Burst Monitor on NASA's Fermi Gamma-ray Space Telescope caught a short burst of gamma rays from the spectacular smashup of two neutron stars, setting off a chain of events that marks the first-ever detection of a cosmic event in gravitational waves and different kinds of light. NASA scientists Colleen Wilson-Hodge and Tyson Littenberg explain what happened and what it means for science and discovery.
New Mexico Play Fairway Analysis: Gamma Ray Logs and Heat Generation Calculations for SW New Mexico
Shari Kelley
2015-10-23
For the New Mexico Play fairway Analysis project, gamma ray geophysical well logs from oil wells penetrating the Proterozoic basement in southwestern New Mexico were digitized. Only the portion of the log in the basement was digitized. The gamma ray logs are converted to heat production using the equation (Bucker and Rybach, 1996) : A[µW/m3] = 0.0158 (Gamma Ray [API] – 0.8).
NASA Astrophysics Data System (ADS)
Gvaramadze, V. V.
1995-09-01
We propose a model of gamma-ray bursts (GRBs) based on close Galactic neutron stars with accretion disks. We outline a simple mechanism of unsteady plasma ejections during episodic accretion events. The relative kinetic energy of ejected blobs can be converted into gamma-rays by internal shocks. The beaming of gamma-ray emission can be responsible for the observed isotropic angular distribution of GRBs.
Finding Sub-threshold Short Gamma-ray Bursts in Fermi GBM Data
NASA Astrophysics Data System (ADS)
Burns, Eric; Fermi Gamma-ray Burst Monitor Team
2018-01-01
The all-sky monitoring capability of Fermi GBM makes it ideal for finding transients, and the most prolific detector of short gamma-ray bursts with about 40 on-board triggers per year. Because the observed brightness of short gamma-ray bursts has no correlation with redshift, weak short gamma-ray bursts are important during the gravitational wave era. With this in mind, we discuss two searches of GBM data to find short gamma-ray which were below the on-board trigger threshold. The untargeted search looks for significant background-subtracted signals in two or more detectors at various timescales in the continuous data, detecting ~80 additional short GRB candidates per year. The targeted search is the most sensitive search for weak gamma-ray signals in GBM data and is run over limited time intervals around sources of interest like gravitational waves.
Chlorine signal attenuation in concrete.
Naqvi, A A; Maslehuddin, M; Ur-Rehman, Khateeb; Al-Amoudi, O S B
2015-11-01
The intensity of prompt gamma-ray was measured at various depths from chlorine-contaminated silica fume (SF) concrete slab concrete specimens using portable neutron generator-based prompt gamma-ray setup. The intensity of 6.11MeV chloride gamma-rays was measured from the chloride contaminated slab at distance of 15.25, 20.25, 25.25, 30.25 and 35.25cm from neutron target in a SF cement concrete slab specimens. Due to attenuation of thermal neutron flux and emitted gamma-ray intensity in SF cement concrete at various depths, the measured intensity of chlorine gamma-rays decreases non-linearly with increasing depth in concrete. A good agreement was noted between the experimental results and the results of Monte Carlo simulation. This study has provided useful experimental data for evaluating the chloride contamination in the SF concrete utilizing gamma-ray attenuation method. Copyright © 2015 Elsevier Ltd. All rights reserved.
Tanaka, Y T; Yoshikawa, I; Yoshioka, K; Terasawa, T; Saito, Y; Mukai, T
2007-03-01
A microchannel plate (MCP) assembly has been used as an ion detector in the low energy particle (LEP) instrument onboard the magnetospheric satellite GEOTAIL. Recently the MCP assembly has detected gamma rays emitted from an astronomical object and has been shown to provide unique information of gamma rays if they are intense enough. However, the detection efficiency for gamma rays was not measured before launch, and therefore we could not analyze the LEP data quantitatively. In this article, we report the gamma-ray detection efficiency of the MCP assembly. The measured efficiencies are 1.29%+/-0.71% and 0.21%+/-0.14% for normal incidence 60 and 662 keV gamma rays, respectively. The incident angle dependence is also presented. Our calibration is crucial to study high energy astrophysical phenomena by using the LEP.
Development of the instruments for the Gamma Ray Observatory
NASA Technical Reports Server (NTRS)
Madden, J. J.; Kniffen, D. A.
1986-01-01
The Gamma Ray Observatory (GRO) is to be launched in 1988 by the STS. The GRO will feature four very large instruments: the Oriented Scintillation Spectrometer Experiment (OSSE), the Imaging Compton Telescope (COMPTEL), the Energetic Gamma Ray Experiment Telescope (EGRET) and the Burst and Transient Source Experiment (BATSE). The instruments weigh from 900-1200 kg each, and required the development of specialized lifting and dolly devices to permit their assembly, manipulation and testing. The GRO is intended a{s a tool for studying discrete celestial objects such as black holes, neutron stars and other gamma-ray emitting objects, scanning for nucleosynthesis processes, mapping the Galaxy and other, high energy galaxies in terms of gamma rays, searching for cosmological effects and observing gamma ray bursts. The instruments will be sensitive from the upper end mof X-rya wavelengths to the highest energies possible. Details of the hardware and performance specifications of each of the instruments are discussed.
NASA Astrophysics Data System (ADS)
Su, Meng
2014-06-01
Data from the Fermi-LAT revealed two large gamma-ray bubbles, extending 50 degrees above and below the Galactic center, with a width of about 40 degrees in longitude. Such structure has been confirmed with multi-wavelength observations. With the most up to date Fermi-LAT data analysis, I will show that the Fermi bubbles have a spectral cutoff at both low energy < 1 GeV and high energy > 150 GeV. Detailed analysis of the spectral features will help us to distinguish the leptonic origin from hadronic origin of the gamma-ray emission from the bubbles. I will also describe what we expect to learn about the bubbles from future gamma-ray telescopes after Fermi, with an emphasis on Dark Matter Particle Explorer and Pair Production Gamma-ray Unit.
Search for medium-energy gamma-ray pulsars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sweeney, W.E. Jr.
1987-01-01
Results are presented from a search for pulsed gamma rays from four radio pulsars, chosen for their interest to gamma-ray astronomers in previous studies. The data set used for the search consists of gamma-ray events at energies of 1-30 MeV, detected during a 40-hour balloon flight of the UCR double Compton scatter telescope launched at the National Scientific Balloon Facility in Palestine, Texas, USA on September 30, 1978. No statistically significant signals were detected from any of the pulsars. Three sigma upper limits to pulsed 1-30 MeV gamma ray flux from PSR 0950+08, PSR 1822+09, PSR 1929+10, and PSR 1953+29more » are presented. Two complete exposures to PSR 0950+08 were obtained. The reported tentative detection of 1-20 MeV gamma rays from PSR 0950+08 is not confirmed.« less
A three-dimensional study of 30- to 300-MeV atmospheric gamma rays
NASA Technical Reports Server (NTRS)
Thompson, D. J.
1974-01-01
A three-dimensional study of atmospheric gamma rays with energy greater than 30 MeV has been carried out. A knowledge of these atmospheric secondaries has significant applications to the study of cosmic gamma rays. For detectors carried on balloons, atmospherically produced gamma rays are the major source of background. For satellite detectors, atmospheric secondaries provide a calibration source. Experimental results were obtained from four balloon flights from Palestine, Texas, with a 15 cm by 15 cm digitized wire grid spark chamber. The energy spectrum for downward-moving gamma rays steepens with increasing atmospheric depth. Near the top of the atmosphere, the spectrum steepens with increasing zenith angle. A new model of atmospheric secondary production has calculated the depth, the energy, and the zenith angle dependence of gamma rays above 30 MeV, using a comprehensive three-dimensional Monte Carlo model of the nucleon-meson-electromagnetic cascade.
Observations of the Large Magellanic Cloud with Fermi
Abdo, A. A.; Ackermann, M.; Ajello, M.; ...
2010-03-18
Context. The Large Magellanic Cloud (LMC) is to date the only normal external galaxy that has been detected in high-energy gamma rays. High-energy gamma rays trace particle acceleration processes and gamma-ray observations allow the nature and sites of acceleration to be studied. Aims. We characterise the distribution and sources of cosmic rays in the LMC from analysis of gamma-ray observations. Methods. We analyse 11 months of continuous sky-survey observations obtained with the Large Area Telescope aboard the Fermi Gamma-Ray Space Telescope and compare it to tracers of the interstellar medium and models of the gamma-ray sources in the LMC. Results.more » The LMC is detected at 33σ significance. The integrated >100 MeV photon flux of the LMC amounts to (2.6 ± 0.2) × 10 -7 ph cm -2 s -1 which corresponds to an energy flux of (1.6 ± 0.1) × 10 -10 erg cm -2 s -1, with additional systematic uncertainties of 16%. The analysis reveals the massive star forming region 30 Doradus as a bright source of gamma-ray emission in the LMC in addition to fainter emission regions found in the northern part of the galaxy. The gamma-ray emission from the LMC shows very little correlation with gas density and is rather correlated to tracers of massive star forming regions. The close confinement of gamma-ray emission to star forming regions suggests a relatively short GeV cosmic-ray proton diffusion length. In conclusion, the close correlation between cosmic-ray density and massive star tracers supports the idea that cosmic rays are accelerated in massive star forming regions as a result of the large amounts of kinetic energy that are input by the stellar winds and supernova explosions of massive stars into the interstellar medium.« less
Supernova remnants and pulsar wind nebulae with Imaging Atmospheric Cherenkov Telescopes (IACTs)
NASA Astrophysics Data System (ADS)
Eger, Peter
2015-08-01
The observation of very-high-energy (VHE, E > 100 GeV) gamma rays is an excellent tool to study the most energetic and violent environments in the Galaxy. This energy range is only accessible with ground-based instruments such as Imaging Atmospheric Cherenkov Telescopes (IACTs) that reconstruct the energy and direction of the primary gamma ray by observing the Cherenkov light from the induced extended air showers in Earths atmosphere. The main goals of Galactic VHE gamma-ray science are the identification of individual sources of cosmic rays (CRs), such as supernova remnants (SNRs), and the study of other extreme astrophysical objects at the highest energies, such as gamma-ray binaries and pulsar wind nebulae (PWNe). One of the main challenges is the discrimination between leptonic and hadronic gamma-ray production channels. To that end, the gamma-ray signal from each individual source needs to be brought into context with the multi-wavelength environment of the astrophysical object in question, particularly with observations tracing the density of the surrounding interstellar medium, or synchrotron radiation from relativistic electrons. In this review presented at the European Cosmic Ray Symposium 2014 (ECRS2014), the most recent developments in the field of Galactic VHE gamma-ray science are highlighted, with particular emphasis on SNRs and PWNe.
Detection of 16 Gamma-Ray Pulsars Through Blind Frequency Searches Using the Fermi LAT
Abdo, A. A.; Ackermann, M.; Ajello, M.; ...
2009-07-02
Pulsars are rapidly rotating, highly magnetized neutron stars emitting radiation across the electromagnetic spectrum. Although there are more than 1800 known radio pulsars, until recently only seven were observed to pulse in gamma rays, and these were all discovered at other wavelengths. The Fermi Large Area Telescope (LAT) makes it possible to pinpoint neutron stars through their gamma-ray pulsations. In this paper, we report the detection of 16 gamma-ray pulsars in blind frequency searches using the LAT. Most of these pulsars are coincident with previously unidentified gamma-ray sources, and many are associated with supernova remnants. Finally, direct detection of gamma-raymore » pulsars enables studies of emission mechanisms, population statistics, and the energetics of pulsar wind nebulae and supernova remnants.« less
MODELING THE GAMMA-RAY EMISSION IN THE GALACTIC CENTER WITH A FADING COSMIC-RAY ACCELERATOR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Ruo-Yu; Wang, Xiang-Yu; Prosekin, Anton
2016-12-20
Recent HESS observations of the ∼200 pc scale diffuse gamma-ray emission from the central molecular zone (CMZ) suggest the presence of a PeV cosmic-ray accelerator (PeVatron) located in the inner 10 pc region of the Galactic center. Interestingly, the gamma-ray spectrum of the point-like source (HESS J1745-290) in the Galactic center shows a cutoff at ∼10 TeV, implying a cutoff around 100 TeV in the cosmic-ray proton spectrum. Here we propose that the gamma-ray emission from the inner and the outer regions may be explained self-consistently by run-away protons from a single yet fading accelerator. In this model, gamma-rays frommore » the CMZ region are produced by protons injected in the past, while gamma-rays from the inner region are produced by protons injected more recently. We suggest that the blast wave formed in a tidal disruption event (TDE) caused by the supermassive black hole (Sgr A*) could serve as such a fading accelerator. With typical parameters of the TDE blast wave, gamma-ray spectra of both the CMZ region and HESS J1745-290 can be reproduced simultaneously. Meanwhile, we find that the cosmic-ray energy density profile in the CMZ region may also be reproduced in the fading accelerator model when appropriate combinations of the particle injection history and the diffusion coefficient of cosmic rays are adopted.« less
Galactic X-ray emission from pulsars
NASA Technical Reports Server (NTRS)
Harding, A. K.
1981-01-01
The contribution of pulsars to the gamma-ray flux from the galactic plane is examined using data from the most recent pulsar surveys. It is assumed that pulsar gamma-rays are produced by curvature radiation from relativistic particles above the polar cap and attenuated by pair production in the strong magnetic and electric fields. Assuming that all pulsars produce gamma-rays in this way, their luminosities can be predicted as a function of period and magnetic field strength. Using the distribution of pulsars in the galaxy as determined from data on 328 pulsars detected in three surveys, the local gamma-ray production spectrum, the longitude profile, and the latitude profile of pulsar gamma-ray flux are calculated. The largest sources of uncertainty in the size of the pulsar contribution are the value of the mean interstellar electron density, the turnover in the pulsar radio luminosity function, and the average pulsar magnetic field strength. A present estimate is that pulsars contribute from 15 to 20 % of the total flux of gamma-rays from the galactic plane.
FERMI LAT discovery of extended gamma-ray emissions in the vicinity of the HB 3 supernova remnant
Katagiri, H.; Yoshida, K.; Ballet, J.; ...
2016-02-11
We report the discovery of extended gamma-ray emission measured by the Large Area Tele- scope (LAT) onboard the Fermi Gamma-ray Space Telescope in the region of the supernova rem- nant (SNR) HB 3 (G132.7+1.3) and the W3 HII complex adjacent to the southeast of the remnant. W3 is spatially associated with bright 12CO (J=1-0) emission. The gamma-ray emission is spatially correlated with this gas and the SNR. We discuss the possibility that gamma rays originate in inter- actions between particles accelerated in the SNR and interstellar gas or radiation fields. The decay of neutral pions produced in nucleon-nucleon interactions betweenmore » accelerated hadrons and interstellar gas provides a reasonable explanation for the gamma-ray emission. The emission fromW3 is consistent with irradiation of the CO clouds by the cosmic rays accelerated in HB 3.« less
NASA Technical Reports Server (NTRS)
Wu, S. T.
2000-01-01
The project has progressed successfully during this period of performance. The highlights of the Gamma Ray Astronomy teams efforts are: (1) Support daily BATSE data operations, including receipt, archival and dissemination of data, quick-look science analysis, rapid gamma-ray burst and transient monitoring and response efforts, instrument state-of-health monitoring, and instrument commanding and configuration; (2) On-going scientific analysis, including production and maintenance of gamma-ray burst, pulsed source and occultation source catalogs, gamma-ray burst spectroscopy, studies of the properties of pulsars and black holes, and long-term monitoring of hard x-ray sources; (3) Maintenance and continuous improvement of BATSE instrument response and calibration data bases; (4) Investigation of the use of solid state detectors for eventual application and instrument to perform all sky monitoring of X-Ray and Gamma sources with high sensitivity; and (5) Support of BATSE outreach activities, including seminars, colloquia and World Wide Web pages. The highlights of this efforts can be summarized in the publications and presentation list.
Design and construction of the Mini-Calorimeter of the AGILE satellite
NASA Astrophysics Data System (ADS)
Labanti, C.; Marisaldi, M.; Fuschino, F.; Galli, M.; Argan, A.; Bulgarelli, A.; Di Cocco, G.; Gianotti, F.; Tavani, M.; Trifoglio, M.
2009-01-01
AGILE is a small space mission of the Italian Space Agency (ASI) devoted to gamma-ray and hard-X astrophysics, successfully launched on April 23, 2007. The AGILE Payload is composed of three instruments: a gamma-ray imager based on a tungsten-silicon tracker (ST), for observations in the gamma ray energy range 30 MeV-50 GeV, a Silicon based X-ray detector, SuperAGILE (SA), for imaging in the range 18-60 keV and a CsI(Tl) Mini-Calorimeter (MCAL) that detects gamma rays or charged particles energy loss in the range 300 keV-100 MeV. MCAL is composed of 30 CsI(Tl) scintillator bars with photodiode readout at both ends, arranged in two orthogonal layers. MCAL can work both as a slave of the ST and as an independent gamma-ray detector for transients and gamma-ray bursts detection. In this paper a detailed description of MCAL is presented together with its performance.
FERMI LAT DISCOVERY OF EXTENDED GAMMA-RAY EMISSIONS IN THE VICINITY OF THE HB 3 SUPERNOVA REMNANT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Katagiri, H.; Yoshida, K.; Ballet, J.
2016-02-20
We report the discovery of extended gamma-ray emission measured by the Large Area Telescope (LAT) onboard the Fermi Gamma-ray Space Telescope in the region of the supernova remnant (SNR) HB 3 (G132.7+1.3) and the W3 II complex adjacent to the southeast of the remnant. W3 is spatially associated with bright {sup 12}CO (J = 1–0) emission. The gamma-ray emission is spatially correlated with this gas and the SNR. We discuss the possibility that gamma rays originate in interactions between particles accelerated in the SNR and interstellar gas or radiation fields. The decay of neutral pions produced in nucleon–nucleon interactions between accelerated hadrons and interstellar gas provides amore » reasonable explanation for the gamma-ray emission. The emission from W3 is consistent with irradiation of the CO clouds by the cosmic rays accelerated in HB 3.« less
2004-09-19
KENNEDY SPACE CENTER, FLA. - A closeup of one of the solar cells that will be removed and replaced on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - A closeup of one of the solar cells that will be removed and replaced on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
Low-mass X-ray binaries and gamma-ray bursts
NASA Technical Reports Server (NTRS)
Lasota, J. P.; Frank, J.; King, A. R.
1992-01-01
More than twenty years after their discovery, the nature of gamma-ray burst sources (GRBs) remains mysterious. The results from BATSE experiment aboard the Compton Observatory show however that most of the sources of gamma-ray bursts cannot be distributed in the galactic disc. The possibility that a small fraction of sites of gamma-ray bursts is of galactic disc origin cannot however be excluded. We point out that large numbers of neutron-star binaries with orbital periods of 10 hr and M dwarf companions of mass 0.2-0.3 solar mass are a natural result of the evolution of low-mass X-ray binaries (LMXBs). The numbers and physical properties of these systems suggest that some gamma-ray burst sources may be identified with this endpoint of LMXB evolution. We suggest an observational test of this hypothesis.
NASA Astrophysics Data System (ADS)
Voisin, Guillaume; Mottez, Fabrice; Bonazzola, Silvano
2018-02-01
Electron-positron pair production by collision of photons is investigated in view of application to pulsar physics. We compute the absorption rate of individual gamma-ray photons by an arbitrary anisotropic distribution of softer photons, and the energy and angular spectrum of the outgoing leptons. We work analytically within the approximation that 1 ≫ mc2/E > ɛ/E, with E and ɛ the gamma-ray and soft-photon maximum energy and mc2 the electron mass energy. We give results at leading order in these small parameters. For practical purposes, we provide expressions in the form of Laurent series which give correct reaction rates in the isotropic case within an average error of ˜ 7 per cent. We apply this formalism to gamma-rays flying downward or upward from a hot neutron star thermally radiating at a uniform temperature of 106 K. Other temperatures can be easily deduced using the relevant scaling laws. We find differences in absorption between these two extreme directions of almost two orders of magnitude, much larger than our error estimate. The magnetosphere appears completely opaque to downward gamma-rays while there are up to ˜ 10 per cent chances of absorbing an upward gamma-ray. We provide energy and angular spectra for both upward and downward gamma-rays. Energy spectra show a typical double peak, with larger separation at larger gamma-ray energies. Angular spectra are very narrow, with an opening angle ranging from 10-3 to 10-7 radians with increasing gamma-ray energies.
Inter-pulse high-resolution gamma-ray spectra using a 14 MeV pulsed neutron generator
Evans, L.G.; Trombka, J.I.; Jensen, D.H.; Stephenson, W.A.; Hoover, R.A.; Mikesell, J.L.; Tanner, A.B.; Senftle, F.E.
1984-01-01
A neutron generator pulsed at 100 s-1 was suspended in an artificial borehole containing a 7.7 metric ton mixture of sand, aragonite, magnetite, sulfur, and salt. Two Ge(HP) gamma-ray detectors were used: one in a borehole sonde, and one at the outside wall of the sample tank opposite the neutron generator target. Gamma-ray spectra were collected by the outside detector during each of 10 discrete time windows during the 10 ms period following the onset of gamma-ray build-up after each neutron burst. The sample was measured first when dry and then when saturated with water. In the dry sample, gamma rays due to inelastic neutron scattering, neutron capture, and decay were counted during the first (150 ??s) time window. Subsequently only capture and decay gamma rays were observed. In the wet sample, only neutron capture and decay gamma rays were observed. Neutron capture gamma rays dominated the spectrum during the period from 150 to 400 ??s after the neutron burst in both samples, but decreased with time much more rapidly in the wet sample. A signal-to-noise-ratio (S/N) analysis indicates that optimum conditions for neutron capture analysis occurred in the 350-800 ??s window. A poor S/N in the first 100-150 ??s is due to a large background continuum during the first time interval. Time gating can be used to enhance gamma-ray spectra, depending on the nuclides in the target material and the reactions needed to produce them, and should improve the sensitivity of in situ well logging. ?? 1984.
Multiwavelength observations of unidentified high energy gamma ray sources
NASA Technical Reports Server (NTRS)
Halpern, Jules P.
1993-01-01
As was the case for COS B, the majority of high-energy (greater than 100 MeV) gamma-ray sources detected by the EGRET instrument on GRO are not immediately identifiable with cataloged objects at other wavelengths. These persistent gamma-ray sources are, next to the gamma-ray bursts, the least understood objects in the universe. Even a rudimentary understanding of their nature awaits identifications and follow-up work at other wavelengths to tell us what they are. The as yet unidentified sources are potentially the most interesting, since they may represent unrecognized new classes of astronomical objects, such as radio-quiet pulsars or new types of active galactic nuclei (AGN's). This two-year investigation is intended to support the analysis, correlation, and theoretical interpretation of data that we are obtaining at x ray, optical, and radio wavelengths in order to render the gamma-ray data interpretable. According to plan, in the first year concentration was on the identification and study of Geminga. The second year will be devoted to studies of similar unidentified gamma-ray sources which will become available in the first EGRET catalogs. The results obtained so far are presented in the two papers which are reproduced in the Appendix. In these papers, we discuss the pulse profiles of Geminga, the geometry and efficiency of the magnetospheric accelerator, the distance to Geminga, the implications for theories of polar cap heating, the effect of the magnetic field on the surface emission and environment of the neutron star, and possible interpretations of a radio-quiet Geminga. The implications of the other gamma-ray pulsars which were discovered to have high gamma-ray efficiency are also discussed, and the remaining unidentified COS B sources are attributed to a population of efficient gamma-ray sources, some of which may be radio quiet.
DISCOVERY OF HIGH-ENERGY AND VERY HIGH ENERGY {gamma}-RAY EMISSION FROM THE BLAZAR RBS 0413
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aliu, E.; Archambault, S.; Arlen, T.
2012-05-10
We report on the discovery of high-energy (HE; E > 0.1 GeV) and very high energy (VHE; E > 100 GeV) {gamma}-ray emission from the high-frequency-peaked BL Lac object RBS 0413. VERITAS, a ground-based {gamma}-ray observatory, detected VHE {gamma} rays from RBS 0413 with a statistical significance of 5.5 standard deviations ({sigma}) and a {gamma}-ray flux of (1.5 {+-} 0.6{sub stat} {+-} 0.7{sub syst}) Multiplication-Sign 10{sup -8} photons m{sup -2} s{sup -1} ({approx}1% of the Crab Nebula flux) above 250 GeV. The observed spectrum can be described by a power law with a photon index of 3.18 {+-} 0.68{sub stat}more » {+-} 0.30{sub syst}. Contemporaneous observations with the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope detected HE {gamma} rays from RBS 0413 with a statistical significance of more than 9{sigma}, a power-law photon index of 1.57 {+-} 0.12{sub stat}+{sup 0.11}{sub -0.12sys}, and a {gamma}-ray flux between 300 MeV and 300 GeV of (1.64 {+-} 0.43{sub stat}{sup +0.31}{sub -0.22sys}) Multiplication-Sign 10{sup -5} photons m{sup -2} s{sup -1}. We present the results from Fermi-LAT and VERITAS, including a spectral energy distribution modeling of the {gamma}-ray, quasi-simultaneous X-ray (Swift-XRT), ultraviolet (Swift-UVOT), and R-band optical (MDM) data. We find that, if conditions close to equipartition are required, both the combined synchrotron self-Compton/external-Compton and the lepto-hadronic models are preferred over a pure synchrotron self-Compton model.« less
Fermi Gamma-Ray Observatory-Science Highlights for the First 8 Months
NASA Technical Reports Server (NTRS)
Moiseev, Alexander
2009-01-01
This viewgraph presentation reviews the science highlights for the first 8 months of the Fermi Gamma-Ray Observatory. Results from pulsars, flaring AGN, gamma ray bursts, diffuse radiation, LMC and electron spectrum are also presented.
Exploring the High Energy Universe: GLAST Mission and Science
NASA Technical Reports Server (NTRS)
McEnery, Julie
2007-01-01
GLAST, the Gamma-Ray Large Area Space Telescope, is NASA's next-generation high-energy gamma-ray satellite scheduled for launch in Autumn 2007. GLAST will allow measurements of cosmic gamma-ray sources in the 10 MeV to 100 GeV energy band to be made with unprecedented sensitivity. Amongst its key scientific objectives are to understand particle acceleration in Active Galactic Nuclei, Pulsars and Supernovae Remnants, to provide high resolution measurements of unidentified gamma-ray sources, to study transient high energy emission from objects such as gamma-ray bursts, and to probe Dark Matter and the early Universe. Dr. McEnery will present an overview of the GLAST mission and its scientific goals.
Study on Effects of Gamma-Ray Irradiation on TlBr Semiconductor Detectors
NASA Astrophysics Data System (ADS)
Matsumura, Motohiro; Watanabe, Kenichi; Yamazaki, Atsushi; Uritani, Akira; Kimura, Norihisa; Nagano, Nobumichi; Hitomi, Keitaro
Radiation hardness of thallium bromide (TlBr) semiconductor detectors to 60Co gamma-ray irradiation was evaluated. The energy spectra and μτ products of electrons were measured to evaluate the irradiation effects. No significant degradation of spectroscopic performance of the TlBr detector for 137Cs gamma-rays was observed up to 45 kGy irradiation. Although the μτ products of electrons in the TlBr detector slightly decreased, position of the photo-peak was stable without significant degradation after the gamma-ray irradiation. We confirmed that the TlBr semiconductor detector has a high tolerance for gamma-ray irradiation at least up to 45 kGy.
Gamma-ray emission from Cataclysmic variables. 1: The Compton EGRET survey
NASA Technical Reports Server (NTRS)
Schlegel, Eric M.; Barrett, Paul E.; De Jager, O. C.; Chanmugam, G.; Hunter, S.; Mattox, J.
1995-01-01
We report the results of the first gamma-ray survey of cataclysmic variables (CVs) using observations obtained with the Energetic Gamma Ray Experiment Telescope (EGRET) instrument on the Compton Observatory. We briefly describe the theoretical models that are applicable to gamma-ray emission from CVs. These models are particularly relevant to magnetic CVs containing asynchronously rotating white dwarfs. No magnetic CV was detected with an upper limit on the flux at 1 GeV of approximately 2 x 10(exp -8)/sq cm/sec, which corresponds to an upper limit on the gamma-ray luminosity of approximately 10(exp 31) ergs/sec, assuming a typical CV distance of 100 pc.
Gamma Rays at Very High Energies
NASA Astrophysics Data System (ADS)
Aharonian, Felix
This chapter presents the elaborated lecture notes on Gamma Rays at Very High Energies given by Felix Aharonian at the 40th Saas-Fee Advanced Course on "Astrophysics at Very High Energies". Any coherent description and interpretation of phenomena related to gammarays requires deep knowledge of many disciplines of physics like nuclear and particle physics, quantum and classical electrodynamics, special and general relativity, plasma physics, magnetohydrodynamics, etc. After giving an introduction to gamma-ray astronomy the author discusses the astrophysical potential of ground-based detectors, radiation mechanisms, supernova remnants and origin of the galactic cosmic rays, TeV emission of young supernova remnants, gamma-emission from the Galactic center, pulsars, pulsar winds, pulsar wind nebulae, and gamma-ray loud binaries.
Very high energy gamma ray extension of GRO observations
NASA Technical Reports Server (NTRS)
Weekes, Trevor C.
1992-01-01
This has been an exiciting year for high energy gamma-ray astronomy, both from space and from ground-based observatories. It has been a particularly active period for the Whipple Observatory gamma-ray group. In phase 1 of the Compton Gamma Ray Observatory (GRO), there has not been too much opportunity for overlapping observations with the Energetic Gamma Ray Experiment Telescope (EGRET) and the other GRO telescopes; however, significant progress was made in the development of data analysis techniques and in improving the sensitivity of the technique which will have direct application in correlative observations in phase 2. Progress made during the period 1 Jul. 1991 - 31 Dec. 1991 is presented.
Method and system for detecting explosives
Reber, Edward L [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID; Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Derr, Kurt W [Idaho Falls, ID
2009-03-10
A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.
Explosives detection system and method
Reber, Edward L.; Jewell, James K.; Rohde, Kenneth W.; Seabury, Edward H.; Blackwood, Larry G.; Edwards, Andrew J.; Derr, Kurt W.
2007-12-11
A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.
Galactic gamma-ray sources, SNOBs, and giant H2 regions
NASA Technical Reports Server (NTRS)
Montmerle, T.
1985-01-01
Progress towards understanding the nature of the COS-B galactic gamma-ray sources was made by two recent developments. The developments are: (1) the existence of extensive wide-latitude CO surveys, from the Northern Hemisphere, and from the Southern Hemisphere which give more precise information on molecular cloud population of the Perseus, Sagittarius, and Carina spiral arms; (2) the study of the time variability of gamma-ray sources in gamma-rays but also at other wavelengths, leading to the discovery of four new variable sources in addition to the already known Crab and Vela pulsars. Three classes of gamma-ray sources are found; invariable sources, active sources, and passive sources.
Method and an apparatus for non-invasively determining the quantity of an element in a body organ
Vartsky, D.; Ellis, K.J.; Cohn, S.H.
1980-06-27
An apparatus and a method for determining in a body organ the amount of an element with the aid of a gaseous gamma ray source, where the element and the source are paired in predetermined pairs, and with the aid of at least one detector selected from the group consisting of Ge(Li) and NaI(Tl). Gamma rays are directed towards the organ, thereby resonantly scattering the gamma rays from nuclei of the element in the organ; the intensity of the gamma rays is detected by the detector; and the amount of the element in the organ is then substantially proportional to the detected intensity of the gamma rays.
NASA Technical Reports Server (NTRS)
Forrest, D. J.
1978-01-01
The SMM gamma ray experiment and the important scientific capabilities of the instrument are discussed. The flare size detectable as a function of spectrum integration time was studied. A preliminary estimate indicates that a solar gamma ray line at 4.4 MeV one-fifth the intensity of that believed to have been emitted on 4 August 1972 can be detected in approximately 1000 sec with a confidence level of 99%.
MCNP modelling of scintillation-detector gamma-ray spectra from natural radionuclides.
Hendriks, P H G M; Maucec, M; de Meijer, R J
2002-09-01
gamma-ray spectra of natural radionuclides are simulated for a BGO detector in a borehole geometry using the Monte Carlo code MCNP. All gamma-ray emissions of the decay of 40K and the series of 232Th and 238U are used to describe the source. A procedure is proposed which excludes the time-consuming electron tracking in less relevant areas of the geometry. The simulated gamma-ray spectra are benchmarked against laboratory data.
Nucleosynthesis, neutrino bursts and gamma-rays from coalescing neutron stars
NASA Technical Reports Server (NTRS)
Eichler, David; Livio, Mario; Piran, Tsvi; Schramm, David N.
1989-01-01
It is pointed out here that neutron-star collisions should synthesize neutron-rich heavy elements, thought to be formed by rapid neutron capture (the r-process). Furthermore, these collisions should produce neutrino bursts and resultant bursts of gamma rays; the latter should comprise a subclass of observable gamma-ray bursts. It is argued that observed r-process abundances and gamma-ray burst rates predict rates for these collisions that are both significant and consistent with other estimates.
Method of photon spectral analysis
Gehrke, Robert J.; Putnam, Marie H.; Killian, E. Wayne; Helmer, Richard G.; Kynaston, Ronnie L.; Goodwin, Scott G.; Johnson, Larry O.
1993-01-01
A spectroscopic method to rapidly measure the presence of plutonium in soils, filters, smears, and glass waste forms by measuring the uranium L-shell x-ray emissions associated with the decay of plutonium. In addition, the technique can simultaneously acquire spectra of samples and automatically analyze them for the amount of americium and .gamma.-ray emitting activation and fission products present. The samples are counted with a large area, thin-window, n-type germanium spectrometer which is equally efficient for the detection of low-energy x-rays (10-2000 keV), as well as high-energy .gamma. rays (>1 MeV). A 8192- or 16,384 channel analyzer is used to acquire the entire photon spectrum at one time. A dual-energy, time-tagged pulser, that is injected into the test input of the preamplifier to monitor the energy scale, and detector resolution. The L x-ray portion of each spectrum is analyzed by a linear-least-squares spectral fitting technique. The .gamma.-ray portion of each spectrum is analyzed by a standard Ge .gamma.-ray analysis program. This method can be applied to any analysis involving x- and .gamma.-ray analysis in one spectrum and is especially useful when interferences in the x-ray region can be identified from the .gamma.-ray analysis and accommodated during the x-ray analysis.
Method of photon spectral analysis
Gehrke, R.J.; Putnam, M.H.; Killian, E.W.; Helmer, R.G.; Kynaston, R.L.; Goodwin, S.G.; Johnson, L.O.
1993-04-27
A spectroscopic method to rapidly measure the presence of plutonium in soils, filters, smears, and glass waste forms by measuring the uranium L-shell x-ray emissions associated with the decay of plutonium. In addition, the technique can simultaneously acquire spectra of samples and automatically analyze them for the amount of americium and [gamma]-ray emitting activation and fission products present. The samples are counted with a large area, thin-window, n-type germanium spectrometer which is equally efficient for the detection of low-energy x-rays (10-2,000 keV), as well as high-energy [gamma] rays (>1 MeV). A 8,192- or 16,384 channel analyzer is used to acquire the entire photon spectrum at one time. A dual-energy, time-tagged pulser, that is injected into the test input of the preamplifier to monitor the energy scale, and detector resolution. The L x-ray portion of each spectrum is analyzed by a linear-least-squares spectral fitting technique. The [gamma]-ray portion of each spectrum is analyzed by a standard Ge [gamma]-ray analysis program. This method can be applied to any analysis involving x- and [gamma]-ray analysis in one spectrum and is especially useful when interferences in the x-ray region can be identified from the [gamma]-ray analysis and accommodated during the x-ray analysis.
Astrophysical gamma-ray production by inverse Compton interactions of relativistic electrons
NASA Technical Reports Server (NTRS)
Schlickeiser, R.
1979-01-01
The inverse Compton scattering of background photon gases by relativistic electrons is a good candidate for the production of high-energy gamma rays in the diffuse interstellar medium as well as in discrete sources. By discussing the special case of the scattering of the diffuse starlight in the interstellar medium by cosmic ray electrons, we demonstrate that previous derivations of the gamma ray source function for this process on the basis of the Thomson limit of the Klein-Nishina cross section lead to incorrect values for gamma-ray energies above 100 MeV. It is shown that the Thomson limit is not applicable for the calculation of gamma-ray source functions in astrophysical circumstances in which target photons with energies greater than 1 eV are scattered by relativistic electrons.
The Gamma-Ray Albedo of the Moon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moskalenko, I.V.; /Stanford U., HEPL /KIPAC, Menlo Park; Porter, T.A.
2008-03-25
We use the GEANT4 Monte Carlo framework to calculate the {gamma}-ray albedo of the Moon due to interactions of cosmic ray (CR) nuclei with moon rock. Our calculation of the albedo spectrum agrees with the EGRET data. We show that the spectrum of {gamma}-rays from the Moon is very steep with an effective cutoff around 3-4 GeV (600 MeV for the inner part of the Moon disk) and exhibits a narrow pion-decay line at 67.5 MeV, perhaps unique in astrophysics. Apart from other astrophysical sources, the albedo spectrum of the Moon is well understood, including its absolute normalization; this makesmore » it a useful 'standard candle' for {gamma}-ray telescopes. The steep albedo spectrum also provides a unique opportunity for energy calibration of {gamma}-ray telescopes, such as the forthcoming Gamma Ray Large Area Space Telescope (GLAST). Since the albedo flux depends on the incident CR spectrum which changes over the solar cycle, it is possible to monitor the CR spectrum using the albedo {gamma}-ray flux. Simultaneous measurements of CR proton and helium spectra by the Payload for Antimatter-Matter Exploration and Light-nuclei Astrophysics (PAMELA), and observations of the albedo {gamma}-rays by the GLAST Large Area Telescope (LAT), can be used to test the model predictions and will enable the LAT to monitor the CR spectrum near the Earth beyond the lifetime of the PAMELA.« less
The Gamma-ray Albedo of the Moon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moskalenko, Igor V.; /Stanford U., HEPL; Porter, Troy A.
2007-09-28
We use the GEANT4 Monte Carlo framework to calculate the {gamma}-ray albedo of the Moon due to interactions of cosmic ray (CR) nuclei with moon rock. Our calculation of the albedo spectrum agrees with the EGRET data. We show that the spectrum of {gamma}-rays from the Moon is very steep with an effective cutoff around 3-4 GeV (600 MeV for the inner part of the Moon disk) and exhibits a narrow pion-decay line at 67.5 MeV, perhaps unique in astrophysics. Apart from other astrophysical sources, the albedo spectrum of the Moon is well understood, including its absolute normalization; this makesmore » it a useful 'standard candle' for {gamma}-ray telescopes. The steep albedo spectrum also provides a unique opportunity for energy calibration of {gamma}-ray telescopes, such as the forthcoming Gamma Ray Large Area Space Telescope (GLAST). Since the albedo flux depends on the incident CR spectrum which changes over the solar cycle, it is possible to monitor the CR spectrum using the albedo {gamma}-ray flux. Simultaneous measurements of CR proton and helium spectra by the Payload for Antimatter-Matter Exploration and Light-nuclei Astrophysics (PAMELA), and observations of the albedo {gamma}-rays by the GLAST Large Area Telescope (LAT), can be used to test the model predictions and will enable the LAT to monitor the CR spectrum near the Earth beyond the lifetime of the PAMELA.« less
NASA Technical Reports Server (NTRS)
1991-01-01
This photograph shows the Compton Gamma-Ray Observatory being released from the Remote Manipulator System (RMS) arm aboard the Space Shuttle Atlantis during the STS-35 mission in April 1991. The GRO reentered the Earth's atmosphere and ended its successful mission in June 2000. For nearly 9 years, GRO's Burst and Transient Source Experiment (BATSE), designed and built by the Marshall Space Flight Center, kept an unblinking watch on the universe to alert scientist to the invisible, mysterious gamma-ray bursts that had puzzled them for decades. By studying gamma-rays from objects like black holes, pulsars, quasars, neutron stars, and other exotic objects, scientists could discover clues to the birth, evolution, and death of star, galaxies, and the universe. The gamma-ray instrument was one of four major science instruments aboard the Compton. It consisted of eight detectors, or modules, located at each corner of the rectangular satellite to simultaneously scan the entire universe for bursts of gamma-rays ranging in duration from fractions of a second to minutes. In January 1999, the instrument, via the Internet, cued a computer-controlled telescope at Las Alamos National Laboratory in Los Alamos, New Mexico, within 20 seconds of registering a burst. With this capability, the gamma-ray experiment came to serve as a gamma-ray burst alert for the Hubble Space Telescope, the Chandra X-Ray Observatory, and major gound-based observatories around the world. Thirty-seven universities, observatories, and NASA centers in 19 states, and 11 more institutions in Europe and Russia, participated in BATSE's science program.
Research in cosmic and gamma ray astrophysics
NASA Technical Reports Server (NTRS)
Stone, E. C.; Davis, L., Jr.; Mewaldt, R. A.; Prince, T. A.
1989-01-01
Research activities in cosmic rays, gamma rays, and astrophysical plasmas are covered. The activities are divided into sections and described, followed by a bibliography. The astrophysical aspects of cosmic rays, gamma rays, and of the radiation and electromagnetic field environment of the Earth and other planets are investigated. These investigations are performed by means of energetic particle and photon detector systems flown on spacecraft and balloons.
Discovery of gamma-ray pulsations from the transitional redback PSR J1227-4853
Johnson, Tyrel J.; Ray, Paul S.; Roy, Jayanta; ...
2015-06-10
Here, the 1.69 ms spin period of PSR J1227–4853 was recently discovered in radio observations of the low-mass X-ray binary XSS J12270–4859 following the announcement of a possible transition to a rotation-powered millisecond pulsar state, inferred from decreases in optical, X-ray, and gamma-ray flux from the source. We report the detection of significant (5σ) gamma-ray pulsations after the transition, at the known spin period, using ~1 year of data from the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. The gamma-ray light curve of PSR J1227–4853 can be fit by one broad peak, which occurs at nearlymore » the same phase as the main peak in the 1.4 GHz radio profile. The partial alignment of light-curve peaks in different wavebands suggests that at least some of the radio emission may originate at high altitude in the pulsar magnetosphere, in extended regions co-located with the gamma-ray emission site. We folded the LAT data at the orbital period, both pre- and post-transition, but find no evidence for significant modulation of the gamma-ray flux. Analysis of the gamma-ray flux over the mission suggests an approximate transition time of 2012 November 30. Continued study of the pulsed emission and monitoring of PSR J1227–4853, and other known redback systems, for subsequent flux changes will increase our knowledge of the pulsar emission mechanism and transitioning systems.« less
NASA Technical Reports Server (NTRS)
Kaaret, Philip
1995-01-01
This grant covers work on the Compton phase 3 investigation, 'Shock High Energy Emission from the Be- Star/Pulsar System PSR 1259-63' and cycle 4 investigations 'Diffuse Gamma-Ray Emission at High Latitudes' and 'Echoes in X-Ray Novae'. Work under the investigation 'Diffuse Gamma-Ray Emission at High Latitudes' has lead to the publication of a paper (attached), describing gamma-ray emissivity variations in the northern galactic hemisphere. Using archival EGRET data, we have found a large irregular region of enhanced gamma-ray emissivity at energies greater 100 MeV. This is the first observation of local structure in the gamma-ray emissivity. Work under the investigation 'Echoes in X-Ray Novae' is proceeding with analysis of data from OSSE from the transient source GRO J1655-40. The outburst of this source last fall triggered this Target of Opportunity investigation. Preliminary spectral analysis shows emission out to 600 keV and a pure power low spectrum with no evidence of an exponential cutoff. Work is complete on the analysis of BATSE data from the Be-Star/Pulsar Sustem PSR 1259-63.
Pulsed Gamma-Rays From PSR J2021 3651 with the Fermi Large Area Telescope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, Aous A.; /Naval Research Lab, Wash., D.C.; Ackermann, M.
2011-11-30
We report the detection of pulsed gamma-rays from the young, spin-powered radio pulsar PSR J2021+3651 using data acquired with the Large Area Telescope (LAT) on the Fermi Gamma-ray Space Telescope (formerly GLAST). The light curve consists of two narrow peaks of similar amplitude separated by 0.468 {+-} 0.002 in phase. The first peak lags the maximum of the 2 GHz radio pulse by 0.162 {+-} 0.004 {+-} 0.01 in phase. The integral gamma-ray photon flux above 100 MeV is (56 {+-} 3 {+-} 11) x 10{sup -8} cm{sup -2} s{sup -1}. The photon spectrum is well-described by an exponentially cut-offmore » power law of the form dF/dE = kE{sup -{Gamma}}e{sup (-E/E{sub c})} where the energy E is expressed in GeV. The photon index is {Gamma} = 1.5 {+-} 0.1 {+-} 0.1 and the exponential cut-off is E{sub c} = 2.4 {+-} 0.3 {+-} 0.5 GeV. The first uncertainty is statistical and the second is systematic. The integral photon flux of the bridge is approximately 10% of the pulsed emission, and the upper limit on off-pulse gamma-ray emission from a putative pulsar wind nebula is < 10% of the pulsed emission at the 95% confidence level. Radio polarization measurements yield a rotation measure of RM = 524 {+-} 4 rad m{sup -2} but a poorly constrained magnetic geometry. Re-analysis of Chandra data enhanced the significance of the weak X-ray pulsations, and the first peak is roughly phase-aligned with the first gamma-ray peak. We discuss the emission region and beaming geometry based on the shape and spectrum of the gamma-ray light curve combined with radio and X-ray measurements, and the implications for the pulsar distance. Gamma-ray emission from the polar cap region seems unlikely for this pulsar.« less
Mihailescu, Lucian; Vetter, Kai M
2013-08-27
Apparatus for detecting and locating a source of gamma rays of energies ranging from 10-20 keV to several MeV's includes plural gamma ray detectors arranged in a generally closed extended array so as to provide Compton scattering imaging and coded aperture imaging simultaneously. First detectors are arranged in a spaced manner about a surface defining the closed extended array which may be in the form a circle, a sphere, a square, a pentagon or higher order polygon. Some of the gamma rays are absorbed by the first detectors closest to the gamma source in Compton scattering, while the photons that go unabsorbed by passing through gaps disposed between adjacent first detectors are incident upon second detectors disposed on the side farthest from the gamma ray source, where the first spaced detectors form a coded aperture array for two or three dimensional gamma ray source detection.
Energy dependence of polarization across broad deexcitation gamma-ray line profiles
NASA Astrophysics Data System (ADS)
Werntz, Carl; Lang, F. L.
1998-04-01
The energy profiles of deexcitation gamma-ray lines from recoiling inelastically scattered nuclei exhibit detailed structure. MeV-wide gamma-ray lines from the direction of the Orion nebula have been detected (H. Bloemen, et al., Astr. and Astrophys. L5, 281 (1994).) by COMPTEL whose source is postulated to be cosmic ray carbon and oxygen nuclei shock accelerated near supernova remnants colliding with ambient hydrogen and helium. Even when the heavy ion velocity distributions are isotropic, structure characteristic of the multipolarity of the gamma transition remains (A. M. Bykov et al, Astr. and Astrophys. 607, L37 (1996); B. Kozlovsky et al, Astrophys. J. 484, (1997).). In experiments in which the energy dependent structure of the deexcitation gamma-ray profiles is not resolved, the gammas display a high degree of linear polarization that rapidly changes with gamma-beam angle. We calculate the polarization, both linear and circular, as a function of gamma-ray energy across the laboratory line profiles of C12*(4.44) and O16*(6.13) inelastically excited by protons and alphas. We then investigate the polarization in the surviving structures for isotropic energetic ions colliding with ^1H and ^4He.
NASA Astrophysics Data System (ADS)
Kuzmichev, L.; Astapov, I.; Bezyazeekov, P.; Boreyko, V.; Borodin, A.; Brückner, M.; Budnev, N.; Chiavassa, A.; Gress, O.; Gress, T.; Grishin, O.; Dyachok, A.; Epimakhov, S.; Fedorov, O.; Gafarov, A.; Grebenyuk, V.; Grinyuk, A.; Haungs, A.; Horns, D.; Huege, T.; Ivanova, A.; Jurov, D.; Kalmykov, N.; Kazarina, Y.; Kindin, V.; Kiryuhin, V.; Kokoulin, R.; Kompaniets, K.; Korosteleva, E.; Kostunin, D.; Kozhin, V.; Kravchenko, E.; Kunnas, M.; Lenok, V.; Lubsandorzhiev, B.; Lubsandorzhiev, N.; Mirgazov, R.; Mirzoyan, R.; Monkhoev, R.; Nachtigal, R.; Osipova, E.; Pakharukov, A.; Panasyuk, M.; Pankov, L.; Petrukhin, A.; Poleschuk, V.; Popesku, M.; Popova, E.; Porelli, A.; Postnikov, E.; Prosin, V.; Ptuskin, V.; Pushnin, A.; Rubtsov, G.; Ryabov, E.; Sagan, Y.; Samoliga, V.; Schröder, F. G.; Semeney, Yu.; Silaev, A.; Silaev, A.; Sidorenko, A.; Skurikhin, A.; Slunecka, V.; Sokolov, A.; Spiering, C.; Sveshnikova, L.; Sulakov, V.; Tabolenko, V.; Tarashansky, B.; Tkachenko, A.; Tkachev, L.; Tluczykont, M.; Wischnewski, R.; Zagorodnikov, A.; Zurbanov, V.; Yashin, I.
2017-06-01
We present the current status of high-energy cosmic-ray physics and gamma-ray astronomy at the Tunka Astrophysical Center (AC). This complex is located in the Tunka Valley, about 50 km from Lake Baikal. Present efforts are focused on the construction of the first stage of the gamma-ray observatory TAIGA - the TAIGA prototype. TAIGA (Tunka Advanced Instrument for cosmic ray physics and Gamma Astronomy) is designed for the study of gamma rays and charged cosmic rays in the energy range 1013 eV-1018 eV. The array includes a network of wide angle timing Cherenkov stations (TAIGA-HiSCORE), each with a FOV = 0.6 sr, plus up to 16 IACTs (FOV - 10∘× 10∘). This part covers an area of 5 km2. Additional muon detectors (TAIGA-Muon), with a total coverage of 2000 m2, are distributed over an area of 1 km2.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), a Spectrolab technician, Anna Herrera, points to the two new solar cells removed and replaced on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), a Spectrolab technician, Anna Herrera, places a new solar cell on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), a Spectrolab technician, Anna Herrera, places a new solar cell on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), Spectrolab technicians begin lifting the protective cover from the Swift spacecraft. Two of Swift’s solar cells on the solar array will be removed and replaced. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), a Spectrolab technician, Anna Herrera, points to an area on the Swift spacecraft’s solar array where cells will be removed and replaced. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
2004-09-19
KENNEDY SPACE CENTER, FLA. - In the clean room at NASA’s Hangar AE on Cape Canaveral Air Force Station (CCAFS), a Spectrolab technician, Anna Herrera, removes one of the solar cells that will be replaced on the Swift spacecraft’s solar array. Swift is a first-of-its-kind, multi-wavelength observatory dedicated to the study of gamma-ray burst (GRB) science. Its three instruments will work together to observe GRBs and afterglows in the gamma-ray, X-ray, ultraviolet and optical wavebands. The main mission objectives for Swift are to determine the origin of gamma-ray bursts, classify gamma-ray bursts and search for new types, determine how the blast wave evolves and interacts with the surroundings, use gamma-ray bursts to study the early universe and perform the first sensitive hard X-ray survey of the sky. Swift is scheduled to launch Oct. 26 from Launch Pad 17-A, CCAFS, on a Boeing Delta 7320 rocket.
NASA Technical Reports Server (NTRS)
Fichtel, Carl E.
1990-01-01
In the near future, high energy (E greater than 20 MeV) gamma ray astronomy offers the promise of a new means of examining the closest galaxies. Two and possibly three local galaxies, the Small and Large Magellanic Clouds and M31, should be visible to the high energy gamma ray telescope on the Gamma Ray Observatory, and the first should be seen by GAMMA-1. With the assumptions of adequate cosmic ray production and reasonable magnetic field strengths, both of which should likely be satisfied, specific predictions of the gamma ray emission can be made separating the concepts of the galactic and universal nature of cosmic rays. A study of the synchrotron radiation from the Large Magellanic Cloud (LMC) suggests that the cosmic ray density is similar to that in the local region of our galaxy, but not uniform. It is hoped the measurements will be able to verify this independent of assumptions about the magnetic fields in the LMC.
Gamma-ray Astrophysics: a New Look at the Universe
NASA Technical Reports Server (NTRS)
Trombka, J. I.; Fichtel, C. E.; Grindlay, J.; Hofstadter, R.
1978-01-01
Gamma-ray astronomy which includes the spectral region from above approximately 100 keV to greater than or equal to 1000 GeV permits investigation of the most energetic photons originating in our galaxy and beyond and provides the most direct means of studying the largest transfers of energy occurring in astrophysical processes. Of all the electromagnetic spectrum, high-energy gamma-ray astronomy measures most directly the presence and dynamic effects of the energetic charged cosmic ray particles, element synthesis, and particle acceleration. Further, gamma rays suffer negligible absorption or scatterings as they travel in straight paths; hence, they may survive billions of years and still reveal their source. The high energy processes in stellar objects (including our Sun), the dynamics of the cosmic-ray gas, the formation of clouds and nebulae, galactic evolution and even certain aspects of cosmology and the origin of the universe may be explored by gamma-ray observations.
The solar gamma ray and neutron capabilities of COMPTEL on the Gamma Ray Observatory
NASA Technical Reports Server (NTRS)
Ryan, James M.; Lockwood, John A.
1989-01-01
The imaging Compton telescope COMPTEL on the Gamma Ray Observatory (GRO) has unusual spectroscopic capabilities for measuring solar gamma-ray and neutron emission. The launch of the GRO is scheduled for June 1990 near the peak of the sunspot cycle. With a 30 to 40 percent probability for the Sun being in the COMPTEL field-of-view during the sunlit part of an orbit, a large number of flares will be observed above the 800 keV gamma-ray threshold of the telescope. The telescope energy range extends to 30 MeV with high time resolution burst spectra available from 0.1 to 10 MeV. Strong Compton tail suppression of instrumental gamma-ray interactions will facilitate improved spectral analysis of solar flare emissions. In addition, the high signal to noise ratio for neutron detection and measurement will provide new neutron spectroscopic capabilities. Specifically, a flare similar to that of 3 June 1982 will provide spectroscopic data on greater than 1500 individual neutrons, enough to construct an unambiguous spectrum in the energy range of 20 to 200 MeV. Details of the instrument and its response to solar gamma-rays and neutrons will be presented.
SEARCHING FOR OVERIONIZED PLASMA IN THE GAMMA-RAY-EMITTING SUPERNOVA REMNANT G349.7+0.2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ergin, T.; Sezer, A.; Saha, L.
2015-05-10
G349.7+0.2 is a supernova remnant (SNR) expanding in a dense medium of molecular clouds and interacting with clumps of molecular material emitting gamma-rays. We analyzed the gamma-ray data of the Large Area Telescope on board the Fermi Gamma-Ray Space Telescope and detected G349.7+0.2 in the energy range of 0.2–300 GeV with a significance of ∼13σ, showing no extended morphology. Modeling of the gamma-ray spectrum revealed that the GeV gamma-ray emission dominantly originates from the decay of neutral pions, where the protons follow a broken power-law distribution with a spectral break at ∼12 GeV. To search for features of radiative recombinationmore » continua in the eastern and western regions of the remnant, we analyzed the Suzaku data of G349.7+0.2 and found no evidence for overionized plasma. In this paper, we discuss possible scenarios to explain the hadronic gamma-ray emission in G349.7+0.2 and the mixed morphology nature of this SNR.« less
Associating Long-term Gamma-ray Variability with the Superorbital Period of LS I + 61 Deg. 303
NASA Technical Reports Server (NTRS)
Ackermann, M.; Ajello, M.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bellazzini, R.; Bonamente, E.; Brandt, T. J.; Bregeon, J.; Brigida, M.;
2013-01-01
Gamma-ray binaries are stellar systems for which the spectral energy distribution (discounting the thermal stellar emission) peaks at high energies. Detected from radio to TeV gamma rays, the gamma-ray binary LS I + 61?303 is highly variable across all frequencies. One aspect of this system's variability is the modulation of its emission with the timescale set by the approx. 26.4960 day orbital period. Here we show that, during the time of our observations, the gamma-ray emission of LS I + 61 deg. 303 also presents a sinusoidal variability consistent with the previously known superorbital period of 1667 days. This modulation is more prominently seen at orbital phases around apastron, whereas it does not introduce a visible change close to periastron. It is also found in the appearance and disappearance of variability at the orbital period in the power spectrum of the data. This behavior could be explained by a quasi-cyclical evolution of the equatorial outflow of the Be companion star, whose features influence the conditions for generating gamma rays. These findings open the possibility to use gamma-ray observations to study the outflows of massive stars in eccentric binary systems.
NASA Astrophysics Data System (ADS)
Atteia, J.-L.; Dezalay, J.-P.; Godet, O.; Klotz, A.; Turpin, D.; Bernardini, M. G.
2018-02-01
Context. Gravitational wave interferometers have proven the existence of a new class of binary black hole (BBH) weighing tens of solar masses, and have provided the first reliable measurement of the rate of coalescing black holes (BHs) in the local Universe. Furthermore, long gamma-ray bursts (GRBs) detected with gamma-ray satellites are believed to be associated with the birth of stellar-mass BHs, providing a measure of the rate of these events across the history of the Universe, thanks to the measure of their cosmological redshift. These two types of sources, which are subject to different detection biases and involve BHs born in different environments with potentially different characteristics, provide complementary information on the birth rate of stellar BHs. Aim. We compare the birth rates of BHs found in BBH mergers and in long GRBs. Methods: We construct a simple model that makes reasonable assumptions on the history of GRB formation, and takes into account some major uncertainties, like the beaming angle of GRBs or the delay between the formation of BBHs and their coalescence. We use this model to evaluate the ratio of the number of stellar mass BHs formed in BBH mergers to those formed in GRBs. Results: We find that in our reference model the birth rate of stellar BHs in BBH mergers represents a significant fraction of the rate of long GRBs and that comparable birth rates are favored by models with moderate beaming angles. These numbers, however, do not consider subluminous GRBs, which may represent another population of sources associated with the birth of stellar mass BHs. We briefly discuss this result in view of our understanding of the progenitors of GRBs and BBH mergers, and we emphasize that this ratio, which will be better constrained in the coming years, can be directly compared with the prediction of stellar evolution models if a single model is used to produce GRBs and BBH mergers with the same assumptions.
Discovery of Giant Gamma-ray Bubbles in the Milky Way
NASA Astrophysics Data System (ADS)
Su, Meng
Based on data from the Fermi Gamma-ray Space Telescope, we have discovered two gigantic gamma-ray emitting bubble structures in our Milky Way (known as the Fermi bubbles), extending ˜50 degrees above and below the Galactic center with a width of ˜40 degrees in longitude. The gamma-ray emission associated with these bubbles has a significantly harder spectrum (dN/dE ˜ E-2) than the inverse Compton emission from known cosmic ray electrons in the Galactic disk, or the gamma-rays produced by decay of pions from proton-ISM collisions. There is no significant difference in the spectrum or gamma-ray luminosity between the north and south bubbles. The bubbles are spatially correlated with the hard-spectrum microwave excess known as the WMAP haze; we also found features in the ROSAT soft X-ray maps at 1.5 -- 2 keV which line up with the edges of the bubbles. The Fermi bubbles are most likely created by some large episode of energy injection in the Galactic center, such as past accretion events onto the central massive black hole, or a nuclear starburst in the last ˜ 10 Myr. Study of the origin and evolution of the bubbles also has the potential to improve our understanding of recent energetic events in the inner Galaxy and the high-latitude cosmic ray population. Furthermore, we have recently identified a gamma-ray cocoon feature within the southern bubble, with a jet-like feature along the cocoon's axis of symmetry, and another directly opposite the Galactic center in the north. If confirmed, these jets are the first resolved gamma-ray jets ever seen.
Multi-Epoch Multiwavelength Spectra and Models for Blazar 3C 279
NASA Technical Reports Server (NTRS)
Hartman, R. C.; Boettcher, M.; Aldering, G.; Aller, H.; Aller, M.; Backman, D. E.; Balonek, T. J.; Bertsch, D. L.; Bloom, S. D.; Bock, H.;
2001-01-01
Of the blazars detected by EGRET in GeV gamma-rays, 3C 279 is not only the best-observed by EGRET, but also one of the best-monitored at lower frequencies. We have assembled eleven spectra, from GHz radio through GeV gamma-rays, from the time intervals of EGRET observations. Although some of the data have appeared in previous publications, most are new, including data taken during the high states in early 1999 and early 2000. All of the spectra show substantial gamma-ray contribution to the total luminosity of the object; in a high state, the gamma-ray luminosity dominates over that at all other frequencies by a factor of more than 10. There is no clear pattern of time correlation; different bands do not always rise and fall together, even in the optical, X-ray, and gamma-ray bands. The spectra are modeled using a leptonic jet, with combined synchrotron self-Compton + external Compton gamma-ray production. Spectral variability of 3C 279 is consistent with variations of the bulk Lorentz factor of the jet, accompanied by changes in the spectral shape of the electron distribution. Our modeling results are consistent with the UV spectrum of 3C 279 being dominated by accretion disk radiation during times of low gamma-ray intensity.
A Detailed Observational Analysis of V1324 Sco, the Most Gamma-Ray-luminous Classical Nova to Date
NASA Astrophysics Data System (ADS)
Finzell, Thomas; Chomiuk, Laura; Metzger, Brian D.; Walter, Frederick M.; Linford, Justin D.; Mukai, Koji; Nelson, Thomas; Weston, Jennifer H. S.; Zheng, Yong; Sokoloski, Jennifer L.; Mioduszewski, Amy; Rupen, Michael P.; Dong, Subo; Starrfield, Sumner; Cheung, C. C.; Woodward, Charles E.; Taylor, Gregory B.; Bohlsen, Terry; Buil, Christian; Prieto, Jose; Wagner, R. Mark; Bensby, Thomas; Bond, I. A.; Sumi, T.; Bennett, D. P.; Abe, F.; Koshimoto, N.; Suzuki, D.; Tristram, P. J.; Christie, Grant W.; Natusch, Tim; McCormick, Jennie; Yee, Jennifer; Gould, Andy
2018-01-01
It has recently been discovered that some, if not all, classical novae emit GeV gamma-rays during outburst, but the mechanisms involved in the production ofgamma-rays are still not well understood. We present here a comprehensive multiwavelength data set—from radio to X-rays—for the most gamma-ray-luminous classical nova to date, V1324 Sco. Using this data set, we show that V1324 Sco is a canonical dusty Fe II-type nova, with a maximum ejecta velocity of 2600 km s‑1 and an ejecta mass of a few × {10}-5 {M}ȯ . There is also evidence for complex shock interactions, including a double-peaked radio light curve which shows high brightness temperatures at early times. To explore why V1324 Sco was so gamma-ray luminous, we present a model of the nova ejecta featuring strong internal shocks and find that higher gamma-ray luminosities result from higher ejecta velocities and/or mass-loss rates. Comparison of V1324 Sco with other gamma-ray-detected novae does not show clear signatures of either, and we conclude that a larger sample of similarly well-observed novae is needed to understand the origin and variation of gamma-rays in novae.
Swift and GLAST Cooperative Efforts
NASA Technical Reports Server (NTRS)
Thompson, D. J.
2007-01-01
Because gamma-ray astrophysics depends in many ways on multiwavelength studies, the Gamma-ray Large Area Space Telescope (GLAST) instrument teams are eagerly anticipating coordinated observations with the Swift observatory. Swift and GLAST combined cover most of twelve orders of magnitude in the electromagnetic spectrum, offering numerous opportunities for cooperation. Three of the high-priority interests are: (1) gamma-ray burst studies; (2) broad-spectrum studies of blazars in both quiescent and flaring states; and (3) identification and detailed study of unidentified gamma-ray sources.
Fermi Gamma-Ray Space Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie E.; Michelson, Peter F.; Paclesas, William S.; Ritz, Steven
2012-01-01
The Fermi Gamma-ray Space Telescope, launched in June 2008, is an observatory designed to survey the high-energy gamma-ray sky. The primary instrument, the Large Area Telescope (LAT), provides observations from 20 MeV to greater than 300 GeV. A second instrument, the Gamma-ray Burst Monitor (GBM), provides observations of transients from less than 10 keV to 40 MeV. We describe the design and performance of the instruments and their subsystems, the spacecraft and the ground system.
All Sky Observations with BATSE and GBM
NASA Technical Reports Server (NTRS)
Wilson-Hodge, Colleen A.
2008-01-01
The Burst and Transient Source Experiment (BATSE) on board the Compton Gamma Ray Observatory (CGRO) monitored the entire sky from 1991-2000. I will review highlights of BATSE observations including gamma ray bursts, black hole candidates, accreting pulsars, and active galaxies. On 2008 June 11, the Fermi Gamma Ray Space Telescope was launched. The Gamma ray Burst Monitor (GBM) on board Fermi continues the all-sky monitoring legacy started with BATSE. I will review early results and planned observations with GBM.
NASA Technical Reports Server (NTRS)
Gao, Yi-Tian; Stecker, Floyd W.; Gleiser, Marcelo; Cline, David B.
1990-01-01
Intrinsic anisotropies in the extragalactic gamma-ray background (EGB), which should be detectable with the forthcoming Gamma Ray Observatory, can be used to examine some of the mechanisms proposed to explain its origin, one of which, the baryon-symmetric big bang (BSBB) model, is investigated here. In this simulation, large domains containing matter and antimatter galaxies produce gamma rays by annihilation at the domain boundaries. This mechanism can produce mountain-chain-shaped angular fluctuations in the EGB flux.
Proof of the Feasibility of Coherent and Incoherent Schemes for Pumping a Gamma-Ray Laser
1988-07-01
DIP!; ilLE-CWPj AD-A 799 638 The University of Texas at DallasCenter for Quantlin, Electronics The Gamma-Ray Laser Project Quarterly Report April...AND INCOHERENT SCHEMES FOR PUMPING A GAMMA-RAY LASER Principal Investigator: Carl B. Collins The University of Texas at Dallas Center for Quantum...FEASIBILITY OF Quarterly Technical Progress COHERENT AND INCOHERENT SCHEMES /I/RR - 61WARA FOR PUMPING A GAMMA-RAY LASER 6.PERFORMINO ORG. REPORT NUMBER
ESA's Integral solves thirty-year old gamma-ray mystery
NASA Astrophysics Data System (ADS)
Integral solves mystery hi-res Size hi-res: 60 kb Credits: Credit: ESA, F. Lebrun (CEA-Saclay). ESA's Integral solves thirty-year old gamma-ray mystery The central regions of our galaxy, the Milky Way, as seen by Integral in gamma rays. With its superior ability to see faint details, Integral correctly reveals the individual sources that comprised the foggy, gamma-ray background seen by previous observatories. The brightest 91 objects seen in this image were classified by Integral as individual sources, while the others appear too faint to be properly characterized at this stage. During the spring and autumn of 2003, Integral observed the central regions of our Galaxy, collecting some of the perpetual glow of diffuse low-energy gamma rays that bathe the entire Galaxy. These gamma rays were first discovered in the mid-1970s by high-flying balloon-borne experiments. Astronomers refer to them as the 'soft' Galactic gamma-ray background, with energies similar to those used in medical X-ray equipment. Initially, astronomers believed that the glow was caused by interactions involving the atoms of the gas that pervades the Galaxy. Whilst this theory could explain the diffuse nature of the emission, since the gas is ubiquitous, it failed to match the observed power of the gamma rays. The gamma rays produced by the proposed mechanisms would be much weaker than those observed. The mystery has remained unanswered for decades. Now Integral's superb gamma-ray telescope IBIS, built for ESA by an international consortium led by Principal Investigator Pietro Ubertini (IAS/CNR, Rome, Italy), has seen clearly that, instead of a fog produced by the interstellar medium, most of the gamma-rays are coming from individual celestial objects. In the view of previous, less sensitive instruments, these objects appeared to merge together. In a paper published today in "Nature", Francois Lebrun (CEA Saclay, Gif sur Yvette, France) and his collaborators report the discovery of 91 gamma-ray sources towards the direction of the Galactic centre. Lebrun's team includes Ubertini and seventeen other European scientists with long-standing experience in high-energy astrophysics. Much to the team's surprise, almost half of these sources do not fall in any class of known gamma-ray objects. They probably represent a new population of gamma-ray emitters. The first clues about a new class of gamma-ray objects came last October, when Integral discovered an intriguing gamma-ray source, known as IGRJ16318-4848. The data from Integral and ESA's other high-energy observatory XMM-Newton suggested that this object is a binary system, probably including a black hole or neutron star, embedded in a thick cocoon of cold gas and dust. When gas from the companion star is accelerated and swallowed by the black hole, energy is released at all wavelengths, mostly in the gamma rays. However, Lebrun is cautious to draw premature conclusions about the sources detected in the Galactic centre. Other interpretations are also possible that do not involve black holes. For instance, these objects could be the remains of exploded stars that are being energised by rapidly rotating celestial 'powerhouses', known as pulsars. Observations with another Integral instrument (SPI, the Spectrometer on Integral) could provide Lebrun and his team with more information on the nature of these sources. SPI measures the energy of incoming gamma rays with extraordinary accuracy and allows scientist to gain a better understanding of the physical mechanisms that generate them. However, regardless of the precise nature of these gamma-ray sources, Integral's observations have convincingly shown that the energy output from these new objects accounts for almost ninety per cent of the soft gamma-ray background coming from the centre of the Galaxy. This result raises the tantalising possibility that objects of this type hide everywhere in the Galaxy, not just in its centre. Again, Lebrun is cautious, saying, "It is tempting to think that we can simply extrapolate our results to the entire Galaxy. However, we have only looked towards its centre and that is a peculiar place compared to the rest." Next on Integral's list of things to do is to extend this work to the rest of the Galaxy. Christoph Winkler, ESA's Integral Project Scientist, says, "We now have to work on the whole disc region of the Galaxy. This will be a tough and long job for Integral. But at the end, the reward will be an exhaustive inventory of the most energetic celestial objects in the Galaxy." Note to editors The paper explaining these results will appear on the 18 March 2004 issue of "Nature". The author list includes F. Lebrun, R. Terrier, A. Bazzano, G. Belanger, A. Bird, L. Bouchet, A. Dean, M. Del Santo, A. Goldwurm, N. Lund, H. Morand, A. Parmar, J. Paul, J.-P. Roques, V. Schoenfelder, A. Strong, P. Ubertini, R. Walter and C. Winkler. For information about the related INTEGRAL and XMM-Newton discovery of IGRJ16318-4848, see: http://www.esa.int/esaSC/Pr_21_2003_s_en.html Integral The International Gamma Ray Astrophysics Laboratory (Integral) is the first space observatory that can simultaneously observe celestial objects in gamma rays, X-rays and visible light. Integral was launched on a Russian Proton rocket on 17 October 2002 into a highly elliptical orbit around Earth. Its principal targets include regions of the galaxy where chemical elements are being produced and compact objects, such as black holes. IBIS, Imager on Board the Integral Satellite - IBIS provides sharper gamma-ray images than any previous gamma-ray instrument. It can locate sources to a precision of 30 arcseconds, the equivalent of measuring the height of a person standing in a crowd, 1.3 kilometres away. The Principal Investigators that built the instrument are P. Ubertini (IAS/CNR, Rome, Italy), F. Lebrun (CEA Saclay, Gif sur Yvette, France), G. Di Cocco (ITESRE, Bologna, Italy). IBIS is equipped with the first un-cooled semiconductor gamma-ray camera, called ISGRI, which is responsible for its outstanding sensitivity. ISGRI was developed and built for ESA by CEA Saclay, France. SPI, Spectrometer on Integral - SPI measures the energy of incoming gamma rays with extraordinary accuracy. It is more sensitive to faint radiation than any previous gamma ray instrument and allows the precise nature of gamma ray sources to be determined. The Principal Investigators that developed SPI are J.-P. Roques, (CESR, Toulouse, France) and V. Schoenfelder (MPE, Garching, Germany). XMM-Newton XMM-Newton can detect more X-ray sources than any previous observatory and is helping to solve many cosmic mysteries of the violent Universe, from black holes to the formation of galaxies. It was launched on 10 December 1999, using an Ariane-5 rocket from French Guiana. Its orbit takes it almost a third of the way to the Moon, so that astronomers can enjoy long, uninterrupted views of celestial objects.
NASA Astrophysics Data System (ADS)
Sudoh, Takahiro; Totani, Tomonori; Kawanaka, Norita
2018-06-01
We present new theoretical modeling to predict the luminosity and spectrum of gamma-ray and neutrino emission of a star-forming galaxy, from the star formation rate (ψ), gas mass (Mgas), stellar mass, and disk size, taking into account production, propagation, and interactions of cosmic rays. The model reproduces the observed gamma-ray luminosities of nearby galaxies detected by Fermi better than the simple power-law models as a function of ψ or ψMgas. This model is then used to predict the cosmic background flux of gamma-rays and neutrinos from star-forming galaxies, by using a semi-analytical model of cosmological galaxy formation that reproduces many observed quantities of local and high-redshift galaxies. Calibration of the model using gamma-ray luminosities of nearby galaxies allows us to make a more reliable prediction than previous studies. In our baseline model, star-forming galaxies produce about 20% of the isotropic gamma-ray background unresolved by Fermi, and only 0.5% of IceCube neutrinos. Even with an extreme model assuming a hard injection cosmic-ray spectral index of 2.0 for all galaxies, at most 22% of IceCube neutrinos can be accounted for. These results indicate that it is difficult to explain most of the IceCube neutrinos by star-forming galaxies, without violating the gamma-ray constraints from nearby galaxies.
NASA Astrophysics Data System (ADS)
Sudoh, Takahiro; Totani, Tomonori; Kawanaka, Norita
2018-04-01
We present new theoretical modeling to predict the luminosity and spectrum of gamma-ray and neutrino emission of a star-forming galaxy, from the star formation rate (ψ), gas mass (Mgas), stellar mass, and disk size, taking into account production, propagation, and interactions of cosmic rays. The model reproduces the observed gamma-ray luminosities of nearby galaxies detected by Fermi better than the simple power-law models as a function of ψ or ψMgas. This model is then used to predict the cosmic background flux of gamma-rays and neutrinos from star-forming galaxies, by using a semi-analytical model of cosmological galaxy formation that reproduces many observed quantities of local and high-redshift galaxies. Calibration of the model using gamma-ray luminosities of nearby galaxies allows us to make a more reliable prediction than previous studies. In our baseline model, star-forming galaxies produce about 20% of the isotropic gamma-ray background unresolved by Fermi, and only 0.5% of IceCube neutrinos. Even with an extreme model assuming a hard injection cosmic-ray spectral index of 2.0 for all galaxies, at most 22% of IceCube neutrinos can be accounted for. These results indicate that it is difficult to explain most of the IceCube neutrinos by star-forming galaxies, without violating the gamma-ray constraints from nearby galaxies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agudo, Ivan; Jorstad, Svetlana G.; Marscher, Alan P.
We combine time-dependent multi-waveband flux and linear polarization observations with submilliarcsecond-scale polarimetric images at {lambda} = 7 mm of the BL Lacertae type blazar OJ287 to locate the {gamma}-ray emission in prominent flares in the jet of the source >14 pc from the central engine. We demonstrate a highly significant correlation between the strongest {gamma}-ray and millimeter-wave flares through Monte Carlo simulations. The two reported {gamma}-ray peaks occurred near the beginning of two major millimeter-wave outbursts, each of which is associated with a linear polarization maximum at millimeter wavelengths. Our very long baseline array observations indicate that the two millimeter-wavemore » flares originated in the second of two features in the jet that are separated by >14 pc. The simultaneity of the peak of the higher-amplitude {gamma}-ray flare and the maximum in polarization of the second jet feature implies that the {gamma}-ray and millimeter-wave flares are cospatial and occur >14 pc from the central engine. We also associate two optical flares, accompanied by sharp polarization peaks, with the two {gamma}-ray events. The multi-waveband behavior is most easily explained if the {gamma}-rays arise from synchrotron self-Compton scattering of optical photons from the flares. We propose that flares are triggered by interaction of moving plasma blobs with a standing shock. The {gamma}-ray and optical emission is quenched by inverse Compton losses as synchrotron photons from the newly shocked plasma cross the emission region. The millimeter-wave polarization is high at the onset of a flare, but decreases as the electrons emitting at these wavelengths penetrate less polarized regions.« less
Hou, X.; Smith, D. A.; Guillemot, L.; ...
2014-10-14
Context. Here, GeV gamma-ray pulsations from over 140 pulsars have been characterized using the Fermi Large Area Telescope, enabling improved understanding of the emission regions within the neutron star magnetospheres, and the contributions of pulsars to high energy electrons and diffuse gamma rays in the Milky Way. The first gamma-ray pulsars to be detected were the most intense and/or those with narrow pulses. Aims. As the Fermi mission progresses, progressively fainter objects can be studied. In addition to more distant pulsars (thus probing a larger volume of the Galaxy), or ones in high background regions (thus improving the sampling uniformitymore » across the Galactic plane), we detect pulsars with broader pulses or lower luminosity. Adding pulsars to our catalog with inclination angles that are rare in the observed sample, and/or with lower spindown power, will reduce the bias in the currently known gamma-ray pulsar population. Methods. We use rotation ephemerides derived from radio observations to phase-fold gamma rays recorded by the Fermi Large Area Telescope, to then determine the pulse profile properties. Spectral analysis provides the luminosities and, when the signal-to-noise ratio allows, the cutoff energies. We constrain the pulsar distances by different means in order to minimize the luminosity uncertainties. Results. We present six new gamma-ray pulsars with an eclectic mix of properties. Three are young, and three are recycled. They include the farthest, the lowest power, two of the highest duty-cycle pulsars seen, and only the fourth young gamma-ray pulsar with a radio interpulse. Finally, we discuss the biases existing in the current gamma-ray pulsar catalog, and steps to be taken to mitigate the bias.« less
NASA Astrophysics Data System (ADS)
Diehl, Roland
2017-06-01
Gamma ray lines from cosmic sources convey the action of nuclear reactions in cosmic sites and their impacts on astrophysical objects. Gamma rays at characteristic energies result from nuclear transitions following radioactive decays or high-energy collisions with excitation of nuclei. The gamma-ray line from the annihilation of positrons at 511 keV falls into the same energy window, although of different origin. We present here the concepts of cosmic gamma ray spectrometry and the corresponding instruments and missions, followed by a discussion of recent results and the challenges and open issues for the future. Among the lessons learned are the diffuse radioactive afterglow of massive-star nucleosynthesis in 26Al and 60Fe gamma rays, which is now being exploited towards the cycle of matter driven by massive stars and their supernovae; large interstellar cavities and superbubbles have been recognised to be of key importance here. Also, constraints on the complex processes making stars explode as either thermonuclear or core-collapse supernovae are being illuminated by gamma-ray lines, in this case from shortlived radioactivities from 56Ni and 44Ti decays. In particular, the three-dimensionality and asphericities that have recently been recognised as important are enlightened in different ways through such gamma-ray line spectroscopy. Finally, the distribution of positron annihilation gamma ray emission with its puzzling bulge-dominated intensity disctribution is measured through spatially-resolved spectra, which indicate that annihilation conditions may differ in different parts of our Galaxy. But it is now understood that a variety of sources may feed positrons into the interstellar medium, and their characteristics largely get lost during slowing down and propagation of positrons before annihilation; a recent microquasar flare was caught as an opportunity to see positrons annihilate at a source.
Population Studies of Radio and Gamma-Ray Pulsars
NASA Technical Reports Server (NTRS)
Harding, Alice K; Gonthier, Peter; Coltisor, Stefan
2004-01-01
Rotation-powered pulsars are one of the most promising candidates for at least some of the 40-50 EGRET unidentified gamma-ray sources that lie near the Galactic plane. Since the end of the EGRO mission, the more sensitive Parkes Multibeam radio survey has detected mere than two dozen new radio pulsars in or near unidentified EGRET sources, many of which are young and energetic. These results raise an important question about the nature of radio quiescence in gamma-ray pulsars: is the non-detection of radio emission a matter of beaming or of sensitivity? The answer is very dependent on the geometry of the radio and gamma-ray beams. We present results of a population synthesis of pulsars in the Galaxy, including for the first time the full geometry of the radio and gamma-ray beams. We use a recent empirically derived model of the radio emission and luminosity, and a gamma-ray emission geometry and luminosity derived theoretically from pair cascades in the polar slot gap. The simulation includes characteristics of eight radio surveys of the Princeton catalog plus the Parkes MB survey. Our results indicate that EGRET was capable of detecting several dozen pulsars as point sources, with the ratio of radio-loud to radio-quiet gamma-ray pulsars increasing significantly to about ten to one when the Parkes Survey is included. Polar cap models thus predict that many of the unidentified EGRET sources could be radio-loud gamma- ray pulsars, previously undetected as radio pulsars due to distance, large dispersion and lack of sensitivity. If true, this would make gamma-ray telescopes a potentially more sensitive tool for detecting distant young neutron stars in the Galactic plane.
Search for gamma-ray emission from Galactic novae with the Fermi -LAT
NASA Astrophysics Data System (ADS)
Franckowiak, A.; Jean, P.; Wood, M.; Cheung, C. C.; Buson, S.
2018-02-01
Context. A number of novae have been found to emit high-energy gamma rays (>100 MeV). However, the origin of this emission is not yet understood. We report on the search for gamma-ray emission from 75 optically detected Galactic novae in the first 7.4 years of operation of the Fermi Large Area Telescope using the Pass 8 data set. Aims: We compile an optical nova catalog including light curves from various resources and estimate the optical peak time and optical peak magnitude in order to search for gamma-ray emission to determine whether all novae are gamma-ray emitters. Methods: We repeated the analysis of the six novae previously identified as gamma-ray sources and developed a unified analysis strategy that we then applied to all novae in our catalog. We searched for emission in a 15 day time window in two-day steps ranging from 20 days before to 20 days after the optical peak time. We performed a population study with Monte Carlo simulations to set constraints on the properties of the gamma-ray emission of novae. Results: Two new novae candidates have been found at 2σ global significance. Although these two novae candidates were not detected at a significant level individually, taking them together with the other non-detected novae, we found a sub-threshold nova population with a cumulative 3σ significance. We report the measured gamma-ray flux for detected sources and flux upper limits for novae without significant detection. Our results can be reproduced by several gamma-ray emissivity models (e.g., a power-law distribution with a slope of 2), while a constant emissivity model (i.e., assuming novae are standard candles) can be rejected.
Search for gamma-ray emission from Galactic novae with the Fermi-LAT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Franckowiak, A.; Jean, P.; Wood, M.
Context. A number of novae have been found to emit high-energy gamma rays (>100 MeV). However, the origin of this emission is not yet understood. We report on the search for gamma-ray emission from 75 optically detected Galactic novae in the first 7.4 years of operation of the Fermi Large Area Telescope using the Pass 8 data set. Aims. We compile an optical nova catalog including light curves from various resources and estimate the optical peak time and optical peak magnitude in order to search for gamma-ray emission to determine whether all novae are gamma-ray emitters. Methods. We repeated themore » analysis of the six novae previously identified as gamma-ray sources and developed a unified analysis strategy that we then applied to all novae in our catalog. We searched for emission in a 15 day time window in two-day steps ranging from 20 days before to 20 days after the optical peak time. We performed a population study with Monte Carlo simulations to set constraints on the properties of the gamma-ray emission of novae. Results. Two new novae candidates have been found at ~ 2σ global significance. Although these two novae candidates were not detected at a significant level individually, taking them together with the other non-detected novae, we found a sub-threshold nova population with a cumulative 3σ significance. We report the measured gamma-ray flux for detected sources and flux upper limits for novae without significant detection. Lastly, our results can be reproduced by several gamma-ray emissivity models (e.g., a power-law distribution with a slope of 2), while a constant emissivity model (i.e., assuming novae are standard candles) can be rejected.« less
Search for gamma-ray emission from Galactic novae with the Fermi-LAT
Franckowiak, A.; Jean, P.; Wood, M.; ...
2018-02-05
Context. A number of novae have been found to emit high-energy gamma rays (>100 MeV). However, the origin of this emission is not yet understood. We report on the search for gamma-ray emission from 75 optically detected Galactic novae in the first 7.4 years of operation of the Fermi Large Area Telescope using the Pass 8 data set. Aims. We compile an optical nova catalog including light curves from various resources and estimate the optical peak time and optical peak magnitude in order to search for gamma-ray emission to determine whether all novae are gamma-ray emitters. Methods. We repeated themore » analysis of the six novae previously identified as gamma-ray sources and developed a unified analysis strategy that we then applied to all novae in our catalog. We searched for emission in a 15 day time window in two-day steps ranging from 20 days before to 20 days after the optical peak time. We performed a population study with Monte Carlo simulations to set constraints on the properties of the gamma-ray emission of novae. Results. Two new novae candidates have been found at ~ 2σ global significance. Although these two novae candidates were not detected at a significant level individually, taking them together with the other non-detected novae, we found a sub-threshold nova population with a cumulative 3σ significance. We report the measured gamma-ray flux for detected sources and flux upper limits for novae without significant detection. Lastly, our results can be reproduced by several gamma-ray emissivity models (e.g., a power-law distribution with a slope of 2), while a constant emissivity model (i.e., assuming novae are standard candles) can be rejected.« less
Research in particle and gamma-ray astrophysics
NASA Technical Reports Server (NTRS)
Stone, E. C.; Davis, L., Jr.; Mewaldt, R. A.; Prince, T. A.
1988-01-01
Research activities in cosmic rays, gamma rays, and astrophysical plasmas are covered. Each activity is described, followed by a bibliography. The research program is directed toward the investigation of the astrophysical aspects of cosmic rays and gamma rays and of the radiation and electromagnetic field environment of the earth and other planets. These investigations were performed by means of energetic particle and photon detector systems flown on spacecraft and balloons.
Long-Term Multiwavelength Studies of High-Redshift Blazar 0836+710
NASA Technical Reports Server (NTRS)
Thompson, D. J.; Akyuz, A.; Donato, D.; Perkins, J. S.; Larsson, S.; Sokolovsky, K.; Fuhrmann, L.; Kurtanidze, O.
2012-01-01
Following gamma-ray flaring activity of high-redshift (z=2.218) blazar 0836+710 in 2011, we have assembled a long-term multiwavelength study of this object. Although this source is monitored regularly by radio telescopes and the Fermi Large Area Telescope, its coverage at other wavelengths is limited. The optical flux appears generally correlated with the gamma-ray flux, while little variability has been seen at X-ray energies. The gamma-ray/radio correlation is complex compared to some other blazars. As for many blazars, the largest variability is seen at gamma-ray wavelengths.
FIREFLY: A cubesat mission to study terrestrial gamma-ray flashes
NASA Astrophysics Data System (ADS)
Klenzing, J. H.; Rowland, D. E.; Hill, J.; Weatherwax, A. T.
2009-12-01
FIREFLY is small satellite mission to investigate the link between atmospheric lightning and terrestrial gamma-ray flashes scheduled to launch in late 2010. The instrumentation includes a Gamma-Ray Detector (GRD), VLF receiver, and photometer. GRD will measure the energy and arrival time of x-ray and gamma-ray photons, as well as the energetic electron flux by using a phoswitch-style layered scintillator. The current status of the instrumentation will be discussed, including laboratory tests and simulations of the GRD. FIREFLY is the second in a series of NSF-funded cubesats designed to study the upper atmosphere.
Gamma-ray burst theory: Back to the drawing board
NASA Technical Reports Server (NTRS)
Harding, Alice K.
1994-01-01
Gamma-ray bursts have always been intriguing sources to study in terms of particle acceleration, but not since their discovery two decades ago has the theory of these objects been in such turmoil. Prior to the launch of Compton Gamma-Ray Observatory and observations by Burst and Transient Source Experiment (BATSE), there was strong evidence pointing to magnetized Galactic neutron stars as the sources of gamma-ray bursts. However, since BATSE the observational picture has changed dramatically, requiring much more distant and possibly cosmological sources. I review the history of gamma-ray burst theory from the era of growing consensus for nearby neutron stars to the recent explosion of halo and cosmological models and the impact of the present confusion on the particle acceleration problem.
Albedo gamma-rays observation at energies above 30 MeV
NASA Astrophysics Data System (ADS)
Galper, A. M.; Grachev, V. M.; Dmitrenko, V. V.; Kirillov-Ugriumov, V. G.; Liakhov, V. A.; Prokhorova, L. A.; Riumin, V. V.; Ulin, S. E.
Albedo gamma-ray observations are presented, which were carried out with the small gamma-ray telescope Elena-F on Salyut-6 at the 30-410 MeV and 50-420 MeV energy ranges. For the equatorial region from 15.0-17.5 GV, the albedo gamma-ray fluxes are 40 plus or minus 20 ph/sq m-s-sr, and the measured power law index of the differential energy spectrum is 1.6 plus or minus 0.5. The orbital station data are compared with simultaneous observations performed on a balloon, and the power law index of the differential energy spectrum of albedo gamma-rays measured by the balloon amounts to 2.1 plus or minus 0.4.
System to quantify gamma-ray radial energy deposition in semiconductor detectors
Kammeraad, Judith E.; Blair, Jerome J.
2001-01-01
A system for measuring gamma-ray radial energy deposition is provided for use in conjunction with a semiconductor detector. The detector comprises two electrodes and a detector material, and defines a plurality of zones within the detecting material in parallel with the two electrodes. The detector produces a charge signal E(t) when a gamma-ray interacts with the detector. Digitizing means are provided for converting the charge signal E(t) into a digitized signal. A computational means receives the digitized signal and calculates in which of the plurality of zones the gamma-ray deposited energy when interacting with the detector. The computational means produces an output indicating the amount of energy deposited by the gamma-ray in each of the plurality of zones.
Wavelet-based techniques for the gamma-ray sky
DOE Office of Scientific and Technical Information (OSTI.GOV)
McDermott, Samuel D.; Fox, Patrick J.; Cholis, Ilias
2016-07-01
Here, we demonstrate how the image analysis technique of wavelet decomposition can be applied to the gamma-ray sky to separate emission on different angular scales. New structures on scales that differ from the scales of the conventional astrophysical foreground and background uncertainties can be robustly extracted, allowing a model-independent characterization with no presumption of exact signal morphology. As a test case, we generate mock gamma-ray data to demonstrate our ability to extract extended signals without assuming a fixed spatial template. For some point source luminosity functions, our technique also allows us to differentiate a diffuse signal in gamma-rays from darkmore » matter annihilation and extended gamma-ray point source populations in a data-driven way.« less
Dense gamma-ray and pair creation using ultra-intense lasers
NASA Astrophysics Data System (ADS)
Liang, Edison; Lo, Willie; Hasson, Hannah; Dyer, Gilliss; Clarke, Taylor; Fasanelli, Fabio; Yao, Kelly; Marchenka, Ilija; Henderson, Alexander; Dashko, Andriy; Zhang, Yuling; Ditmire, Todd
2016-10-01
We report recent results of gamma-ray and e +e- pair creation experiments using the Texas Petawatt laser (TPW) in Austin and the Trident laser at LANL irradiating solid high-Z targets. In addition to achieving record high densities of emerging gamma-rays and pairs at TPW, we measured in detail the spectra of hot electrons, positrons, and gamma-rays, and studied their spectral variation with laser and target parameters. A new type of gamma-ray spectrometer, called the scintillator attenuation spectrometer (SAS), was successfully demonstrated in Trident experiments in 2015. We will discuss the design and results of the SAS. Preliminary results of new experiments at TPW carried out in the summer of 2016 will also be presented.
Gamma-ray astronomy with muons: Sensitivity of IceCube to PeVatrons in the Southern sky
DOE Office of Scientific and Technical Information (OSTI.GOV)
Halzen, Francis; O'Murchadha, Aongus; Kappes, Alexander
2009-10-15
Northern hemisphere TeV gamma-ray observatories such as Milagro and Tibet AS{gamma} have demonstrated the importance of all-sky instruments by discovering previously unidentified sources that may be the PeVatrons producing cosmic rays up to the knee in the cosmic ray spectrum. We evaluate the potential of IceCube to identify similar sources in the southern sky by detailing an analytic approach to determine fluxes of muons from TeV gamma-ray showers. We apply this approach to known gamma-ray sources such as supernova remnants. We find that, similar to Milagro, detection is possible in 10 years for pointlike PeVatrons with fluxes stronger than severalmore » 10{sup -11} particles TeV{sup -1} cm{sup -2} s{sup -1}.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A. A.; National Academy of Sciences, Washington, D.C. 20001; Ackermann, M.
We report on measurements of the cosmic-ray induced {gamma}-ray emission of Earth's atmosphere by the Large Area Telescope on board the Fermi Gamma-ray Space Telescope. The Large Area Telescope has observed the Earth during its commissioning phase and with a dedicated Earth limb following observation in September 2008. These measurements yielded {approx}6.4x10{sup 6} photons with energies >100 MeV and {approx}250 hours total live time for the highest quality data selection. This allows the study of the spatial and spectral distributions of these photons with unprecedented detail. The spectrum of the emission--often referred to as Earth albedo gamma-ray emission--has a power-lawmore » shape up to 500 GeV with spectral index {gamma}=2.79{+-}0.06.« less
Computed radiography as a gamma ray detector—dose response and applications
NASA Astrophysics Data System (ADS)
O'Keeffe, D. S.; McLeod, R. W.
2004-08-01
Computed radiography (CR) can be used for imaging the spatial distribution of photon emissions from radionuclides. Its wide dynamic range and good response to medium energy gamma rays reduces the need for long exposure times. Measurements of small doses can be performed without having to pre-sensitize the computed radiography plates via an x-ray exposure, as required with screen-film systems. Cassette-based Agfa MD30 and Kodak GP25 CR plates were used in applications involving the detection of gamma ray emissions from technetium-99m and iodine-131. Cassette entrance doses as small as 1 µGy (140 keV gamma rays) produce noisy images, but the images are suitable for applications such as the detection of breaks in radiation protection barriers. A consequence of the gamma ray sensitivity of CR plates is the possibility that some nuclear medicine patients may fog their x-rays if the x-ray is taken soon after their radiopharmaceutical injection. The investigation showed that such fogging is likely to be diffuse.
Fermi Detection of Gamma-Ray Emission from the M2 Soft X-Ray Flare on 2010 June 12
NASA Technical Reports Server (NTRS)
Ackermann, M.; Ajello, M.; Allafort, A.; Atwood, W. B.; Baldini, L.; Barbiellini, G.; Bastieri, D.; Bechtol, K.; Bellazzini, R.; Bhat, P. N.;
2012-01-01
The GOES M2-class solar flare, SOL2010-06-12T00:57, was modest in many respects yet exhibited remarkable acceleration of energetic particles. The flare produced an approximately 50 s impulsive burst of hard X- and gamma-ray emission up to at least 400 MeV observed by the Fermi GBM and LAT experiments. The remarkably similar hard X-ray and high-energy gamma-ray time profiles suggest that most of the particles were accelerated to energies greater than or equal to 300 MeV with a delay of approximately 10 s from mildly relativistic electrons, but some reached these energies in as little as approximately 3 s. The gamma-ray line fluence from this flare was about ten times higher than that typically observed from this modest GOES class of X-ray flare. There is no evidence for time-extended greater than 100 MeV emission as has been found for other flares with high-energy gamma rays.
KASCADE-Grande Limits on the Isotropic Diffuse Gamma-Ray Flux between 100 TeV and 1 EeV
NASA Astrophysics Data System (ADS)
Apel, W. D.; Arteaga-Velázquez, J. C.; Bekk, K.; Bertaina, M.; Blümer, J.; Bozdog, H.; Brancus, I. M.; Cantoni, E.; Chiavassa, A.; Cossavella, F.; Daumiller, K.; de Souza, V.; Di Pierro, F.; Doll, P.; Engel, R.; Feng, Z.; Fuhrmann, D.; Gherghel-Lascu, A.; Gils, H. J.; Glasstetter, R.; Grupen, C.; Haungs, A.; Heck, D.; Hörandel, J. R.; Huege, T.; Kampert, K.-H.; Kang, D.; Klages, H. O.; Link, K.; Łuczak, P.; Mathes, H. J.; Mayer, H. J.; Milke, J.; Mitrica, B.; Morello, C.; Oehlschläger, J.; Ostapchenko, S.; Pierog, T.; Rebel, H.; Roth, M.; Schieler, H.; Schoo, S.; Schröder, F. G.; Sima, O.; Toma, G.; Trinchero, G. C.; Ulrich, H.; Weindl, A.; Wochele, J.; Zabierowski, J.; KASCADE-Grande Collaboration
2017-10-01
KASCADE and KASCADE-Grande were multi-detector installations to measure individual air showers of cosmic rays at ultra-high energy. Based on data sets measured by KASCADE and KASCADE-Grande, 90% C.L. upper limits to the flux of gamma-rays in the primary cosmic ray flux are determined in an energy range of {10}14{--}{10}18 eV. The analysis is performed by selecting air showers with a low muon content as expected for gamma-ray-induced showers compared to air showers induced by energetic nuclei. The best upper limit of the fraction of gamma-rays to the total cosmic ray flux is obtained at 3.7× {10}15 eV with 1.1× {10}-5. Translated to an absolute gamma-ray flux this sets constraints on some fundamental astrophysical models, such as the distance of sources for at least one of the IceCube neutrino excess models.
Recent high energy gamma-ray results from SAS-2
NASA Technical Reports Server (NTRS)
Thompson, D. J.; Fichtel, C. E.; Hartman, R. C.; Kniffen, D. A.; Bignami, G. F.; Ogelman, H. B.; Ozel, M. E.; Tumer, T.; Lamb, R. C.
1977-01-01
Recent developments in gamma-ray astronomy due to the results from SAS-2 have focused on two areas. First, the emission from the plane of the Galaxy is the dominant feature in the gamma-ray sky. The galactic latitude and longitude distributions are consistent with the concept that the high-energy radiation originates from cosmic rays interacting with interstellar matter, and the measurements support a galactic origin for cosmic rays. Second, searches of the SAS-2 data for emission from localized sources have shown three strong discrete gamma-ray sources: the Crab nebula and PSR 0531 + 21, the Vela supernova remnant and PSR 0833-45, and a source near galactic coordinates 193 deg longitude, +3 deg latitude, which does not appear to be associated with other known celestial objects. Evidence has also been found for pulsed gamma-ray emission from two other radio pulsars, PSR 1818-04 and PSR 1747-46. A localized source near longitudes 76-80 deg may be associated with the X-ray source Cyg X-3.
A luminous gamma-ray binary in the large magellanic cloud
Corbet, R. H. D.; Chomiuk, L.; Coe, M. J.; ...
2016-09-27
Gamma-ray binaries consist of a neutron star or a black hole interacting with a normal star to produce gamma-ray emission that dominates the radiative output of the system. Previously, only a handful of such systems have been discovered, all within our Galaxy. We report the discovery of a luminous gamma-ray binary in the Large Magellanic Cloud, found with the Fermi Large Area Telescope (LAT), from a search for periodic modulation in all sources in the third Fermi LAT catalog. This is the first such system to be found outside the Milky Way. Furthermore, the system has an orbital period ofmore » 10.3 days, and is associated with a massive O5III star located in the supernova remnant DEM L241, previously identified as the candidate high-mass X-ray binary (HMXB) CXOU J053600.0–673507. X-ray and radio emission are also modulated on the 10.3 day period, but are in anti-phase with the gamma-ray modulation. Optical radial velocity measurements suggest that the system contains a neutron star. The source is significantly more luminous than similar sources in the Milky Way, at radio, optical, X-ray, and gamma-ray wavelengths. The detection of this extra-galactic system, but no new Galactic systems, raises the possibility that the predicted number of gamma-ray binaries in our Galaxy has been overestimated, and that HMXBs may be born containing relatively slowly rotating neutron stars.« less
ASTRONOMY: Neighborhood Gamma Ray Burst Boosts Theory.
Schilling, G
2000-07-07
Titanic explosions that emit powerful flashes of energetic gamma rays are one of astronomy's hottest mysteries. Now an analysis of the nearest gamma ray burst yet detected has added weight to the popular theory that they are expelled during the death throes of supermassive stars.
Fermi-LAT Bright Gamma-ray Detection of Nova ASASSN-18fv
NASA Astrophysics Data System (ADS)
Jean, P.; Cheung, C. C.; Ojha, R.; van Zyl, P.; Angioni, R.
2018-04-01
The Large Area Telescope (LAT), one of two instruments on the Fermi Gamma-ray Space Telescope, has observed bright gamma-ray emission from a source positionally consistent with the bright optical nova ASASSN-18fv (ATel #11454, #11456, #11460, #11467, #11508).
Commissioning of the UK NAtional Nuclear Array
NASA Astrophysics Data System (ADS)
Shearman, R.; Collins, S. M.; Lorusso, G.; Rudigier, M.; Judge, S. M.; Bell, S. J.; Podolyak, Zs.; Regan, P. H.
2017-11-01
The NAtional Nuclear Array (NANA) is a LaBr3(Ce)-based coincidence gamma-ray spectrometer which can be used to identify, and enhance with respect to the background, signature gamma-ray emissions associated with particular radionuclide decays from a complex multi-component spectrum. Gamma-ray energy coincidence measurements using the NANA have been made using a digital data acquisition system based on CAEN V1751C 1 GHz digitizers. The improved time resolution offered by LaBr3(Ce) crystals compared to similar-sized solid state detectors can provide narrow time-correlated, gamma-ray energy coincidence matrices that can be interrogated to select discrete gamma-ray emissions associated with particular radionuclide decays. This paper provides an overview of the operational characteristics of the NANA spectrometer, including energy resolution and full-energy peak efficiency parameters, and provides an example of double and triple gamma-ray coincidence gating on decays associated with the nuclear fuel waste product 134Cs. The full-energy peak efficiency response of the spectrometer is compared to Monte Carlo GEANT4 simulations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singal, J.; Ko, A.; Petrosian, V., E-mail: jsingal@richmond.edu
We present the redshift evolutions and distributions of the gamma-ray luminosity and photon spectral index of flat spectrum radio quasar (FSRQ) type blazars, using non-parametric methods to obtain the evolutions and distributions directly from the data. The sample we use for analysis consists of almost all FSRQs observed with a greater than approximately 7σ detection threshold in the first-year catalog of the Fermi Gamma-ray Space Telescope's Large Area Telescope, with redshifts as determined from optical spectroscopy by Shaw et al. We find that FSQRs undergo rapid gamma-ray luminosity evolution, but negligible photon index evolution, with redshift. With these evolutions accountedmore » for we determine the density evolution and luminosity function of FSRQs and calculate their total contribution to the extragalactic gamma-ray background radiation, resolved and unresolved, which is found to be 16(+10/–4)%, in agreement with previous studies.« less
NASA Astrophysics Data System (ADS)
Raiteri, C. M.; Ghisellini, G.; Villata, M.; de Francesco, G.; Lanteri, L.; Chiaberge, M.; Peila, A.; Antico, G.
1998-02-01
New data from the optical monitoring of gamma -ray loud blazars at the Torino Astronomical Observatory are presented. Observations have been taken in the Johnson's B, V, and Cousins' R bands with the 1.05m REOSC telescope equipped with a 1242x1152 pixel CCD camera. Many of the 22 monitored sources presented here show noticeable magnitude variations. Periods corresponding to pointings of the Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (CGRO) satellite are indicated on the light curves. The comparison of our data with those taken by CGRO in the gamma -ray band will contribute to better understand the mechanism of the gamma -ray emission. We finally show intranight light curves of 3C 66A and OJ 287, where microvariability was detected. Tables 2--21 are only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html
NASA Technical Reports Server (NTRS)
Crannell, C. J.; Crannell, H.; Ramaty, R.
1978-01-01
Processes which lead to the production of gamma rays with energy greater than 8 MeV in solar flares are reviewed and evaluated. Excited states produced by inelastic scattering, charge exchange, and spallation reactions in the abundant nuclear species are considered in order to identify nuclear lines which may contribute to the Gamma ray spectrum of solar flares. The flux of 15.11 MeV Gamma rays relative to the flux of 4.44 MeV Gamma rays from the de-excitation of the corresponding states in C12 is calculated for a number of assumed distributions of exciting particles. This flux ratio is a sensitive diagnostic of accelerated particle spectra. Other high energy nuclear levels are not so isolated as the 15.11 MeV state and are not expected to be so strong. The spectrum of Gamma rays from the decay of Pi dey is sensitive to the energy distribution of particles accelerated to energies greater than 100 MeV.
Gamma-ray vortices from nonlinear inverse Thomson scattering of circularly polarized light.
Taira, Yoshitaka; Hayakawa, Takehito; Katoh, Masahiro
2017-07-10
Inverse Thomson scattering is a well-known radiation process that produces high-energy photons both in nature and in the laboratory. Nonlinear inverse Thomson scattering occurring inside an intense light field is a process which generates higher harmonic photons. In this paper, we theoretically show that the higher harmonic gamma-ray produced by nonlinear inverse Thomson scattering of circularly polarized light is a gamma-ray vortex, which means that it possesses a helical wave front and carries orbital angular momentum. Our work explains a recent experimental result regarding nonlinear inverse Thomson scattering that clearly shows an annular intensity distribution as a remarkable feature of a vortex beam. Our work implies that gamma-ray vortices should be produced in various situations in astrophysics in which high-energy electrons and intense circularly polarized light fields coexist. Nonlinear inverse Thomson scattering is a promising radiation process for realizing a gamma-ray vortex source based on currently available laser and accelerator technologies, which would be an indispensable tool for exploring gamma-ray vortex science.
Prompt optical emission from gamma-ray bursts
NASA Astrophysics Data System (ADS)
Kehoe, Robert; Akerlof, Karl; Balsano, Richard; Barthelmy, Scott; Bloch, Jeff; Butterworth, Paul; Casperson, Don; Cline, Tom; Fletcher, Sandra; Frontera, Fillippo; Gisler, Galen; Heise, John; Hills, Jack; Hurley, Kevin; Lee, Brian; Marshall, Stuart; McKay, Tim; Pawl, Andrew; Piro, Luigi; Priedhorsky, Bill; Szymanski, John; Wren, Jim
The Robotic Optical Transient Search Experiment (ROTSE) seeks to measure contemporaneous and early afterglow optical emission from gamma-ray bursts (GRBs). The ROTSE-I telescope array has been fully automated and responding to burst alerts from the GRB Coordinates Network since March 1998, taking prompt optical data for 30 bursts in its first year. We will briefly review observations of GRB990123 which revealed the first detection of an optical burst occurring during the gamma-ray emission, reaching 9th magnitude at its peak. In addition, we present here preliminary optical results for seven other gamma-ray bursts. No other optical counterparts were seen in this analysis, and the best limiting senisitivities are mV > 13.0 at 14.7 seconds after the gamma-ray rise, and mmV > 16.4 at 62 minutes. These are the most stringent limits obtained for GRB optical counterpart brightness in the first hour after the burst. This analysis suggests that there is not a strong correlation between optical flux and gamma-ray emission.
Southern Analysis of Genomic Alterations in Gamma-Ray-Induced Aprt- Hamster Cell Mutants
Grosovsky, Andrew J.; Drobetsky, Elliot A.; deJong, Pieter J.; Glickman, Barry W.
1986-01-01
The role of genomic alterations in mutagenesis induced by ionizing radiation has been the subject of considerable speculation. By Southern blotting analysis we show here that 9 of 55 (approximately 1/6) gamma-ray-induced mutants at the adenine phosphoribosyl transferase (aprt) locus of Chinese hamster ovary (CHO) cells have a detectable genomic rearrangement. These fall into two classes: intragenic deletions and chromosomal rearrangements. In contrast, no major genomic alterations were detected among 67 spontaneous mutants, although two restriction site loss events were observed. Three gamma-ray-induced mutants were found to be intragenic deletions; all may have identical break-points. The remaining six gamma-ray-induced mutants demonstrating a genomic alteration appear to be the result of chromosomal rearrangements, possibly translocation or inversion events. None of the remaining gamma-ray-induced mutants showed any observable alteration in blotting pattern indicating a substantial role for point mutation in gamma-ray-induced mutagenesis at the aprt locus. PMID:3013724
The Use of Gamma-Ray Imaging to Improve Portal Monitor Performance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ziock, Klaus-Peter; Collins, Jeff; Fabris, Lorenzo
2008-01-01
We have constructed a prototype, rapid-deployment portal monitor that uses visible-light and gamma-ray imaging to allow simultaneous monitoring of multiple lanes of traffic from the side of a roadway. Our Roadside Tracker uses automated target acquisition and tracking (TAT) software to identify and track vehicles in visible light images. The field of view of the visible camera overlaps with and is calibrated to that of a one-dimensional gamma-ray imager. The TAT code passes information on when vehicles enter and exit the system field of view and when they cross gamma-ray pixel boundaries. Based on this in-formation, the gamma-ray imager "harvests"more » the gamma-ray data specific to each vehicle, integrating its radiation signature for the entire time that it is in the field of view. In this fashion we are able to generate vehicle-specific radiation signatures and avoid source confusion problems that plague nonimaging approaches to the same problem.« less
A method for determination mass absorption coefficient of gamma rays by Compton scattering.
El Abd, A
2014-12-01
A method was proposed for determination mass absorption coefficient of gamma rays for compounds, alloys and mixtures. It is based on simulating interaction processes of gamma rays with target elements having atomic numbers from Z=1 to Z=92 using the MCSHAPE software. Intensities of Compton scattered gamma rays at saturation thicknesses and at a scattering angle of 90° were calculated for incident gamma rays of different energies. The obtained results showed that the intensity of Compton scattered gamma rays at saturations and mass absorption coefficients can be described by mathematical formulas. These were used to determine mass absorption coefficients for compound, alloys and mixtures with the knowledge of their Compton scattered intensities. The method was tested by calculating mass absorption coefficients for some compounds, alloys and mixtures. There is a good agreement between obtained results and calculated ones using WinXom software. The advantages and limitations of the method were discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.
Gamma-ray pulsars: Emission zones and viewing geometries
NASA Technical Reports Server (NTRS)
Romani, Roger W.; Yadigaroglu, I.-A.
1995-01-01
There are now a half-dozen young pulsars detected in high-energy photons by the Compton Gamma-Ray Observatory (CGRO), showing a variety of emission efficiencies and pulse profiles. We present here a calculation of the pattern of high-energy emission on the sky in a model which posits gamma-ray production by charge-depleted gaps in the outer magnetosphere. This model accounts for the radio to gamma-ray pulse offsets of the known pulsars, as well as the shape of the high-energy pulse profiles. We also show that about one-third of emitting young radio pulsars will not be detected due to beaming effects, while approximately 2.5 times the number of radio-selected gamma-ray pulsars will be viewed only high energies. Finally we compute the polarization angle variation and find that the previously misunderstood optical polarization sweep of the Crab pulsar arises naturally in this picture. These results strongly support an outer magnetosphere location for the gamma-ray emission.
A search of the SAS-2 data for pulsed gamma-ray emission from radio pulsars
NASA Technical Reports Server (NTRS)
Ogelman, H.; Fichtel, C. E.; Kniffen, D. A.; Thompson, D. J.
1976-01-01
Data from the SAS-2 high-energy (above 35 MeV) gamma-ray experiment have been examined for pulsed emission from each of 75 radio pulsars which were viewed by the instrument and which have sufficiently well-defined period and period-derivative information from radio observations to allow for gamma-ray periodicity searches. When gamma-ray arrival times were converted to pulsar phase using the radio reference timing information, two pulsars, PSR 1747-46 and PSR 1818-04, showed positive effects, each with a probability of less than 1 part in 10,000 of being a random fluctuation in the data for that pulsar. These are in addition to PSR 0531+21 and PSR 0833-45, previously reported. The results of this study suggest that gamma-ray astronomy has reached the detection threshold for gamma-ray pulsars and that work in the near future should give important new information on the nature of pulsars.
NASA Technical Reports Server (NTRS)
Bodnarik, J.; Evans, L.; Floyd, S.; Lim, L.; McClanahan, T.; Namkung, M.; Parsons, A.; Schweitzer, J.; Starr, R.; Trombka, J.
2010-01-01
An outside neutron and gamma ray instrumentation test facility has been constructed at NASA's Goddard Space Flight Center (GSFC) to evaluate conceptual designs of gamma ray and neutron systems that we intend to propose for future planetary lander and rover missions. We will describe this test facility and its current capabilities for operation of planetary in situ instrumentation, utilizing a l4 MeV pulsed neutron generator as the gamma ray excitation source with gamma ray and neutron detectors, in an open field with the ability to remotely monitor and operate experiments from a safe distance at an on-site building. The advantage of a permanent test facility with the ability to operate a neutron generator outside and the flexibility to modify testing configurations is essential for efficient testing of this type of technology. Until now, there have been no outdoor test facilities for realistically testing neutron and gamma ray instruments planned for solar system exploration
AGIS: A Next-generation TeV Gamma-ray Observatory
NASA Astrophysics Data System (ADS)
Vandenbroucke, Justin
2010-05-01
The Advanced Gamma-ray Imaging System (AGIS) is a next-generation array of imaging atmospheric Cherenkov telescopes for gamma-ray astronomy in the 100 GeV to 100 TeV band. TeV astronomy has flourished in the last few years. Together with the extremely successful first year of the Fermi LAT telescope for GeV gamma-ray astronomy, we are now in a golden age of gamma-ray astronomy. AGIS seeks to continue the success of gamma-ray astronomy by discovering hundreds of new TeV sources and improving our understanding of known sources, as well as searching for signals from dark matter annihilation. AGIS will feature 36 Schwarzschild-Couder (SC) telescopes spanning 1 km2. The two-mirror SC design allows a wide field of view (8 deg diameter) and high-resolution (0.05 deg diameter) pixellation. I will present the science capabilities of the AGIS observatory as well as the technical design and current status of the project.
BOW TIES IN THE SKY. I. THE ANGULAR STRUCTURE OF INVERSE COMPTON GAMMA-RAY HALOS IN THE FERMI SKY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Broderick, Avery E.; Shalaby, Mohamad; Tiede, Paul
2016-12-01
Extended inverse Compton halos are generally anticipated around extragalactic sources of gamma rays with energies above 100 GeV. These result from inverse Compton scattered cosmic microwave background photons by a population of high-energy electron/positron pairs produced by the annihilation of the high-energy gamma rays on the infrared background. Despite the observed attenuation of the high-energy gamma rays, the halo emission has yet to be directly detected. Here, we demonstrate that in most cases these halos are expected to be highly anisotropic, distributing the upscattered gamma rays along axes defined either by the radio jets of the sources or oriented perpendicularmore » to a global magnetic field. We present a pedagogical derivation of the angular structure in the inverse Compton halo and provide an analytic formalism that facilitates the generation of mock images. We discuss exploiting this fact for the purpose of detecting gamma-ray halos in a set of companion papers.« less
Internal absorption of gamma-rays in relativistic blobs of active galactic nuclei
NASA Astrophysics Data System (ADS)
Sitarek, Julian; Bednarek, Wlodek
2007-06-01
We investigate the production of gamma-rays in the inverse Compton (IC) scattering process by leptons accelerated inside relativistic blobs in jets of active galactic nuclei. Leptons are injected homogeneously inside the spherical blob and initiate IC e ± pair cascade in the synchrotron radiation (produced by the same population of leptons, SSC model), provided that the optical depth for gamma-rays is larger than unity. It is shown that for likely parameters internal absorption of gamma-rays has to be important. We suggest that new type of blazars might be discovered by the future simultaneous X-ray and γ-ray observations, showing peak emissions in the hard X-rays, and in the GeV γ-rays. Moreover, the considered scenario might be also responsible for the orphan X-ray flares recently reported from BL Lac type active galaxies.
Gamma ray irradiated AgFeO{sub 2} nanoparticles with enhanced gas sensor properties
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Xiuhua, E-mail: xhwang@mail.ahnu.edu.cn; Shi, Zhijie; Yao, Shangwu
2014-11-15
AgFeO{sub 2} nanoparticles were synthesized via a facile hydrothermal method and irradiated by various doses of gamma ray. The products were characterized with X-ray powder diffraction, UV–vis absorption spectrum and transmission electron microscope. The results revealed that the crystal structure, morphology and size of the samples remained unchanged after irradiation, while the intensity of UV–Vis spectra increased with irradiation dose increasing. In addition, gamma ray irradiation improved the performance of gas sensor based on the AgFeO{sub 2} nanoparticles including the optimum operating temperature and sensitivity, which might be ascribed to the generation of defects. - Graphical abstract: Gamma ray irradiationmore » improved the performance of gas sensor based on the AgFeO{sub 2} nanoparticles including sensitivity and optimum operating temperature, which might be ascribed to the generation of defects. - Highlights: • AgFeO{sub 2} nanoparticles were synthesized and irradiated with gamma ray. • AgFeO{sub 2} nanoparticles were employed to fabricate gas sensors to detect ethanol. • Gamma ray irradiation improved the sensitivity and optimum operating temperature.« less
1989-12-29
1.1.2. General Performance Criteria for Gamma Ray Spectrometers 4 1.1.3. Special Criteria for Space-Based Spectrometer Systems 7 1.1.4. Prior Approaches...calculations were performed for selected incident gamma ray energies and were used to generate tabular and graphical listings of gamma scattering results. The... generated . These output presentations were studied to identify behavior patterns of "good" and "bad" event sequences. For the specific gamma energy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshima, Masumi; Kin, Tadahiro; Kimura, Atsushi
Multi-step cascades from the {sup 62}Ni(n{sub cold},{gamma}) {sup 63}Ni reaction were studied via a {gamma}-ray spectroscopy method. With a {gamma}-ray detector array multiple {gamma}-ray coincident events were accumulated. By selecting full cascade events from the capture state to the ground state, we have developed a new computer-based level construction method and it is applied to excited level assignment in {sup 63}Ni.
Multiwavelength Opportunities for GeV and TeV Telescopes
NASA Technical Reports Server (NTRS)
Thompson, David J.
2010-01-01
With AGILE and Fermi now in orbit and TeV telescopes continuing to improve their performance, a variety of multiwavelength opportunities is increasingly available. One goal of such programs is to take advantage of the complementary capabilities of the two types of telescopes: the wide field surveys of the satellite detectors and the high sensitivity and resolution of the ground-based telescopes. Some aspects of these multiwavelength efforts will be carried out in near-real-time but must be anticipated with advance preparation. These include gamma-ray burst follow-ups and flare campaigns. Other projects such as long-term variability studies and gammaray source identification require deep observations and cooperative work with astrophysicists at longer wavelengths, along with the theoretical studies that tie the observations together.
Status of the prototype Pulsed Photonuclear Assessment (PPA) inspection system
NASA Astrophysics Data System (ADS)
Jones, James L.; Blackburn, Brandon W.; Norman, Daren R.; Watson, Scott M.; Haskell, Kevin J.; Johnson, James T.; Hunt, Alan W.; Harmon, Frank; Moss, Calvin
2007-08-01
The Idaho National Laboratory, in collaboration with Idaho State University's Idaho Accelerator Center and the Los Alamos National Laboratory, continues to develop the Pulsed Photonuclear Assessment (PPA) technique for shielded nuclear material detection in large volume configurations, such as cargo containers. In recent years, the Department of Homeland Security has supported the development of a prototype PPA cargo inspection system. This PPA system integrates novel neutron and gamma-ray detectors for nuclear material detection along with a complementary and unique gray scale, density mapping component for significant shield material detection. This paper will present the developmental status of the prototype system, its detection performance using several INL Calibration Pallets, and planned enhancements to further increase its nuclear material detection capability.
Lee, S H; Jo, S H; Lee, S M; Koh, H J; Song, H; Park, J W; Lee, W H; Huh, T L
2004-09-01
To investigate the regulation of NADPH-producing isocitrate dehydrogenase (ICDH) in cytosol (IDPc) and mitochondria (IDPm) upon gamma-ray irradiation, and the roles of IDPc and IDPm in the protection against cellular damage induced by gamma-ray irradiation. Changes of IDPc and IDPm proteins upon gamma-ray irradiation to NIH3T3 cells were analysed by immunoblotting. To increase or decrease the expression of IDPc or IDPm, NIH3T3 cells were stably transfected with mouse IDPc or IDPm cDNA in either the sense or the antisense direction. The transfected cells with either increased or decreased IDPc or IDPm were exposed to gamma-rays, and the levels of reactive oxygen species generation, protein oxidation and lipid peroxidation were measured. Both IDPc and IDPm activities were induced by gamma-ray in NIH3T3 cells. Cells with decreased expression of IDPc or IDPm had elevated reactive oxygen species generation, lipid peroxidation and protein oxidation. Conversely, overproduction of IDPc or IDPm protein partially protected the cells from oxidative damage induced by gamma-ray irradiation. The protective role of IDPc and IDPm against gamma-ray-induced cellular damage can be attributed to elevated NADPH, reducing equivalents needed for recycling reduced glutathione in the cytosol and mitochondria. Thus, a primary biological function of the ICDHs may be production of NADPH, which is a prerequisite for some cellular defence systems against oxidative damage.
NASA Astrophysics Data System (ADS)
Wunderer, Cornelia B.; GRI Collaboration
2008-03-01
Observations of the gamma-ray sky reveal the most powerful sources and the most violent events in the Universe. While at lower wavebands the observed emission is generally dominated by thermal processes, the gamma-ray sky provides us with a view on the non-thermal Universe. Here particles are accelerated to extreme relativistic energies by mechanisms which are still poorly understood, and nuclear reactions are synthesizing the basic constituents of our world. Cosmic accelerators and cosmic explosions are major science themes that are addressed in the gamma-ray regime. ESA's INTEGRAL observatory currently provides the astronomical community with a unique tool to investigate the sky up to MeV energies and hundreds of sources, new classes of objects, extraordinary views of antimatter annihilation in our Galaxy, and fingerprints of recent nucleosynthesis processes have been discovered. NASA's GLAST mission will similarly take the next step in surveying the high-energy ( GeV) sky, and NuSTAR will pioneer focusing observations at hard X-ray energies (to 80 keV). There will be clearly a growing need to perform deeper, more focused investigations of gamma-ray sources in the 100-keV to MeV regime. Recent technological advances in the domain of gamma-ray focusing using Laue diffraction and multilayer-coated mirror techniques have paved the way towards a gamma-ray mission, providing major improvements compared to past missions regarding sensitivity and angular resolution. Such a future Gamma-Ray Imager will allow the study of particle acceleration processes and explosion physics in unprecedented detail, providing essential clues on the innermost nature of the most violent and most energetic processes in the Universe.
NASA Technical Reports Server (NTRS)
1991-01-01
This photograph shows the Compton Gamma-Ray Observatory (GRO) being deployed by the Remote Manipulator System (RMS) arm aboard the Space Shuttle Atlantis during the STS-37 mission in April 1991. The GRO reentered Earth atmosphere and ended its successful mission in June 2000. For nearly 9 years, the GRO Burst and Transient Source Experiment (BATSE), designed and built by the Marshall Space Flight Center (MSFC), kept an unblinking watch on the universe to alert scientists to the invisible, mysterious gamma-ray bursts that had puzzled them for decades. By studying gamma-rays from objects like black holes, pulsars, quasars, neutron stars, and other exotic objects, scientists could discover clues to the birth, evolution, and death of stars, galaxies, and the universe. The gamma-ray instrument was one of four major science instruments aboard the Compton. It consisted of eight detectors, or modules, located at each corner of the rectangular satellite to simultaneously scan the entire universe for bursts of gamma-rays ranging in duration from fractions of a second to minutes. In January 1999, the instrument, via the Internet, cued a computer-controlled telescope at Las Alamos National Laboratory in Los Alamos, New Mexico, within 20 seconds of registering a burst. With this capability, the gamma-ray experiment came to serve as a gamma-ray burst alert for the Hubble Space Telescope, the Chandra X-Ray Observatory, and major gound-based observatories around the world. Thirty-seven universities, observatories, and NASA centers in 19 states, and 11 more institutions in Europe and Russia, participated in the BATSE science program.
Universal energy spectrum from point sources
NASA Technical Reports Server (NTRS)
Tomozawa, Yukio
1992-01-01
The suggestion is made that the energy spectrum from point sources such as galactic black hole candidates (GBHC) and active galactic nuclei (AGN) is universal on the average, irrespective of the species of the emitted particles, photons, nucleons, or others. The similarity between the observed energy spectra of cosmic rays, gamma-rays, and X-rays is discussed. In other words, the existing data for gamma-rays and X-rays seem to support the prediction. The expected data from the Gamma Ray Observatory are to provide a further test.
The EGRET high energy gamma ray telescope
NASA Technical Reports Server (NTRS)
Hartman, R. C.; Bertsch, D. L.; Fichtel, C. E.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.; Mayer-Hasselwander, H. A.
1992-01-01
The Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (GRO) is sensitive in the energy range from about 20 MeV to about 30,000 MeV. Electron-positron pair production by incident gamma photons is utilized as the detection mechanism. The pair production occurs in tantalum foils interleaved with the layers of a digital spark chamber system; the spark chamber records the tracks of the electron and positron, allowing the reconstruction of the arrival direction of the gamma ray. If there is no signal from the charged particle anticoincidence detector which surrounds the upper part of the detector, the spark chamber array is triggered by two hodoscopes of plastic scintillators. A time of flight requirement is included to reject events moving backward through the telescope. The energy of the gamma ray is primarily determined by absorption of the energies of the electron and positron in a 20 cm deep NaI(Tl) scintillator.
The EGRET high energy gamma ray telescope
NASA Astrophysics Data System (ADS)
Hartman, R. C.; Bertsch, D. L.; Fichtel, C. E.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.; Mayer-Hasselwander, H. A.; Michelson, P. F.; von Montigny, C.; Nolan, P. L.; Pinkau, K.; Rothermel, H.; Schneid, E.; Sommer, M.; Sreekumar, P.; Thompson, D. J.
1992-02-01
The Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (GRO) is sensitive in the energy range from about 20 MeV to about 30,000 MeV. Electron-positron pair production by incident gamma photons is utilized as the detection mechanism. The pair production occurs in tantalum foils interleaved with the layers of a digital spark chamber system; the spark chamber records the tracks of the electron and positron, allowing the reconstruction of the arrival direction of the gamma ray. If there is no signal from the charged particle anticoincidence detector which surrounds the upper part of the detector, the spark chamber array is triggered by two hodoscopes of plastic scintillators. A time of flight requirement is included to reject events moving backward through the telescope. The energy of the gamma ray is primarily determined by absorption of the energies of the electron and positron in a 20 cm deep NaI(Tl) scintillator.
Measured neutron and gamma spectra from californium-252 in a tissue-equivalent medium.
Elson, H R; Stupar, T A; Shapiro, A; Kereiakes, J G
1979-01-01
A method of experimentally obtaining both neutron and gamma-ray spectra in a scattering medium is described. The method utilizes a liquid-organic scintillator (NE-213) coupled with a pulse-shape discrimination circuit. This allows the separation of the neutron-induced pulse-height data from the gamma-ray pulse-height data. Using mathematical unfolding techniques, the two sets of pulse-height data were transformed to obtain the neutron and gamma-ray energy spectra. A small spherical detector was designed and constructed to reduce the errors incurred by attempting spectral measurements in a scattering medium. Demonstration of the utility of the system to obtain the neutron and gamma-ray spectra in a scattering medium was performed by characterizing the neutron and gamma-ray spectra at various sites about a 3.7-microgram (1.5 cm active length) californium-252 source in a tissue-equivalent medium.
NASA Technical Reports Server (NTRS)
Lockwood, J. A.; Webber, W. R.; Friling, L. A.; Macri, J.; Hsieh, L.
1981-01-01
Balloon-borne measurements of the atmospheric and diffuse gamma-ray flux in the energy range 0.4-7.0 MeV with a Compton telescope, which included pulse-shape discrimination of the first scattering detector and a time-of-flight system between the first and second detector elements, are reported. Comparison of the diffuse cosmic gamma-ray flux to the atmospheric gamma rays indicates that 0.2-5.0 MeV is the optimum energy range for measurements made at the top of the earth's atmosphere. The measured total atmospheric gamma-ray flux between zero and 40 deg has an energy spectrum that agrees with the calculations of Ling (1975). Observations indicate that the ratio of the diffuse to atmospheric gamma ray fluxes at 3.5 g/sq cm is a maximum, about 1.0, between 0.7 and 3.0 MeV.
Abdo, A A; Ackermann, M; Ajello, M; Atwood, W B; Baldini, L; Ballet, J; Barbiellini, G; Bastieri, D; Baughman, B M; Bechtol, K; Bellazzini, R; Berenji, B; Blandford, R D; Bloom, E D; Bonamente, E; Borgland, A W; Bregeon, J; Brez, A; Brigida, M; Bruel, P; Burnett, T H; Buson, S; Caliandro, G A; Cameron, R A; Caraveo, P A; Casandjian, J M; Cavazzuti, E; Cecchi, C; Celik, O; Charles, E; Chekhtman, A; Cheung, C C; Chiang, J; Ciprini, S; Claus, R; Cohen-Tanugi, J; Cominsky, L R; Conrad, J; Cutini, S; Dermer, C D; de Angelis, A; de Palma, F; Digel, S W; Di Bernardo, G; do Couto e Silva, E; Drell, P S; Drlica-Wagner, A; Dubois, R; Dumora, D; Farnier, C; Favuzzi, C; Fegan, S J; Focke, W B; Fortin, P; Frailis, M; Fukazawa, Y; Funk, S; Fusco, P; Gaggero, D; Gargano, F; Gasparrini, D; Gehrels, N; Germani, S; Giebels, B; Giglietto, N; Giommi, P; Giordano, F; Glanzman, T; Godfrey, G; Grenier, I A; Grondin, M-H; Grove, J E; Guillemot, L; Guiriec, S; Gustafsson, M; Hanabata, Y; Harding, A K; Hayashida, M; Hughes, R E; Itoh, R; Jackson, M S; Jóhannesson, G; Johnson, A S; Johnson, R P; Johnson, T J; Johnson, W N; Kamae, T; Katagiri, H; Kataoka, J; Kawai, N; Kerr, M; Knödlseder, J; Kocian, M L; Kuehn, F; Kuss, M; Lande, J; Latronico, L; Lemoine-Goumard, M; Longo, F; Loparco, F; Lott, B; Lovellette, M N; Lubrano, P; Madejski, G M; Makeev, A; Mazziotta, M N; McConville, W; McEnery, J E; Meurer, C; Michelson, P F; Mitthumsiri, W; Mizuno, T; Moiseev, A A; Monte, C; Monzani, M E; Morselli, A; Moskalenko, I V; Murgia, S; Nolan, P L; Norris, J P; Nuss, E; Ohsugi, T; Omodei, N; Orlando, E; Ormes, J F; Paneque, D; Panetta, J H; Parent, D; Pelassa, V; Pepe, M; Pesce-Rollins, M; Piron, F; Porter, T A; Rainò, S; Rando, R; Razzano, M; Reimer, A; Reimer, O; Reposeur, T; Ritz, S; Rochester, L S; Rodriguez, A Y; Roth, M; Ryde, F; Sadrozinski, H F-W; Sanchez, D; Sander, A; Saz Parkinson, P M; Scargle, J D; Sellerholm, A; Sgrò, C; Shaw, M S; Siskind, E J; Smith, D A; Smith, P D; Spandre, G; Spinelli, P; Starck, J-L; Strickman, M S; Strong, A W; Suson, D J; Tajima, H; Takahashi, H; Takahashi, T; Tanaka, T; Thayer, J B; Thayer, J G; Thompson, D J; Tibaldo, L; Torres, D F; Tosti, G; Tramacere, A; Uchiyama, Y; Usher, T L; Vasileiou, V; Vilchez, N; Vitale, V; Waite, A P; Wang, P; Winer, B L; Wood, K S; Ylinen, T; Ziegler, M
2010-03-12
We report on the first Fermi Large Area Telescope (LAT) measurements of the so-called "extragalactic" diffuse gamma-ray emission (EGB). This component of the diffuse gamma-ray emission is generally considered to have an isotropic or nearly isotropic distribution on the sky with diverse contributions discussed in the literature. The derivation of the EGB is based on detailed modeling of the bright foreground diffuse Galactic gamma-ray emission, the detected LAT sources, and the solar gamma-ray emission. We find the spectrum of the EGB is consistent with a power law with a differential spectral index gamma = 2.41 +/- 0.05 and intensity I(>100 MeV) = (1.03 +/- 0.17) x 10(-5) cm(-2) s(-1) sr(-1), where the error is systematics dominated. Our EGB spectrum is featureless, less intense, and softer than that derived from EGRET data.
The mini-calorimeter of the AGILE satellite
NASA Astrophysics Data System (ADS)
Labanti, C.; Marisaldi, M.; Fuschino, F.; Galli, M.; Argan, A.; Bulgarelli, A.; Costa, E.; Di Cocco, G.; Gianotti, F.; Tavani, M.; Trifoglio, M.
2006-06-01
AGILE is a small space mission of the Italian Space Agency (ASI) devoted to astrophysics in the gamma-ray energy range 30 MeV - 50 GeV, and in the X-ray band 15 keV - 45 keV. The AGILE Payload is composed of three instruments: a gamma-ray imager based on a Tungsten-Silicon Tracker (ST), for observations in the gamma ray energy range 30 MeV - 50 GeV, a Silicon based X-ray detector, Super-Agile (SA), for imaging in the range 15 keV - 40 keV and a CsI(Tl) Mini-Calorimeter (MCAL) that detects gamma rays or particle energy deposits between 300 keV and 200 MeV. The payload is currently fully integrated and the satellite is expected to be launched in the second half of 2006. MCAL is composed of 30 CsI(Tl) scintillator detectors with the shape of a bar with photodiode readout at both ends, arranged in two orthogonal layers. MCAL can work both as a slave of the ST and as an independent gamma-ray detector for the detection of transients and Gamma Ray Bursts. In this paper a detailed description of MCAL is presented together with the first on ground calibration results.
Multiwavelength Studies of the Peculiar Gamma-ray Source 3EG J1835+5918
NASA Technical Reports Server (NTRS)
Reimer, O.; Brazier, K. T. S.; Carraminana, A.; Kanbach, G.; Nolan, P. L.; Thompson, D. J.
1999-01-01
The source 3EG J1835+5918 was discovered early in the CGRO (Compton Gamma Ray Observatory) mission by EGRET as a bright unidentified gamma-ray source outside the galactic plane. Especially remarkable, it has not been possible to identify this object with any known counterpart in any other wavelengths band since then. Analyzing our recent ROSAT HRI observation, for the first time we are able to suggest X-ray counterparts of 3EG J1835+5918. The discovered X-ray sources were subject of deep optical investigations in order to reveal their nature and conclude on the possibility of being counterparts for this peculiar gamma-ray source.
NASA Technical Reports Server (NTRS)
2012-01-01
We present time-resolved broad-band observations of the quasar 3C 279 obtained from multiwavelength campaigns conducted during the first two years of the Fermi Gamma-ray Space Telescope mission. While investigating the previously reported gamma-ray/optical flare accompanied by a change in optical polarization, we found that the optical emission appears delayed with respect to the gamma-ray emission by about 10 days. X-ray observations reveal a pair of 'isolated' flares separated. by approx. 90 days, with only weak gamma-ray/optical counterparts. The spectral structure measured by Spitzer reveals a synchrotron component peaking in the mid-infrared band with a sharp break at the far-infrared band during the gamma-ray flare, while the peak appears in the mm/sub-mm band in the low state. Selected spectral energy distributions are fitted with leptonic models including Comptonization of external radiation produced in a dusty torus or the broad-line region. Adopting the interpretation of the polarization swing involving propagation of the emitting region along a curved trajectory, we can explain the evolution of the broad-band spectra during the gamma-ray flaring event by a shift of its location from approx. 1 pc to approx. 4 pc from the central black hole. On the other hand, if the gamma-ray flare is generated instead at sub-pc distance from the central black hole, the far-infrared break can be explained by synchrotron self-absorption. We also model the low spectral state, dominated by the mm/sub-mm peaking synchrotron component, and suggest that the corresponding inverse-Compton component explains the steady X-ray emission.
Microphysics in the Gamma-Ray Burst Central Engine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Janiuk, Agnieszka, E-mail: agnes@cft.edu.pl
We calculate the structure and evolution of a gamma-ray burst central engine where an accreting torus has formed around the newly born black hole. We study the general relativistic, MHD models and we self-consistently incorporate the nuclear equation of state. The latter accounts for the degeneracy of relativistic electrons, protons, and neutrons, and is used in the dynamical simulation, instead of a standard polytropic γ -law. The EOS provides the conditions for the nuclear pressure in the function of density and temperature, which evolve with time according to the conservative MHD scheme. We analyze the structure of the torus andmore » outflowing winds, and compute the neutrino flux emitted through the nuclear reaction balance in the dense and hot matter. We also estimate the rate of transfer of the black-hole rotational energy to the bipolar jets. Finally, we elaborate on the nucleosynthesis of heavy elements in the accretion flow and the wind, through computations of the thermonuclear reaction network. We discuss the possible signatures of the radioactive element decay in the accretion flow. We suggest that further detailed modeling of the accretion flow in the GRB engine, together with its microphysics, may be a valuable tool to constrain the black-hole mass and spin. It can be complementary to the gravitational wave analysis if the waves are detected with an electromagnetic counterpart.« less
Enhanced high-energy gamma-ray emission from the microquasar Cygnus X-3 detected by Fermi/LAT
NASA Astrophysics Data System (ADS)
Loh, Alan; Corbel, Stephane
2017-02-01
Following the recent decrease of the hard X-ray emission from the high-mass X-ray binary Cygnus X-3 as seen by the Swift/Burst Alert Telescope (https://swift.gsfc.nasa.gov/results/transients/CygX-3/), the Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed significant gamma-ray emission originating from the microquasar.
Exploring the nature of the unidentified very-high-energy gamma-ray source HESS J1507-622
NASA Astrophysics Data System (ADS)
Domainko, W.; Ohm, S.
2012-09-01
Context. Several extended sources of very-high-energy (VHE; E > 100 GeV) gamma rays have been found that lack counterparts belonging to an established class of VHE gamma-ray emitters. Aims: The nature of the first unidentified VHE gamma-ray source with significant angular offset from the Galactic plane of 3.5°, HESS J1507-622, is explored. Methods.Fermi-LAT data in the high-energy (HE, 100 MeV < E < 100 GeV) gamma-ray range collected over 34 month are used to describe the spectral energy distribution (SED) of the source. Additionally, implications of the off-plane location of the source for a leptonic and hadronic gamma-ray emission model are investigated. Results: HESS J1507-622 is detected in the Fermi energy range and its spectrum is best described by a power law in energy with Γ = 1.7 ± 0.1stat ± 0.2sys and integral flux between (0.3-300) GeV of F = (2.0 ± 0.5stat ± 1.0sys) × 10-9 cm-2 s-1. The SED constructed from the Fermi and H.E.S.S. data for this source does not support a smooth power-law continuation from the VHE to the HE gamma-ray range. With the available data it is not possible to discriminate between a hadronic and a leptonic scenario for HESS J1507-622. The location and compactness of the source indicate a considerable physical offset from the Galactic plane for this object. In case of a multiple-kpc distance, this challenges a pulsar wind nebula (PWN) origin for HESS J1507-622 since the time of travel for a pulsar born in the Galactic disk to reach such a location would exceed the inverse Compton (IC) cooling time of electrons that are energetic enough to produce VHE gamma-rays. However, an origin of this gamma-ray source connected to a pulsar that was born off the Galactic plane in the explosion of a hypervelocity star cannot be excluded. Conclusions: The nature of HESS J1507-622 is still unknown to date, and a PWN scenario cannot be ruled out in general. On the contrary HESS J1507-622 could be the first discovered representative of a population of spatially extended VHE gamma-ray emitters with HE gamma-ray counterpart that are located at considerable offsets from the Galactic plane. Future surveys in the VHE gamma-ray range are necessary to probe the presence or absence of such a source population.
Liu, Juntao; Zhang, Feng; Wang, Xinguang; Han, Fei; Yuan, Zhelong
2014-12-01
Formation porosity can be determined using the boron capture gamma ray counting ratio with a near to far detector in a pulsed neutron-gamma element logging tool. The thermal neutron distribution, boron capture gamma spectroscopy and porosity response for formations with different water salinity and wellbore diameter characteristics were simulated using the Monte Carlo method. We found that a boron lining improves the signal-to-noise ratio and that the boron capture gamma ray counting ratio has a higher sensitivity for determining porosity than total capture gamma. Copyright © 2014 Elsevier Ltd. All rights reserved.
SU-G-IeP4-12: Performance of In-111 Coincident Gamma-Ray Counting: A Monte Carlo Simulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pahlka, R; Kappadath, S; Mawlawi, O
2016-06-15
Purpose: The decay of In-111 results in a non-isotropic gamma-ray cascade, which is normally imaged using a gamma camera. Creating images with a gamma camera using coincident gamma-rays from In-111 has not been previously studied. Our objective was to explore the feasibility of imaging this cascade as coincidence events and to determine the optimal timing resolution and source activity using Monte Carlo simulations. Methods: GEANT4 was used to simulate the decay of the In-111 nucleus and to model the gamma camera. Each photon emission was assigned a timestamp, and the time delay and angular separation for the second gamma-ray inmore » the cascade was consistent with the known intermediate state half-life of 85ns. The gamma-rays are transported through a model of a Siemens dual head Symbia “S” gamma camera with a 5/8-inch thick crystal and medium energy collimators. A true coincident event was defined as a single 171keV gamma-ray followed by a single 245keV gamma-ray within a specified time window (or vice versa). Several source activities (ranging from 10uCi to 5mCi) with and without incorporation of background counts were then simulated. Each simulation was analyzed using varying time windows to assess random events. The noise equivalent count rate (NECR) was computed based on the number of true and random counts for each combination of activity and time window. No scatter events were assumed since sources were simulated in air. Results: As expected, increasing the timing window increased the total number of observed coincidences albeit at the expense of true coincidences. A timing window range of 200–500ns maximizes the NECR at clinically-used source activities. The background rate did not significantly alter the maximum NECR. Conclusion: This work suggests coincident measurements of In-111 gamma-ray decay can be performed with commercial gamma cameras at clinically-relevant activities. Work is ongoing to assess useful clinical applications.« less
Flash-Bang Detector to Model the Attenuation of High-Energy Photons
NASA Astrophysics Data System (ADS)
Pagsanjan, N., III; Kelley, N. A.; Smith, D. M.; Sample, J. G.
2015-12-01
It has been known for years that lightning and thunderstorms produce gamma rays and x-rays. Terrestrial gamma-ray flashes (TGFs) are extremely bright bursts of gamma rays originating from thunderstorms. X-ray stepped leaders are bursts of x-rays coming from the lightning channel. It is known that the attenuation of these high-energy photons is a function of distance, losing energy and intensity at larger distances. To complement gamma-ray detectors on the ground it would be useful to measure the distance to the flash. Knowing the distance would allow for the true source fluence of gamma rays or x-rays to be modeled. A flash-bang detector, which uses a micro-controller, a photodiode, a microphone and temperature sensor will be able to detect the times at which lightning and thunder occurs. Knowing the speed of sound as function of temperature and the time difference between the flash and the thunder, the range to the lightning can be calculated. We will present the design of our detector as well as some preliminary laboratory test results.
High-resolution radio and X-ray observations of the supernova remnant W28
NASA Technical Reports Server (NTRS)
Andrews, M. D.; Basart, J. P.; Lamb, R. C.; Becker, R. H.
1983-01-01
The present study has the objective to report the first high resolution radio and X-ray observations of the central part of the galactic supernova remnant, W28, taking into account the possible association of the remnant with the unidentified gamma-ray source, 2CG 006-00. This gamma-ray source is approximately two-thirds as bright as the Crab pulsar above 100 MeV, and has a somewhat flatter spectrum. Both the radio and X-ray observations reveal previously unknown aspects of W28 which support the possibility of W28 being a gamma-ray source. The radio data show a flat-spectrum, nonthermal component reminiscent of the Crab Nebula and Vela, both of which are confirmed gamma-ray sources. The X-ray observations reveal a compact source within W28, again suggestive of both the Crab and Vela. If the similarities among W28, the Crab Nebula, and the Vela remnant are valid, the gamma-ray source 2CG 00-00 should be studied for periodicity, the conclusive signature of a compact source of emission.
Simultaneous CT and SPECT tomography using CZT detectors
Paulus, Michael J.; Sari-Sarraf, Hamed; Simpson, Michael L.; Britton, Jr., Charles L.
2002-01-01
A method for simultaneous transmission x-ray computed tomography (CT) and single photon emission tomography (SPECT) comprises the steps of: injecting a subject with a tracer compound tagged with a .gamma.-ray emitting nuclide; directing an x-ray source toward the subject; rotating the x-ray source around the subject; emitting x-rays during the rotating step; rotating a cadmium zinc telluride (CZT) two-sided detector on an opposite side of the subject from the source; simultaneously detecting the position and energy of each pulsed x-ray and each emitted .gamma.-ray captured by the CZT detector; recording data for each position and each energy of each the captured x-ray and .gamma.-ray; and, creating CT and SPECT images from the recorded data. The transmitted energy levels of the x-rays lower are biased lower than energy levels of the .gamma.-rays. The x-ray source is operated in a continuous mode. The method can be implemented at ambient temperatures.
Gamma Ray Astrophysics: New insight into the universe
NASA Technical Reports Server (NTRS)
Fichtel, C. E.; Trombka, J. I.
1981-01-01
Gamma ray observations of the solar system, the galaxy and extragalactic radiation are reported. Topics include: planets, comets, and asteroids; solar observations; interstellar medium and galactic structure; compact objects; cosmology; and diffuse radiation. The instrumentation used in gamma ray astronomy in covered along with techniques for the analysis of observational spectra.
A New View of the High Energy Gamma-ray Sky with the Fermi Gamma-Ray Space Telescope
NASA Technical Reports Server (NTRS)
McEnery, Julie
2010-01-01
This slide presentation reviews some of the findings that have been made possible by the use of the Fermi Gamma-ray Space Telescope. It describes the current status of the Fermi Telescope and reviews some of the science highlights.
Gammapy: Python toolbox for gamma-ray astronomy
NASA Astrophysics Data System (ADS)
Deil, Christoph; Donath, Axel; Owen, Ellis; Terrier, Regis; Bühler, Rolf; Armstrong, Thomas
2017-11-01
Gammapy analyzes gamma-ray data and creates sky images, spectra and lightcurves, from event lists and instrument response information; it can also determine the position, morphology and spectra of gamma-ray sources. It is used to analyze data from H.E.S.S., Fermi-LAT, and the Cherenkov Telescope Array (CTA).
Evaluation of electronic logging and gamma ray device for bridge boring interpretation.
DOT National Transportation Integrated Search
1971-07-01
Since shallow electric logging devices and gamma ray devices (for use in holes of less than 200 feet in depth) have recently been developed, it was the aim of this work to ascertain if correlation between electric logs and/or gamma ray logs and known...
Gamma-ray burst spectroscopy capabilities of the BATSE/GRO experiment
NASA Technical Reports Server (NTRS)
Matteson, J. L.; Fishman, G. J.; Meegan, C. A.; Parnell, T. A.; Wilson, R. B.; Paciesas, W.; Cline, T. L.; Teegarden, B. J.
1985-01-01
A scintillation spectrometer is included in each of the eight BATSE/GRO detector modules, resulting in all-sky coverage for gamma-ray bursts. The scientific motivation, design and capabilities of these spectrometers for performing spectral observations over a wide range of gamma-ray energies and burst intensities are described.
Pair Production and Gamma-Ray Emission in the Outer Magnetospheres of Rapidly Spinning Young Pulsars
NASA Technical Reports Server (NTRS)
Ruderman, Malvin; Chen, Kaiyou
1997-01-01
Electron-positron pair production and acceleration in the outer magnetosphere may be crucial for a young rapidly spinning canonical pulsar to be a strong Gamma-ray emitter. Collision between curvature radiated GeV photons and soft X-ray photons seems to be the only efficient pair production mechanism. For Crib-like pulsars, the magnetic field near the light cylinder is so strong, such that the synchrotron radiation of secondary pairs will be in the needed X-ray range. However, for majority of the known Gamma-ray pulsars, surface emitted X-rays seem to work as the matches and fuels for a gamma-ray generation fireball in the outer magnetosphere. The needed X-rays could come from thermal emission of a cooling neutron star or could be the heat generated by bombardment of the polar cap by energetic particles generated in the outer magnetosphere. With detection of more Gamma-ray pulsars, it is becoming evident that the neutron star's intrisic geometry (the inclination angle between the rotation and magnetic axes) and observational geometry (the viewing angle with respect to the rotation axis) are crucial to the understanding of varieties of observational properties exhibited by these pulsars. Inclination angles for many known high energy Gamma-ray pulsars appear to be large and the distribution seems to be consistent with random orientation. However, all of them except Geminga are pre-selected from known radio pulsars. The viewing angles are thus limited to be around the respective inclination angles for beamed radio emission, which may induce strong selection effect. The viewing angles as well as the inclination angles of PSR 1509-58 and PSB 0656+14 may be small such that most of the high energy Gamma-rays produced in the outer accelerators may not reach the observer's direction. The observed Gamma-rays below 5 MeV from this pulsar may be synchrotron radiation of secondary electron-positron pairs produced outside the accelerating regions.
Analysis of the COS B data for evidence of linear polarization of VELA pulsar gamma rays
NASA Astrophysics Data System (ADS)
Mattox, John R.; Mayer-Hasselwander, Hans A.; Strong, Andy W.
1990-11-01
The COS B spark chamber telescope observations of the Vela pulsar were analyzed for gamma-ray polarization. No significant quadrupole moment is found in the azimuthal distribution of the electron-positron pair production planes. However, analysis of the sensitivity indicates that even 100-percent polarization would not be detected. Therefore, the null result does not constrain the polarization of the Vela pulsar gamma-ray emission. This result contradicts the report of Caraveo et al. (1988) of possible evidence for polarization of the Vela pulsar gamma rays.
Electronic considerations for externally segmented germanium detectors
NASA Technical Reports Server (NTRS)
Madden, N. W.; Landis, D. A.; Goulding, F. S.; Pehl, R. H.; Cork, C. P.; Luke, P. N.; Malone, D. F.; Pollard, M. J.
1991-01-01
The dominant background source for germanium gamma ray detector spectrometers used for some astrophysics observations is internal beta decay. Externally segmented germanium gamma ray coaxial detectors can identify beta decay by localizing the event. Energetic gamma rays interact in the germanium detector by multiple Compton interactions while beta decay is a local process. In order to recognize the difference between gamma rays and beta decay events, the external electrode (outside of detector) is electrically partitioned. The instrumentation of these external segments and the consequence with respect to the spectrometer energy signal is examined.
NASA Astrophysics Data System (ADS)
Cramer, S. N.; Roussin, R. W.
1981-11-01
A Monte Carlo analysis of a time-dependent neutron and secondary gamma-ray integral experiment on a thick concrete and steel shield is presented. The energy range covered in the analysis is 15-2 MeV for neutron source energies. The multigroup MORSE code was used with the VITAMIN C 171-36 neutron-gamma-ray cross-section data set. Both neutron and gamma-ray count rates and unfolded energy spectra are presented and compared, with good general agreement, with experimental results.
GRIS observations of Al-26 gamma-ray line emission from two points in the Galactic plane
NASA Technical Reports Server (NTRS)
Teegarden, B. J.; Barthelmy, S. D.; Gehrels, N.; Tueller, J.; Leventhal, M.
1991-01-01
Both of the Gamma-Ray Imaging Spectrometer (GRIS) experiment's two observations of the Galactic center region, at l = zero and 335 deg respectively, detected Al-26 gamma-ray line emission. While these observations are consistent with the assumed high-energy gamma-ray distribution, they are consistent with other distributions as well. The data suggest that the Al-26 emission is distributed over Galactic longitude rather than being confined to a point source. The GRIS data also indicate that the 1809 keV line is broadened.
Process and apparatus for detecting presence of plant substances
Kirby, John A.
1991-01-01
An apparatus and process for detecting the presence of plant substances in a particular environment which comprises the steps of: measuring the background K40 gamma ray radiation level in a particular environment with a 1.46 MeV gamma ray counter system; measuring the amount of K40 gamma ray radiation emanating from a package containing a plant substance being passed through an environment with a counter; and generating an alarm signal when the total K40 gamma ray radiation reaches a predetermined level over and above the background level.
Gamma-ray background induced by atmospheric neutrons
NASA Astrophysics Data System (ADS)
Ma, Y.-Q.
1984-03-01
A small piggyback detector system is used to study the reduction of gamma-ray background induced by atmospheric neutrons in the type of actively shielded gamma-ray spectroscopes. The system consists of two 1.5 x 1.5 arcsec NaI crystal units, one of which is surrounded by some neutron shield material. The results of a balloon flight in 1981 are presented. The data show that a shield of 3 cm-thick pure paraffin cannot reduce the gamma-ray background. On the contrary, it may even cause some enhancement.
A Search for Microsecond Gamma Ray Bursts From Primordial Black Holes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frank Krennrich
2004-08-12
The project is called SGARFACE (Short Gamma Ray Front Air Cherenkov Experiment) and is an atmospheric Cherenkov detector to provide sensitivity to short bursts of gamma rays of extraterrestrial origin. The detector is an addition to the Whipple 10m gamma ray telescope on Mt. Hopkins in southern Arizona and uses a digital trigger module for recognizing Cherenkov light flashes from gamma ray bursts. The digital trigger modules have been designed, tested and constructed at Iowa State University and have been installed at the Whipple 10m telescope. Operation of the experiment started in March 2003 and data collecting will likely continuemore » until spring of 2005. A final results paper addressing a search for primordial black holes is likely to be finished by summer of 2005.« less
Prompt Optical Observations of Gamma-Ray Bursts
NASA Astrophysics Data System (ADS)
Akerlof, Carl; Balsano, Richard; Barthelmy, Scott; Bloch, Jeff; Butterworth, Paul; Casperson, Don; Cline, Tom; Fletcher, Sandra; Frontera, Fillippo; Gisler, Galen; Heise, John; Hills, Jack; Hurley, Kevin; Kehoe, Robert; Lee, Brian; Marshall, Stuart; McKay, Tim; Pawl, Andrew; Piro, Luigi; Szymanski, John; Wren, Jim
2000-03-01
The Robotic Optical Transient Search Experiment (ROTSE) seeks to measure simultaneous and early afterglow optical emission from gamma-ray bursts (GRBs). A search for optical counterparts to six GRBs with localization errors of 1 deg2 or better produced no detections. The earliest limiting sensitivity is mROTSE>13.1 at 10.85 s (5 s exposure) after the gamma-ray rise, and the best limit is mROTSE>16.0 at 62 minutes (897 s exposure). These are the most stringent limits obtained for the GRB optical counterpart brightness in the first hour after the burst. Consideration of the gamma-ray fluence and peak flux for these bursts and for GRB 990123 indicates that there is not a strong positive correlation between optical flux and gamma-ray emission.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirotani, Kouichi, E-mail: hirotani@tiara.sinica.edu.tw
2011-06-01
The spectral characteristics of the pulsed gamma-ray emission from outer-magnetospheric particle accelerators are investigated. Either positrons or electrons are accelerated outward by the magnetic-field-aligned electric field to emit gamma rays via the curvature process. Since the particles move along relatively straight paths in the trailing side of a rotating magnetosphere, they attain higher Lorentz factors to emit more energetic gamma rays than those in the leading side. It is first demonstrated that the cutoff energy of the curvature radiation evolves with the rotation phase owing to the variation of the curvature radii of the particle paths and maximizes at amore » slightly later phase of the trailing peak in the gamma-ray light curve.« less
Gamma-Ray Upper Limits on Magnetars with Six Years of FERMI-LAT Observations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jian; Rea, Nanda; Torres, Diego F.
2017-01-16
In this article, we report on the search for gamma-ray emission from 20 magnetars using six years of Fermi Large Area Telescope observations. No significant evidence for gamma-ray emission from any of the currently known magnetars is found. We derived the most stringent upper limits to date on the 0.1–10 GeV emission of Galactic magnetars, which are estimated between ~10 -12 and 10 -11 erg s -1 cm -2. We searched gamma-ray pulsations for the four magnetars having reliable ephemerides over the observing period, but detected none. Finally, we also report updated morphologies and spectral properties of seven spatially extendedmore » gamma-ray sources, which are most likely attributed to supernova remnants associated with or adjacent to the magnetars.« less
Distribution of cosmic gamma rays in the galactic anticenter region as observed by SAS-2
NASA Technical Reports Server (NTRS)
Kniffen, D. A.; Fichtel, C. E.; Hartman, R. C.; Thompson, D. J.; Ozel, M. E.; Tumer, T.; Bignami, G. F.; Ogelman, H.
1975-01-01
The high energy (above 35 MeV) gamma ray telescope flown on the second Small Astronomy Satellite has collected over one thousand gamma rays from the direction of the galactic anticenter. In addition to the diffuse galactic emission the distribution indicates a strong pulsed contribution from the Crab nebula with the same period and phase as the NP0532 pulsar. There also seems to be an excess in the direction of (gal. long. ? 195 deg; gal. lat ? +5 deg) where there is a region containing old supernova remnants. Search for gamma ray pulsations from other pulsars in the region do not show any statistically significant signal. The general intensity distribution of the gamma rays away from the plane appear to be similar to nonthermal radio emission brightness contours.
New applications and developments in the neutron shielding
NASA Astrophysics Data System (ADS)
Uğur, Fatma Aysun
2017-09-01
Shielding neutrons involve three steps that are slowing neutrons, absorption of neutrons, and impregnation of gamma rays. Neutrons slow down with thermal energy by hydrogen, water, paraffin, plastic. Hydrogenated materials are also very effective for the absorption of neutrons. Gamma rays are produced by neutron (radiation) retention on the neutron shield, inelastic scattering, and degradation of activation products. If a source emits gamma rays at various energies, high-energy gamma rays sometimes specify shielding requirements. Multipurpose Materials for Neutron Shields; Concrete, especially with barium mixed in, can slow and absorb the neutrons, and shield the gamma rays. Plastic with boron is also a good multipurpose shielding material. In this study; new applications and developments in the area of neutron shielding will be discussed in terms of different materials.
Monte Carlo simulations of the gamma-ray exposure rates of common rocks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haber, Daniel A.; Malchow, Russell L.; Burnley, Pamela C.
Monte Carlo simulations have been performed to model the gamma ray emission and attenuation properties of common rocks. In geologic materials, 40K, 238U, and 232Th are responsible for most gamma ray production. If the concentration of these radioelements and attenuation factors such as degree of water saturation are known, an estimate of the gamma-ray exposure rate can be made. The results show that there are no significant differences in gamma-ray screening between major rock types. If the total number of radionuclide atoms are held constant then the major controlling factor is density of the rock. Finally, the thickness of regolithmore » or soil overlying rock can be estimated by modeling the exposure rate if the radionuclide contents of both materials are known.« less
Monte Carlo simulations of the gamma-ray exposure rates of common rocks
Haber, Daniel A.; Malchow, Russell L.; Burnley, Pamela C.
2016-11-24
Monte Carlo simulations have been performed to model the gamma ray emission and attenuation properties of common rocks. In geologic materials, 40K, 238U, and 232Th are responsible for most gamma ray production. If the concentration of these radioelements and attenuation factors such as degree of water saturation are known, an estimate of the gamma-ray exposure rate can be made. The results show that there are no significant differences in gamma-ray screening between major rock types. If the total number of radionuclide atoms are held constant then the major controlling factor is density of the rock. Lastly, the thickness of regolithmore » or soil overlying rock can be estimated by modeling the exposure rate if the radionuclide contents of both materials are known.« less
Monte Carlo simulations of the gamma-ray exposure rates of common rocks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haber, Daniel A.; Malchow, Russell L.; Burnley, Pamela C.
Monte Carlo simulations have been performed to model the gamma ray emission and attenuation properties of common rocks. In geologic materials, 40K, 238U, and 232Th are responsible for most gamma ray production. If the concentration of these radioelements and attenuation factors such as degree of water saturation are known, an estimate of the gamma-ray exposure rate can be made. The results show that there are no significant differences in gamma-ray screening between major rock types. If the total number of radionuclide atoms are held constant then the major controlling factor is density of the rock. Lastly, the thickness of regolithmore » or soil overlying rock can be estimated by modeling the exposure rate if the radionuclide contents of both materials are known.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ackermann, M.; Buehler, R.; Ajello, M.
2013-08-20
Gamma-ray binaries are stellar systems for which the spectral energy distribution (discounting the thermal stellar emission) peaks at high energies. Detected from radio to TeV gamma rays, the {gamma}-ray binary LS I +61 Degree-Sign 303 is highly variable across all frequencies. One aspect of this system's variability is the modulation of its emission with the timescale set by the {approx}26.4960 day orbital period. Here we show that, during the time of our observations, the {gamma}-ray emission of LS I +61 Degree-Sign 303 also presents a sinusoidal variability consistent with the previously known superorbital period of 1667 days. This modulation ismore » more prominently seen at orbital phases around apastron, whereas it does not introduce a visible change close to periastron. It is also found in the appearance and disappearance of variability at the orbital period in the power spectrum of the data. This behavior could be explained by a quasi-cyclical evolution of the equatorial outflow of the Be companion star, whose features influence the conditions for generating gamma rays. These findings open the possibility to use {gamma}-ray observations to study the outflows of massive stars in eccentric binary systems.« less
NASA Astrophysics Data System (ADS)
Tsuchiya, H.; Harada, H.; Koizumi, M.; Kitatani, F.; Takamine, J.; Kureta, M.; Iimura, H.
2013-11-01
Neutron resonance densitometry (NRD) has been proposed to quantify nuclear materials in melted fuel (MF) that will be removed from the Fukushima Daiichi nuclear power plant. The problem is complex due to the expected presence of strong neutron absorbing impurities such as 10B and high radiation field that is mainly caused by 137Cs. To identify the impurities under the high radiation field, NRD is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). We investigated with Geant4 the performance of a gamma-ray detector for NRCA in NRD. The gamma-ray detector has a well shape, consisting of cylindrical and tube type LaBr3 scintillators. We show how it measures 478 keV gamma rays derived from 10B(n, αγ) reaction in MF under a high 137Cs-radiation environment. It was found that the gamma-ray detector was able to well suppress the Compton edge of 662-keV gamma rays of 137Cs and had a high peak-to-Compton continuum ratio, by using the tube type scintillator as a back-catcher detector. Then, we demonstrate that with this ability, detection of 478-keV gamma rays from 10B is accomplished in realistic measuring time.
Dark Matter Limits from Dwarf Spheroidal Galaxies with the HAWC Gamma-Ray Observatory
NASA Astrophysics Data System (ADS)
Albert, A.; Alfaro, R.; Alvarez, C.; Álvarez, J. D.; Arceo, R.; Arteaga-Velázquez, J. C.; Avila Rojas, D.; Ayala Solares, H. A.; Bautista-Elivar, N.; Becerril, A.; Belmont-Moreno, E.; BenZvi, S. Y.; Bernal, A.; Braun, J.; Brisbois, C.; Caballero-Mora, K. S.; Capistrán, T.; Carramiñana, A.; Casanova, S.; Castillo, M.; Cotti, U.; Cotzomi, J.; Coutiño de León, S.; De León, C.; De la Fuente, E.; Diaz Hernandez, R.; Dingus, B. L.; DuVernois, M. A.; Díaz-Vélez, J. C.; Ellsworth, R. W.; Engel, K.; Fiorino, D. W.; Fraija, N.; García-González, J. A.; Garfias, F.; González, M. M.; Goodman, J. A.; Hampel-Arias, Z.; Harding, J. P.; Hernandez, S.; Hernandez-Almada, A.; Hona, B.; Hüntemeyer, P.; Iriarte, A.; Jardin-Blicq, A.; Joshi, V.; Kaufmann, S.; Kieda, D.; Lauer, R. J.; Lennarz, D.; León Vargas, H.; Linnemann, J. T.; Longinotti, A. L.; Longo Proper, M.; Raya, G. Luis; Luna-García, R.; López-Coto, R.; Malone, K.; Marinelli, S. S.; Martinez-Castellanos, I.; Martínez-Castro, J.; Martínez-Huerta, H.; Matthews, J. A.; Miranda-Romagnoli, P.; Moreno, E.; Mostafá, M.; Nellen, L.; Newbold, M.; Nisa, M. U.; Noriega-Papaqui, R.; Pelayo, R.; Pretz, J.; Pérez-Pérez, E. G.; Ren, Z.; Rho, C. D.; Rivière, C.; Rosa-González, D.; Rosenberg, M.; Ruiz-Velasco, E.; Salesa Greus, F.; Sandoval, A.; Schneider, M.; Schoorlemmer, H.; Sinnis, G.; Smith, A. J.; Springer, R. W.; Surajbali, P.; Taboada, I.; Tibolla, O.; Tollefson, K.; Torres, I.; Vianello, G.; Weisgarber, T.; Westerhoff, S.; Wood, J.; Yapici, T.; Younk, P. W.; Zhou, H.
2018-02-01
The High Altitude Water Cherenkov (HAWC) gamma-ray observatory is a wide field of view observatory sensitive to 500 GeV–100 TeV gamma-rays and cosmic rays. It can also perform diverse indirect searches for dark matter annihilation and decay. Among the most promising targets for the indirect detection of dark matter are dwarf spheroidal galaxies. These objects are expected to have few astrophysical sources of gamma-rays but high dark matter content, making them ideal candidates for an indirect dark matter detection with gamma-rays. Here we present individual limits on the annihilation cross section and decay lifetime for 15 dwarf spheroidal galaxies within the field of view, as well as their combined limit. These are the first limits on the annihilation cross section and decay lifetime using data collected with HAWC. We also present the HAWC flux upper limits of the 15 dwarf spheroidal galaxies in half-decade energy bins.
The bright optical flash and afterglow from the gamma-ray burst GRB 130427A.
Vestrand, W T; Wren, J A; Panaitescu, A; Wozniak, P R; Davis, H; Palmer, D M; Vianello, G; Omodei, N; Xiong, S; Briggs, M S; Elphick, M; Paciesas, W; Rosing, W
2014-01-03
The optical light generated simultaneously with x-rays and gamma rays during a gamma-ray burst (GRB) provides clues about the nature of the explosions that occur as massive stars collapse. We report on the bright optical flash and fading afterglow from powerful burst GRB 130427A. The optical and >100-megaelectron volt (MeV) gamma-ray flux show a close correlation during the first 7000 seconds, which is best explained by reverse shock emission cogenerated in the relativistic burst ejecta as it collides with surrounding material. At later times, optical observations show the emergence of emission generated by a forward shock traversing the circumburst environment. The link between optical afterglow and >100-MeV emission suggests that nearby early peaked afterglows will be the best candidates for studying gamma-ray emission at energies ranging from gigaelectron volts to teraelectron volts.
Relativistic electron avalanches as a thunderstorm discharge competing with lightning
NASA Astrophysics Data System (ADS)
Kelley, Nicole A.; Smith, David M.; Dwyer, Joseph R.; Splitt, Michael; Lazarus, Steven; Martinez-McKinney, Forest; Hazelton, Bryna; Grefenstette, Brian; Lowell, Alexander; Rassoul, Hamid K.
2015-08-01
Gamma-ray `glows' are long duration (seconds to tens of minutes) X-ray and gamma-ray emission coming from thunderclouds. Measurements suggest the presence of relativistic runaway electron avalanches (RREA), the same process underlying terrestrial gamma-ray flashes. Here we demonstrate that glows are relatively a common phenomena near the tops of thunderstorms, when compared with events such as terrestrial gamma-ray flashes. Examining the strongest glow measured by the airborne detector for energetic emissions, we show that this glow is measured near the end of a downward RREA, consistent with occurring between the upper positive charge layer and the negative screening layer above it. The glow discharges the upper positive layer by >=9.6 mA, strong enough to be an important charging mechanism of the storm. For this glow, the gamma-ray flux observed is close to the value at which relativistic feedback processes become important, with an avalanche multiplication factor of 4,500.
NASA Astrophysics Data System (ADS)
Bogomolov, A. V.; Dmitriev, A. V.; Myagkova, I. N.; Ryumin, S. P.; Smirnova, O. N.; Sobolevsky, I. M.
The spectra of neutrons > 10 MeV and gamma-rays 1.5-100 MeV under the Earth Radiation Belts, restored from the data, obtained onboard orbital complex ``SALUTE-7''-``KOSMOS-1686'', are presented. The spectra shapes are similar to those for albedo neutrons and gamma-rays, but absolute values of their fluxes (0.2 cm^-2 s^-1 for neutrons, 0.8 cm^-2 s^-1 for gamma-rays at the equator and 1.2 cm^-2 s^-1, 1.9 cm^-2 s^-1, accordingly, at L=1.9) are several times as large. It is possibly explained by the fact that most of the detected particles were produced by the cosmic ray interactions with the orbital complex matter. Neutron and gamma-ray fluxes obtained from ``CORONAS-I'' data are near those for albedo particles.
NASA Astrophysics Data System (ADS)
Kirillov, V. A.; Kuchuro, J. I.
2014-09-01
We have used EPR dosimetry on tooth enamel to show that the combined effect of x-rays with effective energy 34 keV and gamma radiation with average energy 1250 keV leads to a significant increase in the reconstructed absorbed dose compared with the applied dose from a gamma source or from an x-ray source or from both sources of electromagnetic radiation. In simulation experiments, we develop an approach to estimating the contribution of diagnostic x-rays to the exposure dose formed in the tooth enamel by the combined effect of x-rays and gamma radiation.
Search for gamma-rays from M31 and other extragalactic objects
NASA Technical Reports Server (NTRS)
Cawley, M. F.; Fegan, D. J.; Gibbs, K.; Gorham, P. W.; Lamb, R. C.; Liebing, D. F.; Porter, N. A.; Stenger, V. J.; Weeles, T. C.
1985-01-01
Although the existence of fluxes of gamma-rays of energies 10 to the 12th power eV is now established for galactic sources, the detection of such gamma-rays from extragalactic sources has yet to be independently confirmed in any case. The detection and confirmation of such energetic photons is of great astrophysical importance in the study of production mechanisms for cosmic rays, and other high energy processes in extragalactic objects. Observations of m31 are discussed. It is reported as a 10 to the 12th power eV gamma-ray source. Flux limits on a number of other extragalactic objects chosen for study are given.
Limits on Neutrino Emission from Gamma-Ray Bursts with the 40 String IceCube Detector
NASA Astrophysics Data System (ADS)
Abbasi, R.; Abdou, Y.; Abu-Zayyad, T.; Adams, J.; Aguilar, J. A.; Ahlers, M.; Andeen, K.; Auffenberg, J.; Bai, X.; Baker, M.; Barwick, S. W.; Bay, R.; Bazo Alba, J. L.; Beattie, K.; Beatty, J. J.; Bechet, S.; Becker, J. K.; Becker, K.-H.; Benabderrahmane, M. L.; Benzvi, S.; Berdermann, J.; Berghaus, P.; Berley, D.; Bernardini, E.; Bertrand, D.; Besson, D. Z.; Bindig, D.; Bissok, M.; Blaufuss, E.; Blumenthal, J.; Boersma, D. J.; Bohm, C.; Bose, D.; Böser, S.; Botner, O.; Braun, J.; Brown, A. M.; Buitink, S.; Carson, M.; Chirkin, D.; Christy, B.; Clem, J.; Clevermann, F.; Cohen, S.; Colnard, C.; Cowen, D. F.; D'Agostino, M. V.; Danninger, M.; Daughhetee, J.; Davis, J. C.; de Clercq, C.; Demirörs, L.; Depaepe, O.; Descamps, F.; Desiati, P.; de Vries-Uiterweerd, G.; Deyoung, T.; Díaz-Vélez, J. C.; Dierckxsens, M.; Dreyer, J.; Dumm, J. P.; Ehrlich, R.; Eisch, J.; Ellsworth, R. W.; Engdegård, O.; Euler, S.; Evenson, P. A.; Fadiran, O.; Fazely, A. R.; Fedynitch, A.; Feusels, T.; Filimonov, K.; Finley, C.; Fischer-Wasels, T.; Foerster, M. M.; Fox, B. D.; Franckowiak, A.; Franke, R.; Gaisser, T. K.; Gallagher, J.; Geisler, M.; Gerhardt, L.; Gladstone, L.; Glüsenkamp, T.; Goldschmidt, A.; Goodman, J. A.; Grant, D.; Griesel, T.; Groß, A.; Grullon, S.; Gurtner, M.; Ha, C.; Hallgren, A.; Halzen, F.; Han, K.; Hanson, K.; Heinen, D.; Helbing, K.; Herquet, P.; Hickford, S.; Hill, G. C.; Hoffman, K. D.; Homeier, A.; Hoshina, K.; Hubert, D.; Huelsnitz, W.; Hülß, J.-P.; Hulth, P. O.; Hultqvist, K.; Hussain, S.; Ishihara, A.; Jacobsen, J.; Japaridze, G. S.; Johansson, H.; Joseph, J. M.; Kampert, K.-H.; Kappes, A.; Karg, T.; Karle, A.; Kelley, J. L.; Kemming, N.; Kenny, P.; Kiryluk, J.; Kislat, F.; Klein, S. R.; Köhne, J.-H.; Kohnen, G.; Kolanoski, H.; Köpke, L.; Kopper, S.; Koskinen, D. J.; Kowalski, M.; Kowarik, T.; Krasberg, M.; Krings, T.; Kroll, G.; Kuehn, K.; Kuwabara, T.; Labare, M.; Lafebre, S.; Laihem, K.; Landsman, H.; Larson, M. J.; Lauer, R.; Lehmann, R.; Lünemann, J.; Madsen, J.; Majumdar, P.; Marotta, A.; Maruyama, R.; Mase, K.; Matis, H. S.; Meagher, K.; Merck, M.; Mészáros, P.; Meures, T.; Middell, E.; Milke, N.; Miller, J.; Montaruli, T.; Morse, R.; Movit, S. M.; Nahnhauer, R.; Nam, J. W.; Naumann, U.; Nießen, P.; Nygren, D. R.; Odrowski, S.; Olivas, A.; Olivo, M.; O'Murchadha, A.; Ono, M.; Panknin, S.; Paul, L.; Pérez de Los Heros, C.; Petrovic, J.; Piegsa, A.; Pieloth, D.; Porrata, R.; Posselt, J.; Price, P. B.; Prikockis, M.; Przybylski, G. T.; Rawlins, K.; Redl, P.; Resconi, E.; Rhode, W.; Ribordy, M.; Rizzo, A.; Rodrigues, J. P.; Roth, P.; Rothmaier, F.; Rott, C.; Ruhe, T.; Rutledge, D.; Ruzybayev, B.; Ryckbosch, D.; Sander, H.-G.; Santander, M.; Sarkar, S.; Schatto, K.; Schmidt, T.; Schoenwald, A.; Schukraft, A.; Schultes, A.; Schulz, O.; Schunck, M.; Seckel, D.; Semburg, B.; Seo, S. H.; Sestayo, Y.; Seunarine, S.; Silvestri, A.; Slipak, A.; Spiczak, G. M.; Spiering, C.; Stamatikos, M.; Stanev, T.; Stephens, G.; Stezelberger, T.; Stokstad, R. G.; Stoyanov, S.; Strahler, E. A.; Straszheim, T.; Sullivan, G. W.; Swillens, Q.; Taavola, H.; Taboada, I.; Tamburro, A.; Tarasova, O.; Tepe, A.; Ter-Antonyan, S.; Tilav, S.; Toale, P. A.; Toscano, S.; Tosi, D.; Turčan, D.; van Eijndhoven, N.; Vandenbroucke, J.; van Overloop, A.; van Santen, J.; Vehring, M.; Voge, M.; Voigt, B.; Walck, C.; Waldenmaier, T.; Wallraff, M.; Walter, M.; Weaver, C.; Wendt, C.; Westerhoff, S.; Whitehorn, N.; Wiebe, K.; Wiebusch, C. H.; Williams, D. R.; Wischnewski, R.; Wissing, H.; Wolf, M.; Woschnagg, K.; Xu, C.; Xu, X. W.; Yodh, G.; Yoshida, S.; Zarzhitsky, P.
2011-04-01
IceCube has become the first neutrino telescope with a sensitivity below the TeV neutrino flux predicted from gamma-ray bursts if gamma-ray bursts are responsible for the observed cosmic-ray flux above 1018eV. Two separate analyses using the half-complete IceCube detector, one a dedicated search for neutrinos from pγ interactions in the prompt phase of the gamma-ray burst fireball and the other a generic search for any neutrino emission from these sources over a wide range of energies and emission times, produced no evidence for neutrino emission, excluding prevailing models at 90% confidence.
NASA Technical Reports Server (NTRS)
Leiter, D.
1979-01-01
A consistent theoretical interpretation is given for the suggestion that a steepening of the spectrum between X-ray and gamma ray energies may be a general, gamma-ray characteristic of Seyfert galaxies, if the diffuse gamma ray spectrum is considered to be a superposition of unresolved contributions, from one or more classes of extragalactic objects. In the case of NGC 4151, the dominant process is shown to be Penrose Compton scattering in the ergosphere of a Kerr black hole, assumed to exist in the Seyfert's active galactic nucleus.
High energy X-ray observations of COS-B gamma-ray sources from OSO-8
NASA Technical Reports Server (NTRS)
Dolan, J. F.; Crannell, C. J.; Dennis, B. R.; Frost, K. J.; Orwig, L. E.; Caraveo, P. A.
1985-01-01
During the three years between satellite launch in June 1975 and turn-off in October 1978, the high energy X-ray spectrometer on board OSO-8 observed nearly all of the COS-B gamma-ray source positions given in the 2CG catalog (Swanenburg et al., 1981). An X-ray source was detected at energies above 20 keV at the 6-sigma level of significance in the gamma-ray error box containing 2CG342 - 02 and at the 3-sigma level of significance in the error boxes containing 2CG065 + 00, 2CG195 + 04, and 2CG311 - 01. No definite association between the X-ray and gamma-ray sources can be made from these data alone. Upper limits are given for the 2CG sources from which no X-ray flux was detected above 20 keV.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Tyrel J.; Ray, Paul S.; Roy, Jayanta
Here, the 1.69 ms spin period of PSR J1227–4853 was recently discovered in radio observations of the low-mass X-ray binary XSS J12270–4859 following the announcement of a possible transition to a rotation-powered millisecond pulsar state, inferred from decreases in optical, X-ray, and gamma-ray flux from the source. We report the detection of significant (5σ) gamma-ray pulsations after the transition, at the known spin period, using ~1 year of data from the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. The gamma-ray light curve of PSR J1227–4853 can be fit by one broad peak, which occurs at nearlymore » the same phase as the main peak in the 1.4 GHz radio profile. The partial alignment of light-curve peaks in different wavebands suggests that at least some of the radio emission may originate at high altitude in the pulsar magnetosphere, in extended regions co-located with the gamma-ray emission site. We folded the LAT data at the orbital period, both pre- and post-transition, but find no evidence for significant modulation of the gamma-ray flux. Analysis of the gamma-ray flux over the mission suggests an approximate transition time of 2012 November 30. Continued study of the pulsed emission and monitoring of PSR J1227–4853, and other known redback systems, for subsequent flux changes will increase our knowledge of the pulsar emission mechanism and transitioning systems.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, T. J.; Ray, P. S.; Cheung, C. C.
The 1.69 ms spin period of PSR J1227−4853 was recently discovered in radio observations of the low-mass X-ray binary XSS J12270−4859 following the announcement of a possible transition to a rotation-powered millisecond pulsar state, inferred from decreases in optical, X-ray, and gamma-ray flux from the source. We report the detection of significant (5σ) gamma-ray pulsations after the transition, at the known spin period, using ∼1 year of data from the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope. The gamma-ray light curve of PSR J1227−4853 can be fit by one broad peak, which occurs at nearly themore » same phase as the main peak in the 1.4 GHz radio profile. The partial alignment of light-curve peaks in different wavebands suggests that at least some of the radio emission may originate at high altitude in the pulsar magnetosphere, in extended regions co-located with the gamma-ray emission site. We folded the LAT data at the orbital period, both pre- and post-transition, but find no evidence for significant modulation of the gamma-ray flux. Analysis of the gamma-ray flux over the mission suggests an approximate transition time of 2012 November 30. Continued study of the pulsed emission and monitoring of PSR J1227−4853, and other known redback systems, for subsequent flux changes will increase our knowledge of the pulsar emission mechanism and transitioning systems.« less
Interaction of Radiation with Graphene Based Nanomaterials for Sensing Fissile Materials
2016-03-01
about how ionizing radiation (gamma rays, neutrons ) and associated charged particles interact with nano-materials/structures based on graphene, which...various experimental tests of effect of light, X-rays, gamma-rays and neutrons on graphene & graphene FET) 2. What other organizations have been...knowledge about how ionizing radiation (gamma rays, neutrons ) and associated charged particles interact with nano- materials/structures based on graphene
Energy- and time-resolved detection of prompt gamma-rays for proton range verification.
Verburg, Joost M; Riley, Kent; Bortfeld, Thomas; Seco, Joao
2013-10-21
In this work, we present experimental results of a novel prompt gamma-ray detector for proton beam range verification. The detection system features an actively shielded cerium-doped lanthanum(III) bromide scintillator, coupled to a digital data acquisition system. The acquisition was synchronized to the cyclotron radio frequency to separate the prompt gamma-ray signals from the later-arriving neutron-induced background. We designed the detector to provide a high energy resolution and an effective reduction of background events, enabling discrete proton-induced prompt gamma lines to be resolved. Measuring discrete prompt gamma lines has several benefits for range verification. As the discrete energies correspond to specific nuclear transitions, the magnitudes of the different gamma lines have unique correlations with the proton energy and can be directly related to nuclear reaction cross sections. The quantification of discrete gamma lines also enables elemental analysis of tissue in the beam path, providing a better prediction of prompt gamma-ray yields. We present the results of experiments in which a water phantom was irradiated with proton pencil-beams in a clinical proton therapy gantry. A slit collimator was used to collimate the prompt gamma-rays, and measurements were performed at 27 positions along the path of proton beams with ranges of 9, 16 and 23 g cm(-2) in water. The magnitudes of discrete gamma lines at 4.44, 5.2 and 6.13 MeV were quantified. The prompt gamma lines were found to be clearly resolved in dimensions of energy and time, and had a reproducible correlation with the proton depth-dose curve. We conclude that the measurement of discrete prompt gamma-rays for in vivo range verification of clinical proton beams is feasible, and plan to further study methods and detector designs for clinical use.
PKS 2123-463: A Confirmed Gamma-ray Blazar at High Redshift
NASA Technical Reports Server (NTRS)
D'Ammando, F.; Rau, A.; Schady, P.; Finke, J.; Orienti, M.; Greiner, J.; Kann, D. A.; Ojha, R.; Foley, A. R.; Stevens, J.;
2013-01-01
The flat spectrum radio quasar (FSRQ) PKS 2123-463 was associated in the first Fermi- Large Area Telescope (LAT) source catalogue with the gamma-ray source 1FGL J2126.1-4603, but when considering the full first two years of Fermi observations, no gamma-ray source at a position consistent with this FSRQ was detected, and thus PKS 2123-463 was not reported in the second Fermi-LAT source catalogue. On 2011 December 14 a gamma-ray source positionally consistent with PKS 2123-463 was detected in flaring activity by Fermi-LAT. This activity triggered radio-to-X-ray observations by the Swift,Gamma-ray Optical/Near-Infrared Detector (GROND), Australia Telescope Compact Array (ATCA), Ceduna and Seven Dishes Karoo Array Telescope (KAT-7) observatories. Results of the localization of the gamma-ray source over 41 months of Fermi-LAT operation are reported here in conjunction with the results of the analysis of radio, optical, ultraviolet (UV) and X-ray data collected soon after the gamma-ray flare. The strict spatial association with the lower energy counterpart together with a simultaneous increase of the activity in optical, UV, X-ray and gamma-ray bands led to a firm identification of the gamma-ray source with PKS 2123-463. A new photometric redshift has been estimated as z = 1.46 plus or minus 0.05 using GROND and Swift Ultraviolet/Optical Telescope (UVOT) observations, in rough agreement with the disputed spectroscopic redshift of z = 1.67.We fit the broad-band spectral energy distribution with a synchrotron/external Compton model. We find that a thermal disc component is necessary to explain the optical/UV emission detected by Swift/UVOT. This disc has a luminosity of approximately 1.8 x 10(exp 46) erg s(exp -1), and a fit to the disc emission assuming a Schwarzschild (i.e. non-rotating) black hole gives a mass of approximately 2 x 10(exp 9) solar mass. This is the first black hole mass estimate for this source.
A Correlated Optical and Gamma Emission from GRB 081126A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gendre, B.; Klotz, A.; CESR, Observatoire Midi-Pyrenees, CNRS, Universite de Toulouse, BP 4346, F-31028-Toulouse Cedex 04
2010-10-15
We present an analysis of time-resolved optical emissions observed from the gamma-ray burst GRB 081126 during the prompt phase. The analysis employed time-resolved photometry using optical data obtained by the TAROT telescope, BAT data from the Swift spacecraft and time-resolved spectroscopy at high energies from the GBM instrument onboard the Fermi spacecraft. The optical emission of GRB 081126 is found to be compatible with the second gamma emission pulse shifted by a positive time-lag of 8.4{+-}3.9 sec. This is the first well resolved observation of a time lag between optical and gamma emissions during a gamma-ray burst. Our observations couldmore » potentially provide new constraints on the fireball model for gamma ray burst early emissions. Furthermore, observations of time-lags between optical and gamma ray photons provides an exciting opportunity to constrain quantum gravity theories.« less
NASA Astrophysics Data System (ADS)
Lerche, R. A.; Cable, M. D.; Phillion, D. W.
1990-09-01
We are developing a streak camera based instrument to diagnose the fusion reaction rate (burn history) within laser-driven ICF targets filled with D-T fuel. Recently, we attempted measurements using the 16.7 MeV gamma ray emitted in the T(d,gamma)He(5) fusion reaction. Pb glass which has a large cross section for pair production acts as a gamma-ray-to-light converter. Gamma rays interact within the glass to form electron-positron pairs that produce large amounts (1000 photons/gamma ray) of prompt (less than 10 ps) Cerenkov light as they slow down. In our experimental instrument, an f/10 Cassegrain telescope optically couples light produced within the converter to a streak camera having 20-ps resolution. Experiments using high-yield (10(exp 13) D-T neutrons), direct-drive targets at Nova produced good signals with widths of 200 ps. Time-of-flight measurements show the signals to be induced by neutrons rather than gamma rays. The Pb glass appears to act as a fast neutron-to-light converter. We continue to study the interactions process and the possibility of using the 16.7 MeV gamma rays for burn time measurements.
A study of the sensitivity of an imaging telescope (GRITS) for high energy gamma-ray astronomy
NASA Technical Reports Server (NTRS)
Yearian, Mason R.
1990-01-01
When a gamma-ray telescope is placed in Earth orbit, it is bombarded by a flux of cosmic protons much greater than the flux of interesting gammas. These protons can interact in the telescope's thermal shielding to produce detectable gamma rays, most of which are vetoed. Since the proton flux is so high, the unvetoed gamma rays constitute a significant background relative to some weak sources. This background increases the observing time required to pinpoint some sources and entirely obscures other sources. Although recent telescopes have been designed to minimize this background, its strength and spectral characteristics were not previously calculated in detail. Monte Carlo calculations are presented which characterize the strength, spectrum and other features of the cosmic proton background using FLUKA, a hadronic cascade program. Several gamma-ray telescopes, including SAS-2, EGRET and the Gamma Ray Imaging Telescope System (GRITS), are analyzed, and their proton-induced backgrounds are characterized. In all cases, the backgrounds are either shown to be low relative to interesting signals or suggestions are made which would reduce the background sufficiently to leave the telescope unimpaired. In addition, several limiting cases are examined for comparison to previous estimates and calibration measurements.
NASA Astrophysics Data System (ADS)
Darwish, A. A. A.; Issa, Shams A. M.
2018-07-01
Naphthalocyanines have an important optical and electrical property, made it eligible to be a key utilitarian materials for a couple of special applications. Therefore, this study focused on the influence of gamma rays irradiation on the structure and optical properties of Vanadyl 2,3-naphthalocyanine (VONc) films. The VONc films have been prepared using the thermal evaporating technique. The investigated films were irradiated with gamma-rays 20, 40 and 60 kGy doses. X-ray diffraction exhibited that the as-deposited VONc films have nanostructure nature, which changed to the amorphous structure with gamma-rays radiation dosage. The optical results indicate that the optical absorption mechanism complied with the indirect allowed transition. It was observed also, there were no prominent changes found in the energy gap values when VONc films were exposed to gamma radiation. However, the optical conductivity rises with additional amounts of gamma-ray dose. This behavior may be attributed to the addition of electrons which freed by the incident photon energy because of a few changes in the film structure caused by the gamma-ray radiation. These outcomes illustrated that VONc films own the characteristics to be utilized in the field of optoelectronic applications.
QUASI-PERIODIC PULSATIONS IN THE GAMMA-RAY EMISSION OF A SOLAR FLARE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakariakov, V. M.; Foullon, C.; Inglis, A. R.
2010-01-01
Quasi-periodic pulsations (QPPs) of gamma-ray emission with a period of about 40 s are found in a single loop X-class solar flare on 2005 January 1 at photon energies up to 2-6 MeV with the SOlar Neutrons and Gamma-rays (SONG) experiment aboard the CORONAS-F mission. The oscillations are also found to be present in the microwave emission detected with the Nobeyama Radioheliograph, and in the hard X-ray and low energy gamma-ray channels of RHESSI. Periodogram and correlation analysis shows that the 40 s QPPs of microwave, hard X-ray, and gamma-ray emission are almost synchronous in all observation bands. Analysis ofmore » the spatial structure of hard X-ray and low energy (80-225 keV) gamma-ray QPP with RHESSI reveals synchronous while asymmetric QPP at both footpoints of the flaring loop. The difference between the averaged hard X-ray fluxes coming from the two footpoint sources is found to oscillate with a period of about 13 s for five cycles in the highest emission stage of the flare. The proposed mechanism generating the 40 s QPP is a triggering of magnetic reconnection by a kink oscillation in a nearby loop. The 13 s periodicity could be produced by the second harmonics of the sausage mode of the flaring loop.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prosekin, Anton; Aharonian, Felix; Essey, Warren
2012-10-01
Blazars are expected to produce both gamma rays and cosmic rays. Therefore, observed high-energy gamma rays from distant blazars may contain a significant contribution from secondary gamma rays produced along the line of sight by the interactions of cosmic-ray protons with background photons. Unlike the standard models of blazars that consider only the primary photons emitted at the source, models that include the cosmic-ray contribution predict that even {approx}10 TeV photons should be detectable from distant objects with redshifts as high as z {>=} 0.1. Secondary photons contribute to signals of point sources only if the intergalactic magnetic fields aremore » very small, B {approx}< 10{sup -14} G, and their detection can be used to set upper bounds on magnetic fields along the line of sight. Secondary gamma rays have distinct spectral and temporal features. We explore the temporal properties of such signals using a semi-analytical formalism and detailed numerical simulations, which account for all the relevant processes, including magnetic deflections. In particular, we elucidate the interplay of time delays coming from the proton deflections and from the electromagnetic cascade, and we find that, at multi-TeV energies, secondary gamma rays can show variability on timescales of years for B {approx} 10{sup -15} G.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mujaini, M., E-mail: madihah@uniten.edu.my; Chankow, N.; Yusoff, M. Z.
2016-01-22
Uranium ore can be easily detected due to various gamma-ray energies emitted from uranium daughters particularly from {sup 238}U daughters such as {sup 214}Bi, {sup 214}Pb and {sup 226}Ra. After uranium is extracted from uranium ore, only low energy gamma-rays emitted from {sup 235}U may be detected if the detector is placed in close contact to the specimen. In this research, identification and characterization of uranium bearing materials is experimentally investigated using direct measurement of gamma-rays from {sup 235}U in combination with the x-ray fluorescence (XRF) technique. Measurement of gamma-rays can be conducted by using high purity germanium (HPGe) detectormore » or cadmium telluride (CdTe) detector while a {sup 57}Coradioisotope-excited XRF spectrometer using CdTe detector is used for elemental analysis. The proposed technique was tested with various uranium bearing specimens containing natural, depleted and enriched uranium in both metallic and powder forms.« less
Results from the energetic gamma-ray experiment telescope (EGRET) on the Compton Observatory
NASA Technical Reports Server (NTRS)
Fichtel, C. E.; Bertsch, D. L.; Dingus, B.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.
1993-01-01
The Energetic Gamma-Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (CGRO) covers the high energy gamma ray energy range, approximately 30 MeV to 30 GeV, with a sensitivity considerably greater than earlier high energy gamma-ray satellites. Thus far, 4 pulsars have been detected and their properties measured, including in 3 cases the energy spectrum as a function of phase. The details of the galactic plane are being mapped and a spectra of the center region has been obtained in good agreement with that expected from cosmic ray interactions. The Magellanic clouds have been examined with the Large Magellanic Cloud (LMC) having been detected at a level consistent with it having a cosmic ray density compatible with quasi-stable equilibrium. Sixteen Active Galactic Nuclei (AGN's) have been seen thus far with a high degree of certainty including 12 quasars and 4 BL Lac objects, but no Seyferts. Time variation has been detected in some of these AGN's
Hijaz, Faraj M; Smith, J Scott
2010-01-01
Food irradiation improves food safety and maintains food quality by controlling microorganisms and extending shelf life. However, acceptance and commercial adoption of food irradiation is still low. Consumer groups such as Public Citizen and the Food and Water Watch have opposed irradiation because of the formation of 2-alkylcyclobutanones (2-ACBs) in irradiated, lipid-containing foods. The objectives of this study were to measure and to compare the level of 2-dodecylcyclobutanone (2-DCB) in ground beef irradiated by low-energy X-rays and gamma rays. Beef patties were irradiated by low-energy X-rays and gamma rays (Cs-137) at 3 targeted absorbed doses of 1.5, 3.0, and 5.0 kGy. The samples were extracted with n-hexane using a Soxhlet apparatus, and the 2-DCB concentration was determined with gas chromatography-mass spectrometry. The 2-DCB concentration increased linearly (P < 0.05) with irradiation dose for gamma-ray and low-energy X-ray irradiated patties. There was no significant difference in 2-DCB concentration between gamma-ray and low-energy X-ray irradiated patties (P > 0.05) at all targeted doses. © 2010 Institute of Food Technologists®
Gonze, Marc-André; Renaud, Philippe; Korsakissok, Irène; Kato, Hiroaki; Hinton, Thomas G; Mourlon, Christophe; Simon-Cornu, Marie
2014-10-07
The Fukushima Dai-ichi nuclear accident led to massive atmospheric deposition of radioactive substances onto the land surfaces. The spatial distribution of deposits has been estimated by Japanese authorities for gamma-emitting radionuclides through either airborne monitoring surveys (since April 2011) or in situ gamma-ray spectrometry of bare soil areas (since summer 2011). We demonstrate that significant differences exist between the two surveys for radiocaesium isotopes and that these differences can be related to dry deposits through the use of physically based relationships involving aerosol deposition velocities. The methodology, which has been applied to cesium-134 and cesium-137 deposits within 80-km of the nuclear site, provides reasonable spatial estimations of dry and wet deposits that are discussed and compared to atmospheric numerical simulations from the Japanese Atomic Energy Agency and the French Institute of Radioprotection and Nuclear Safety. As a complementary approach to numerical simulations, this field-based analysis has the possibility to contribute information that can be applied to the understanding and assessment of dose impacts to human populations and the environment around Fukushima.
7th International Fermi Symposium
NASA Astrophysics Data System (ADS)
2017-10-01
The two Fermi instruments have been surveying the high-energy sky since August 2008. The Large Area Telescope (LAT) has discovered more than three thousand gamma-ray sources and many new source classes, bringing the importance of gamma-ray astrophysics to an ever-broadening community. The LAT catalog includes supernova remnants, pulsar wind nebulae, pulsars, binary systems, novae, several classes of active galaxies, starburst galaxies, normal galaxies, and a large number of unidentified sources. Continuous monitoring of the high-energy gamma-ray sky has uncovered numerous outbursts from a wide range of transients. Fermi LAT's study of diffuse gamma-ray emission in our Galaxy revealed giant bubbles, as well as an excess of gamma-rays from the Galactic center region, both observations have become exciting puzzles for the astrophysics community. The direct measurement of a harder-than- expected cosmic-ray electron spectrum may imply the presence of nearby cosmic-ray accelerators. LAT data have provided stringent constraints on new phenomena such as supersymmetric dark-matter annihilations as well as tests of fundamental physics. The full reprocessing of the entire mission dataset with Pass 8 includes improved event reconstruction, a wider energy range, better energy measurements, and significantly increased effective area, all them boosting the discovery potential and the ability to do precision observations with LAT. The Gamma-ray Burst Monitor (GBM) continues to be a prolific detector of gamma-ray transients: magnetars, solar flares, terrestrial gamma-ray flashes and gamma-ray bursts at keV to MeV energies, complementing the higher energy LAT observations of those sources in addition to providing valuable science return in their own right. All gamma-ray data are made immediately available at the Fermi Science Support Center (http://fermi.gsfc.nasa.gov/ssc). These publicly available data and Fermi analysis tools have enabled a large number of important studies. We especially encourage guest investigators worldwide to participate in this symposium to share results and to learn about upcoming opportunities. This meeting will focus on the new scientific investigations and results enabled by Fermi, the mission and instrument characteristics, future opportunities, coordinated observations and analysis techniques. In particular, we also encourage discussion of future prospects/science with Fermi in preparation for the upcoming NASA senior review. Details on the 7th International Fermi Symposium can be found here: https://events.mpe.mpg.de/Fermi2017
Solar X-Ray and Gamma-Ray Imaging Spectroscopy
NASA Astrophysics Data System (ADS)
Dennis, B. R.; Christe, S. D.; Shih, A. Y.; Holman, G. D.; Emslie, A. G.; Caspi, A.
2018-02-01
X-ray and gamma-ray Sun observations from a lunar-based observatory would provide unique information on solar atmosphere thermal and nonthermal processes. EUV and energetic neutral atom imaging spectroscopy would augment the scientific value.
NASA Technical Reports Server (NTRS)
Sodroski, Thomas J.; Dwek, Eli
2000-01-01
The primary task objective is to construct a 3-D model for the distribution of high-energy (20 MeV - 30 GeV) gamma-ray emission in the Galactic disk. Under this task the contractor will utilize data from the EGRET instrument on the Compton Gamma-Ray Observatory, H I and CO surveys, radio-continuum surveys at 408 MHz, 1420 MHz, 5 GHz, and 19 GHz, the COBE Diffuse Infrared Background Experiment (DIRBE) all-sky maps from 1 to 240 microns, and ground-based B, V, J, H, and K photometry. The respective contributions to the gamma-ray emission from cosmic ray/matter interactions, inverse Compton scattering, and extragalactic emission will be determined.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Butt, Y M; Romero, G E; Torres, D F
We suggest that ultraluminous X-ray sources (ULXs) and some of the variable low latitude EGRET gamma-ray sources may be two different manifestations of the same underlying phenomena: high-mass microquasars with relativistic jets forming a small angle with the line of sight (i.e. microblazars). Microblazars with jets formed by relatively cool plasma (Lorentz factors for the leptons up to a few hundreds) naturally lead to ULXs. If the jet contains very energetic particles (high-energy cutoff above Lorentz factors of several thousands) the result is a relatively strong gamma-ray source. As pointed out by Kaufman Bernads, Romero & Mirabel (2002), a gamma-raymore » microblazar will always have an X-ray counterpart (although it might be relatively weak), whereas X-ray microblazars might have no gamma-ray counterparts.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kulisek, Jonathan A.; Schweppe, John E.; Stave, Sean C.
2015-06-01
Helicopter-mounted gamma-ray detectors can provide law enforcement officials the means to quickly and accurately detect, identify, and locate radiological threats over a wide geographical area. The ability to accurately distinguish radiological threat-generated gamma-ray signatures from background gamma radiation in real time is essential in order to realize this potential. This problem is non-trivial, especially in urban environments for which the background may change very rapidly during flight. This exacerbates the challenge of estimating background due to the poor counting statistics inherent in real-time airborne gamma-ray spectroscopy measurements. To address this, we have developed a new technique for real-time estimation ofmore » background gamma radiation from aerial measurements. This method is built upon on the noise-adjusted singular value decomposition (NASVD) technique that was previously developed for estimating the potassium (K), uranium (U), and thorium (T) concentrations in soil post-flight. The method can be calibrated using K, U, and T spectra determined from radiation transport simulations along with basis functions, which may be determined empirically by applying maximum likelihood estimation (MLE) to previously measured airborne gamma-ray spectra. The method was applied to both measured and simulated airborne gamma-ray spectra, with and without man-made radiological source injections. Compared to schemes based on simple averaging, this technique was less sensitive to background contamination from the injected man-made sources and may be particularly useful when the gamma-ray background frequently changes during the course of the flight.« less
Found: A Galaxy's Missing Gamma Rays
NASA Astrophysics Data System (ADS)
Kohler, Susanna
2016-04-01
Recent reanalysis of data from the Fermi Gamma-ray Space Telescope has resulted in the first detection of high-energy gamma rays emitted from a nearby galaxy. This discovery reveals more about how supernovae interact with their environments.Colliding Supernova RemnantAfter a stellar explosion, the supernovas ejecta expand, eventually encountering the ambient interstellar medium. According to models, this generates a strong shock, and a fraction of the kinetic energy of the ejecta is transferred into cosmic rays high-energy radiation composed primarily of protons and atomic nuclei. Much is still unknown about this process, however. One open question is: what fraction of the supernovas explosion power goes into accelerating these cosmic rays?In theory, one way to answer this is by looking for gamma rays. In a starburst galaxy, the collision of the supernova-accelerated cosmic rays with the dense interstellar medium is predicted to produce high-energy gamma rays. That radiation should then escape the galaxy and be visible to us.Pass 8 to the RescueObservational tests of this model, however, have beenstumped by Arp 220. This nearby ultraluminous infrared galaxy is the product of a galaxy merger ~700 million years ago that fueled a frenzy of starbirth. Due to its dusty interior and extreme levels of star formation, Arp 220 has long been predicted to emit the gamma rays produced by supernova-accelerated cosmic rays. But though weve looked, gamma-ray emission has never been detected from this galaxy until now.In a recent study, a team of scientists led by Fang-Kun Peng (Nanjing University) reprocessed 7.5 years of Fermi observations using the new Pass 8 analysis software. The resulting increase in resolution revealed the first detection of GeV emission from Arp 220!Acceleration EfficiencyGamma-ray luminosity vs. total infrared luminosity for LAT-detected star-forming galaxies and Seyferts. Arp 220s luminosities are consistent with the scaling relation. [Peng et al. 2016]Peng and collaborators argue that this emission is due solely to cosmic-ray interactions with interstellar gas. This picture is supported by the lack of variability in the emission, and the fact that Arp 220s gamma-ray luminosity is consistent with the scaling relation between gamma-ray and infrared luminosity for star-forming galaxies. The authors also argue that, due to Arp 220s high gas density, all cosmic rays will interact with the gas before escaping.Under these two assumptions, Peng and collaborators use the gamma-ray luminosity and the known supernova rate in Arp 220 to estimate how efficiently cosmic rays are acceleratedby supernova remnants in the galaxy. They determine that 4.2 2.6% of the supernova remnants kinetic energy is used to accelerate cosmic rays above 1 GeV.This is the first time such a rate has been measured directly from gamma-ray emission, but its consistent with estimates of 3-10% efficiency in the Milky Way. Future analysis of other ultraluminous infrared galaxies like Arp 220 with Fermi (and Pass 8!) will hopefully reveal more about these recent-merger, starburst environments.CitationFang-Kun Peng et al 2016 ApJ 821 L20. doi:10.3847/2041-8205/821/2/L20
Prompt gamma ray imaging for verification of proton boron fusion therapy: A Monte Carlo study.
Shin, Han-Back; Yoon, Do-Kun; Jung, Joo-Young; Kim, Moo-Sub; Suh, Tae Suk
2016-10-01
The purpose of this study was to verify acquisition feasibility of a single photon emission computed tomography image using prompt gamma rays for proton boron fusion therapy (PBFT) and to confirm an enhanced therapeutic effect of PBFT by comparison with conventional proton therapy without use of boron. Monte Carlo simulation was performed to acquire reconstructed image during PBFT. We acquired percentage depth dose (PDD) of the proton beams in a water phantom, energy spectrum of the prompt gamma rays, and tomographic images, including the boron uptake region (BUR; target). The prompt gamma ray image was reconstructed using maximum likelihood expectation maximisation (MLEM) with 64 projection raw data. To verify the reconstructed image, both an image profile and contrast analysis according to the iteration number were conducted. In addition, the physical distance between two BURs in the region of interest of each BUR was measured. The PDD of the proton beam from the water phantom including the BURs shows more efficient than that of conventional proton therapy on tumour region. A 719keV prompt gamma ray peak was clearly observed in the prompt gamma ray energy spectrum. The prompt gamma ray image was reconstructed successfully using 64 projections. Different image profiles including two BURs were acquired from the reconstructed image according to the iteration number. We confirmed successful acquisition of a prompt gamma ray image during PBFT. In addition, the quantitative image analysis results showed relatively good performance for further study. Copyright © 2016 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inoue, Yoshiyuki; Tanaka, Yasuyuki T., E-mail: yinoue@astro.isas.jaxa.jp
The Fermi gamma-ray space telescope has revolutionized our understanding of the cosmic gamma-ray background radiation in the GeV band. However, investigation on the cosmic TeV gamma-ray background radiation still remains sparse. Here, we report the lower bound on the cosmic TeV gamma-ray background spectrum placed by the cumulative flux of individual detected extragalactic TeV sources including blazars, radio galaxies, and starburst galaxies. The current limit on the cosmic TeV gamma-ray background above 0.1 TeV is obtained as 2.8 × 10{sup −8}(E/100 GeV){sup −0.55} exp(−E/2100GeV)[GeV cm{sup −2} s{sup −1} sr{sup −1}] < E{sup 2}dN/dE < 1.1 × 10{sup −7}(E/100 GeV){sup −0.49} [GeV cm{sup −2} s{sup −1} sr{sup −1}], wheremore » the upper bound is set by requirement that the cascade flux from the cosmic TeV gamma-ray background radiation can not exceed the measured cosmic GeV gamma-ray background spectrum. Two nearby blazars, Mrk 421 and Mrk 501, explain ∼70% of the cumulative background flux at 0.8–4 TeV, while extreme blazars start to dominate at higher energies. We also provide the cumulative background flux from each population, i.e., blazars, radio galaxies, and starburst galaxies which will be the minimum requirement for their contribution to the cosmic TeV gamma-ray background radiation.« less
Gamma-Ray and Parsec-Scale Jet Properties of a Complete Sample of Blazars from the MOJAVE Program
NASA Technical Reports Server (NTRS)
Lister, M.L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; Ackermann, M.;
2011-01-01
We investigate the Fermi LAT gamma-ray and 15 GHz VLBA radio properties of a joint gamma-ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -300 during this period, and thus probes the full range of gamma-ray loudness (gamma-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing gamma-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the gamma-ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - gamma-ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.
NASA Technical Reports Server (NTRS)
Trombka, J. I.; Floyd, S.; Ruitberg, A.; Evans, L.; Starr, R.; Metzger, A.; Reedy, R.; Drake, D.; Moss, C.; Edwards, B.
1993-01-01
An important part of the investigation of planetary origin and evolution is the determination of the surface composition of planets, comets, and asteroids. Measurements of discrete line X-ray and gamma ray emissions from condensed bodies in space can be used to obtain both qualitative and quantitative elemental composition information. The Planetary Instrumentation Definition and Development Program (PIDDP) X-Ray/Gamma Ray Team has been established to develop remote sensing and in situ technologies for future planetary exploration missions.
FERMI LAT Discovery of Extended Gamma-Ray Emission in the Direction of Supernova Remnant W51C
Abdo, A. A.; Ackermann, M.; Ajello, M.; ...
2009-10-27
In this paper, the discovery of bright gamma-ray emission coincident with supernova remnant (SNR) W51C is reported using the Large Area Telescope (LAT) onboard the Fermi Gamma-ray Space Telescope. W51C is a middle-aged remnant (~10 4 yr) with intense radio synchrotron emission in its shell and known to be interacting with a molecular cloud. The gamma-ray emission is spatially extended, broadly consistent with the radio and X-ray extent of SNR W51C. The energy spectrum in the 0.2-50 GeV band exhibits steepening toward high energies. The luminosity is greater than 1 × 10 36 erg s –1 given the distance constraint of D > 5.5 kpc, which makes this object one of the most luminous gamma-ray sources in our Galaxy. The observed gamma-rays can be explained reasonably by a combination of efficient acceleration of nuclear cosmic rays at supernova shocks and shock-cloud interactions. The decay of neutral π mesons produced in hadronic collisions provides a plausible explanation for the gamma-ray emission. The product of the average gas density and the total energy content of the accelerated protons amounts tomore » $$\\bar{n}_{\\rm H}W_p \\simeq 5\\times 10^{51}\\ (D/6\\ {\\rm kpc})^2\\ \\rm erg\\ cm^{-3}$$. Electron density constraints from the radio and X-ray bands render it difficult to explain the LAT signal as due to inverse Compton scattering. Finally, the Fermi LAT source coincident with SNR W51C sheds new light on the origin of Galactic cosmic rays.« less
Fermi-LAT Discovery of Extended Gamma-Ray Emission in the Direction of Supernova Remnant W51C
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdo, A.A.; /Naval Research Lab, Wash., D.C. /Federal City Coll.; Ackermann, M.
The discovery of bright gamma-ray emission coincident with supernova remnant (SNR) W51C is reported using the Large Area Telescope (LAT) onboard the Fermi Gamma-ray Space Telescope. W51C is a middle-aged remnant ({approx}10{sup 4} yr) with intense radio synchrotron emission in its shell and known to be interacting with a molecular cloud. The gamma-ray emission is spatially extended, broadly consistent with the radio and X-ray extent of SNR W51C. The energy spectrum in the 0.2-50 GeV band exhibits steepening toward high energies. The luminosity is greater than 1 x 10{sup 36} erg s{sup -1} given the distance constraint of D >more » 5.5 kpc, which makes this object one of the most luminous gamma-ray sources in our Galaxy. The observed gamma-rays can be explained reasonably by a combination of efficient acceleration of nuclear cosmic rays at supernova shocks and shock-cloud interactions. The decay of neutral p mesons produced in hadronic collisions provides a plausible explanation for the gamma-ray emission. The product of the average gas density and the total energy content of the accelerated protons amounts to {bar n}{sub H} W{sub p} {approx_equal} 5 x 10{sup 51} (D/6 kpc){sup 2} erg cm{sup -3}. Electron density constraints from the radio and X-ray bands render it difficult to explain the LAT signal as due to inverse Compton scattering. The Fermi LAT source coincident with SNR W51C sheds new light on the origin of Galactic cosmic rays.« less
Three Millisecond Pulsars in Fermi LAT Unassociated Bright Sources
NASA Technical Reports Server (NTRS)
Ransom, S. M.; Ray, P. S.; Camilo, F.; Roberts, M. S. E.; Celik, O.; Wolff, M. T.; Cheung, C. C.; Kerr, M.; Pennucci, T.; DeCesar, M. E.;
2010-01-01
We searched for radio pulsars in 25 of the non-variable, unassociated sources in the Fermi LAT Bright Source List with the Green Bank Telescope at 820 MHz. We report the discovery of three radio and gamma-ray millisecond pulsar (MSPs) from a high Galactic latitude subset of these sources. All of the pulsars are in binary systems, which would have made them virtually impossible to detect in blind gamma-ray pulsation searches. They seem to be relatively normal, nearby (<= 2 kpc) MSPs. These observations, in combination with the Fermi detection of gamma-rays from other known radio MSPs, imply that most, if not all, radio MSPs are efficient gamma-ray producers. The gamma-ray spectra of the pulsars are power law in nature with exponential cutoffs at a few Ge V, as has been found with most other pulsars. The MSPs have all been detected as X-ray point sources. Their soft X-ray luminosities of approx 10(exp 30) - 10(exp 31) erg/s are typical of the rare radio MSPs seen in X-rays.
The sub-energetic gamma-ray burst GRB 031203 as a cosmic analogue to the nearby GRB 980425.
Soderberg, A M; Kulkarni, S R; Berger, E; Fox, D W; Sako, M; Frail, D A; Gal-Yam, A; Moon, D S; Cenko, S B; Yost, S A; Phillips, M M; Persson, S E; Freedman, W L; Wyatt, P; Jayawardhana, R; Paulson, D
2004-08-05
Over the six years since the discovery of the gamma-ray burst GRB 980425, which was associated with the nearby (distance approximately 40 Mpc) supernova 1998bw, astronomers have debated fiercely the nature of this event. Relative to bursts located at cosmological distance (redshift z approximately 1), GRB 980425 was under-luminous in gamma-rays by three orders of magnitude. Radio calorimetry showed that the explosion was sub-energetic by a factor of 10. Here we report observations of the radio and X-ray afterglow of the recent GRB 031203 (refs 5-7), which has a redshift of z = 0.105. We demonstrate that it too is sub-energetic which, when taken together with the low gamma-ray luminosity, suggests that GRB 031203 is the first cosmic analogue to GRB 980425. We find no evidence that this event was a highly collimated explosion viewed off-axis. Like GRB 980425, GRB 031203 appears to be an intrinsically sub-energetic gamma-ray burst. Such sub-energetic events have faint afterglows. We expect intensive follow-up of faint bursts with smooth gamma-ray light curves (common to both GRB 031203 and 980425) to reveal a large population of such events.
The Use of the BAT Instrument on SWIFT for the Detection of Prompt Gamma-Ray Emission from Novae
NASA Technical Reports Server (NTRS)
Skinner, Gerry; Senziani, Fabio; Jean, Pierre; Hernanz, Margarita
2007-01-01
Gamma-rays are expected to be emitted during and immediately following a nova explosion due to the annihilation of positrons emitted by freshly produced short-lived radioactive isotopes. The expected gammaray emission is relatively short-lived and as nova explosions are unpredictable, the best chance of detecting the gamma-rays is with n wide field instrument. At the time when the flux is expected to rcach its peak, most of the gamma-ray production is at depths such that the photons suffer several Compton scatterings before escaping, degrading their energy down to the hard X-ray band (10s of keV). SWIFT/BAT is a very wide field coded mask instrument working in the energy band 14-190 keV and so is very well suited to the search for such gamma-rays. A retrospective search is being made in the BAT data for evidence for gamma-ray emission from the direction of novae at around the time of their explosion. So far the only positive detection is of RS Ophiuchi and in this case the emission is probably due to shock heating.
Perez-Mendez, V.
1997-01-21
A gamma ray camera is disclosed for detecting rays emanating from a radiation source such as an isotope. The gamma ray camera includes a sensor array formed of a visible light crystal for converting incident gamma rays to a plurality of corresponding visible light photons, and a photosensor array responsive to the visible light photons in order to form an electronic image of the radiation therefrom. The photosensor array is adapted to record an integrated amount of charge proportional to the incident gamma rays closest to it, and includes a transparent metallic layer, photodiode consisting of a p-i-n structure formed on one side of the transparent metallic layer, and comprising an upper p-type layer, an intermediate layer and a lower n-type layer. In the preferred mode, the scintillator crystal is composed essentially of a cesium iodide (CsI) crystal preferably doped with a predetermined amount impurity, and the p-type upper intermediate layers and said n-type layer are essentially composed of hydrogenated amorphous silicon (a-Si:H). The gamma ray camera further includes a collimator interposed between the radiation source and the sensor array, and a readout circuit formed on one side of the photosensor array. 6 figs.
Perez-Mendez, Victor
1997-01-01
A gamma ray camera for detecting rays emanating from a radiation source such as an isotope. The gamma ray camera includes a sensor array formed of a visible light crystal for converting incident gamma rays to a plurality of corresponding visible light photons, and a photosensor array responsive to the visible light photons in order to form an electronic image of the radiation therefrom. The photosensor array is adapted to record an integrated amount of charge proportional to the incident gamma rays closest to it, and includes a transparent metallic layer, photodiode consisting of a p-i-n structure formed on one side of the transparent metallic layer, and comprising an upper p-type layer, an intermediate layer and a lower n-type layer. In the preferred mode, the scintillator crystal is composed essentially of a cesium iodide (CsI) crystal preferably doped with a predetermined amount impurity, and the p-type upper intermediate layers and said n-type layer are essentially composed of hydrogenated amorphous silicon (a-Si:H). The gamma ray camera further includes a collimator interposed between the radiation source and the sensor array, and a readout circuit formed on one side of the photosensor array.
Observations of Spin-Powered Pulsars with the AGILE Gamma-Ray Telescope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pellizzoni, A.; Pilia, M.; Possenti, M.
2008-12-24
AGILE is a small gamma-ray astronomy satellite mission of the Italian Space Agency dedicated to high-energy astrophysics launched in 2007 April. It provides large sky exposure levels (> or approx. 10{sup 9} cm{sup 2} s per year on the Galactic Plane) with sensitivity peaking at E{approx}400 MeV(and simultaneous X-ray monitoring in the 18-60 keV band) where the bulk of pulsar energy output is typically released. Its {approx}1 {mu}s is absolute time tagging capability makes it perfectly suited for the study of gamma-ray pulsars following up on the CGRO/EGRET heritage. In this paper we summarize the timing results obtained during themore » first year of AGILE observations of the known gamma-ray pulsars Vela, Crab, Geminga and B 1706-4. AGILE collected a large number of gamma-ray photons from EGRET pulsars ({approx}10,000 pulsed counts for Vela) in only few months of observations unveiling new interesting features at sub-millisecond level in the pulsars' high-energy light-curves and paving the way to the discovery of new gamma-ray pulsars.« less
PKS 2123-463: A Confirmed Gamma-ray Blazar at High Redshift
NASA Technical Reports Server (NTRS)
DAmmando, F.; Rau, A.; Schady, P.; Finke, J.; Orienti, M.; Greiner, J.; Kann, D. A.; Ojha, R.; Foley, A. R.; Stevens, J.;
2012-01-01
The flat spectrum radio quasar (FSRQ) PKS 2123-463 was associated in the First Fermi-LAT source catalog with the gamma-ray source 1FGL J2126.1-4603, but when considering the full first two years of Fermi observations, no gamma-ray source at a position consistent with this FSRQ was detected, and thus PKS 2123-463 was not reported in the Second Fermi-LAT source catalog. On 2011 December 14 a gamma-ray source positionally consistent with PKS 2123-463 was detected in flaring activity by Fermi-LAT. This activity triggered radio-to-X-ray observations by the Swift, GROND, ATCA, Ceduna, and KAT-7 observatories. Results of the localization of the gamma-ray source over 41 months of Fermi-LAT operation are reported here in conjunction with the results of the analysis of radio, optical, UV and X-ray data collected soon after the gamma-ray flare. The strict spatial association with the lower energy counterpart together with a simultaneous increase of the activity in optical, UV, X-ray and gamma-ray bands led to a firm identification of the gamma-ray source with PKS 2123-463. A new photometric redshift has been estimated as z = 1.46 +/- 0.05 using GROND and Swift/UVOT observations, in rough agreement with the disputed spectroscopic redshift of z = 1.67. We fit the broadband spectral energy distribution with a synchrotron/external Compton model. We find that a thermal disk component is necessary to explain the optical/UV emis- sion detected by Swift/UVOT. This disk has a luminosity of 1.8x1046 erg s-1, and a fit to the disk emission assuming a Schwarzschild (i.e., nonrotating) black hole gives a mass of 2 x 109 M(solar mass). This is the first black hole mass estimate for this source.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Xiangyu; Liu Ruoyu; Aharonian, Felix
Ultrahigh cosmic rays (UHECRs) with energies {approx}> 10{sup 19} eV emitted at cosmological distances will be attenuated by cosmic microwave and infrared background radiation through photohadronic processes. Lower energy extragalactic cosmic rays ({approx}10{sup 18}-10{sup 19} eV) can only travel a linear distance smaller than {approx}Gpc in a Hubble time due to the diffusion if the extragalactic magnetic fields are as strong as nano-Gauss. These prevent us from directly observing most of the UHECRs in the universe, and thus the observed UHECR intensity reflects only the emissivity in the nearby universe within hundreds of Mpc. However, UHECRs in the distant universe,more » through interactions with the cosmic background photons, produce UHE electrons and gamma rays that in turn initiate electromagnetic cascades on cosmic background photons. This secondary cascade radiation forms part of the extragalactic diffuse GeV-TeV gamma-ray radiation and, unlike the original UHECRs, is observable. Motivated by new measurements of extragalactic diffuse gamma-ray background radiation by Fermi/Large Area Telescope, we obtained upper limit placed on the UHECR emissivity in the distant universe by requiring that the cascade radiation they produce not exceed the observed levels. By comparison with the gamma-ray emissivity of candidate UHECR sources (such as gamma-ray bursts (GRBs) and active galactic nuclei) at high redshifts, we find that the obtained upper limit for a flat proton spectrum is {approx_equal} 10{sup 1.5} times larger than the gamma-ray emissivity in GRBs and {approx_equal} 10 times smaller than the gamma-ray emissivity in BL Lac objects. In the case of iron nuclei composition, the derived upper limit of UHECR emissivity is a factor of 3-5 times higher. Robust upper limit on the cosmogenic neutrino flux is further obtained, which is marginally reachable by the Icecube detector and the next-generation detector JEM-EUSO.« less
Gamma-ray astronomy in the medium energy (10-50 MeV) range
NASA Technical Reports Server (NTRS)
Kniffen, D. A.; Bertsch, D. L.; Morris, D. J.; Palmeira, R. A. R.; Rao, K. R.
1977-01-01
To observe the medium energy component of the intense galactic center gamma-ray emission, two balloon flights of a medium energy gamma-ray spark chamber telescope were flown in Brazil in 1975. The results indicate the emission is higher than previously thought and above the predictions of a theoretical model proposed.
Argonne Physics Division - Theory Group
Gamma-ray Telescopes October 7 Ken Nollett (PHY) Discussion of the Astro2010 Astronomy and Astrophysics (HEP) Gamma-ray astronomy and VERITAS July 2 Francesca Primas (European Southern Observatory ) Recent Results in TeV Gamma-Ray Astronomy December 1 Kaori Otsuki (U of C) Astrophysical site for the r
Solving the Mystery of Short Gamma Ray Bursts
NASA Technical Reports Server (NTRS)
Gehrels, Neil
2006-01-01
Gamma-ray bursts are among the most fascinating occurrences in the cosmos. Until this year, the origin of short gamma-ray bursts was a complete mystery. A new NASA satellite named Swift has now captured the first images of these events and found that they are caused by tremendous explosions in the distant universe.
77 FR 58587 - Mr. James Chaisson; Confirmatory Order (Effective Immediately)
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-21
... an area supervisor and lead radiographer for the Wyoming operations of Texas Gamma Ray, LLC (TGR or.... Chaisson engaged in deliberate misconduct that caused Texas Gamma Ray, LLC (TGR), at the time an NRC... Texas Gamma Ray LLC (TGR), and the Nuclear Regulatory Commission (NRC) relating to the 3-year ban...
Comparison of Terrestrial Gamma Ray Flash Simulations with Observations by Fermi
2016-10-31
allowing a direction comparison between the gamma rays measured in low -Earth orbit and the VLF-LF radio frequency emissions recorded on the ground...directly calculated from X and its time derivative, including the gamma-ray emission rate, the current moment, and the optical power of the TGF. For
Slaughter, Dennis R.; Pohl, Bertram A.; Dougan, Arden D.; Bernstein, Adam; Prussin, Stanley G.; Norman, Eric B.
2008-04-15
A system for inspecting cargo for the presence of special nuclear material. The cargo is irradiated with neutrons. The neutrons produce fission products in the special nuclear material which generate gamma rays. The gamma rays are detecting indicating the presence of the special nuclear material.
Polarization of the prompt gamma-ray emission from the gamma-ray burst of 6 December 2002.
Coburn, Wayne; Boggs, Steven E
2003-05-22
Observations of the afterglows of gamma-ray bursts (GRBs) have revealed that they lie at cosmological distances, and so correspond to the release of an enormous amount of energy. The nature of the central engine that powers these events and the prompt gamma-ray emission mechanism itself remain enigmatic because, once a relativistic fireball is created, the physics of the afterglow is insensitive to the nature of the progenitor. Here we report the discovery of linear polarization in the prompt gamma-ray emission from GRB021206, which indicates that it is synchrotron emission from relativistic electrons in a strong magnetic field. The polarization is at the theoretical maximum, which requires a uniform, large-scale magnetic field over the gamma-ray emission region. A large-scale magnetic field constrains possible progenitors to those either having or producing organized fields. We suggest that the large magnetic energy densities in the progenitor environment (comparable to the kinetic energy densities of the fireball), combined with the large-scale structure of the field, indicate that magnetic fields drive the GRB explosion.